#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZNF721	170960	genome.wustl.edu	37	4	419668	419668	+	IGR	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:419668G>C	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						AAGGTAGCCTGAGAGAGGCTG	0.448																																																	0																																										SO:0001628	intergenic_variant	79963			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.419668G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q69YG7	RNA	SNP	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-		0.448	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	G	NM_133474		419668	-1	no_errors	ENST00000451020	ensembl	human	known	70_37	rna	SNP	1.000	C
ABCA12	26154	genome.wustl.edu	37	2	215865463	215865463	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:215865463G>A	ENST00000272895.7	-	22	3364	c.3145C>T	c.(3145-3147)Caa>Taa	p.Q1049*	ABCA12_ENST00000389661.4_Nonsense_Mutation_p.Q731*	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1049					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GGAATTGCTTGAACCTGGACT	0.393																																					Ovarian(66;664 1488 5121 34295)												0													113.0	118.0	116.0					2																	215865463		2203	4300	6503	SO:0001587	stop_gained	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3145C>T	2.37:g.215865463G>A	ENSP00000272895:p.Gln1049*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q1049*	ENST00000272895.7	37	c.3145	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	41	8.970001	0.99021	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9082	0.97015	0.0:0.0:1.0:0.0	.	.	.	.	X	1049;731	.	ENSP00000272895:Q1049X	Q	-	1	0	ABCA12	215573708	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.582000	0.98214	2.705000	0.92388	0.555000	0.69702	CAA	ABCA12	-	NULL		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	G	NM_173076		215865463	-1	no_errors	ENST00000272895	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ABCA4	24	genome.wustl.edu	37	1	94564508	94564508	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:94564508C>T	ENST00000370225.3	-	6	696	c.610G>A	c.(610-612)Gcc>Acc	p.A204T	ABCA4_ENST00000535735.1_Missense_Mutation_p.A204T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	204					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCGCTGCAGGCGATGTCCTTC	0.617																																																	0			GRCh37	CM070626	ABCA4	M							41.0	40.0	40.0					1																	94564508		2203	4300	6503	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.610G>A	1.37:g.94564508C>T	ENSP00000359245:p.Ala204Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.A204T	ENST00000370225.3	37	c.610	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899785	0.72754	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.91351	-2.71;-2.83	5.83	5.83	0.93111	.	0.179711	0.48767	D	0.000161	D	0.91321	0.7263	M	0.67953	2.075	0.58432	D	0.999999	D;D	0.71674	0.998;0.997	D;P	0.64144	0.922;0.736	D	0.88471	0.3062	10	0.07030	T	0.85	.	17.9044	0.88914	0.0:1.0:0.0:0.0	.	204;204	F5H6E5;P78363	.;ABCA4_HUMAN	T	204	ENSP00000359245:A204T;ENSP00000437682:A204T	ENSP00000359245:A204T	A	-	1	0	ABCA4	94337096	1.000000	0.71417	0.981000	0.43875	0.930000	0.56654	7.449000	0.80643	2.757000	0.94681	0.563000	0.77884	GCC	ABCA4	-	tigrfam_Rim_ABC_transpt		0.617	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	C	NM_000350		94564508	-1	no_errors	ENST00000370225	ensembl	human	known	70_37	missense	SNP	1.000	T
ABI3BP	25890	genome.wustl.edu	37	3	100645270	100645270	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:100645270C>G	ENST00000284322.5	-	2	265	c.156G>C	c.(154-156)ttG>ttC	p.L52F	ABI3BP_ENST00000471714.1_Missense_Mutation_p.L52F|ABI3BP_ENST00000495063.1_Missense_Mutation_p.L52F|ABI3BP_ENST00000532144.1_5'UTR	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	52					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GCAAGAACTTCAAGAGGATGG	0.448																																																	0													205.0	199.0	201.0					3																	100645270		1981	4154	6135	SO:0001583	missense	25890			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.156G>C	3.37:g.100645270C>G	ENSP00000284322:p.Leu52Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L52F	ENST00000284322.5	37	c.156	CCDS46880.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.082387	0.76528	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000495063	T;T	0.32023	1.68;1.47	5.55	4.68	0.58851	.	0.092507	0.64402	D	0.000001	T	0.35393	0.0930	N	0.12182	0.205	0.80722	D	1	D;D;D	0.71674	0.981;0.998;0.986	P;D;P	0.69654	0.621;0.965;0.738	T	0.35599	-0.9782	10	0.62326	D	0.03	-5.1364	12.9936	0.58634	0.0:0.9217:0.0:0.0783	.	45;52;52	Q9H717;Q5JPC9;Q7Z7G0	.;.;TARSH_HUMAN	F	52	ENSP00000420524:L52F;ENSP00000284322:L52F	ENSP00000284322:L52F	L	-	3	2	ABI3BP	102127960	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.740000	0.47418	1.352000	0.45808	0.650000	0.86243	TTG	ABI3BP	-	NULL		0.448	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	C			100645270	-1	no_errors	ENST00000284322	ensembl	human	known	70_37	missense	SNP	1.000	G
ACBD5	91452	genome.wustl.edu	37	10	27486362	27486362	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:27486362G>T	ENST00000375888.1	-	13	1666	c.1602C>A	c.(1600-1602)aaC>aaA	p.N534K	ACBD5_ENST00000375901.1_Missense_Mutation_p.N416K|ACBD5_ENST00000375897.3_Missense_Mutation_p.N348K|ACBD5_ENST00000375905.4_Missense_Mutation_p.N490K|ACBD5_ENST00000396271.3_Missense_Mutation_p.N525K			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	534					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						ATTTTCCTCAGTTCAGTTTTC	0.318																																																	0													86.0	76.0	79.0					10																	27486362		2203	4300	6503	SO:0001583	missense	91452			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1602C>A	10.37:g.27486362G>T	ENSP00000365049:p.Asn534Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.N534K	ENST00000375888.1	37	c.1602		10	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539827	0.45176	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	T;T;T;T;T	0.40225	2.07;1.85;1.04;1.2;2.13	5.86	1.73	0.24493	.	0.239682	0.47093	D	0.000244	T	0.38612	0.1047	N	0.19112	0.55	0.26290	N	0.978142	P;D;D	0.59767	0.925;0.986;0.961	B;P;B	0.57960	0.436;0.83;0.335	T	0.18999	-1.0319	10	0.87932	D	0	.	7.882	0.29627	0.3615:0.0:0.6385:0.0	.	525;348;523	Q5T8D3-3;B7Z2A7;B7Z2R7	.;.;.	K	531;525;490;416;348;534	ENSP00000379568:N525K;ENSP00000365070:N490K;ENSP00000365066:N416K;ENSP00000365062:N348K;ENSP00000365049:N534K	ENSP00000365049:N534K	N	-	3	2	ACBD5	27526368	1.000000	0.71417	0.999000	0.59377	0.882000	0.50991	1.387000	0.34430	0.323000	0.23307	0.650000	0.86243	AAC	ACBD5	-	pirsf_M-assoc_diazepam-bd-inh		0.318	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	G	NM_145698		27486362	-1	no_errors	ENST00000375888	ensembl	human	known	70_37	missense	SNP	1.000	T
ACD	65057	genome.wustl.edu	37	16	67692860	67692860	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:67692860G>A	ENST00000393919.4	-	7	1138	c.874C>T	c.(874-876)Cac>Tac	p.H292Y	PARD6A_ENST00000219255.3_5'Flank|PARD6A_ENST00000458121.2_5'Flank|PARD6A_ENST00000602551.1_5'Flank|ACD_ENST00000219251.8_Missense_Mutation_p.H289Y			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	292	Interaction with POT1.				intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GCAGCCCAGTGGGTGACAGGG	0.612																																																	0													74.0	73.0	73.0					16																	67692860		2198	4300	6498	SO:0001583	missense	65057			AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.874C>T	16.37:g.67692860G>A	ENSP00000377496:p.His292Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q562H5|Q9H8F9	Missense_Mutation	SNP	pfam_Telomere_Pot1	p.H289Y	ENST00000393919.4	37	c.865	CCDS42181.1	16	.	.	.	.	.	.	.	.	.	.	G	14.57	2.573438	0.45902	.	.	ENSG00000102977	ENST00000219251;ENST00000393919	T;T	0.32023	1.47;1.47	4.96	2.91	0.33838	.	0.933679	0.09024	N	0.859708	T	0.20981	0.0505	N	0.19112	0.55	0.09310	N	1	P;P	0.39352	0.539;0.669	B;B	0.34652	0.091;0.187	T	0.12192	-1.0557	10	0.48119	T	0.1	-0.4756	11.667	0.51379	0.0:0.341:0.659:0.0	.	292;289	Q96AP0;Q96AP0-2	ACD_HUMAN;.	Y	289;292	ENSP00000219251:H289Y;ENSP00000377496:H292Y	ENSP00000219251:H289Y	H	-	1	0	ACD	66250361	0.986000	0.35501	0.104000	0.21259	0.318000	0.28184	2.309000	0.43699	0.440000	0.26502	0.462000	0.41574	CAC	ACD	-	NULL		0.612	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACD	HGNC	protein_coding	OTTHUMT00000268880.1	G	NM_022914		67692860	-1	no_errors	ENST00000219251	ensembl	human	known	70_37	missense	SNP	0.034	A
ACLY	47	genome.wustl.edu	37	17	40061806	40061806	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:40061806G>C	ENST00000352035.2	-	9	1102	c.972C>G	c.(970-972)ctC>ctG	p.L324L	ACLY_ENST00000537919.1_Intron|ACLY_ENST00000393896.2_Silent_p.L324L|ACLY_ENST00000590151.1_Silent_p.L324L|ACLY_ENST00000353196.1_Silent_p.L324L	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	324					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				TCATGAGGGAGAGGATAGTCT	0.572																																					Colon(64;807 1396 15971 30971)												0													184.0	157.0	166.0					17																	40061806		2203	4300	6503	SO:0001819	synonymous_variant	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.972C>G	17.37:g.40061806G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.L324	ENST00000352035.2	37	c.972	CCDS11412.1	17																																																																																			ACLY	-	superfamily_Succinyl-CoA_synth-like,pirsf_ATP-citrate_synthase		0.572	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	HGNC	protein_coding	OTTHUMT00000257465.1	G	NM_001096		40061806	-1	no_errors	ENST00000352035	ensembl	human	known	70_37	silent	SNP	0.877	C
ADD1	118	genome.wustl.edu	37	4	2906520	2906520	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:2906520C>A	ENST00000398129.1	+	9	1211	c.1191C>A	c.(1189-1191)taC>taA	p.Y397*	ADD1_ENST00000446856.1_Nonsense_Mutation_p.Y397*|ADD1_ENST00000398123.2_Nonsense_Mutation_p.Y397*|ADD1_ENST00000355842.3_Nonsense_Mutation_p.Y397*|ADD1_ENST00000503455.2_Nonsense_Mutation_p.Y397*|ADD1_ENST00000513328.2_Nonsense_Mutation_p.Y397*|ADD1_ENST00000264758.7_Nonsense_Mutation_p.Y397*|ADD1_ENST00000398125.1_Nonsense_Mutation_p.Y397*			P35611	ADDA_HUMAN	adducin 1 (alpha)	397					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTATCGATACCCTGCTCTGA	0.463																																					Esophageal Squamous(71;505 1201 20414 34538 37449)												0													106.0	101.0	103.0					4																	2906520		2203	4300	6503	SO:0001587	stop_gained	118			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1191C>A	4.37:g.2906520C>A	ENSP00000381197:p.Tyr397*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Nonsense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.Y397*	ENST00000398129.1	37	c.1191	CCDS43205.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.290145|12.290145	0.99654|0.99654	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000514940|ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129	.|.	.|.	.|.	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.048164	.|0.85682	.|D	.|0.000000	T|.	0.46151|.	0.1378|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.50808|.	-0.8784|.	3|.	.|0.13470	.|T	.|0.59	-20.513|-20.513	12.4247|12.4247	0.55540|0.55540	0.0:0.9231:0.0:0.0769|0.0:0.9231:0.0:0.0769	.|.	.|.	.|.	.|.	N|X	103|397	.|.	.|ENSP00000264758:Y397X	T|Y	+|+	2|3	0|2	ADD1|ADD1	2876318|2876318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.741000|2.741000	0.47426|0.47426	2.506000|2.506000	0.84524|0.84524	0.655000|0.655000	0.94253|0.94253	ACC|TAC	ADD1	-	NULL		0.463	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	HGNC	protein_coding	OTTHUMT00000242840.1	C	NM_014189		2906520	+1	no_errors	ENST00000264758	ensembl	human	known	70_37	nonsense	SNP	1.000	A
AFF2	2334	genome.wustl.edu	37	X	148037544	148037544	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:148037544G>C	ENST00000370460.2	+	11	2448	c.1969G>C	c.(1969-1971)Gaa>Caa	p.E657Q	AFF2_ENST00000342251.3_Missense_Mutation_p.E624Q|AFF2_ENST00000370457.5_Missense_Mutation_p.E624Q|AFF2_ENST00000286437.5_Missense_Mutation_p.E298Q	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	657					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CACTCCCAAAGAAAAAGAAAG	0.473																																																	0													95.0	101.0	99.0					X																	148037544		2203	4300	6503	SO:0001583	missense	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1969G>C	X.37:g.148037544G>C	ENSP00000359489:p.Glu657Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E657Q	ENST00000370460.2	37	c.1969	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548888	0.65311	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.5	5.5	0.81552	.	0.118903	0.53938	D	0.000043	T	0.71995	0.3406	L	0.55481	1.735	0.52501	D	0.999952	D;D;D;D;D;D	0.58620	0.983;0.979;0.979;0.979;0.979;0.983	P;P;P;P;P;P	0.59424	0.857;0.776;0.776;0.776;0.776;0.857	T	0.67280	-0.5710	10	0.21540	T	0.41	.	18.4401	0.90664	0.0:0.0:1.0:0.0	.	298;622;624;618;647;657	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	Q	657;624;624;298	ENSP00000359489:E657Q;ENSP00000359486:E624Q;ENSP00000345459:E624Q;ENSP00000286437:E298Q	ENSP00000286437:E298Q	E	+	1	0	AFF2	147845244	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.229000	0.65316	2.295000	0.77249	0.556000	0.70494	GAA	AFF2	-	pfam_TF_AF4/FMR2		0.473	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	G	NM_002025		148037544	+1	no_errors	ENST00000370460	ensembl	human	known	70_37	missense	SNP	1.000	C
AKAP8	10270	genome.wustl.edu	37	19	15469820	15469820	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:15469820C>G	ENST00000269701.2	-	13	1641	c.1581G>C	c.(1579-1581)ttG>ttC	p.L527F		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	527					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GTCTGTTGTTCAAAACACTCT	0.413																																					GBM(190;1671 2163 3274 27186 30476)												0													158.0	142.0	147.0					19																	15469820		2203	4300	6503	SO:0001583	missense	10270			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.1581G>C	19.37:g.15469820C>G	ENSP00000269701:p.Leu527Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_AKAP95	p.L527F	ENST00000269701.2	37	c.1581	CCDS12329.1	19	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384192	0.61845	.	.	ENSG00000105127	ENST00000269701	T	0.55930	0.49	5.84	4.81	0.61882	.	0.000000	0.44285	D	0.000474	T	0.57961	0.2089	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.59150	-0.7508	10	0.72032	D	0.01	-20.336	8.0363	0.30495	0.0:0.8425:0.0:0.1575	.	527	O43823	AKAP8_HUMAN	F	527	ENSP00000269701:L527F	ENSP00000269701:L527F	L	-	3	2	AKAP8	15330820	0.999000	0.42202	1.000000	0.80357	0.777000	0.43975	0.475000	0.22164	2.769000	0.95229	0.563000	0.77884	TTG	AKAP8	-	pfam_AKAP95		0.413	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8	HGNC	protein_coding	OTTHUMT00000461293.3	C	NM_005858		15469820	-1	no_errors	ENST00000269701	ensembl	human	known	70_37	missense	SNP	1.000	G
AKR1A1	10327	genome.wustl.edu	37	1	46032303	46032303	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:46032303C>G	ENST00000372070.3	+	4	894	c.147C>G	c.(145-147)atC>atG	p.I49M	AKR1A1_ENST00000471651.1_Missense_Mutation_p.I49M|AKR1A1_ENST00000351829.4_Missense_Mutation_p.I49M	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	49					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	GTGCTGCTATCTACGGCAATG	0.512																																																	0													126.0	114.0	118.0					1																	46032303		2203	4300	6503	SO:0001583	missense	10327			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.147C>G	1.37:g.46032303C>G	ENSP00000361140:p.Ile49Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.I49M	ENST00000372070.3	37	c.147	CCDS523.1	1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395209	0.42512	.	.	ENSG00000117448	ENST00000372070;ENST00000434299;ENST00000351829	T;T;T	0.24908	1.83;1.83;1.83	6.13	1.92	0.25849	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.357263	0.34828	N	0.003641	T	0.14141	0.0342	N	0.25992	0.78	0.41527	D	0.988432	B	0.09022	0.002	B	0.15870	0.014	T	0.12243	-1.0555	10	0.59425	D	0.04	.	2.1282	0.03743	0.2383:0.3997:0.2224:0.1397	.	49	P14550	AK1A1_HUMAN	M	49	ENSP00000361140:I49M;ENSP00000398414:I49M;ENSP00000312606:I49M	ENSP00000312606:I49M	I	+	3	3	AKR1A1	45804890	0.914000	0.31030	0.878000	0.34440	0.988000	0.76386	0.084000	0.14891	0.100000	0.17581	0.644000	0.83932	ATC	AKR1A1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr		0.512	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1	C	NM_006066		46032303	+1	no_errors	ENST00000351829	ensembl	human	known	70_37	missense	SNP	0.953	G
ALAD	210	genome.wustl.edu	37	9	116153117	116153117	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:116153117C>T	ENST00000409155.3	-	5	554	c.358G>A	c.(358-360)Gat>Aat	p.D120N	ALAD_ENST00000277315.5_Missense_Mutation_p.D103N|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	120					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	AGGCAGACATCACAGGCCACC	0.607																																																	0													100.0	86.0	91.0					9																	116153117		2203	4300	6503	SO:0001583	missense	210			M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.358G>A	9.37:g.116153117C>T	ENSP00000386284:p.Asp120Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	pfam_Porphobilinogen_synth,pirsf_Porphobilinogen_synth,prints_Porphobilinogen_synth	p.D120N	ENST00000409155.3	37	c.358	CCDS6794.2	9	.	.	.	.	.	.	.	.	.	.	C	20.6	4.021234	0.75275	.	.	ENSG00000148218	ENST00000409155;ENST00000277315	D;D	0.95377	-3.69;-3.69	5.67	5.67	0.87782	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.98905	0.9629	H	0.99197	4.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99316	1.0905	10	0.87932	D	0	-8.931	18.3566	0.90359	0.0:1.0:0.0:0.0	.	120;103;149	P13716;B7Z3I9;P13716-2	HEM2_HUMAN;.;.	N	120;103	ENSP00000386284:D120N;ENSP00000277315:D103N	ENSP00000277315:D103N	D	-	1	0	ALAD	115192938	0.998000	0.40836	0.467000	0.27180	0.158000	0.22134	5.577000	0.67444	2.667000	0.90743	0.563000	0.77884	GAT	ALAD	-	pfam_Porphobilinogen_synth,pirsf_Porphobilinogen_synth		0.607	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAD	HGNC	protein_coding	OTTHUMT00000053724.3	C	NM_001003945		116153117	-1	no_errors	ENST00000409155	ensembl	human	known	70_37	missense	SNP	0.998	T
ALDH4A1	8659	genome.wustl.edu	37	1	19216523	19216523	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:19216523G>A	ENST00000375341.3	-	2	396	c.139C>T	c.(139-141)Cga>Tga	p.R47*	ALDH4A1_ENST00000538309.1_5'UTR|RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000290597.5_Nonsense_Mutation_p.R47*|ALDH4A1_ENST00000538839.1_Nonsense_Mutation_p.R47*	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	47					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGCATCTCGCTCAGGGCTG	0.652																																																	0													45.0	37.0	39.0					1																	19216523		2203	4299	6502	SO:0001587	stop_gained	8659			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.139C>T	1.37:g.19216523G>A	ENSP00000364490:p.Arg47*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Nonsense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	p.R47*	ENST00000375341.3	37	c.139	CCDS188.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574643	0.86542	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000375335;ENST00000432718	.	.	.	5.32	4.4	0.53042	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4901	12.8559	0.57884	0.0:0.0:0.8367:0.1633	.	.	.	.	X	47	.	ENSP00000290597:R47X	R	-	1	2	ALDH4A1	19089110	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	4.500000	0.60387	1.371000	0.46172	0.558000	0.71614	CGA	ALDH4A1	-	superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH		0.652	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	G			19216523	-1	no_errors	ENST00000290597	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ALG1L	200810	genome.wustl.edu	37	3	125649457	125649457	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:125649457C>T	ENST00000340333.3	-	5	454	c.291G>A	c.(289-291)gtG>gtA	p.V97V	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	97							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CTTCATGTTTCACCAGCTCAT	0.597																																																	0													51.0	55.0	53.0					3																	125649457		1368	2309	3677	SO:0001819	synonymous_variant	200810			BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.291G>A	3.37:g.125649457C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNA5	Silent	SNP	NULL	p.V97	ENST00000340333.3	37	c.291	CCDS33840.1	3																																																																																			ALG1L	-	NULL		0.597	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG1L	HGNC	protein_coding	OTTHUMT00000356347.1	C	NM_001015050		125649457	-1	no_errors	ENST00000340333	ensembl	human	known	70_37	silent	SNP	1.000	T
ANKRD36	375248	genome.wustl.edu	37	2	97877440	97877440	+	Missense_Mutation	SNP	T	T	C	rs35711845	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:97877440T>C	ENST00000461153.2	+	58	3675	c.3431T>C	c.(3430-3432)aTg>aCg	p.M1144T	ANKRD36_ENST00000420699.2_Missense_Mutation_p.M1144T			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1144										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GTTCCGAATATGGCCACGGAA	0.338													.|||	1324	0.264377	0.0885	0.3602	5008	,	,		25668	0.1964		0.5129	False		,,,				2504	0.2485																0								T	THR/MET	250,1134		3,244,445	149.0	140.0	143.0		3431	-2.3	0.0	2	dbSNP_126	143	1583,1599		99,1385,107	yes	missense	ANKRD36	NM_001164315.1	81	102,1629,552	CC,CT,TT		49.7486,18.0636,40.1445	benign	1144/1942	97877440	1833,2733	692	1591	2283	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3431T>C	2.37:g.97877440T>C	ENSP00000419530:p.Met1144Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1144T	ENST00000461153.2	37	c.3431	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	1.894	-0.454824	0.04540	0.180636	0.497486	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.77229	-1.08;-1.08	1.17	-2.3	0.06785	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39941	-0.9589	8	0.23891	T	0.37	.	1.5487	0.02570	0.4242:0.0:0.2415:0.3342	rs35711845;rs62156172	1144	A6QL64	AN36A_HUMAN	T	1144;1144;404	ENSP00000419530:M1144T;ENSP00000391950:M1144T	ENSP00000391950:M1144T	M	+	2	0	ANKRD36	97241167	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.779000	0.26746	-0.591000	0.05859	-0.727000	0.03589	ATG	ANKRD36	-	NULL		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	T			97877440	+1	no_errors	ENST00000420699	ensembl	human	known	70_37	missense	SNP	0.000	C
ALPP	250	genome.wustl.edu	37	2	233244519	233244519	+	Missense_Mutation	SNP	C	C	T	rs371726976		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:233244519C>T	ENST00000392027.2	+	5	799	c.530C>T	c.(529-531)tCg>tTg	p.S177L	AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	177					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CAGCACGCCTCGCCAGCCGGC	0.642																																																	0								C	LEU/SER	1,4405		0,1,2202	60.0	59.0	59.0		530	2.3	1.0	2		59	0,8600		0,0,4300	no	missense	ALPP	NM_001632.3	145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	177/536	233244519	1,13005	2203	4300	6503	SO:0001583	missense	250			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.530C>T	2.37:g.233244519C>T	ENSP00000375881:p.Ser177Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.S177L	ENST00000392027.2	37	c.530	CCDS2490.1	2	.	.	.	.	.	.	.	.	.	.	.	17.34	3.365036	0.61513	2.27E-4	0.0	ENSG00000163283	ENST00000392027	D	0.96685	-4.09	2.31	2.31	0.28768	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98529	0.9509	H	0.96547	3.84	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99035	1.0822	10	0.87932	D	0	.	12.9891	0.58608	0.0:1.0:0.0:0.0	.	177	P05187	PPB1_HUMAN	L	177	ENSP00000375881:S177L	ENSP00000375881:S177L	S	+	2	0	ALPP	232952763	1.000000	0.71417	0.984000	0.44739	0.215000	0.24574	5.387000	0.66243	1.289000	0.44618	0.298000	0.19748	TCG	ALPP	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase		0.642	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	C	NM_001632		233244519	+1	no_errors	ENST00000392027	ensembl	human	known	70_37	missense	SNP	1.000	T
ANKRD42	338699	genome.wustl.edu	37	11	82938887	82938887	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:82938887G>A	ENST00000393392.2	+	7	964	c.802G>A	c.(802-804)Gat>Aat	p.D268N	ANKRD42_ENST00000533342.1_Missense_Mutation_p.D296N|ANKRD42_ENST00000260047.6_Missense_Mutation_p.D295N|ANKRD42_ENST00000531895.1_Missense_Mutation_p.D296N	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42	268					positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						TGAGCGTGCTGATAATGGATC	0.378																																																	0													144.0	130.0	135.0					11																	82938887		2203	4300	6503	SO:0001583	missense	338699			AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.802G>A	11.37:g.82938887G>A	ENSP00000377051:p.Asp268Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A49	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D268N	ENST00000393392.2	37	c.802	CCDS8265.1	11	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614685	0.28712	.	.	ENSG00000137494	ENST00000260047;ENST00000531895;ENST00000393392;ENST00000533342;ENST00000342658;ENST00000531815	T;T;T;T;D	0.81579	2.56;2.56;2.56;2.56;-1.51	5.2	1.37	0.22104	Ankyrin repeat-containing domain (4);	0.439107	0.23515	N	0.047344	T	0.58949	0.2158	N	0.16066	0.365	0.34529	D	0.709026	B;B;B;B	0.17465	0.01;0.007;0.01;0.022	B;B;B;B	0.18561	0.015;0.022;0.015;0.02	T	0.50381	-0.8835	9	.	.	.	-1.8501	5.1516	0.15013	0.2756:0.1777:0.5467:0.0	.	296;560;387;268	E9PIL2;A1DRY3;A1XPJ0;Q8N9B4	.;.;.;ANR42_HUMAN	N	295;296;268;296;36;21	ENSP00000260047:D295N;ENSP00000434666:D296N;ENSP00000377051:D268N;ENSP00000435790:D296N;ENSP00000435197:D21N	.	D	+	1	0	ANKRD42	82616535	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.831000	0.39141	0.414000	0.25790	0.561000	0.74099	GAT	ANKRD42	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.378	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ANKRD42	HGNC	protein_coding	OTTHUMT00000392934.1	G	NM_182603		82938887	+1	no_errors	ENST00000393392	ensembl	human	known	70_37	missense	SNP	1.000	A
AP1B1	162	genome.wustl.edu	37	22	29755894	29755894	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:29755894C>A	ENST00000405198.1	-	3	229	c.198G>T	c.(196-198)aaG>aaT	p.K66N	AP1B1_ENST00000415447.1_Missense_Mutation_p.K66N|AP1B1_ENST00000402502.1_Missense_Mutation_p.K66N|AP1B1_ENST00000357586.2_Missense_Mutation_p.K66N|AP1B1_ENST00000432560.2_Missense_Mutation_p.K66N|AP1B1_ENST00000356015.2_Missense_Mutation_p.K66N|AP1B1_ENST00000317368.7_Missense_Mutation_p.K66N			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	66					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						ATACTAGCTTCTTCAGCTCCA	0.512											OREG0026449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													134.0	114.0	121.0					22																	29755894		2203	4300	6503	SO:0001583	missense	162			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.198G>T	22.37:g.29755894C>A	ENSP00000384194:p.Lys66Asn	Somatic	812	WXS	Illumina HiSeq	Phase_IV	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu_1_2_4	p.K66N	ENST00000405198.1	37	c.198	CCDS13855.1	22	.	.	.	.	.	.	.	.	.	.	C	20.2	3.958224	0.73902	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.09	4.06	0.47325	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	H	0.98802	4.335	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90631	0.4567	10	0.87932	D	0	-29.6258	13.8799	0.63676	0.0:0.9248:0.0:0.0752	.	66;66;66;66	F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;AP1B1_HUMAN;.	N	66	ENSP00000350199:K66N;ENSP00000348297:K66N;ENSP00000400065:K66N;ENSP00000384194:K66N;ENSP00000319361:K66N;ENSP00000386071:K66N;ENSP00000387612:K66N;ENSP00000400022:K66N	ENSP00000319361:K66N	K	-	3	2	AP1B1	28085894	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.987000	0.40687	1.265000	0.44215	0.561000	0.74099	AAG	AP1B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP_complex_bsu_1_2_4		0.512	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	C	NM_001127		29755894	-1	no_errors	ENST00000357586	ensembl	human	known	70_37	missense	SNP	1.000	A
APC2	10297	genome.wustl.edu	37	19	1456386	1456386	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:1456386C>T	ENST00000535453.1	+	7	2512	c.799C>T	c.(799-801)Cag>Tag	p.Q267*	APC2_ENST00000233607.2_Nonsense_Mutation_p.Q267*|APC2_ENST00000238483.4_Intron|CTB-25B13.12_ENST00000588225.1_RNA			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCACCCCTCAGCCGGGCAA	0.677																																																	0													23.0	23.0	23.0					19																	1456386		2188	4292	6480	SO:0001587	stop_gained	10297				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.799C>T	19.37:g.1456386C>T	ENSP00000442954:p.Gln267*	Somatic		WXS	Illumina HiSeq	Phase_IV	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Nonsense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.Q267*	ENST00000535453.1	37	c.799	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	C	39	7.448341	0.98289	.	.	ENSG00000115266	ENST00000233607;ENST00000535453	.	.	.	4.66	4.66	0.58398	.	0.349959	0.24823	N	0.035318	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-33.9234	13.0426	0.58908	0.0:1.0:0.0:0.0	.	.	.	.	X	267	.	ENSP00000233607:Q267X	Q	+	1	0	APC2	1407386	0.155000	0.22806	0.995000	0.50966	0.754000	0.42855	2.210000	0.42816	2.136000	0.66102	0.455000	0.32223	CAG	APC2	-	NULL		0.677	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	C	NM_005883		1456386	+1	no_errors	ENST00000233607	ensembl	human	known	70_37	nonsense	SNP	0.631	T
APBA3	9546	genome.wustl.edu	37	19	3759797	3759797	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:3759797C>T	ENST00000316757.3	-	2	666	c.466G>A	c.(466-468)Gag>Aag	p.E156K	MRPL54_ENST00000330133.4_5'Flank	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	156					in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCCCCCTCCACCCATTCT	0.642																																																	0													22.0	26.0	25.0					19																	3759797		2201	4294	6495	SO:0001583	missense	9546			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.466G>A	19.37:g.3759797C>T	ENSP00000315136:p.Glu156Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O60483|Q9UPZ2	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.E156K	ENST00000316757.3	37	c.466	CCDS12110.1	19	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836196	0.32421	.	.	ENSG00000011132	ENST00000316757	T	0.07216	3.21	4.39	3.35	0.38373	.	1.027280	0.07770	N	0.951508	T	0.06325	0.0163	L	0.29908	0.895	0.09310	N	1	B	0.26363	0.147	B	0.15870	0.014	T	0.40739	-0.9547	10	0.09338	T	0.73	.	9.1769	0.37118	0.0:0.8953:0.0:0.1047	.	156	O96018	APBA3_HUMAN	K	156	ENSP00000315136:E156K	ENSP00000315136:E156K	E	-	1	0	APBA3	3710797	0.004000	0.15560	0.199000	0.23439	0.045000	0.14185	1.379000	0.34340	0.842000	0.35045	0.561000	0.74099	GAG	APBA3	-	NULL		0.642	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	HGNC	protein_coding	OTTHUMT00000453634.2	C			3759797	-1	no_errors	ENST00000316757	ensembl	human	known	70_37	missense	SNP	0.022	T
AR	367	genome.wustl.edu	37	X	66943614	66943614	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:66943614G>A	ENST00000374690.3	+	8	3218	c.2694G>A	c.(2692-2694)gaG>gaA	p.E898E	AR_ENST00000396043.2_Silent_p.E366E|AR_ENST00000396044.3_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	897	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		I -> T (in AIS).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TGATGGCAGAGATCATCTCTG	0.488									Androgen Insensitivity Syndrome																																								0													203.0	163.0	177.0					X																	66943614		2203	4300	6503	SO:0001819	synonymous_variant	367	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2694G>A	X.37:g.66943614G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.E898	ENST00000374690.3	37	c.2694	CCDS14387.1	X																																																																																			AR	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.488	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	G	NM_000044		66943614	+1	no_errors	ENST00000374690	ensembl	human	known	70_37	silent	SNP	1.000	A
ARAP1	116985	genome.wustl.edu	37	11	72415360	72415360	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:72415360T>C	ENST00000393609.3	-	14	2031	c.1829A>G	c.(1828-1830)aAt>aGt	p.N610S	ARAP1_ENST00000429686.1_Intron|ARAP1_ENST00000334211.8_Missense_Mutation_p.N365S|ARAP1_ENST00000393605.3_Missense_Mutation_p.N370S|ARAP1_ENST00000426523.1_Missense_Mutation_p.N365S|ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000359373.5_Missense_Mutation_p.N610S|ARAP1_ENST00000455638.2_Missense_Mutation_p.N610S	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	610	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CCCAGCGCCATTCCCCAGCTG	0.672																																					Ovarian(102;1198 1520 13195 17913 37529)												0													16.0	19.0	18.0					11																	72415360		2199	4292	6491	SO:0001583	missense	116985			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.1829A>G	11.37:g.72415360T>C	ENSP00000377233:p.Asn610Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.N610S	ENST00000393609.3	37	c.1829	CCDS41687.1	11	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360855	0.82353	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000340247	T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	M	0.87456	2.885	0.43782	D	0.996319	D;P;D;D	0.71674	0.996;0.747;0.996;0.998	D;P;D;D	0.71870	0.975;0.477;0.975;0.974	D	0.85029	0.0916	10	0.49607	T	0.09	.	14.2758	0.66179	0.0:0.0:0.0:1.0	.	365;610;610;370	E7EU13;Q96P48-3;Q96P48;Q96P48-1	.;.;ARAP1_HUMAN;.	S	610;610;370;365;610;365;399	ENSP00000352332:N610S;ENSP00000390461:N610S;ENSP00000377230:N370S;ENSP00000335506:N365S;ENSP00000377233:N610S;ENSP00000392264:N365S	ENSP00000335506:N365S	N	-	2	0	ARAP1	72093008	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.005000	0.88553	2.071000	0.62044	0.533000	0.62120	AAT	ARAP1	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP		0.672	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1	T	NM_001040118		72415360	-1	no_errors	ENST00000393609	ensembl	human	known	70_37	missense	SNP	1.000	C
ARHGEF40	55701	genome.wustl.edu	37	14	21542609	21542609	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:21542609C>T	ENST00000298694.4	+	3	847	c.720C>T	c.(718-720)ggC>ggT	p.G240G	ARHGEF40_ENST00000298693.3_Silent_p.G240G			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	240						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						GACCTGAGGGCGAGTATGTGG	0.657																																																	0													31.0	40.0	37.0					14																	21542609		2200	4299	6499	SO:0001819	synonymous_variant	55701				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.720C>T	14.37:g.21542609C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G240	ENST00000298694.4	37	c.720	CCDS32041.1	14																																																																																			ARHGEF40	-	NULL		0.657	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	C			21542609	+1	no_errors	ENST00000298694	ensembl	human	known	70_37	silent	SNP	0.998	T
ARF6	382	genome.wustl.edu	37	14	50360887	50360887	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:50360887C>T	ENST00000298316.5	+	2	980	c.433C>T	c.(433-435)Cgg>Tgg	p.R145W		NM_001663.3	NP_001654.1	P62330	ARF6_HUMAN	ADP-ribosylation factor 6	145					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular component movement (GO:0006928)|cortical actin cytoskeleton organization (GO:0030866)|establishment of epithelial cell polarity (GO:0090162)|GTP catabolic process (GO:0006184)|hepatocyte apoptotic process (GO:0097284)|liver development (GO:0001889)|myeloid cell apoptotic process (GO:0033028)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|protein localization to cell surface (GO:0034394)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|regulation of dendritic spine development (GO:0060998)|regulation of filopodium assembly (GO:0051489)|regulation of Rac protein signal transduction (GO:0035020)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|thioesterase binding (GO:0031996)			endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	all_epithelial(31;0.000822)|Breast(41;0.0117)					GACCCGGATTCGGGACAGGAA	0.552																																																	0													40.0	36.0	38.0					14																	50360887		2203	4300	6503	SO:0001583	missense	382				CCDS9695.1	14q21.3	2004-06-21			ENSG00000165527	ENSG00000165527		"""ADP-ribosylation factors"""	659	protein-coding gene	gene with protein product		600464				1993656, 10343114	Standard	NM_001663		Approved		uc001wxg.4	P62330	OTTHUMG00000140296	ENST00000298316.5:c.433C>T	14.37:g.50360887C>T	ENSP00000298316:p.Arg145Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	P26438|Q6FGZ2	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R145W	ENST00000298316.5	37	c.433	CCDS9695.1	14	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320491	0.60634	.	.	ENSG00000165527	ENST00000298316	D	0.83250	-1.7	5.05	4.16	0.48862	.	0.000000	0.85682	D	0.000000	D	0.86426	0.5930	M	0.85462	2.755	0.54753	D	0.999988	D	0.58970	0.984	P	0.51266	0.664	D	0.86539	0.1827	10	0.87932	D	0	-9.5638	7.179	0.25761	0.2834:0.63:0.0:0.0867	.	145	P62330	ARF6_HUMAN	W	145	ENSP00000298316:R145W	ENSP00000298316:R145W	R	+	1	2	ARF6	49430637	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.997000	0.49457	1.113000	0.41760	0.491000	0.48974	CGG	ARF6	-	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type		0.552	ARF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF6	HGNC	protein_coding	OTTHUMT00000276883.1	C	NM_001663		50360887	+1	no_errors	ENST00000298316	ensembl	human	known	70_37	missense	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7047686	7047686	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:7047686C>G	ENST00000356654.4	+	7	2797	c.2560C>G	c.(2560-2562)Ctg>Gtg	p.L854V	ATN1_ENST00000396684.2_Missense_Mutation_p.L854V	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	854					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						ATGCCCATCTCTGGGCCCAGT	0.607											OREG0021641	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													40.0	41.0	41.0					12																	7047686		2203	4300	6503	SO:0001583	missense	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.2560C>G	12.37:g.7047686C>G	ENSP00000349076:p.Leu854Val	Somatic	638	WXS	Illumina HiSeq	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.L854V	ENST00000356654.4	37	c.2560	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478114	0.26511	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.45276	0.9;0.9;0.9	4.96	4.96	0.65561	.	0.331492	0.16875	U	0.195941	T	0.39145	0.1067	N	0.22421	0.69	0.31358	N	0.68175	B	0.28400	0.21	B	0.38921	0.285	T	0.36480	-0.9746	10	0.26408	T	0.33	.	18.8408	0.92183	0.0:1.0:0.0:0.0	.	854	P54259	ATN1_HUMAN	V	854;854;854;439	ENSP00000349076:L854V;ENSP00000379915:L854V;ENSP00000441744:L854V	ENSP00000229279:L439V	L	+	1	2	ATN1	6917947	0.998000	0.40836	0.987000	0.45799	0.134000	0.20937	1.428000	0.34892	2.767000	0.95098	0.650000	0.86243	CTG	ATN1	-	pfam_Atrophin-like,prints_Atrophin-1		0.607	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	C	NM_001940		7047686	+1	no_errors	ENST00000356654	ensembl	human	known	70_37	missense	SNP	0.998	G
ATP11A	23250	genome.wustl.edu	37	13	113510282	113510282	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr13:113510282G>A	ENST00000487903.1	+	20	2389	c.2301G>A	c.(2299-2301)ctG>ctA	p.L767L	ATP11A_ENST00000283558.8_Silent_p.L767L|ATP11A_ENST00000375630.2_Silent_p.L767L|ATP11A_ENST00000375645.3_Silent_p.L767L			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	767					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CACTGTCTCTGATAATGAAGC	0.517																																																	0													114.0	121.0	119.0					13																	113510282		2203	4300	6503	SO:0001819	synonymous_variant	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2301G>A	13.37:g.113510282G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXT2	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L767	ENST00000487903.1	37	c.2301	CCDS32011.1	13																																																																																			ATP11A	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl		0.517	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	G	NM_015205		113510282	+1	no_errors	ENST00000375630	ensembl	human	known	70_37	silent	SNP	0.003	A
ATP2B2	491	genome.wustl.edu	37	3	10413730	10413730	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:10413730C>T	ENST00000352432.4	-	11	1491	c.1422G>A	c.(1420-1422)atG>atA	p.M474I	ATP2B2_ENST00000360273.2_Missense_Mutation_p.M474I|ATP2B2_ENST00000343816.4_Missense_Mutation_p.M460I|ATP2B2_ENST00000397077.1_Missense_Mutation_p.M429I|ATP2B2_ENST00000383800.4_Missense_Mutation_p.M429I			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	474					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TGTCCTTCATCATTTTCTGGG	0.567																																					Ovarian(125;1619 1709 15675 19819 38835)												0													114.0	100.0	105.0					3																	10413730		2203	4300	6503	SO:0001583	missense	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1422G>A	3.37:g.10413730C>T	ENSP00000324172:p.Met474Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.M474I	ENST00000352432.4	37	c.1422	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	18.89	3.720292	0.68959	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	4.71	4.71	0.59529	ATPase, P-type, ATPase-associated domain (1);	0.126183	0.64402	D	0.000001	D	0.94712	0.8294	M	0.88241	2.94	0.80722	D	1	B;B;B	0.34290	0.002;0.447;0.332	B;P;B	0.46850	0.004;0.529;0.32	D	0.95529	0.8601	10	0.87932	D	0	-23.9341	17.8685	0.88803	0.0:1.0:0.0:0.0	.	409;441;474	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	I	474;429;429;474;460;409;330;474	ENSP00000324172:M474I;ENSP00000373311:M429I;ENSP00000380267:M429I;ENSP00000353414:M474I;ENSP00000344677:M460I;ENSP00000414854:M330I	ENSP00000342954:M474I	M	-	3	0	ATP2B2	10388730	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.568000	0.82369	2.443000	0.82685	0.655000	0.94253	ATG	ATP2B2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr		0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	C	NM_001683		10413730	-1	no_errors	ENST00000352432	ensembl	human	known	70_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76761674	76761674	+	3'UTR	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:76761674G>T	ENST00000373344.5	-	0	9848				ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_3'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATATAAAAATGAGCCTTTTAG	0.249			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0																																										SO:0001624	3_prime_UTR_variant	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.*2155C>A	X.37:g.76761674G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			ATRX	-	-		0.249	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	G	NM_000489		76761674	-1	no_errors	ENST00000480283	ensembl	human	known	70_37	rna	SNP	0.996	T
AZIN1	51582	genome.wustl.edu	37	8	103870315	103870315	+	5'UTR	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:103870315G>A	ENST00000337198.5	-	0	994				AZIN1_ENST00000522311.1_5'Flank|AZIN1_ENST00000347770.4_5'UTR|KB-1254G8.1_ENST00000519337.1_lincRNA	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1						cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			AAGTCGAACTGCTCTCTATAC	0.463																																																	0																																										SO:0001623	5_prime_UTR_variant	51582			AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.-170C>T	8.37:g.103870315G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCD5|Q6IBQ7|Q96D20	RNA	SNP	-	NULL	ENST00000337198.5	37	NULL	CCDS6295.1	8																																																																																			AZIN1	-	-		0.463	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZIN1	HGNC	protein_coding	OTTHUMT00000380133.1	G			103870315	-1	no_errors	ENST00000517581	ensembl	human	known	70_37	rna	SNP	1.000	A
BAG6	7917	genome.wustl.edu	37	6	31607000	31607000	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:31607000G>A	ENST00000375964.6	-	25	3620	c.3307C>T	c.(3307-3309)Cgg>Tgg	p.R1103W	BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000404765.2_Missense_Mutation_p.R1133W|BAG6_ENST00000362049.6_Missense_Mutation_p.R1048W|BAG6_ENST00000375976.4_Missense_Mutation_p.R1097W|BAG6_ENST00000211379.5_Missense_Mutation_p.R1097W|BAG6_ENST00000439687.2_Missense_Mutation_p.R874W	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	1103					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						ATATCAGACCGGAGCTAAAGA	0.527																																																	0													36.0	34.0	35.0					6																	31607000		2203	4300	6503	SO:0001583	missense	7917			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.3307C>T	6.37:g.31607000G>A	ENSP00000365131:p.Arg1103Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	pfam_DUF3538,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.R1133W	ENST00000375964.6	37	c.3397	CCDS47403.1	6	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241629	0.58995	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049	T;T;T;T;T;T	0.46451	1.26;1.25;1.26;1.23;0.87;1.48	5.38	4.48	0.54585	.	0.294818	0.35124	N	0.003430	T	0.41488	0.1161	L	0.49126	1.545	0.33731	D	0.618213	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	P;D;D;D	0.72075	0.887;0.967;0.965;0.976	T	0.51148	-0.8742	10	0.87932	D	0	.	4.6026	0.12361	0.0821:0.151:0.6106:0.1564	.	874;1048;1103;1097	E7EMZ4;F8VXY4;P46379;P46379-2	.;.;BAG6_HUMAN;.	W	1097;1103;1097;1133;874;1048	ENSP00000365143:R1097W;ENSP00000365131:R1103W;ENSP00000211379:R1097W;ENSP00000384494:R1133W;ENSP00000402856:R874W;ENSP00000354875:R1048W	ENSP00000211379:R1097W	R	-	1	2	BAG6	31714979	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.123000	0.57917	2.813000	0.96785	0.655000	0.94253	CGG	BAG6	-	NULL		0.527	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAG6	HGNC	protein_coding		G	NM_080703		31607000	-1	no_errors	ENST00000404765	ensembl	human	known	70_37	missense	SNP	1.000	A
BARHL2	343472	genome.wustl.edu	37	1	91182630	91182630	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:91182630C>T	ENST00000370445.4	-	1	164	c.123G>A	c.(121-123)gcG>gcA	p.A41A		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	41					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		TCCTAAAATCCGCGGTCCTGG	0.577																																					GBM(199;3561 4100 22440)												0													88.0	97.0	94.0					1																	91182630		2203	4300	6503	SO:0001819	synonymous_variant	343472			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.123G>A	1.37:g.91182630C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVP2|Q7Z4N7	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.A41	ENST00000370445.4	37	c.123	CCDS730.1	1																																																																																			BARHL2	-	NULL		0.577	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL2	HGNC	protein_coding	OTTHUMT00000027728.2	C			91182630	-1	no_errors	ENST00000370445	ensembl	human	known	70_37	silent	SNP	1.000	T
BDKRB1	623	genome.wustl.edu	37	14	96730151	96730151	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:96730151C>T	ENST00000216629.6	+	3	738	c.132C>T	c.(130-132)atC>atT	p.I44I	RP11-404P21.3_ENST00000553638.1_RNA|RP11-404P21.8_ENST00000555847.1_3'UTR|RP11-404P21.8_ENST00000553811.1_3'UTR|BDKRB1_ENST00000553356.1_Silent_p.I44I	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	44					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)	p.I44M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		CAACATTTATCATCTCCATCT	0.542																																																	1	Substitution - Missense(1)	urinary_tract(1)											91.0	72.0	79.0					14																	96730151		2203	4300	6503	SO:0001819	synonymous_variant	623			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.132C>T	14.37:g.96730151C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7F5|Q546S7|Q8N0Y8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_BK_rcpt_B1,prints_GPCR_Rhodpsn,prints_Brdyknn_rcpt	p.I44	ENST00000216629.6	37	c.132	CCDS9943.1	14																																																																																			BDKRB1	-	prints_GPCR_Rhodpsn		0.542	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDKRB1	HGNC	protein_coding	OTTHUMT00000413300.1	C			96730151	+1	no_errors	ENST00000216629	ensembl	human	known	70_37	silent	SNP	0.172	T
BIRC6	57448	genome.wustl.edu	37	2	32743990	32743990	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:32743990C>T	ENST00000421745.2	+	57	11734	c.11600C>T	c.(11599-11601)tCa>tTa	p.S3867L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3867					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.S3867L(1)|p.S3839L(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ACAACATTATCAGATGTTCTT	0.353																																					Pancreas(94;175 1509 16028 18060 45422)												2	Substitution - Missense(2)	breast(2)											82.0	76.0	78.0					2																	32743990		2203	4300	6503	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.11600C>T	2.37:g.32743990C>T	ENSP00000393596:p.Ser3867Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S3867L	ENST00000421745.2	37	c.11600	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297190	0.81025	.	.	ENSG00000115760	ENST00000421745	T	0.75050	-0.9	5.44	5.44	0.79542	.	0.134127	0.48286	D	0.000187	T	0.65668	0.2713	N	0.24115	0.695	0.52099	D	0.999949	B	0.20052	0.041	B	0.16289	0.015	T	0.62695	-0.6800	10	0.72032	D	0.01	.	19.2669	0.93990	0.0:1.0:0.0:0.0	.	3867	Q9NR09	BIRC6_HUMAN	L	3867	ENSP00000393596:S3867L	ENSP00000393596:S3867L	S	+	2	0	BIRC6	32597494	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.487000	0.81328	2.537000	0.85549	0.655000	0.94253	TCA	BIRC6	-	NULL		0.353	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	C	NM_016252		32743990	+1	no_errors	ENST00000421745	ensembl	human	known	70_37	missense	SNP	1.000	T
BOC	91653	genome.wustl.edu	37	3	112992158	112992158	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:112992158G>T	ENST00000495514.1	+	8	1908	c.1204G>T	c.(1204-1206)Gcc>Tcc	p.A402S	BOC_ENST00000273395.4_Missense_Mutation_p.A402S|BOC_ENST00000355385.3_Missense_Mutation_p.A402S			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	402	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GAGCGCCCATGCCGTAGTCCA	0.597																																																	0													33.0	24.0	27.0					3																	112992158		2195	4288	6483	SO:0001583	missense	91653			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1204G>T	3.37:g.112992158G>T	ENSP00000418663:p.Ala402Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A402S	ENST00000495514.1	37	c.1204	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531439	0.27387	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.68181	-0.31;-0.31;-0.31	5.66	4.78	0.61160	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	N	0.05351	-0.065	0.58432	D	0.999997	B;B	0.27791	0.189;0.115	B;B	0.41174	0.237;0.349	T	0.50767	-0.8789	10	0.16896	T	0.51	.	16.0274	0.80553	0.0:0.0:0.8645:0.1355	.	402;402	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	S	402	ENSP00000418663:A402S;ENSP00000273395:A402S;ENSP00000347546:A402S	ENSP00000273395:A402S	A	+	1	0	BOC	114474848	1.000000	0.71417	0.065000	0.19835	0.034000	0.12701	9.198000	0.94994	1.378000	0.46305	0.655000	0.94253	GCC	BOC	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like		0.597	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	G	NM_033254		112992158	+1	no_errors	ENST00000273395	ensembl	human	known	70_37	missense	SNP	0.999	T
BOD1L1	259282	genome.wustl.edu	37	4	13606480	13606480	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:13606480G>A	ENST00000040738.5	-	10	2179	c.2044C>T	c.(2044-2046)Cgc>Tgc	p.R682C		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	682	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R682C(1)									ATTTCTGAGCGTTCTACTTGC	0.398																																																	1	Substitution - Missense(1)	large_intestine(1)											264.0	278.0	273.0					4																	13606480		2203	4300	6503	SO:0001583	missense	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2044C>T	4.37:g.13606480G>A	ENSP00000040738:p.Arg682Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.R682C	ENST00000040738.5	37	c.2044	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705713	0.30232	.	.	ENSG00000038219	ENST00000040738	T	0.10668	2.85	5.71	3.8	0.43715	.	0.158511	0.30252	N	0.010050	T	0.06645	0.0170	L	0.27053	0.805	0.21652	N	0.999608	B	0.30179	0.271	B	0.19148	0.024	T	0.28427	-1.0044	10	0.87932	D	0	-0.8342	6.2574	0.20881	0.0968:0.0:0.5953:0.3079	.	682	Q8NFC6	BOD1L_HUMAN	C	682	ENSP00000040738:R682C	ENSP00000040738:R682C	R	-	1	0	BOD1L	13215578	0.801000	0.28930	0.171000	0.22900	0.105000	0.19272	2.639000	0.46570	1.408000	0.46895	0.563000	0.77884	CGC	BOD1L1	-	NULL		0.398	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	G	NM_148894		13606480	-1	no_errors	ENST00000040738	ensembl	human	known	70_37	missense	SNP	0.295	A
BRWD3	254065	genome.wustl.edu	37	X	79975055	79975055	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:79975055G>A	ENST00000373275.4	-	18	2193	c.1977C>T	c.(1975-1977)gaC>gaT	p.D659D	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	659					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTAGTCTCAGGTCTTGTTCTC	0.393																																																	0													177.0	147.0	157.0					X																	79975055		2203	4300	6503	SO:0001819	synonymous_variant	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1977C>T	X.37:g.79975055G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D659	ENST00000373275.4	37	c.1977	CCDS14447.1	X																																																																																			BRWD3	-	NULL		0.393	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	G	NM_153252		79975055	-1	no_errors	ENST00000373275	ensembl	human	known	70_37	silent	SNP	0.991	A
C14orf28	122525	genome.wustl.edu	37	14	45373686	45373686	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:45373686G>A	ENST00000325192.3	+	4	978	c.703G>A	c.(703-705)Gaa>Aaa	p.E235K	RP11-857B24.5_ENST00000555157.1_RNA|C14orf28_ENST00000557112.1_Missense_Mutation_p.E205K|C14orf28_ENST00000553841.1_3'UTR	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	235								p.E235K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						TTGGAAATCTGAAGATCTGGC	0.348																																																	1	Substitution - Missense(1)	lung(1)											157.0	153.0	155.0					14																	45373686		2203	4300	6503	SO:0001583	missense	122525			AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.703G>A	14.37:g.45373686G>A	ENSP00000326846:p.Glu235Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E235K	ENST00000325192.3	37	c.703	CCDS32069.1	14	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661817	0.67700	.	.	ENSG00000179476	ENST00000325192;ENST00000557112	T;T	0.28069	1.63;1.63	5.97	5.97	0.96955	.	0.051921	0.85682	D	0.000000	T	0.20251	0.0487	N	0.08118	0	0.54753	D	0.999981	B	0.14805	0.011	B	0.13407	0.009	T	0.04693	-1.0933	10	0.45353	T	0.12	.	17.9074	0.88923	0.0:0.0:1.0:0.0	.	235	Q4W4Y0	CN028_HUMAN	K	235;205	ENSP00000326846:E235K;ENSP00000451791:E205K	ENSP00000326846:E235K	E	+	1	0	C14orf28	44443436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.922000	0.70036	2.835000	0.97688	0.591000	0.81541	GAA	C14orf28	-	NULL		0.348	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	C14orf28	HGNC	protein_coding	OTTHUMT00000410086.1	G	NM_001017923		45373686	+1	no_errors	ENST00000325192	ensembl	human	known	70_37	missense	SNP	1.000	A
MCEMP1	199675	genome.wustl.edu	37	19	7743008	7743008	+	Missense_Mutation	SNP	C	C	T	rs142070554		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:7743008C>T	ENST00000333598.3	+	3	657	c.203C>T	c.(202-204)cCg>cTg	p.P68L	TRAPPC5_ENST00000596148.1_5'Flank|TRAPPC5_ENST00000426877.2_5'Flank|TRAPPC5_ENST00000317378.5_5'Flank|C19orf59_ENST00000597445.1_Missense_Mutation_p.P25L|CTD-3214H19.16_ENST00000597959.1_5'Flank	NM_174918.2	NP_777578.2	Q8IX19	MCEM1_HUMAN		68						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)|stomach(1)	5						CAGTGCAGGCCGCCCTCAGAC	0.592											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								C	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	146.0	142.0	143.0		203	-3.2	0.0	19	dbSNP_134	143	0,8600		0,0,4300	no	missense	C19orf59	NM_174918.2	98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	68/188	7743008	1,13005	2203	4300	6503	SO:0001583	missense	199675																														ENST00000333598.3:c.203C>T	19.37:g.7743008C>T	ENSP00000329920:p.Pro68Leu	Somatic	644	WXS	Illumina HiSeq	Phase_IV	Q8IX20	Missense_Mutation	SNP	NULL	p.P68L	ENST00000333598.3	37	c.203	CCDS12183.1	19	.	.	.	.	.	.	.	.	.	.	C	6.683	0.494697	0.12702	2.27E-4	0.0	ENSG00000183019	ENST00000333598	T	0.26067	1.76	3.94	-3.16	0.05217	.	1.413440	0.04916	N	0.454199	T	0.13329	0.0323	N	0.19112	0.55	0.09310	N	1	B	0.21071	0.051	B	0.14023	0.01	T	0.23619	-1.0183	10	0.31617	T	0.26	1.3433	2.7615	0.05307	0.3368:0.3163:0.0:0.3469	.	68	Q8IX19	MCEM1_HUMAN	L	68	ENSP00000329920:P68L	ENSP00000329920:P68L	P	+	2	0	C19orf59	7649008	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.149000	0.10204	-0.342000	0.08363	0.561000	0.74099	CCG	C19orf59	-	NULL		0.592	C19orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf59	HGNC	protein_coding	OTTHUMT00000461248.1	C			7743008	+1	no_errors	ENST00000333598	ensembl	human	known	70_37	missense	SNP	0.000	T
MROH9	80133	genome.wustl.edu	37	1	170993874	170993874	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:170993874G>C	ENST00000367759.4	+	19	2300	c.2146G>C	c.(2146-2148)Gag>Cag	p.E716Q		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0																	TTACAGTTTTGAGATGGTGGT	0.338																																																	0													71.0	62.0	65.0					1																	170993874		692	1590	2282	SO:0001583	missense	80133			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.2146G>C	1.37:g.170993874G>C	ENSP00000356733:p.Glu716Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E716Q	ENST00000367759.4	37	c.2146	CCDS53429.1	1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217832	0.58560	.	.	ENSG00000117501	ENST00000367759	T	0.64803	-0.12	5.51	5.51	0.81932	.	.	.	.	.	T	0.57460	0.2055	L	0.29908	0.895	0.29402	N	0.86185	D	0.89917	1.0	D	0.87578	0.998	T	0.50566	-0.8813	9	0.20046	T	0.44	.	15.2722	0.73712	0.0:0.0:1.0:0.0	.	716	F5GWX6	.	Q	716	ENSP00000356733:E716Q	ENSP00000356733:E716Q	E	+	1	0	C1orf129	169260498	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	2.895000	0.48648	2.736000	0.93811	0.655000	0.94253	GAG	C1orf129	-	superfamily_ARM-type_fold		0.338	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf129	HGNC	protein_coding		G	NM_025063		170993874	+1	no_errors	ENST00000367759	ensembl	human	known	70_37	missense	SNP	1.000	C
C9orf116	138162	genome.wustl.edu	37	9	138387442	138387442	+	Missense_Mutation	SNP	G	G	C	rs141771436	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:138387442G>C	ENST00000429260.2	-	3	262	c.242C>G	c.(241-243)tCg>tGg	p.S81W	C9orf116_ENST00000371791.1_Intron|C9orf116_ENST00000371789.3_Intron	NM_001048265.1|NM_144654.2	NP_001041730.1|NP_653255.1	Q5BN46	CI116_HUMAN	chromosome 9 open reading frame 116	81															OV - Ovarian serous cystadenocarcinoma(145;7.39e-08)|Epithelial(140;5.19e-07)|all cancers(34;1.04e-05)		AAATTTATTCGAATTTGGATA	0.368																																																	0													71.0	66.0	68.0					9																	138387442		2203	4300	6503	SO:0001583	missense	138162			BC021261	CCDS6989.1, CCDS43899.1	9q34.3	2012-04-02			ENSG00000160345	ENSG00000160345			28435	protein-coding gene	gene with protein product	"""p53-induced expression 1 in Rb&#8722;/&#8722; cells"""	614502				12477932	Standard	NM_144654		Approved	MGC29761, RbEST47, PIERCE1	uc004cft.1	Q5BN46	OTTHUMG00000020902	ENST00000429260.2:c.242C>G	9.37:g.138387442G>C	ENSP00000395281:p.Ser81Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T897|Q8WU44	Missense_Mutation	SNP	NULL	p.S81W	ENST00000429260.2	37	c.242	CCDS43899.1	9	.	.	.	.	.	.	.	.	.	.	G	14.57	2.576346	0.45902	.	.	ENSG00000160345	ENST00000429260	.	.	.	5.03	1.99	0.26369	.	3.139920	0.00956	N	0.003029	T	0.49949	0.1587	M	0.73962	2.25	0.09310	N	1	B	0.17667	0.023	B	0.15484	0.013	T	0.28586	-1.0039	9	0.54805	T	0.06	-5.1917	4.7719	0.13160	0.0818:0.1487:0.6153:0.1541	.	81	Q5BN46	CI116_HUMAN	W	81	.	ENSP00000395281:S81W	S	-	2	0	C9orf116	137527263	0.115000	0.22152	0.001000	0.08648	0.239000	0.25481	2.556000	0.45862	0.509000	0.28195	0.650000	0.86243	TCG	C9orf116	-	NULL		0.368	C9orf116-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf116	HGNC	protein_coding	OTTHUMT00000054985.2	G	NM_144654		138387442	-1	no_errors	ENST00000429260	ensembl	human	known	70_37	missense	SNP	0.001	C
CACNA2D3	55799	genome.wustl.edu	37	3	54798357	54798357	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:54798357C>T	ENST00000474759.1	+	13	1407	c.1359C>T	c.(1357-1359)acC>acT	p.T453T	CACNA2D3_ENST00000415676.2_Silent_p.T453T|CACNA2D3_ENST00000288197.5_Silent_p.T453T|CACNA2D3_ENST00000490478.1_Silent_p.T359T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	453	Cache.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TGGTGTGGACCGAAGCTTACA	0.507																																																	0													105.0	102.0	103.0					3																	54798357		2055	4199	6254	SO:0001819	synonymous_variant	55799			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1359C>T	3.37:g.54798357C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.T453	ENST00000474759.1	37	c.1359	CCDS54598.1	3																																																																																			CACNA2D3	-	pfam_Cache_domain		0.507	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	C			54798357	+1	no_errors	ENST00000288197	ensembl	human	known	70_37	silent	SNP	0.007	T
CALD1	800	genome.wustl.edu	37	7	134618729	134618729	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:134618729G>C	ENST00000361675.2	+	5	1438	c.1209G>C	c.(1207-1209)aaG>aaC	p.K403N	CALD1_ENST00000495522.1_Intron|CALD1_ENST00000361388.2_Intron|CALD1_ENST00000393118.2_Intron|CALD1_ENST00000361901.2_Intron|CALD1_ENST00000422748.1_Intron|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000417172.1_Intron|CALD1_ENST00000543443.1_Intron			Q05682	CALD1_HUMAN	caldesmon 1	403					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						AAGAGACAAAGATAAAAGGGG	0.423																																																	0													103.0	110.0	108.0					7																	134618729		2203	4300	6503	SO:0001583	missense	800			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1209G>C	7.37:g.134618729G>C	ENSP00000354826:p.Lys403Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.K403N	ENST00000361675.2	37	c.1209	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	9.991	1.230836	0.22542	.	.	ENSG00000122786	ENST00000361675	T	0.36157	1.27	5.11	5.11	0.69529	.	0.374875	0.22360	N	0.061084	T	0.37705	0.1013	L	0.36672	1.1	0.80722	D	1	P	0.42078	0.77	P	0.46144	0.505	T	0.06409	-1.0828	9	.	.	.	-20.344	16.3081	0.82856	0.0:0.0:1.0:0.0	.	403	Q05682	CALD1_HUMAN	N	403	ENSP00000354826:K403N	.	K	+	3	2	CALD1	134269269	0.993000	0.37304	0.143000	0.22291	0.230000	0.25150	2.397000	0.44477	2.372000	0.80975	0.563000	0.77884	AAG	CALD1	-	pfam_Caldesmon_LSP		0.423	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	G	NM_033138		134618729	+1	no_errors	ENST00000361675	ensembl	human	novel	70_37	missense	SNP	0.889	C
CCDC144NL	339184	genome.wustl.edu	37	17	20799133	20799133	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:20799133G>A	ENST00000327925.5	-	1	320	c.201C>T	c.(199-201)ggC>ggT	p.G67G	RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA|RNU6-1178P_ENST00000516674.1_RNA|RP11-344E13.3_ENST00000582324.1_RNA|RP11-344E13.3_ENST00000577537.1_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	67										large_intestine(3)|lung(3)|skin(1)	7						GGTCTAAGGCGCCCTCACCGT	0.642																																																	0													74.0	85.0	81.0					17																	20799133		2203	4300	6503	SO:0001819	synonymous_variant	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.201C>T	17.37:g.20799133G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.G67	ENST00000327925.5	37	c.201	CCDS32591.1	17																																																																																			CCDC144NL	-	NULL		0.642	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC144NL	HGNC	protein_coding	OTTHUMT00000255361.2	G	NM_001004306		20799133	-1	no_errors	ENST00000327925	ensembl	human	known	70_37	silent	SNP	0.000	A
CCDC168	643677	genome.wustl.edu	37	13	103381996	103381996	+	Frame_Shift_Del	DEL	A	A	-	rs74709711|rs397851855		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr13:103381996delA	ENST00000322527.2	-	1	7163	c.7164delT	c.(7162-7164)tttfs	p.F2388fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2388																	GTACACAGGCAAAAAAAAAGG	0.408																																																	0										28,1990		2,24,983	94.0	105.0	101.0			4.3	1.0	13	dbSNP_126	104	35,4075		2,31,2022	no	frameshift	CCDC168	NM_001146197.1		4,55,3005	A1A1,A1R,RR		0.8516,1.3875,1.0281			103381996	63,6065	692	1591	2283	SO:0001589	frameshift_variant	643677				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7164delT	13.37:g.103381996delA	ENSP00000320232:p.Phe2388fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N800	Frame_Shift_Del	DEL	NULL	p.F2388fs	ENST00000322527.2	37	c.7164		13																																																																																			CCDC168	-	NULL		0.408	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		A	NM_001146197		103381996	-1	no_errors	ENST00000322527	ensembl	human	known	70_37	frame_shift_del	DEL	0.998	-
CCR1	1230	genome.wustl.edu	37	3	46244879	46244879	+	Missense_Mutation	SNP	C	C	T	rs201235369		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:46244879C>T	ENST00000296140.3	-	2	1051	c.926G>A	c.(925-927)cGg>cAg	p.R309Q	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	309					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CAGGTACTTCCGGAACCTCTC	0.582																																																	0													92.0	79.0	84.0					3																	46244879		2203	4300	6503	SO:0001583	missense	1230				CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.926G>A	3.37:g.46244879C>T	ENSP00000296140:p.Arg309Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VA9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR5,prints_P2_purnocptor,prints_NPY_rcpt,prints_ATII_rcpt	p.R309Q	ENST00000296140.3	37	c.926	CCDS2737.1	3	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629290	0.28978	.	.	ENSG00000163823	ENST00000296140	T	0.57273	0.41	5.41	0.3	0.15776	.	0.493976	0.19160	N	0.121220	T	0.36386	0.0965	L	0.39326	1.205	0.39492	D	0.968065	B	0.31227	0.314	B	0.24394	0.053	T	0.14200	-1.0481	10	0.52906	T	0.07	.	7.2574	0.26183	0.0:0.6185:0.1137:0.2678	.	309	P32246	CCR1_HUMAN	Q	309	ENSP00000296140:R309Q	ENSP00000296140:R309Q	R	-	2	0	CCR1	46219883	1.000000	0.71417	0.919000	0.36401	0.066000	0.16364	2.008000	0.40893	0.057000	0.16193	0.561000	0.74099	CGG	CCR1	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_NPY_rcpt		0.582	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR1	HGNC	protein_coding	OTTHUMT00000257325.2	C	NM_001295		46244879	-1	no_errors	ENST00000296140	ensembl	human	known	70_37	missense	SNP	1.000	T
CD14	929	genome.wustl.edu	37	5	140011944	140011944	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:140011944C>T	ENST00000302014.6	-	2	1254	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	CD14_ENST00000401743.2_Missense_Mutation_p.E209K	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	209					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTCCGCGTTCGCCCAGTCCA	0.622																																																	0													56.0	61.0	59.0					5																	140011944		2203	4300	6503	SO:0001583	missense	929				CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.625G>A	5.37:g.140011944C>T	ENSP00000304236:p.Glu209Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pirsf_Monocyte_diff_Ag_CD14	p.E209K	ENST00000302014.6	37	c.625	CCDS4232.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.123036	0.94429	.	.	ENSG00000170458	ENST00000302014;ENST00000401743;ENST00000498971	D;D;T	0.90788	-2.73;-2.73;1.55	5.74	4.88	0.63580	.	0.218964	0.31589	N	0.007387	D	0.93559	0.7944	M	0.76574	2.34	0.33338	D	0.569458	D	0.76494	0.999	P	0.61658	0.892	D	0.95715	0.8761	10	0.72032	D	0.01	-16.4211	10.7107	0.45982	0.0:0.9128:0.0:0.0872	.	209	P08571	CD14_HUMAN	K	209	ENSP00000304236:E209K;ENSP00000385519:E209K;ENSP00000426543:E209K	ENSP00000304236:E209K	E	-	1	0	CD14	139992128	0.595000	0.26857	0.983000	0.44433	0.998000	0.95712	1.825000	0.39081	1.440000	0.47531	0.655000	0.94253	GAA	CD14	-	pirsf_Monocyte_diff_Ag_CD14		0.622	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD14	HGNC	protein_coding	OTTHUMT00000251681.2	C	NM_000591		140011944	-1	no_errors	ENST00000302014	ensembl	human	known	70_37	missense	SNP	0.701	T
CHD6	84181	genome.wustl.edu	37	20	40044128	40044128	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:40044128C>T	ENST00000373233.3	-	34	6814	c.6637G>A	c.(6637-6639)Ggg>Agg	p.G2213R	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2213					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GCTGACTCCCCATGCCAGCCA	0.602																																																	0													29.0	27.0	28.0					20																	40044128		2203	4300	6503	SO:0001583	missense	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6637G>A	20.37:g.40044128C>T	ENSP00000362330:p.Gly2213Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G2213R	ENST00000373233.3	37	c.6637	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989885	0.74589	.	.	ENSG00000124177	ENST00000373233	D	0.85339	-1.97	6.07	6.07	0.98685	.	0.097322	0.45606	D	0.000357	D	0.89357	0.6692	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88958	0.3391	10	0.62326	D	0.03	-23.4767	11.4063	0.49900	0.0:0.9188:0.0:0.0812	.	2213	Q8TD26	CHD6_HUMAN	R	2213	ENSP00000362330:G2213R	ENSP00000362330:G2213R	G	-	1	0	CHD6	39477542	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.739000	0.74827	2.890000	0.99128	0.650000	0.86243	GGG	CHD6	-	NULL		0.602	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	C			40044128	-1	no_errors	ENST00000373233	ensembl	human	known	70_37	missense	SNP	1.000	T
CHD9	80205	genome.wustl.edu	37	16	53331007	53331007	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:53331007G>C	ENST00000398510.3	+	29	5737	c.5650G>C	c.(5650-5652)Gaa>Caa	p.E1884Q	CHD9_ENST00000447540.1_Missense_Mutation_p.E1884Q|CHD9_ENST00000564845.1_Missense_Mutation_p.E1884Q|CHD9_ENST00000566029.1_Missense_Mutation_p.E1884Q			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1884					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TGATAGTTTGGAAAAATATTT	0.378																																																	0													167.0	165.0	166.0					16																	53331007		1831	4098	5929	SO:0001583	missense	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5650G>C	16.37:g.53331007G>C	ENSP00000381522:p.Glu1884Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1884Q	ENST00000398510.3	37	c.5650		16	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196477	0.58126	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.87650	-2.28;-2.28	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000016	D	0.89220	0.6653	L	0.55103	1.725	0.36982	D	0.894369	B;B;B;B	0.32324	0.075;0.364;0.075;0.123	B;B;B;B	0.44044	0.026;0.439;0.026;0.057	D	0.90519	0.4487	10	0.51188	T	0.08	-12.8165	18.6896	0.91578	0.0:0.0:1.0:0.0	.	252;1884;1884;1884	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	Q	1884;1884;252	ENSP00000396345:E1884Q;ENSP00000381522:E1884Q	ENSP00000381522:E1884Q	E	+	1	0	CHD9	51888508	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.038000	0.70964	2.421000	0.82119	0.484000	0.47621	GAA	CHD9	-	NULL		0.378	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	G	NM_025134		53331007	+1	no_errors	ENST00000398510	ensembl	human	known	70_37	missense	SNP	1.000	C
CHIA	27159	genome.wustl.edu	37	1	111860363	111860363	+	Missense_Mutation	SNP	A	A	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:111860363A>C	ENST00000369740.1	+	7	644	c.541A>C	c.(541-543)Act>Cct	p.T181P	CHIA_ENST00000343320.6_Missense_Mutation_p.T181P|CHIA_ENST00000451398.2_Missense_Mutation_p.T20P|CHIA_ENST00000353665.6_Missense_Mutation_p.T20P|CHIA_ENST00000483391.1_Missense_Mutation_p.T20P|CHIA_ENST00000430615.1_Missense_Mutation_p.T73P|RP5-1125M8.2_ENST00000426321.1_RNA	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	181					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		GCTGATGGTCACTGCTGCAGT	0.483																																																	0													99.0	84.0	89.0					1																	111860363		2203	4300	6503	SO:0001583	missense	27159			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.541A>C	1.37:g.111860363A>C	ENSP00000358755:p.Thr181Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.T181P	ENST00000369740.1	37	c.541	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	A	18.02	3.530110	0.64860	.	.	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94;2.94;2.94;2.94	4.22	4.22	0.49857	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	U	0.000012	T	0.38480	0.1042	H	0.97962	4.115	0.47065	D	0.999306	D	0.76494	0.999	D	0.78314	0.991	T	0.59247	-0.7490	10	0.87932	D	0	-27.9935	11.5544	0.50739	1.0:0.0:0.0:0.0	.	181	Q9BZP6	CHIA_HUMAN	P	125;20;181;181;20;20;20;73	ENSP00000387671:T125P;ENSP00000436946:T20P;ENSP00000358755:T181P;ENSP00000341828:T181P;ENSP00000390476:T20P;ENSP00000338970:T20P;ENSP00000433309:T20P;ENSP00000391132:T73P	ENSP00000341828:T181P	T	+	1	0	CHIA	111661886	1.000000	0.71417	0.976000	0.42696	0.944000	0.59088	2.680000	0.46918	1.680000	0.50976	0.460000	0.39030	ACT	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II		0.483	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1	A			111860363	+1	no_errors	ENST00000343320	ensembl	human	known	70_37	missense	SNP	1.000	C
CKAP2L	150468	genome.wustl.edu	37	2	113498516	113498516	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:113498516C>T	ENST00000302450.6	-	8	1969	c.1891G>A	c.(1891-1893)Gaa>Aaa	p.E631K	CKAP2L_ENST00000541405.1_Missense_Mutation_p.E466K|NT5DC4_ENST00000327581.4_Intron	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	631						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						TTCACAGATTCCATCTTCTTG	0.418																																																	0													226.0	213.0	217.0					2																	113498516		2203	4300	6503	SO:0001583	missense	150468			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1891G>A	2.37:g.113498516C>T	ENSP00000305204:p.Glu631Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.E631K	ENST00000302450.6	37	c.1891	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689122	0.29962	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.22539	1.95;1.95	4.9	4.02	0.46733	.	1.993500	0.02143	N	0.057349	T	0.30854	0.0778	L	0.47016	1.485	0.09310	N	1	P;P	0.44139	0.728;0.827	B;P	0.49192	0.346;0.602	T	0.14783	-1.0460	10	0.32370	T	0.25	-12.983	8.4938	0.33117	0.0:0.8977:0.0:0.1023	.	220;631	Q8IYA6-2;Q8IYA6	.;CKP2L_HUMAN	K	466;631	ENSP00000438763:E466K;ENSP00000305204:E631K	ENSP00000305204:E631K	E	-	1	0	CKAP2L	113214987	0.118000	0.22208	0.186000	0.23195	0.227000	0.25037	1.844000	0.39269	2.714000	0.92807	0.655000	0.94253	GAA	CKAP2L	-	NULL		0.418	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	C	NM_152515		113498516	-1	no_errors	ENST00000302450	ensembl	human	known	70_37	missense	SNP	0.063	T
CKAP2L	150468	genome.wustl.edu	37	2	113498523	113498523	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:113498523C>T	ENST00000302450.6	-	8	1962	c.1884G>A	c.(1882-1884)aaG>aaA	p.K628K	CKAP2L_ENST00000541405.1_Silent_p.K463K|NT5DC4_ENST00000327581.4_Intron	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	628						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						ATTCCATCTTCTTGGCCAGCT	0.423																																																	0													207.0	195.0	199.0					2																	113498523		2203	4300	6503	SO:0001819	synonymous_variant	150468			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1884G>A	2.37:g.113498523C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Silent	SNP	NULL	p.K628	ENST00000302450.6	37	c.1884	CCDS2100.1	2																																																																																			CKAP2L	-	NULL		0.423	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	C	NM_152515		113498523	-1	no_errors	ENST00000302450	ensembl	human	known	70_37	silent	SNP	0.000	T
CNFN	84518	genome.wustl.edu	37	19	42891379	42891379	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:42891379C>G	ENST00000222032.5	-	4	314	c.265G>C	c.(265-267)Gac>Cac	p.D89H	CNFN_ENST00000597255.1_Missense_Mutation_p.D89H	NM_032488.3	NP_115877.2	Q9BYD5	CNFN_HUMAN	cornifelin	89					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				lung(1)|prostate(1)	2		Prostate(69;0.00899)				GCCGCCCAGTCGTGCCCGACG	0.677																																																	0													28.0	35.0	32.0					19																	42891379		2201	4298	6499	SO:0001583	missense	84518			AB049591	CCDS12606.1	19q13.31	2006-01-11				ENSG00000105427			30183	protein-coding gene	gene with protein product		611764					Standard	NM_032488		Approved	PLAC8L2	uc002otp.4	Q9BYD5		ENST00000222032.5:c.265G>C	19.37:g.42891379C>G	ENSP00000222032:p.Asp89His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R569	Missense_Mutation	SNP	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich	p.D89H	ENST00000222032.5	37	c.265	CCDS12606.1	19	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900601	0.72754	.	.	ENSG00000105427	ENST00000222032	.	.	.	4.49	3.45	0.39498	.	0.000000	0.85682	D	0.000000	T	0.80093	0.4560	M	0.92317	3.295	0.58432	D	0.99999	D	0.71674	0.998	D	0.63033	0.91	D	0.83450	0.0048	9	0.87932	D	0	-31.3634	10.2491	0.43358	0.0:0.9026:0.0:0.0974	.	89	Q9BYD5	CNFN_HUMAN	H	89	.	ENSP00000222032:D89H	D	-	1	0	CNFN	47583219	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	5.499000	0.66937	1.206000	0.43276	0.545000	0.68477	GAC	CNFN	-	pfam_Uncharacterised_Cys-rich,tigrfam_Uncharacterised_Cys-rich		0.677	CNFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNFN	HGNC	protein_coding	OTTHUMT00000463859.1	C	NM_032488		42891379	-1	no_errors	ENST00000222032	ensembl	human	known	70_37	missense	SNP	1.000	G
CORO7	79585	genome.wustl.edu	37	16	4415047	4415047	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:4415047C>G	ENST00000251166.4	-	11	1000	c.855G>C	c.(853-855)ctG>ctC	p.L285L	CORO7_ENST00000537233.2_Silent_p.L267L|CORO7_ENST00000539968.1_Silent_p.L65L|CORO7-PAM16_ENST00000572467.1_Silent_p.L285L|CORO7_ENST00000574025.1_Silent_p.L200L|CORO7_ENST00000423908.2_Silent_p.L117L	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	285					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						CGTAACAGTACAGCTGCCTCT	0.662																																																	0													35.0	33.0	33.0					16																	4415047		2192	4295	6487	SO:0001819	synonymous_variant	100529144			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.855G>C	16.37:g.4415047C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFD6|B4DL18|I3L416|Q17RK4	Silent	SNP	pfam_DUF1900,pfam_Protein_transpt,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L285	ENST00000251166.4	37	c.855	CCDS10513.1	16																																																																																			CORO7-PAM16	-	pfam_DUF1900		0.662	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	HGNC	protein_coding	OTTHUMT00000251628.2	C	NM_024535		4415047	-1	no_errors	ENST00000572467	ensembl	human	known	70_37	silent	SNP	0.963	G
COG4	25839	genome.wustl.edu	37	16	70530299	70530299	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:70530299G>A	ENST00000323786.5	-	12	1538	c.1517C>T	c.(1516-1518)cCt>cTt	p.P506L		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	502					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GGTGGTGGCAGGAAAGCCCAT	0.552																																																	0													111.0	88.0	96.0					16																	70530299		2198	4300	6498	SO:0001583	missense	25839			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1517C>T	16.37:g.70530299G>A	ENSP00000315775:p.Pro506Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.P506L	ENST00000323786.5	37	c.1517	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367303	0.82463	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000539961	T	0.54071	0.59	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	M	0.75777	2.31	0.80722	D	1	D;D;D	0.55800	0.973;0.973;0.973	P;P;P	0.55871	0.729;0.786;0.786	T	0.71958	-0.4435	10	0.87932	D	0	-10.6873	20.5792	0.99380	0.0:0.0:1.0:0.0	.	412;501;502	Q8N8L9;Q6PIW8;Q9H9E3	.;.;COG4_HUMAN	L	506;502;164	ENSP00000315775:P506L	ENSP00000315775:P506L	P	-	2	0	COG4	69087800	1.000000	0.71417	0.974000	0.42286	0.352000	0.29268	9.623000	0.98386	2.873000	0.98535	0.561000	0.74099	CCT	COG4	-	NULL		0.552	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3	G			70530299	-1	no_errors	ENST00000323786	ensembl	human	known	70_37	missense	SNP	1.000	A
CRHR1	1394	genome.wustl.edu	37	17	43907534	43907534	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:43907534T>C	ENST00000398285.3	+	7	596	c.596T>C	c.(595-597)tTc>tCc	p.F199S	CRHR1_ENST00000339069.5_Missense_Mutation_p.F69S|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000314537.5_Missense_Mutation_p.F170S|CRHR1_ENST00000352855.5_Missense_Mutation_p.F130S|CRHR1_ENST00000577353.1_Missense_Mutation_p.F170S	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	199					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GCCACCTGGTTCGTGGTCCAG	0.627																																					Ovarian(110;57 1568 10207 38216 49865)												0													95.0	98.0	97.0					17																	43907534		2185	4269	6454	SO:0001583	missense	1394			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.596T>C	17.37:g.43907534T>C	ENSP00000381333:p.Phe199Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF1_rcpt,prints_GPCR_2_diuretic_rcpt	p.F199S	ENST00000398285.3	37	c.596	CCDS45712.1	17	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505972	0.85282	.	.	ENSG00000120088	ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.52	5.52	0.82312	GPCR, family 2-like (1);	0.090459	0.85682	D	0.000000	T	0.66567	0.2802	M	0.89163	3.01	0.80722	D	1	P;P;P;P;P;P	0.49447	0.83;0.924;0.494;0.661;0.907;0.83	P;P;B;P;P;P	0.52823	0.586;0.71;0.371;0.497;0.586;0.586	T	0.74321	-0.3703	10	0.87932	D	0	.	13.5984	0.62004	0.0:0.0:0.0:1.0	.	170;199;69;69;130;170	P34998-4;P34998;B3TIK8;B4DMR5;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.;.;.	S	69;199;170;170;130	ENSP00000340522:F69S;ENSP00000381333:F199S;ENSP00000326060:F170S;ENSP00000344068:F130S	ENSP00000326060:F170S	F	+	2	0	CRHR1	41263315	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	8.031000	0.88826	2.102000	0.63906	0.459000	0.35465	TTC	CRHR1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.627	CRHR1-001	KNOWN	basic|CCDS	protein_coding	CRHR1	HGNC	protein_coding	OTTHUMT00000441241.3	T			43907534	+1	no_errors	ENST00000398285	ensembl	human	known	70_37	missense	SNP	1.000	C
CSMD2	114784	genome.wustl.edu	37	1	34204807	34204807	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:34204807C>T	ENST00000373381.4	-	15	2478	c.2302G>A	c.(2302-2304)Gag>Aag	p.E768K		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	728	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTGATGGTCTCTGAGCCCTGA	0.602																																																	0													64.0	59.0	61.0					1																	34204807		2203	4300	6503	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2302G>A	1.37:g.34204807C>T	ENSP00000362479:p.Glu768Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E768K	ENST00000373381.4	37	c.2302		1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035327	0.93630	.	.	ENSG00000121904	ENST00000373381	T	0.64618	-0.11	6.17	6.17	0.99709	Complement control module (2);Sushi/SCR/CCP (3);	0.060191	0.64402	D	0.000002	T	0.69663	0.3136	L	0.43646	1.37	0.80722	D	1	P;B	0.37731	0.607;0.362	P;P	0.51945	0.61;0.685	T	0.58973	-0.7541	10	0.20046	T	0.44	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	728;768	Q7Z408;E7EUA6	CSMD2_HUMAN;.	K	768	ENSP00000362479:E768K	ENSP00000241312:E728K	E	-	1	0	CSMD2	33977394	1.000000	0.71417	0.974000	0.42286	0.841000	0.47740	6.107000	0.71517	2.941000	0.99782	0.655000	0.94253	GAG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.602	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		C	NM_052896		34204807	-1	no_errors	ENST00000373381	ensembl	human	known	70_37	missense	SNP	0.998	T
DNM1P51	0	genome.wustl.edu	37	15	84954323	84954323	+	RNA	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:84954323G>A	ENST00000558801.1	-	0	7442									DNM1 pseudogene 51																		CCATCAGTGTGTTCTGGTTCC	0.567																																																	0																																												114817					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84954323G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			CSPG4P5	-	-		0.567	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	G			84954323	-1	no_errors	ENST00000456932	ensembl	human	known	70_37	rna	SNP	1.000	A
CSTF1	1477	genome.wustl.edu	37	20	54974255	54974255	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:54974255C>G	ENST00000217109.4	+	5	1230	c.878C>G	c.(877-879)tCa>tGa	p.S293*	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	293					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			GATGGTGTTTCAAATCGATGC	0.383																																																	0													167.0	145.0	152.0					20																	54974255		2203	4300	6503	SO:0001587	stop_gained	1477				CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.878C>G	20.37:g.54974255C>G	ENSP00000217109:p.Ser293*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5QPD8	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S293*	ENST00000217109.4	37	c.878	CCDS13452.1	20	.	.	.	.	.	.	.	.	.	.	C	40	7.965956	0.98585	.	.	ENSG00000101138	ENST00000415828;ENST00000217109;ENST00000425890;ENST00000452950	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	3.4313	20.0572	0.97657	0.0:1.0:0.0:0.0	.	.	.	.	X	293;293;280;293	.	ENSP00000217109:S293X	S	+	2	0	CSTF1	54407662	1.000000	0.71417	0.946000	0.38457	0.999000	0.98932	7.615000	0.83006	2.826000	0.97356	0.655000	0.94253	TCA	CSTF1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.383	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF1	HGNC	protein_coding	OTTHUMT00000079794.2	C	NM_001033521		54974255	+1	no_errors	ENST00000217109	ensembl	human	known	70_37	nonsense	SNP	1.000	G
CTIF	9811	genome.wustl.edu	37	18	46284630	46284630	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr18:46284630G>C	ENST00000256413.3	+	8	1220	c.925G>C	c.(925-927)Gag>Cag	p.E309Q	CTIF_ENST00000382998.4_Missense_Mutation_p.E309Q	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	309					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGTGGCTTCTGAGCGGCTGCC	0.632																																																	0													49.0	58.0	55.0					18																	46284630		2203	4300	6503	SO:0001583	missense	9811			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.925G>C	18.37:g.46284630G>C	ENSP00000256413:p.Glu309Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTR8|Q8IVD5	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E309Q	ENST00000256413.3	37	c.925	CCDS11935.1	18	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267846	0.40095	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.47528	0.84;0.84	5.51	4.64	0.57946	.	0.454661	0.22727	N	0.056364	T	0.38161	0.1030	L	0.38175	1.15	0.37309	D	0.909042	B;B	0.26258	0.145;0.09	B;B	0.27380	0.079;0.036	T	0.33163	-0.9879	10	0.27785	T	0.31	-20.3236	12.2877	0.54800	0.0779:0.0:0.9221:0.0	.	309;309	O43310-2;O43310	.;CTIF_HUMAN	Q	309;309;261	ENSP00000256413:E309Q;ENSP00000372459:E309Q	ENSP00000256413:E309Q	E	+	1	0	CTIF	44538628	1.000000	0.71417	0.019000	0.16419	0.963000	0.63663	5.472000	0.66768	1.325000	0.45301	0.561000	0.74099	GAG	CTIF	-	NULL		0.632	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTIF	HGNC	protein_coding	OTTHUMT00000255907.1	G	NM_014772		46284630	+1	no_errors	ENST00000382998	ensembl	human	known	70_37	missense	SNP	0.853	C
CTDP1	9150	genome.wustl.edu	37	18	77474779	77474779	+	Missense_Mutation	SNP	G	G	A	rs377684676		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr18:77474779G>A	ENST00000299543.7	+	8	1466	c.1319G>A	c.(1318-1320)cGg>cAg	p.R440Q	CTDP1_ENST00000075430.7_Missense_Mutation_p.R440Q	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	440					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CCGGGACAGCGGCCTGCCCAG	0.701																																																	0								G	GLN/ARG,GLN/ARG,GLN/ARG	1,4335		0,1,2167	9.0	11.0	10.0		1319,1319,962	-0.5	0.0	18		10	0,8500		0,0,4250	no	missense,missense,missense	CTDP1	NM_048368.3,NM_004715.4,NM_001202504.1	43,43,43	0,1,6417	AA,AG,GG		0.0,0.0231,0.0078	benign,benign,benign	440/868,440/962,321/843	77474779	1,12835	2168	4250	6418	SO:0001583	missense	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.1319G>A	18.37:g.77474779G>A	ENSP00000299543:p.Arg440Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	pfam_FCP1_C,pfam_NIF,superfamily_HAD-like_dom,superfamily_BRCT_dom,superfamily_Single_hybrid_motif,smart_NIF,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_NIF,tigrfam_FCP1_euk	p.R440Q	ENST00000299543.7	37	c.1319	CCDS12017.1	18	.	.	.	.	.	.	.	.	.	.	G	4.229	0.041348	0.08196	2.31E-4	0.0	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.09073	3.03;3.02	4.42	-0.507	0.11985	.	0.924510	0.09223	N	0.831598	T	0.05914	0.0154	L	0.31926	0.97	0.09310	N	1	B;B;B	0.14012	0.008;0.009;0.005	B;B;B	0.06405	0.001;0.002;0.001	T	0.46911	-0.9157	10	0.09843	T	0.71	-12.5877	8.5847	0.33651	0.7049:0.0:0.2951:0.0	.	321;440;440	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	Q	440	ENSP00000299543:R440Q;ENSP00000075430:R440Q	ENSP00000075430:R440Q	R	+	2	0	CTDP1	75575767	0.001000	0.12720	0.002000	0.10522	0.012000	0.07955	-0.008000	0.12788	-0.029000	0.13827	-0.471000	0.05019	CGG	CTDP1	-	NULL		0.701	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDP1	HGNC	protein_coding	OTTHUMT00000256432.1	G	NM_004715		77474779	+1	no_errors	ENST00000299543	ensembl	human	known	70_37	missense	SNP	0.040	A
CTNNA1	1495	genome.wustl.edu	37	5	138264974	138264974	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:138264974G>C	ENST00000302763.7	+	14	2029	c.1939G>C	c.(1939-1941)Gat>Cat	p.D647H	CTNNA1_ENST00000540387.1_Missense_Mutation_p.D277H|CTNNA1_ENST00000518825.1_Missense_Mutation_p.D647H|CTNNA1_ENST00000355078.5_Missense_Mutation_p.D544H	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	647					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGAGACAGAAGATTTTGATGT	0.572																																																	0													111.0	111.0	111.0					5																	138264974		2203	4300	6503	SO:0001583	missense	1495			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1939G>C	5.37:g.138264974G>C	ENSP00000304669:p.Asp647His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.D647H	ENST00000302763.7	37	c.1939	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521411	0.85600	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.63438	0.2511	L	0.47716	1.5	0.80722	D	1	B;B;D	0.55385	0.02;0.009;0.971	B;B;D	0.67231	0.033;0.012;0.95	T	0.60591	-0.7233	10	0.48119	T	0.1	-22.6849	19.3974	0.94612	0.0:0.0:1.0:0.0	.	647;524;647	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	H	544;647;647;632;647;277	ENSP00000347190:D544H;ENSP00000304669:D647H;ENSP00000427821:D647H;ENSP00000438476:D277H	ENSP00000304669:D647H	D	+	1	0	CTNNA1	138292873	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.901000	0.87382	2.752000	0.94435	0.655000	0.94253	GAT	CTNNA1	-	pfam_Vinculin/catenin		0.572	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	G	NM_001903		138264974	+1	no_errors	ENST00000302763	ensembl	human	known	70_37	missense	SNP	1.000	C
CXorf22	170063	genome.wustl.edu	37	X	35937975	35937975	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:35937975G>T	ENST00000297866.5	+	1	125	c.59G>T	c.(58-60)aGc>aTc	p.S20I		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	20										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CTCGCCATGAGCATCCAAAGG	0.577																																																	0													59.0	44.0	49.0					X																	35937975		2202	4300	6502	SO:0001583	missense	170063			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.59G>T	X.37:g.35937975G>T	ENSP00000297866:p.Ser20Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.S20I	ENST00000297866.5	37	c.59	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	g	6.885	0.532688	0.13127	.	.	ENSG00000165164	ENST00000297866	T	0.14640	2.49	0.951	0.951	0.19579	.	2.819220	0.01189	N	0.007277	T	0.09992	0.0245	N	0.22421	0.69	0.09310	N	1	B	0.33135	0.399	B	0.28709	0.093	T	0.23190	-1.0195	10	0.44086	T	0.13	-25.9675	5.503	0.16838	0.0:0.0:1.0:0.0	.	20	Q6ZTR5	CX022_HUMAN	I	20	ENSP00000297866:S20I	ENSP00000297866:S20I	S	+	2	0	CXorf22	35847896	0.005000	0.15991	0.022000	0.16811	0.096000	0.18686	0.702000	0.25631	0.181000	0.19994	0.183000	0.17082	AGC	CXorf22	-	NULL		0.577	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	G	NM_152632		35937975	+1	no_errors	ENST00000297866	ensembl	human	known	70_37	missense	SNP	0.065	T
CYB5R1	51706	genome.wustl.edu	37	1	202936328	202936328	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:202936328C>T	ENST00000367249.4	-	1	80	c.6G>A	c.(4-6)ggG>ggA	p.G2G	CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	2					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	CCGTCTGGATCCCCATGACGG	0.687																																																	0													41.0	35.0	37.0					1																	202936328		2203	4300	6503	SO:0001819	synonymous_variant	51706			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.6G>A	1.37:g.202936328C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Silent	SNP	pfam_OxRdtase_FAD/NAD-bd,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Phe_hydroxylase	p.G2	ENST00000367249.4	37	c.6	CCDS1431.1	1																																																																																			CYB5R1	-	NULL		0.687	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	C	NM_016243		202936328	-1	no_errors	ENST00000367249	ensembl	human	known	70_37	silent	SNP	0.787	T
CYP2A6	1548	genome.wustl.edu	37	19	41351907	41351907	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:41351907G>C	ENST00000301141.5	-	6	947	c.927C>G	c.(925-927)acC>acG	p.T309T	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	309					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CATAGCGCAGGGTGGTGCTGA	0.572																																																	0													98.0	85.0	90.0					19																	41351907		2203	4300	6503	SO:0001819	synonymous_variant	1548			AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.927C>G	19.37:g.41351907G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.T309	ENST00000301141.5	37	c.927	CCDS12568.1	19																																																																																			CYP2A6	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450		0.572	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A6	HGNC	protein_coding	OTTHUMT00000463259.1	G	NM_000762		41351907	-1	no_errors	ENST00000301141	ensembl	human	known	70_37	silent	SNP	0.975	C
DCAF4L2	138009	genome.wustl.edu	37	8	88885439	88885439	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:88885439C>T	ENST00000319675.3	-	1	857	c.761G>A	c.(760-762)cGc>cAc	p.R254H		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	254										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						ATTTCCACAGCGCAGATCAAT	0.507																																																	0													121.0	114.0	116.0					8																	88885439		2203	4300	6503	SO:0001583	missense	138009			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.761G>A	8.37:g.88885439C>T	ENSP00000316496:p.Arg254His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R254H	ENST00000319675.3	37	c.761	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	C	14.05	2.421141	0.42918	.	.	ENSG00000176566	ENST00000319675	T	0.23348	1.91	1.92	-0.607	0.11615	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.29158	0.0725	M	0.68593	2.085	0.34258	D	0.679575	D	0.56521	0.976	P	0.51550	0.673	T	0.42666	-0.9438	10	0.66056	D	0.02	.	4.0648	0.09856	0.0:0.5649:0.2491:0.186	.	254	Q8NA75	DC4L2_HUMAN	H	254	ENSP00000316496:R254H	ENSP00000316496:R254H	R	-	2	0	DCAF4L2	88954555	1.000000	0.71417	0.126000	0.21872	0.467000	0.32768	2.541000	0.45735	0.750000	0.32877	0.467000	0.42956	CGC	DCAF4L2	-	superfamily_WD40_repeat_dom		0.507	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	C	NM_152418		88885439	-1	no_errors	ENST00000319675	ensembl	human	known	70_37	missense	SNP	0.995	T
DCUN1D3	123879	genome.wustl.edu	37	16	20873536	20873536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:20873536C>A	ENST00000324344.4	-	2	610	c.325G>T	c.(325-327)Gaa>Taa	p.E109*	DCUN1D3_ENST00000563934.1_Nonsense_Mutation_p.E109*|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	109	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		TCCATGCCTTCCTCCAAAATT	0.507																																																	0													161.0	133.0	143.0					16																	20873536		2201	4300	6501	SO:0001587	stop_gained	123879			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.325G>T	16.37:g.20873536C>A	ENSP00000319482:p.Glu109*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVY4	Nonsense_Mutation	SNP	pfam_PONY_dom	p.E109*	ENST00000324344.4	37	c.325	CCDS10592.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.215401	0.97385	.	.	ENSG00000188215	ENST00000324344	.	.	.	6.03	6.03	0.97812	.	0.043583	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-27.4729	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	109	.	ENSP00000319482:E109X	E	-	1	0	DCUN1D3	20781037	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.861000	0.98227	0.655000	0.94253	GAA	DCUN1D3	-	NULL		0.507	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D3	HGNC	protein_coding	OTTHUMT00000254415.2	C	NM_173475		20873536	-1	no_errors	ENST00000324344	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DDX46	9879	genome.wustl.edu	37	5	134152222	134152222	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:134152222G>A	ENST00000354283.4	+	19	2674	c.2539G>A	c.(2539-2541)Gag>Aag	p.E847K	DDX46_ENST00000452510.2_Missense_Mutation_p.E847K			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	847					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGAAATGCTGAGAAATTAGA	0.393																																					Colon(13;391 453 4901 21675 24897)												0													56.0	59.0	58.0					5																	134152222		2203	4300	6503	SO:0001583	missense	9879				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2539G>A	5.37:g.134152222G>A	ENSP00000346236:p.Glu847Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E847K	ENST00000354283.4	37	c.2539	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605824	0.46527	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.25250	1.81;1.81	5.93	5.93	0.95920	.	0.047005	0.85682	D	0.000000	T	0.19967	0.0480	N	0.24115	0.695	0.58432	D	0.999998	B	0.25850	0.136	B	0.24006	0.05	T	0.07868	-1.0750	10	0.11794	T	0.64	-21.4903	20.3397	0.98756	0.0:0.0:1.0:0.0	.	847	Q7L014	DDX46_HUMAN	K	847	ENSP00000416534:E847K;ENSP00000346236:E847K	ENSP00000346236:E847K	E	+	1	0	DDX46	134180121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.964000	0.70379	2.803000	0.96430	0.585000	0.79938	GAG	DDX46	-	NULL		0.393	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	HGNC	protein_coding	OTTHUMT00000371584.1	G	NM_014829		134152222	+1	no_errors	ENST00000452510	ensembl	human	known	70_37	missense	SNP	1.000	A
DENND4C	55667	genome.wustl.edu	37	9	19352601	19352601	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:19352601C>T	ENST00000380432.2	+	21	3897	c.3864C>T	c.(3862-3864)ttC>ttT	p.F1288F	DENND4C_ENST00000434457.2_Silent_p.F1573F|DENND4C_ENST00000602925.1_Silent_p.F1524F			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1288					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CTTGTCCATTCTGTAAAAGCA	0.378																																																	0													103.0	99.0	100.0					9																	19352601		2203	4300	6503	SO:0001819	synonymous_variant	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.3864C>T	9.37:g.19352601C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F1288	ENST00000380432.2	37	c.3864		9																																																																																			DENND4C	-	NULL		0.378	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		C	NM_017925		19352601	+1	no_errors	ENST00000380437	ensembl	human	known	70_37	silent	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32563427	32563427	+	Missense_Mutation	SNP	G	G	C	rs128626232		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:32563427G>C	ENST00000357033.4	-	17	2223	c.2017C>G	c.(2017-2019)Cag>Gag	p.Q673E	DMD_ENST00000378677.2_Missense_Mutation_p.Q669E|DMD_ENST00000288447.4_Missense_Mutation_p.Q665E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	673					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGTGATGGCTGAGTGGTGGTG	0.458																																																	0			GRCh37	CM950339	DMD	M	rs128626232						187.0	136.0	153.0					X																	32563427		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2017C>G	X.37:g.32563427G>C	ENSP00000354923:p.Gln673Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q673E	ENST00000357033.4	37	c.2017	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081751	0.76528	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.72725	0.21;0.21;-0.68	5.64	5.64	0.86602	.	0.000000	0.32444	U	0.006088	T	0.82245	0.4995	M	0.67953	2.075	0.80722	D	1	D;P;D;P	0.60160	0.982;0.954;0.987;0.924	D;D;P;P	0.67900	0.952;0.954;0.713;0.9	T	0.79827	-0.1639	10	0.30854	T	0.27	.	18.6837	0.91556	0.0:0.0:1.0:0.0	.	665;665;673;669	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	E	665;669;673;673;550;665	ENSP00000367948:Q669E;ENSP00000354923:Q673E;ENSP00000288447:Q665E	ENSP00000288447:Q665E	Q	-	1	0	DMD	32473348	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.394000	0.90185	2.356000	0.79943	0.506000	0.49869	CAG	DMD	-	pirsf_Dystrophin/utrophin		0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	G	NM_004006		32563427	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	missense	SNP	1.000	C
DRP2	1821	genome.wustl.edu	37	X	100503170	100503170	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:100503170C>T	ENST00000395209.3	+	13	1872	c.1345C>T	c.(1345-1347)Cac>Tac	p.H449Y	DRP2_ENST00000402866.1_Missense_Mutation_p.H449Y|DRP2_ENST00000538510.1_Missense_Mutation_p.H449Y|DRP2_ENST00000541709.1_Missense_Mutation_p.H371Y	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	449					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGAGGTCATTCACTGCCTGAC	0.502																																																	0													256.0	207.0	223.0					X																	100503170		2203	4300	6503	SO:0001583	missense	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1345C>T	X.37:g.100503170C>T	ENSP00000378635:p.His449Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.H449Y	ENST00000395209.3	37	c.1345	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549430	0.65311	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.28	5.28	0.74379	EF-hand domain, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.65481	0.2695	L	0.44542	1.39	0.46774	D	0.999198	P	0.43607	0.812	P	0.48368	0.575	T	0.68416	-0.5414	10	0.59425	D	0.04	-15.9852	18.0619	0.89380	0.0:1.0:0.0:0.0	.	449	Q13474	DRP2_HUMAN	Y	449;449;371;449	ENSP00000385038:H449Y;ENSP00000378635:H449Y;ENSP00000444752:H371Y;ENSP00000441051:H449Y	ENSP00000378635:H449Y	H	+	1	0	DRP2	100389826	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.835000	0.62781	2.200000	0.70718	0.513000	0.50165	CAC	DRP2	-	pfam_EF-hand_dom_typ1,pirsf_Dystrophin-related_2		0.502	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	HGNC	protein_coding	OTTHUMT00000057522.3	C	NM_001939		100503170	+1	no_errors	ENST00000395209	ensembl	human	known	70_37	missense	SNP	1.000	T
DSCAML1	57453	genome.wustl.edu	37	11	117651364	117651364	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:117651364C>T	ENST00000321322.6	-	2	389	c.388G>A	c.(388-390)Gtg>Atg	p.V130M	DSCAML1_ENST00000527706.1_Intron	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	70	Ig-like C2-type 2.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATGTGCGGCACGTCGTAGATG	0.652																																																	0													114.0	116.0	115.0					11																	117651364		2200	4296	6496	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.388G>A	11.37:g.117651364C>T	ENSP00000315465:p.Val130Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V130M	ENST00000321322.6	37	c.388	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613460	0.87359	.	.	ENSG00000177103	ENST00000321322	T	0.62105	0.05	5.1	5.1	0.69264	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78761	0.4334	M	0.65677	2.01	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.80674	-0.1277	9	0.72032	D	0.01	.	18.9124	0.92491	0.0:1.0:0.0:0.0	.	70	Q8TD84	DSCL1_HUMAN	M	130	ENSP00000315465:V130M	ENSP00000315465:V130M	V	-	1	0	DSCAML1	117156574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.880000	0.69698	2.536000	0.85505	0.563000	0.77884	GTG	DSCAML1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.652	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	C	NM_020693		117651364	-1	no_errors	ENST00000321322	ensembl	human	known	70_37	missense	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56328484	56328484	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:56328484C>T	ENST00000361203.3	-	96	21885	c.21878G>A	c.(21877-21879)cGa>cAa	p.R7293Q	DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.R5289Q|DST_ENST00000370788.2_Missense_Mutation_p.R5207Q|DST_ENST00000370769.4_Missense_Mutation_p.R7404Q|DST_ENST00000370754.5_Missense_Mutation_p.R7582Q|DST_ENST00000244364.6_Missense_Mutation_p.R4966Q|DST_ENST00000446842.2_Missense_Mutation_p.R7078Q			Q03001	DYST_HUMAN	dystonin	7402	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCCTCGGGGTCGGAAAGCAGC	0.567																																																	0													130.0	138.0	135.0					6																	56328484		2006	4156	6162	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21878G>A	6.37:g.56328484C>T	ENSP00000354508:p.Arg7293Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.R7582Q	ENST00000361203.3	37	c.22745		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.268261|4.268261	0.80469|0.80469	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000523292|ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.|T;T;T;T;T;T;T	.|0.66995	.|1.04;-0.23;-0.24;-0.12;0.71;-0.11;-0.18	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.000000	.|0.45606	.|D	.|0.000354	T|T	0.80924|0.80924	0.4717|0.4717	M|M	0.78801|0.78801	2.425|2.425	.|.	.|.	.|.	.|D;P;D;D;P;D;D;D	.|0.89917	.|1.0;0.513;1.0;1.0;0.769;0.997;0.999;0.996	.|D;B;D;D;B;D;D;P	.|0.80764	.|0.994;0.093;0.99;0.994;0.1;0.968;0.99;0.49	T|T	0.81484|0.81484	-0.0912|-0.0912	4|9	.|0.66056	.|D	.|0.02	.|.	20.1013|20.1013	0.97878|0.97878	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|5289;7404;7582;7402;4966;90;53;5207	.|Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8;Q9BSP9;Q86T18;E7ERU0	.|.;.;.;DYST_HUMAN;.;.;.;.	N|Q	91|4966;7582;7404;5289;7078;5207;7293	.|ENSP00000244364:R4966Q;ENSP00000359790:R7582Q;ENSP00000359805:R7404Q;ENSP00000400883:R5289Q;ENSP00000393645:R7078Q;ENSP00000359824:R5207Q;ENSP00000354508:R7293Q	.|ENSP00000244364:R4966Q	D|R	-|-	1|2	0|0	DST|DST	56436443|56436443	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	7.750000|7.750000	0.85110|0.85110	2.748000|2.748000	0.94277|0.94277	0.655000|0.655000	0.94253|0.94253	GAC|CGA	DST	-	superfamily_ABC_transptrTM_dom_typ1		0.567	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	C	NM_001723		56328484	-1	no_errors	ENST00000370754	ensembl	human	known	70_37	missense	SNP	1.000	T
DSE	29940	genome.wustl.edu	37	6	116752140	116752140	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:116752140T>C	ENST00000331677.3	+	5	1138	c.694T>C	c.(694-696)Tgg>Cgg	p.W232R	DSE_ENST00000452085.3_Missense_Mutation_p.W232R|DSE_ENST00000359564.2_Missense_Mutation_p.W232R|DSE_ENST00000537543.1_Missense_Mutation_p.W251R			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	232					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		AGCCTACTTATGGACCAAACA	0.443																																																	0													122.0	106.0	111.0					6																	116752140		2203	4300	6503	SO:0001583	missense	29940			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.694T>C	6.37:g.116752140T>C	ENSP00000332151:p.Trp232Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.W251R	ENST00000331677.3	37	c.751	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	T	25.3	4.619722	0.87460	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.39210	-0.9625	10	0.66056	D	0.02	-10.1375	16.4608	0.84044	0.0:0.0:0.0:1.0	.	251;232	B7Z765;Q9UL01	.;DSE_HUMAN	R	232;251;232;232	ENSP00000404049:W232R;ENSP00000441152:W251R;ENSP00000332151:W232R;ENSP00000352567:W232R	ENSP00000332151:W232R	W	+	1	0	DSE	116858833	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.552000	0.82192	2.288000	0.76882	0.533000	0.62120	TGG	DSE	-	superfamily_Chondroitin_lyas		0.443	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	T	NM_013352		116752140	+1	no_errors	ENST00000537543	ensembl	human	known	70_37	missense	SNP	1.000	C
ECT2L	345930	genome.wustl.edu	37	6	139165616	139165616	+	Silent	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:139165616A>G	ENST00000423192.1	+	6	824	c.663A>G	c.(661-663)agA>agG	p.R221R	ECT2L_ENST00000367682.2_Silent_p.R221R|ECT2L_ENST00000541398.1_Silent_p.R152R			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	221							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						TAAAGCCCAGATGCCAACCAC	0.502			"""N, Splice, Mis"""		ETP ALL																																			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	0													98.0	97.0	97.0					6																	139165616		1904	4127	6031	SO:0001819	synonymous_variant	345930				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.663A>G	6.37:g.139165616A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	pfam_DH-domain,pfam_F-box_dom_cyclin-like,superfamily_DH-domain,superfamily_F-box_dom_cyclin-like,smart_DH-domain,pfscan_DH-domain	p.R221	ENST00000423192.1	37	c.663	CCDS43508.1	6																																																																																			ECT2L	-	NULL		0.502	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECT2L	HGNC	protein_coding	OTTHUMT00000042441.3	A	NM_001077706		139165616	+1	no_errors	ENST00000367682	ensembl	human	known	70_37	silent	SNP	0.003	G
ELN	2006	genome.wustl.edu	37	7	73471043	73471043	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:73471043G>T	ENST00000252034.7	+	21	1756	c.1357G>T	c.(1357-1359)Gga>Tga	p.G453*	ELN_ENST00000458204.1_Splice_Site_p.G443*|ELN_ENST00000357036.5_Splice_Site_p.G458*|ELN_ENST00000380584.4_Splice_Site_p.G439W|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Splice_Site_p.G448W|ELN_ENST00000445912.1_Splice_Site_p.G453*|ELN_ENST00000320492.7_Splice_Site_p.G391W|ELN_ENST00000358929.4_Splice_Site_p.G453C|ELN_ENST00000429192.1_Splice_Site_p.G458W|ELN_ENST00000380553.4_Splice_Site_p.G336W|ELN_ENST00000380575.4_Splice_Site_p.G443W|ELN_ENST00000380562.4_Splice_Site_p.G453*|ELN_ENST00000380576.5_Splice_Site_p.G453W|ELN_ENST00000320399.6_Splice_Site_p.G453*	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TGCCAAGTACGGTAAGTGCCC	0.627			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0													42.0	43.0	43.0					7																	73471043		2203	4300	6503	SO:0001630	splice_region_variant	2006				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1357+1G>T	7.37:g.73471043G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Nonsense_Mutation	SNP	prints_Tropoelastin	p.G453*	ENST00000252034.7	37	c.1357	CCDS5562.2	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	24.5|24.5|24.5	4.534749|4.534749|4.534749	0.85812|0.85812|0.85812	.|.|.	.|.|.	ENSG00000049540|ENSG00000049540|ENSG00000049540	ENST00000358929|ENST00000320492;ENST00000414324;ENST00000380575;ENST00000380584;ENST00000429192;ENST00000380553;ENST00000380576|ENST00000445912;ENST00000252034;ENST00000380562;ENST00000458204;ENST00000357036;ENST00000442462;ENST00000320399	T|T;T;T;T;T;T;T|.	0.57273|0.41758|.	0.41|1.0;1.19;1.2;1.31;1.02;0.99;1.01|.	3.91|3.91|3.91	3.91|3.91|3.91	0.45181|0.45181|0.45181	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.43188|0.43188|.	0.1236|0.1236|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|D;D;D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D;D|.	.|0.97110|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	T|T|.	0.47598|0.47598|.	-0.9105|-0.9105|.	5|7|.	0.54805|0.87932|0.12766	T|D|T	0.06|0|0.61	.|.|.	11.7797|11.7797|11.7797	0.52006|0.52006|0.52006	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|391;448;443;458;453;336;383;439|.	.|G5E950;G3V0G6;P15502-7;P15502-12;P15502-13;P15502-11;B3KRT8;P15502-8|.	.|.;.;.;.;.;.;.;.|.	C|W|X	453|391;448;443;439;458;336;453|453;453;453;443;458;422;453	ENSP00000351807:G453C|ENSP00000315607:G391W;ENSP00000392575:G448W;ENSP00000369949:G443W;ENSP00000369958:G439W;ENSP00000391129:G458W;ENSP00000369926:G336W;ENSP00000369950:G453W|.	ENSP00000351807:G453C|ENSP00000315607:G391W|ENSP00000252034:G453X	G|G|G	+|+|+	1|1|1	0|0|0	ELN|ELN|ELN	73108979|73108979|73108979	0.993000|0.993000|0.993000	0.37304|0.37304|0.37304	0.786000|0.786000|0.786000	0.31890|0.31890|0.31890	0.399000|0.399000|0.399000	0.30720|0.30720|0.30720	2.665000|2.665000|2.665000	0.46791|0.46791|0.46791	2.215000|2.215000|2.215000	0.71742|0.71742|0.71742	0.449000|0.449000|0.449000	0.29647|0.29647|0.29647	GGT|GGG|GGA	ELN	-	NULL		0.627	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000316913.1	G	NM_000501	Nonsense_Mutation	73471043	+1	no_errors	ENST00000320399	ensembl	human	known	70_37	nonsense	SNP	0.935	T
EML6	400954	genome.wustl.edu	37	2	55071220	55071220	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:55071220G>A	ENST00000356458.6	+	7	1404	c.884G>A	c.(883-885)cGc>cAc	p.R295H		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	295						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						AAAGCAGACCGCCTTCTAGCA	0.498																																																	0													132.0	115.0	120.0					2																	55071220		692	1591	2283	SO:0001583	missense	400954				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.884G>A	2.37:g.55071220G>A	ENSP00000348842:p.Arg295His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R295H	ENST00000356458.6	37	c.884	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520534	0.44866	.	.	ENSG00000214595	ENST00000356458	T	0.05649	3.41	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.000000	0.23658	U	0.045858	T	0.06280	0.0162	N	0.17474	0.49	0.52501	D	0.999954	B	0.14438	0.01	B	0.10450	0.005	T	0.46830	-0.9163	10	0.31617	T	0.26	.	19.7959	0.96481	0.0:0.0:1.0:0.0	.	295	Q6ZMW3	EMAL6_HUMAN	H	295	ENSP00000348842:R295H	ENSP00000348842:R295H	R	+	2	0	EML6	54924724	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	3.906000	0.56340	2.689000	0.91719	0.655000	0.94253	CGC	EML6	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.498	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	G	XM_001725002		55071220	+1	no_errors	ENST00000356458	ensembl	human	novel	70_37	missense	SNP	1.000	A
LRRC8E	80131	genome.wustl.edu	37	19	7964601	7964601	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:7964601C>G	ENST00000306708.6	+	3	1295	c.1194C>G	c.(1192-1194)ctC>ctG	p.L398L	AC010336.1_ENST00000539278.1_Missense_Mutation_p.L222F|RN7SL115P_ENST00000392196.5_RNA	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	398					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						AGCTCAATCTCAACCACGAGT	0.617																																																	0													60.0	51.0	54.0					19																	7964601		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.1194C>G	19.37:g.7964601C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Missense_Mutation	SNP	NULL	p.L222F	ENST00000306708.6	37	c.666	CCDS12189.1	19	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482303	0.44147	.	.	ENSG00000214248	ENST00000539278	.	.	.	4.74	-0.373	0.12516	.	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78319	-0.2250	6	0.87932	D	0	.	16.3348	0.83053	0.0:0.3648:0.6352:0.0	.	.	.	.	F	222	.	ENSP00000441047:L222F	L	-	3	2	AC010336.2	7870601	0.753000	0.28349	0.997000	0.53966	0.962000	0.63368	-0.078000	0.11375	-0.089000	0.12484	0.555000	0.69702	TTG	AC010336.1	-	NULL		0.617	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214248	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000461354.1	C	NM_025061		7964601	-1	no_errors	ENST00000539278	ensembl	human	known	70_37	missense	SNP	1.000	G
TNFSF15	9966	genome.wustl.edu	37	9	117554505	117554508	+	Intron	DEL	ACAC	ACAC	-	rs112858578|rs142936750|rs370583345|rs113508621		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	ACAC	ACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:117554505_117554508delACAC	ENST00000374045.4	-	3	415				AL390240.1_ENST00000408807.1_RNA|TNFSF15_ENST00000374044.1_5'Flank	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						ataTGTGTGTacacacacacacac	0.382																																																	0																																										SO:0001627	intron_variant	0			AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.301+178GTGT>-	9.37:g.117554513_117554516delACAC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	RNA	DEL	-	NULL	ENST00000374045.4	37	NULL	CCDS6809.1	9																																																																																			AL390240.1	-	-		0.382	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221734	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000055424.2	ACAC	NM_005118		117554508	+1	no_errors	ENST00000408807	ensembl	human	novel	70_37	rna	DEL	0.007:0.007:0.010:0.012	-
AC114776.3	0	genome.wustl.edu	37	2	111469825	111469825	+	lincRNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:111469825C>G	ENST00000414159.2	-	0	1721																											AGGACAAACTCAAAGCCCTCC	0.577																																																	0																																												0																															2.37:g.111469825C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414159.2	37	NULL		2																																																																																			AC114776.3	-	-		0.577	AC114776.3-001	KNOWN	basic	lincRNA	ENSG00000235881	Clone_based_vega_gene	lincRNA	OTTHUMT00000331943.2	C			111469825	-1	no_errors	ENST00000414159	ensembl	human	known	70_37	rna	SNP	0.412	G
PWAR6	100506965	genome.wustl.edu	37	15	25277465	25277465	+	lincRNA	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:25277465C>A	ENST00000552334.1	+	0	446				RP11-701H24.3_ENST00000546615.1_lincRNA|RP11-701H24.10_ENST00000552781.1_RNA					Prader Willi/Angelman region RNA 6																		aaaatgccttcagtcctttct	0.433																																																	0																																												0			BC043194, AK096584		15q11.2	2014-03-28	2013-09-11		ENSG00000257151	ENSG00000257151		"""Long non-coding RNAs"""	49129	non-coding RNA	RNA, long non-coding							Standard			Approved	HBT8, PAR-6			OTTHUMG00000170276		15.37:g.25277465C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000552334.1	37	NULL		15																																																																																			RP11-701H24.2	-	-		0.433	PWAR6-001	KNOWN	basic	lincRNA	ENSG00000257151	Clone_based_vega_gene	lincRNA	OTTHUMT00000408286.1	C			25277465	+1	no_errors	ENST00000552334	ensembl	human	known	70_37	rna	SNP	0.000	A
NOS2P1	645740	genome.wustl.edu	37	17	25989944	25989944	+	lincRNA	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:25989944G>A	ENST00000583179.1	-	0	740																											TGGAGCAGATGGGGGTTAATG	0.542																																																	0																																												0																															17.37:g.25989944G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000583179.1	37	NULL		17																																																																																			RP11-19P22.5	-	-		0.542	RP11-19P22.5-001	KNOWN	basic	lincRNA	ENSG00000265788	Clone_based_vega_gene	lincRNA	OTTHUMT00000445273.1	G			25989944	-1	no_errors	ENST00000583179	ensembl	human	known	70_37	rna	SNP	0.000	A
RP11-271K11.5	0	genome.wustl.edu	37	17	29374691	29374691	+	RNA	SNP	G	G	A	rs575048733		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:29374691G>A	ENST00000583112.1	-	0	47																		p.?(1)									TTCTGGAGGAGGAGCTGTAGT	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21288	0.0		0.0	False		,,,				2504	0.0																1	Unknown(1)	central_nervous_system(1)																																										0																															17.37:g.29374691G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000583112.1	37	NULL		17																																																																																			RP11-271K11.5	-	-		0.522	RP11-271K11.5-002	KNOWN	basic	processed_transcript	ENSG00000265798	Clone_based_vega_gene	pseudogene	OTTHUMT00000444574.1	G			29374691	-1	no_errors	ENST00000583112	ensembl	human	known	70_37	rna	SNP	0.119	A
MAP2K7	5609	genome.wustl.edu	37	19	7978326	7978326	+	3'UTR	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:7978326G>A	ENST00000397979.3	+	0	2324				CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000545011.1_3'UTR|MAP2K7_ENST00000397983.3_3'UTR|MAP2K7_ENST00000397981.3_3'UTR|TGFBR3L_ENST00000565886.1_5'Flank	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7						activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						GAGGGGTCCGGAGGGAGTCAG	0.682																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.*1010G>A	19.37:g.7978326G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	RNA	SNP	-	NULL	ENST00000397979.3	37	NULL	CCDS42491.1	19																																																																																			CTD-3193O13.13	-	-		0.682	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	ENSG00000268149	Clone_based_vega_gene	protein_coding	OTTHUMT00000267980.1	G			7978326	-1	no_errors	ENST00000595655	ensembl	human	known	70_37	rna	SNP	0.044	A
FTH1	2495	genome.wustl.edu	37	11	61735921	61735921	+	5'Flank	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:61735921G>A	ENST00000273550.7	-	0	0				FTH1_ENST00000529191.1_5'Flank|FTH1_ENST00000529631.1_5'Flank|FTH1_ENST00000532601.1_5'Flank|FTH1_ENST00000526640.1_5'Flank|AP003733.1_ENST00000601917.1_Missense_Mutation_p.D116N	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1						cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)			NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	AAACGACGTGGATCTAAAGGC	0.592																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794			11.37:g.61735921G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	NULL	p.D116N	ENST00000273550.7	37	c.346	CCDS41655.1	11																																																																																			AP003733.1	-	NULL		0.592	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269089	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000388444.1	G	NM_002032		61735921	+1	no_errors	ENST00000601917	ensembl	human	known	70_37	missense	SNP	0.000	A
DMTN	2039	genome.wustl.edu	37	8	21927809	21927809	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:21927809G>A	ENST00000523266.1	+	8	1030	c.568G>A	c.(568-570)Gac>Aac	p.D190N	DMTN_ENST00000443491.2_Missense_Mutation_p.D165N|DMTN_ENST00000523782.2_Missense_Mutation_p.D165N|DMTN_ENST00000358242.3_Missense_Mutation_p.D190N|DMTN_ENST00000432128.1_Missense_Mutation_p.D190N|DMTN_ENST00000265800.5_Missense_Mutation_p.D190N|DMTN_ENST00000381470.3_Missense_Mutation_p.D190N|DMTN_ENST00000415253.1_Missense_Mutation_p.D190N|DMTN_ENST00000519907.1_Missense_Mutation_p.D190N|DMTN_ENST00000517600.1_Missense_Mutation_p.D150N	NM_001978.2	NP_001969.2	Q08495	DEMA_HUMAN	dematin actin binding protein	190					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|actin filament capping (GO:0051693)|actin filament reorganization (GO:0090527)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cytoskeleton organization (GO:0007010)|erythrocyte development (GO:0048821)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of platelet aggregation (GO:1901731)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of wound healing (GO:0090303)|protein complex assembly (GO:0006461)|protein secretion by platelet (GO:0070560)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)|regulation of lamellipodium assembly (GO:0010591)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection membrane (GO:0031253)|cortical cytoskeleton (GO:0030863)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|protein self-association (GO:0043621)|receptor binding (GO:0005102)|spectrin binding (GO:0030507)										AATCGAAACCGACTACTGGCC	0.592																																																	0													87.0	88.0	87.0					8																	21927809		2203	4300	6503	SO:0001583	missense	2039			U28389	CCDS6020.1, CCDS47820.1, CCDS47821.1	8p21.1	2013-05-03	2013-05-03	2013-05-03	ENSG00000158856	ENSG00000158856			3382	protein-coding gene	gene with protein product		125305	"""erythrocyte membrane protein band 4.9 (dematin)"""	EPB49		8341682, 12011427	Standard	NM_001978		Approved	DMT		Q08495	OTTHUMG00000097087	ENST00000523266.1:c.568G>A	8.37:g.21927809G>A	ENSP00000427866:p.Asp190Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0T5|B3KP70|B3KRH3|E9PEJ0|Q13215|Q9BRE3	Missense_Mutation	SNP	pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin_headpiece,pfscan_Villin_headpiece	p.D190N	ENST00000523266.1	37	c.568	CCDS6020.1	8	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975002	0.92919	.	.	ENSG00000158856	ENST00000381470;ENST00000432128;ENST00000443491;ENST00000517600;ENST00000541895;ENST00000520174;ENST00000517804;ENST00000265800;ENST00000381455;ENST00000517418;ENST00000358242;ENST00000415253;ENST00000523266;ENST00000519907	T;T;T;T;T;T;T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66	4.79	4.79	0.61399	.	0.111045	0.64402	D	0.000012	T	0.45836	0.1362	L	0.39898	1.24	0.54753	D	0.999986	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;0.998;0.994	D;D;D;P;P;P	0.77557	0.981;0.99;0.99;0.746;0.825;0.736	T	0.24621	-1.0155	9	.	.	.	.	15.6961	0.77499	0.0:0.0:1.0:0.0	.	129;150;190;165;165;190	E9PD40;B4DI75;Q08495;B3KRH3;E9PEJ0;Q08495-2	.;.;DEMA_HUMAN;.;.;.	N	190;190;165;150;150;165;190;190;129;190;190;190;190;190	ENSP00000370879:D190N;ENSP00000416111:D190N;ENSP00000397904:D165N;ENSP00000430618:D150N;ENSP00000430382:D165N;ENSP00000428415:D190N;ENSP00000265800:D190N;ENSP00000429948:D190N;ENSP00000350977:D190N;ENSP00000401291:D190N;ENSP00000427866:D190N;ENSP00000429377:D190N	.	D	+	1	0	EPB49	21983755	1.000000	0.71417	0.940000	0.37924	0.703000	0.40648	9.678000	0.98647	2.367000	0.80283	0.511000	0.50034	GAC	EPB49	-	NULL		0.592	DMTN-009	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	EPB49	HGNC	protein_coding	OTTHUMT00000375178.1	G	NM_001978		21927809	+1	no_errors	ENST00000265800	ensembl	human	known	70_37	missense	SNP	1.000	A
ESCO1	114799	genome.wustl.edu	37	18	19146125	19146125	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr18:19146125G>C	ENST00000269214.5	-	6	2625	c.1688C>G	c.(1687-1689)tCt>tGt	p.S563C		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	563					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						ACTGCTTTTAGATGTCTGGTT	0.318																																																	0													163.0	174.0	170.0					18																	19146125		2203	4298	6501	SO:0001583	missense	114799			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1688C>G	18.37:g.19146125G>C	ENSP00000269214:p.Ser563Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	NULL	p.S563C	ENST00000269214.5	37	c.1688	CCDS32800.1	18	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972600	0.34848	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.61510	0.1;1.53	4.55	1.66	0.24008	.	0.703360	0.13010	N	0.420951	T	0.58581	0.2132	L	0.54323	1.7	0.34413	D	0.696541	D	0.61697	0.99	P	0.52710	0.707	T	0.62886	-0.6759	10	0.44086	T	0.13	-5.9168	6.6608	0.23012	0.33:0.0:0.67:0.0	.	563	Q5FWF5	ESCO1_HUMAN	C	563	ENSP00000269214:S563C;ENSP00000372763:S563C	ENSP00000269214:S563C	S	-	2	0	ESCO1	17400123	1.000000	0.71417	0.089000	0.20774	0.551000	0.35334	1.718000	0.38001	0.091000	0.17302	-0.379000	0.06801	TCT	ESCO1	-	NULL		0.318	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO1	HGNC	protein_coding	OTTHUMT00000443942.1	G	NM_052911		19146125	-1	no_errors	ENST00000269214	ensembl	human	known	70_37	missense	SNP	0.984	C
EYA3	2140	genome.wustl.edu	37	1	28415061	28415061	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:28415061G>C	ENST00000373871.3	-	0	146				EYA3_ENST00000436342.2_5'UTR|EYA3_ENST00000545175.1_5'UTR|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000373863.3_5'UTR|EYA3_ENST00000540618.1_5'UTR	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3						anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		CCCCACAACAGGACATGGAGA	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	2140			U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.-95C>G	1.37:g.28415061G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	RNA	SNP	-	NULL	ENST00000373871.3	37	NULL	CCDS316.1	1																																																																																			EYA3	-	-		0.592	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA3	HGNC	protein_coding	OTTHUMT00000011184.1	G	NM_001990		28415061	-1	no_errors	ENST00000471498	ensembl	human	known	70_37	rna	SNP	0.759	C
FAM135B	51059	genome.wustl.edu	37	8	139149461	139149461	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:139149461T>C	ENST00000395297.1	-	19	4114	c.3944A>G	c.(3943-3945)cAa>cGa	p.Q1315R		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1315										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATAACGGTCTTGGGGAGAAGC	0.423										HNSCC(54;0.14)																																							0													152.0	149.0	150.0					8																	139149461		1879	4109	5988	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3944A>G	8.37:g.139149461T>C	ENSP00000378710:p.Gln1315Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.Q1315R	ENST00000395297.1	37	c.3944	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	T	28.2	4.896864	0.91962	.	.	ENSG00000147724	ENST00000395297	T	0.44083	0.93	5.92	5.92	0.95590	Domain of unknown function DUF676, lipase-like (1);	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	M	0.90309	3.105	0.58432	D	0.999994	D	0.69078	0.997	D	0.79108	0.992	T	0.77877	-0.2424	10	0.87932	D	0	-15.4886	15.5416	0.76052	0.0:0.0:0.0:1.0	.	1315	Q49AJ0	F135B_HUMAN	R	1315	ENSP00000378710:Q1315R	ENSP00000378710:Q1315R	Q	-	2	0	FAM135B	139218643	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.975000	0.88055	2.260000	0.74910	0.528000	0.53228	CAA	FAM135B	-	pfam_DUF676_lipase-like		0.423	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	T	NM_015912		139149461	-1	no_errors	ENST00000395297	ensembl	human	known	70_37	missense	SNP	1.000	C
FAM189A1	23359	genome.wustl.edu	37	15	29418552	29418552	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:29418552G>A	ENST00000261275.4	-	9	1145	c.1146C>T	c.(1144-1146)ggC>ggT	p.G382G		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	382	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						GTGAGCCCATGCCAGGATCCT	0.672																																																	0													37.0	40.0	39.0					15																	29418552		692	1591	2283	SO:0001819	synonymous_variant	23359				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.1146C>T	15.37:g.29418552G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PK09	Silent	SNP	pfam_CD20-like	p.G382	ENST00000261275.4	37	c.1146	CCDS45198.1	15																																																																																			FAM189A1	-	NULL		0.672	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	G	NM_015307		29418552	-1	no_errors	ENST00000261275	ensembl	human	known	70_37	silent	SNP	0.000	A
FATE1	89885	genome.wustl.edu	37	X	150889972	150889972	+	Splice_Site	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:150889972C>T	ENST00000370350.3	+	3	425	c.340C>T	c.(340-342)Cgc>Tgc	p.R114C		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	114						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CCATTATGATCGGTAAGAGCT	0.602																																																	0													79.0	62.0	68.0					X																	150889972		2203	4300	6503	SO:0001630	splice_region_variant	89885			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.341+1C>T	X.37:g.150889972C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.R114C	ENST00000370350.3	37	c.340	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	C	15.20	2.764402	0.49574	.	.	ENSG00000147378	ENST00000370350	T	0.49139	0.79	3.92	-1.63	0.08345	.	1.132520	0.06614	N	0.756234	T	0.28732	0.0712	N	0.19112	0.55	0.09310	N	1	B	0.30793	0.295	B	0.21546	0.035	T	0.21348	-1.0248	10	0.72032	D	0.01	-0.0367	6.2126	0.20638	0.6139:0.2842:0.0:0.1019	.	114	Q969F0	FATE1_HUMAN	C	114	ENSP00000359375:R114C	ENSP00000359375:R114C	R	+	1	0	FATE1	150640628	0.001000	0.12720	0.001000	0.08648	0.024000	0.10985	-1.017000	0.03630	-0.503000	0.06586	0.529000	0.55759	CGC	FATE1	-	pfam_FATE/Miff/Tango-11		0.602	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	C	NM_033085	Missense_Mutation	150889972	+1	no_errors	ENST00000370350	ensembl	human	known	70_37	missense	SNP	0.001	T
FBXO41	150726	genome.wustl.edu	37	2	73491453	73491453	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:73491453C>T	ENST00000521871.1	-	6	2174	c.1759G>A	c.(1759-1761)Gca>Aca	p.A587T	FBXO41_ENST00000520530.2_Missense_Mutation_p.A587T|FBXO41_ENST00000295133.5_Missense_Mutation_p.A648T			Q8TF61	FBX41_HUMAN	F-box protein 41	587										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						GTCCAGACTGCGGGGTGGCGG	0.647																																																	0													47.0	53.0	51.0					2																	73491453		2164	4263	6427	SO:0001583	missense	150726			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1759G>A	2.37:g.73491453C>T	ENSP00000428646:p.Ala587Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.A648T	ENST00000521871.1	37	c.1942	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695523	0.88830	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	T;T	0.42131	0.98;0.98	5.15	5.15	0.70609	F-box domain, Skp2-like (1);	0.109289	0.64402	D	0.000008	T	0.53753	0.1816	L	0.33189	0.99	0.58432	D	0.999999	D	0.89917	1.0	D	0.72075	0.976	T	0.49615	-0.8921	10	0.40728	T	0.16	.	17.3587	0.87344	0.0:1.0:0.0:0.0	.	587	Q8TF61	FBX41_HUMAN	T	648;587	ENSP00000295133:A648T;ENSP00000428646:A587T	ENSP00000295133:A648T	A	-	1	0	FBXO41	73344961	1.000000	0.71417	0.383000	0.26132	0.936000	0.57629	5.902000	0.69869	2.677000	0.91161	0.561000	0.74099	GCA	FBXO41	-	superfamily_F-box_dom_cyclin-like		0.647	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	C			73491453	-1	no_errors	ENST00000295133	ensembl	human	known	70_37	missense	SNP	0.986	T
FIBP	9158	genome.wustl.edu	37	11	65653836	65653836	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:65653836C>T	ENST00000338369.2	-	4	581	c.469G>A	c.(469-471)Gac>Aac	p.D157N	FIBP_ENST00000426652.2_5'UTR|FIBP_ENST00000357519.4_Missense_Mutation_p.D157N|FIBP_ENST00000533045.1_Missense_Mutation_p.D154N	NM_198897.1	NP_942600.1	O43427	FIBP_HUMAN	fibroblast growth factor (acidic) intracellular binding protein	157					fibroblast growth factor receptor signaling pathway (GO:0008543)|platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	10				READ - Rectum adenocarcinoma(159;0.166)		TGAATATTGTCCACCAGGGAG	0.562																																																	0													166.0	134.0	145.0					11																	65653836		2201	4296	6497	SO:0001583	missense	9158			AF010187	CCDS8118.1, CCDS8119.1	11q13.1	2006-06-15			ENSG00000172500	ENSG00000172500			3705	protein-coding gene	gene with protein product		608296				9806903	Standard	NM_004214		Approved	FGFIBP	uc001ogd.3	O43427	OTTHUMG00000166846	ENST00000338369.2:c.469G>A	11.37:g.65653836C>T	ENSP00000344572:p.Asp157Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0J7|Q27Q85|Q6IBQ3|Q9HD65	Missense_Mutation	SNP	pfam_FIBP	p.D157N	ENST00000338369.2	37	c.469	CCDS8119.1	11	.	.	.	.	.	.	.	.	.	.	C	13.11	2.138572	0.37728	.	.	ENSG00000172500	ENST00000338369;ENST00000357519;ENST00000533045	T;T;T	0.22336	1.96;1.96;1.96	4.3	4.3	0.51218	.	0.114707	0.56097	D	0.000023	T	0.08980	0.0222	N	0.03608	-0.345	0.45930	D	0.998763	B;B;B	0.31413	0.322;0.0;0.0	B;B;B	0.31191	0.125;0.0;0.001	T	0.21348	-1.0248	10	0.08837	T	0.75	-12.0054	14.3013	0.66355	0.0:1.0:0.0:0.0	.	154;157;157	E9PSD3;O43427-2;O43427	.;.;FIBP_HUMAN	N	157;157;154	ENSP00000344572:D157N;ENSP00000350124:D157N;ENSP00000434043:D154N	ENSP00000344572:D157N	D	-	1	0	FIBP	65410412	1.000000	0.71417	0.102000	0.21198	0.953000	0.61014	6.762000	0.74950	2.216000	0.71823	0.462000	0.41574	GAC	FIBP	-	pfam_FIBP		0.562	FIBP-001	KNOWN	basic|CCDS	protein_coding	FIBP	HGNC	protein_coding	OTTHUMT00000391575.2	C	NM_198897		65653836	-1	no_errors	ENST00000338369	ensembl	human	known	70_37	missense	SNP	0.900	T
FLG	2312	genome.wustl.edu	37	1	152287815	152287815	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:152287815C>G	ENST00000368799.1	-	2	153	c.118G>C	c.(118-120)Gaa>Caa	p.E40Q	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	40	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCGAAATTCCTTTTCCAGA	0.328									Ichthyosis																																								0													175.0	179.0	178.0					1																	152287815		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.118G>C	1.37:g.152287815C>G	ENSP00000357789:p.Glu40Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E40Q	ENST00000368799.1	37	c.118	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.563022	0.27915	.	.	ENSG00000143631	ENST00000368799	T	0.27890	1.64	5.2	1.07	0.20283	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.39091	0.1065	M	0.89658	3.05	0.09310	N	1	P	0.47484	0.896	P	0.56788	0.806	T	0.24404	-1.0161	9	0.87932	D	0	-16.2742	8.5295	0.33326	0.0:0.4669:0.4489:0.0842	.	40	P20930	FILA_HUMAN	Q	40	ENSP00000357789:E40Q	ENSP00000357789:E40Q	E	-	1	0	FLG	150554439	0.070000	0.21116	0.001000	0.08648	0.001000	0.01503	0.731000	0.26058	0.047000	0.15862	-1.113000	0.02065	GAA	FLG	-	pfam_S100_Ca-bd_sub		0.328	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	C	NM_002016		152287815	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.002	G
FOXA3	3171	genome.wustl.edu	37	19	46375406	46375406	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:46375406C>G	ENST00000302177.2	+	2	340	c.143C>G	c.(142-144)tCt>tGt	p.S48C		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	48					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CCTCTAAGCTCTCCCTATCCC	0.662																																																	0													46.0	56.0	52.0					19																	46375406		2202	4296	6498	SO:0001583	missense	3171			L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.143C>G	19.37:g.46375406C>G	ENSP00000304004:p.Ser48Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A9LYI5|Q53F16|Q9UMW9	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S48C	ENST00000302177.2	37	c.143	CCDS12677.1	19	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776369	0.31411	.	.	ENSG00000170608	ENST00000302177	T	0.18960	2.18	4.3	4.3	0.51218	Fork-head N-terminal (1);	0.571052	0.16635	N	0.205913	T	0.14056	0.0340	N	0.14661	0.345	0.39245	D	0.963937	B	0.02656	0.0	B	0.06405	0.002	T	0.08046	-1.0741	10	0.40728	T	0.16	.	14.2977	0.66325	0.0:1.0:0.0:0.0	.	48	P55318	FOXA3_HUMAN	C	48	ENSP00000304004:S48C	ENSP00000304004:S48C	S	+	2	0	FOXA3	51067246	0.000000	0.05858	1.000000	0.80357	0.732000	0.41865	-0.202000	0.09451	2.236000	0.73375	0.297000	0.19635	TCT	FOXA3	-	pfam_Fork-head_N		0.662	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA3	HGNC	protein_coding	OTTHUMT00000461682.1	C			46375406	+1	no_errors	ENST00000302177	ensembl	human	known	70_37	missense	SNP	1.000	G
FYCO1	79443	genome.wustl.edu	37	3	46008029	46008029	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:46008029G>T	ENST00000296137.2	-	8	3002	c.2797C>A	c.(2797-2799)Ctc>Atc	p.L933I	FYCO1_ENST00000535325.1_Missense_Mutation_p.L933I	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	933					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GCGTCCTGGAGCTCCTGGACA	0.622																																																	0													57.0	56.0	56.0					3																	46008029		2203	4300	6503	SO:0001583	missense	79443			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2797C>A	3.37:g.46008029G>T	ENSP00000296137:p.Leu933Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.L933I	ENST00000296137.2	37	c.2797	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	G	9.722	1.160004	0.21454	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	D;D	0.84070	-1.8;-1.8	5.39	5.39	0.77823	.	0.137379	0.50627	D	0.000116	D	0.89462	0.6722	M	0.71581	2.175	0.09310	N	1	D;D	0.89917	1.0;0.966	D;P	0.80764	0.994;0.604	T	0.82723	-0.0316	10	0.52906	T	0.07	-14.1714	12.7055	0.57058	0.0785:0.0:0.9215:0.0	.	933;933	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	I	933	ENSP00000296137:L933I;ENSP00000441178:L933I	ENSP00000296137:L933I	L	-	1	0	FYCO1	45983033	1.000000	0.71417	0.993000	0.49108	0.041000	0.13682	4.275000	0.58927	2.535000	0.85469	0.655000	0.94253	CTC	FYCO1	-	NULL		0.622	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	G	NM_024513		46008029	-1	no_errors	ENST00000535325	ensembl	human	known	70_37	missense	SNP	0.074	T
GAGE12H	729442	genome.wustl.edu	37	X	49346276	49346276	+	Missense_Mutation	SNP	A	A	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:49346276A>C	ENST00000381722.1	+	3	187	c.105A>C	c.(103-105)gaA>gaC	p.E35D		NM_001098410.1	NP_001091880.1	A6NDE8	GG12H_HUMAN	G antigen 12H	35												Ovarian(276;0.236)					TCAGTGATGAAGTGGAACCAG	0.448																																																	0													15.0	8.0	11.0					X																	49346276		716	1132	1848	SO:0001583	missense	729442				CCDS43948.1	Xp11.23	2008-05-13			ENSG00000224902	ENSG00000224902			31908	protein-coding gene	gene with protein product		300732					Standard	NM_001098410		Approved	OTTHUMG00000024149		A6NDE8	OTTHUMG00000024149	ENST00000381722.1:c.105A>C	X.37:g.49346276A>C	ENSP00000371141:p.Glu35Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GAGE	p.E35D	ENST00000381722.1	37	c.105	CCDS43948.1	X	.	.	.	.	.	.	.	.	.	.	.	11.67	1.707321	0.30322	.	.	ENSG00000224902	ENST00000381722	T	0.12879	2.64	0.971	-0.618	0.11576	.	.	.	.	.	T	0.27241	0.0668	M	0.67953	2.075	0.09310	N	1	D	0.69078	0.997	D	0.79108	0.992	T	0.12167	-1.0558	9	0.66056	D	0.02	.	3.1369	0.06442	0.5307:0.0:0.4693:0.0	.	35	A6NDE8	GG12H_HUMAN	D	35	ENSP00000371141:E35D	ENSP00000371141:E35D	E	+	3	2	GAGE12H	49233220	0.003000	0.15002	0.001000	0.08648	0.147000	0.21601	0.016000	0.13377	-0.251000	0.09542	0.125000	0.15800	GAA	GAGE12H	-	pfam_GAGE		0.448	GAGE12H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAGE12H	HGNC	protein_coding	OTTHUMT00000060833.3	A			49346276	+1	no_errors	ENST00000381722	ensembl	human	known	70_37	missense	SNP	0.001	C
GALNT9	50614	genome.wustl.edu	37	12	132837615	132837615	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:132837615C>T	ENST00000328957.8	-	4	679	c.680G>A	c.(679-681)cGc>cAc	p.R227H	GALNT9_ENST00000535208.1_5'UTR	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	227	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CAGCCGCGCGCGGATCAGTCC	0.622																																					Colon(186;2147 2752 13553 41466)												0													36.0	41.0	39.0					12																	132837615		692	1591	2283	SO:0001583	missense	50614			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.680G>A	12.37:g.132837615C>T	ENSP00000329846:p.Arg227His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R227H	ENST00000328957.8	37	c.680		12	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077738	0.36662	.	.	ENSG00000182870	ENST00000328957	T	0.61980	0.06	4.11	4.11	0.48088	Glycosyl transferase, family 2 (1);	0.072827	0.56097	D	0.000024	T	0.79834	0.4514	M	0.82923	2.615	0.80722	D	1	D;P;D	0.89917	0.989;0.778;1.0	P;B;D	0.69654	0.846;0.411;0.965	D	0.84447	0.0586	10	0.87932	D	0	.	16.3145	0.82913	0.0:1.0:0.0:0.0	.	227;227;84	B2RXG6;Q9HCQ5;B3KP58	.;GALT9_HUMAN;.	H	227	ENSP00000329846:R227H	ENSP00000329846:R227H	R	-	2	0	GALNT9	131347688	1.000000	0.71417	0.932000	0.37286	0.052000	0.14988	5.804000	0.69135	1.837000	0.53436	0.561000	0.74099	CGC	GALNT9	-	pfam_Glyco_trans_2		0.622	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	C	NM_001122636		132837615	-1	no_errors	ENST00000328957	ensembl	human	known	70_37	missense	SNP	1.000	T
GAR1	54433	genome.wustl.edu	37	4	110739145	110739145	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:110739145A>G	ENST00000226796.6	+	3	532	c.268A>G	c.(268-270)Aca>Gca	p.T90A	GAR1_ENST00000394631.3_Missense_Mutation_p.T90A|RP11-602N24.3_ENST00000609440.1_lincRNA	NM_018983.3	NP_061856.1	Q9NY12	GAR1_HUMAN	GAR1 ribonucleoprotein	90					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA snoRNP complex (GO:0031429)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cation channel activity (GO:0005261)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	9						TAAATGTACCACAGATGAAAA	0.333																																																	0													132.0	128.0	129.0					4																	110739145		2203	4300	6503	SO:0001583	missense	54433			AJ276003	CCDS34050.1	4q	2013-07-31	2013-07-31	2008-10-13	ENSG00000109534	ENSG00000109534			14264	protein-coding gene	gene with protein product		606468	"""nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)"", ""GAR1 ribonucleoprotein homolog (yeast)"""	NOLA1		10757788	Standard	XM_005263069		Approved		uc003hzu.3	Q9NY12	OTTHUMG00000161108	ENST00000226796.6:c.268A>G	4.37:g.110739145A>G	ENSP00000226796:p.Thr90Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5MJQ2	Missense_Mutation	SNP	pfam_H/ACA_rnp_Gar1/Naf1,superfamily_Transl_elong_init/rib_B-barrel	p.T90A	ENST00000226796.6	37	c.268	CCDS34050.1	4	.	.	.	.	.	.	.	.	.	.	A	16.21	3.057944	0.55325	.	.	ENSG00000109534	ENST00000394631;ENST00000226796	.	.	.	4.94	4.94	0.65067	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	N	0.25789	0.76	0.54753	D	0.999982	B;B	0.33777	0.371;0.425	B;B	0.41946	0.239;0.371	T	0.36504	-0.9745	9	0.06757	T	0.87	.	14.9009	0.70678	1.0:0.0:0.0:0.0	.	90;90	Q9NY12-2;Q9NY12	.;GAR1_HUMAN	A	90	.	ENSP00000226796:T90A	T	+	1	0	GAR1	110958594	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.965000	0.76067	1.975000	0.57531	0.533000	0.62120	ACA	GAR1	-	pfam_H/ACA_rnp_Gar1/Naf1,superfamily_Transl_elong_init/rib_B-barrel		0.333	GAR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GAR1	HGNC	protein_coding	OTTHUMT00000363810.2	A			110739145	+1	no_errors	ENST00000226796	ensembl	human	known	70_37	missense	SNP	1.000	G
GFPT2	9945	genome.wustl.edu	37	5	179745956	179745956	+	Splice_Site	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:179745956G>A	ENST00000253778.8	-	10	964	c.795C>T	c.(793-795)agC>agT	p.S265S	GFPT2_ENST00000520165.1_5'UTR	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	265	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CTATGATAGCGCTGGGGCAAG	0.602																																																	0													47.0	48.0	48.0					5																	179745956		2093	4205	6298	SO:0001630	splice_region_variant	9945			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.795-1C>T	5.37:g.179745956G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XM2|Q9BWS4	Silent	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.S265	ENST00000253778.8	37	c.795	CCDS43411.1	5																																																																																			GFPT2	-	tigrfam_GlmS_trans		0.602	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	G	NM_005110	Silent	179745956	-1	no_errors	ENST00000253778	ensembl	human	known	70_37	silent	SNP	0.254	A
GJB6	10804	genome.wustl.edu	37	13	20797329	20797329	+	Nonsense_Mutation	SNP	G	G	C	rs370775704		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr13:20797329G>C	ENST00000356192.6	-	5	911	c.291C>G	c.(289-291)taC>taG	p.Y97*	GJB6_ENST00000400066.3_Nonsense_Mutation_p.Y97*|GJB6_ENST00000400065.3_Nonsense_Mutation_p.Y97*|GJB6_ENST00000241124.6_Nonsense_Mutation_p.Y97*	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	97					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)				biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		CGTGCCTGTAGTAGGCCACAT	0.542																																																	0													57.0	50.0	52.0					13																	20797329		2203	4300	6503	SO:0001587	stop_gained	10804			AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.291C>G	13.37:g.20797329G>C	ENSP00000348521:p.Tyr97*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Nonsense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.Y97*	ENST00000356192.6	37	c.291	CCDS9291.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.517158	0.97629	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	.	.	.	5.28	5.28	0.74379	.	0.078557	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.3037	0.54889	0.0773:0.0:0.9227:0.0	.	.	.	.	X	97	.	ENSP00000241124:Y97X	Y	-	3	2	GJB6	19695329	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	3.951000	0.56684	2.450000	0.82876	0.655000	0.94253	TAC	GJB6	-	pfam_Connexin_N		0.542	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB6	HGNC	protein_coding	OTTHUMT00000272906.1	G			20797329	-1	no_errors	ENST00000241124	ensembl	human	known	70_37	nonsense	SNP	1.000	C
GLIS3	169792	genome.wustl.edu	37	9	4299597	4299597	+	5'UTR	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:4299597G>A	ENST00000381971.3	-	0	319				RP11-358M14.2_ENST00000440674.1_RNA	NM_001042413.1	NP_001035878.1	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CAAACGGGGGGACGGAGCGCG	0.716																																																	0																																										SO:0001623	5_prime_UTR_variant	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.-275C>T	9.37:g.4299597G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL19|Q1PHK5	RNA	SNP	-	NULL	ENST00000381971.3	37	NULL	CCDS43784.1	9																																																																																			GLIS3	-	-		0.716	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000354776.1	G	NM_152629		4299597	-1	no_errors	ENST00000490709	ensembl	human	known	70_37	rna	SNP	0.997	A
COLGALT1	79709	genome.wustl.edu	37	19	17692157	17692157	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:17692157C>T	ENST00000252599.4	+	12	1893	c.1773C>T	c.(1771-1773)tcC>tcT	p.S591S		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	591					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										GCGCCAAGTCCCAGAAGATGC	0.602																																																	0													94.0	80.0	85.0					19																	17692157		2203	4300	6503	SO:0001819	synonymous_variant	79709			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1773C>T	19.37:g.17692157C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC64	Silent	SNP	pfam_Glyco_trans_25	p.S591	ENST00000252599.4	37	c.1773	CCDS12363.1	19																																																																																			GLT25D1	-	NULL		0.602	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D1	HGNC	protein_coding	OTTHUMT00000464216.1	C	NM_024656		17692157	+1	no_errors	ENST00000252599	ensembl	human	known	70_37	silent	SNP	0.994	T
GNAL	2774	genome.wustl.edu	37	18	11753944	11753944	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr18:11753944G>T	ENST00000423027.3	+	4	714	c.393G>T	c.(391-393)caG>caT	p.Q131H	GNAL_ENST00000334049.6_Splice_Site_p.Q208H|GNAL_ENST00000535121.1_Splice_Site_p.Q131H|GNAL_ENST00000590972.1_3'UTR|GNAL_ENST00000269162.5_Splice_Site_p.Q131H			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	131					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						AATATTCCCAGGTAAGAAATG	0.343																																																	0													71.0	72.0	71.0					18																	11753944		2203	4300	6503	SO:0001630	splice_region_variant	2774			AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.393+1G>T	18.37:g.11753944G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZA26|Q86XU3	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_S	p.Q208H	ENST00000423027.3	37	c.624	CCDS11852.1	18	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660288	0.67586	.	.	ENSG00000141404	ENST00000540217;ENST00000334049;ENST00000535121;ENST00000269162;ENST00000423027	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	5.58	3.78	0.43462	G protein alpha subunit, helical insertion (2);	0.255684	0.47093	N	0.000248	D	0.88209	0.6375	L	0.33093	0.98	0.80722	D	1	P;P	0.42556	0.783;0.727	P;P	0.53266	0.516;0.722	D	0.87391	0.2363	10	0.87932	D	0	.	10.5169	0.44896	0.069:0.0:0.7968:0.1342	.	131;208	P38405;Q86XU3	GNAL_HUMAN;.	H	70;208;131;131;131	ENSP00000334051:Q208H;ENSP00000439023:Q131H;ENSP00000269162:Q131H;ENSP00000408489:Q131H	ENSP00000269162:Q131H	Q	+	3	2	GNAL	11743944	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	5.460000	0.66691	0.705000	0.31890	0.561000	0.74099	CAG	GNAL	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su		0.343	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAL	HGNC	protein_coding	OTTHUMT00000254561.2	G	NM_182978, NM_002071	Missense_Mutation	11753944	+1	no_errors	ENST00000334049	ensembl	human	known	70_37	missense	SNP	1.000	T
GOLGA8S	653061	genome.wustl.edu	37	15	23606542	23606542	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:23606542delT	ENST00000562295.1	+	12	1049	c.1049delT	c.(1048-1050)cttfs	p.L350fs	RN7SL536P_ENST00000491146.2_RNA					golgin A8 family, member S																		CAGGAGAGGCTTCCAGAGCAG	0.622																																																	0																																										SO:0001589	frameshift_variant	653061					15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.1049delT	15.37:g.23606542delT	ENSP00000455298:p.Leu350fs	Somatic		WXS	Illumina HiSeq	Phase_IV		Frame_Shift_Del	DEL	NULL	p.P351fs	ENST00000562295.1	37	c.1049		15																																																																																			GOLGA8S	-	NULL		0.622	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8S	HGNC	protein_coding	OTTHUMT00000431934.1	T	NR_038843		23606542	+1	no_errors	ENST00000562295	ensembl	human	novel	70_37	frame_shift_del	DEL	0.007	-
GOLGA8B	440270	genome.wustl.edu	37	15	34820227	34820227	+	Missense_Mutation	SNP	C	C	T	rs564951643	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:34820227C>T	ENST00000342314.5	-	15	1602	c.1505G>A	c.(1504-1506)aGc>aAc	p.S502N	GOLGA8A_ENST00000543376.1_Intron|GOLGA8B_ENST00000438958.2_Missense_Mutation_p.S532N|GOLGA8B_ENST00000267731.7_Missense_Mutation_p.S502N|MIR1233-2_ENST00000408138.1_RNA	NM_001023567.4	NP_001018861.3	A8MQT2	GOG8B_HUMAN	golgin A8 family, member B	502	Golgi-targeting domain.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)	1		all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GTGCCCCTCGCTGTAGCTGCC	0.677													c|||	2282	0.455671	0.2852	0.6268	5008	,	,		6865	0.4752		0.4771	False		,,,				2504	0.5225																0													1.0	1.0	1.0					15																	34820227		186	856	1042	SO:0001583	missense	440270			AF164622	CCDS45211.1	15q14	2011-10-25	2010-02-12		ENSG00000215252	ENSG00000215252			31973	protein-coding gene	gene with protein product		609619	"""golgi autoantigen, golgin subfamily a, 8B"""				Standard	NM_001023567		Approved		uc001ziq.3	A8MQT2	OTTHUMG00000129549	ENST00000342314.5:c.1505G>A	15.37:g.34820227C>T	ENSP00000343064:p.Ser502Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLZ2|O94937|Q2M3S9|Q9NZG8|Q9NZW0|Q9NZW3	Missense_Mutation	SNP	NULL	p.S532N	ENST00000342314.5	37	c.1595	CCDS45211.1	15	.	.	.	.	.	.	.	.	.	.	c	0.012	-1.665869	0.00765	.	.	ENSG00000215252	ENST00000342314;ENST00000267731;ENST00000438958;ENST00000268079	T;T;T	0.16743	2.32;2.32;2.32	1.46	0.12	0.14691	.	.	.	.	.	T	0.02610	0.0079	N	0.00197	-1.87	0.19300	N	0.999972	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.42932	-0.9422	9	0.02654	T	1	.	4.8792	0.13670	0.0:0.191:0.0:0.809	.	359;502	B7ZMK6;A8MQT2	.;GOG8B_HUMAN	N	502;502;532;393	ENSP00000343064:S502N;ENSP00000267731:S502N;ENSP00000400063:S532N	ENSP00000267731:S502N	S	-	2	0	GOLGA8B	32607519	0.217000	0.23597	0.002000	0.10522	0.001000	0.01503	1.468000	0.35332	0.055000	0.16094	-1.252000	0.01501	AGC	GOLGA8B	-	NULL		0.677	GOLGA8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA8B	HGNC	protein_coding	OTTHUMT00000251739.2	C	NM_001023567		34820227	-1	no_errors	ENST00000438958	ensembl	human	known	70_37	missense	SNP	0.997	T
GPR179	440435	genome.wustl.edu	37	17	36485781	36485781	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:36485781T>C	ENST00000342292.4	-	11	3691	c.3671A>G	c.(3670-3672)gAa>gGa	p.E1224G	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1224					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTTGGGCAGTTCCTGCCACCC	0.562																																																	0													95.0	103.0	100.0					17																	36485781		1920	4142	6062	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3671A>G	17.37:g.36485781T>C	ENSP00000345060:p.Glu1224Gly	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.E1224G	ENST00000342292.4	37	c.3671	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	T	7.657	0.684137	0.14907	.	.	ENSG00000188888	ENST00000342292	T	0.57595	0.39	5.32	4.21	0.49690	.	0.409242	0.24791	N	0.035564	T	0.44540	0.1298	L	0.50333	1.59	0.09310	N	1	B	0.22683	0.073	B	0.23275	0.045	T	0.42378	-0.9455	10	0.62326	D	0.03	-11.6847	7.9523	0.30023	0.0:0.093:0.0:0.907	.	1224	Q6PRD1	GP179_HUMAN	G	1224	ENSP00000345060:E1224G	ENSP00000345060:E1224G	E	-	2	0	GPR179	33739307	0.000000	0.05858	0.180000	0.23079	0.049000	0.14656	0.633000	0.24598	2.235000	0.73313	0.334000	0.21626	GAA	GPR179	-	NULL		0.562	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	T			36485781	-1	no_errors	ENST00000342292	ensembl	human	known	70_37	missense	SNP	0.023	C
GPR68	8111	genome.wustl.edu	37	14	91701266	91701266	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:91701266G>C	ENST00000531499.2	-	2	468	c.129C>G	c.(127-129)ctC>ctG	p.L43L	GPR68_ENST00000238699.3_Silent_p.L53L|GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_Silent_p.L43L			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	43					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		AGCCGAAGTAGAGGGACAGGC	0.612																																																	0													72.0	67.0	68.0					14																	91701266		2203	4300	6503	SO:0001819	synonymous_variant	8111			U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.129C>G	14.37:g.91701266G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13334|Q4VBB4|Q6IX34	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_OGR1_rcpt,prints_GPCR_Rhodpsn,prints_P2_purnocptor,prints_Psych_rcpt	p.L53	ENST00000531499.2	37	c.159	CCDS9894.2	14																																																																																			GPR68	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.612	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR68	HGNC	protein_coding	OTTHUMT00000395245.2	G			91701266	-1	no_errors	ENST00000238699	ensembl	human	known	70_37	silent	SNP	0.992	C
GPRASP1	9737	genome.wustl.edu	37	X	101909234	101909234	+	Silent	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:101909234A>G	ENST00000361600.5	+	5	1194	c.393A>G	c.(391-393)aaA>aaG	p.K131K	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Silent_p.K131K|GPRASP1_ENST00000444152.1_Silent_p.K131K|GPRASP1_ENST00000537097.1_Silent_p.K131K	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	131					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TGGTTGCTAAAACAAAGTACC	0.438																																																	0													108.0	103.0	105.0					X																	101909234		2203	4300	6503	SO:0001819	synonymous_variant	9737			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.393A>G	X.37:g.101909234A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O43168|Q96LA1	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.K131	ENST00000361600.5	37	c.393	CCDS35352.1	X																																																																																			GPRASP1	-	NULL		0.438	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	A	NM_014710		101909234	+1	no_errors	ENST00000361600	ensembl	human	known	70_37	silent	SNP	0.051	G
GPRC5B	51704	genome.wustl.edu	37	16	19883546	19883546	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:19883546T>G	ENST00000300571.2	-	2	813	c.622A>C	c.(622-624)Atg>Ctg	p.M208L	GPRC5B_ENST00000535671.1_Missense_Mutation_p.M208L|GPRC5B_ENST00000537135.1_Missense_Mutation_p.M234L|GPRC5B_ENST00000569479.1_Missense_Mutation_p.M208L|GPRC5B_ENST00000569847.1_Missense_Mutation_p.M208L	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	208					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						AGCAGTACCATGTCGTAGATG	0.597																																																	0													134.0	111.0	119.0					16																	19883546		2197	4300	6497	SO:0001583	missense	51704			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.622A>C	16.37:g.19883546T>G	ENSP00000300571:p.Met208Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.M234L	ENST00000300571.2	37	c.700	CCDS10581.1	16	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065002	0.55432	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000537135	D;D;D	0.86627	-2.15;-2.15;-2.15	5.17	4.06	0.47325	GPCR, family 3, C-terminal (2);	0.169570	0.53938	N	0.000054	D	0.86896	0.6043	L	0.28274	0.84	0.39096	D	0.961188	P;P	0.45348	0.856;0.856	P;P	0.60949	0.881;0.881	D	0.85057	0.0932	9	.	.	.	.	11.5361	0.50639	0.0:0.0:0.1501:0.8499	.	234;208	B7Z831;Q9NZH0	.;GPC5B_HUMAN	L	208;208;234	ENSP00000300571:M208L;ENSP00000442858:M208L;ENSP00000441775:M234L	.	M	-	1	0	GPRC5B	19791047	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.883000	0.56168	0.962000	0.38057	0.528000	0.53228	ATG	GPRC5B	-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.597	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	HGNC	protein_coding	OTTHUMT00000254285.1	T			19883546	-1	no_errors	ENST00000537135	ensembl	human	known	70_37	missense	SNP	1.000	G
GRIA2	2891	genome.wustl.edu	37	4	158254137	158254137	+	Splice_Site	SNP	A	A	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:158254137A>T	ENST00000264426.9	+	7	1328	c.1049A>T	c.(1048-1050)cAg>cTg	p.Q350L	GRIA2_ENST00000296526.7_Splice_Site_p.Q350L|GRIA2_ENST00000507898.1_Splice_Site_p.Q303L|GRIA2_ENST00000449365.1_Splice_Site_p.Q303L|GRIA2_ENST00000393815.2_Splice_Site_p.Q303L	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	350					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GCCCTCAAACAGGTCAGTTAC	0.423																																																	0													44.0	49.0	47.0					4																	158254137		2203	4299	6502	SO:0001630	splice_region_variant	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1050+1A>T	4.37:g.158254137A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q350L	ENST00000264426.9	37	c.1049	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	A	19.11	3.764004	0.69878	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.29	5.29	0.74685	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	M	0.62723	1.935	0.80722	D	1	P;D;P	0.58970	0.789;0.984;0.914	B;P;P	0.61275	0.328;0.824;0.886	T	0.45891	-0.9230	10	0.72032	D	0.01	.	15.2244	0.73339	1.0:0.0:0.0:0.0	.	350;350;303	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	L	303;303;350;350;303	ENSP00000426845:Q303L;ENSP00000377403:Q303L;ENSP00000296526:Q350L;ENSP00000264426:Q350L;ENSP00000389837:Q303L	ENSP00000264426:Q350L	Q	+	2	0	GRIA2	158473587	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.339000	0.96797	1.994000	0.58287	0.455000	0.32223	CAG	GRIA2	-	pfam_ANF_lig-bd_rcpt		0.423	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	A		Missense_Mutation	158254137	+1	no_errors	ENST00000264426	ensembl	human	known	70_37	missense	SNP	1.000	T
GRM5	2915	genome.wustl.edu	37	11	88780671	88780671	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:88780671C>T	ENST00000305447.4	-	1	519	c.370G>A	c.(370-372)Gaa>Aaa	p.E124K	GRM5_ENST00000455756.2_Missense_Mutation_p.E124K|GRM5_ENST00000418177.2_Missense_Mutation_p.E124K|GRM5_ENST00000393294.3_Missense_Mutation_p.E124K|GRM5_ENST00000305432.5_Missense_Mutation_p.E124K|GRM5_ENST00000393297.1_Missense_Mutation_p.E124K	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	124					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ACCAAGCCTTCTTCCTCTTCT	0.532																																																	0													84.0	73.0	77.0					11																	88780671		2201	4299	6500	SO:0001583	missense	2915			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.370G>A	11.37:g.88780671C>T	ENSP00000306138:p.Glu124Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6J164	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3_mtglu_rcpt_5,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_1,pfscan_GPCR_3_C	p.E124K	ENST00000305447.4	37	c.370	CCDS44694.1	11	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586067	0.46110	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297;ENST00000393294	D;D;D;D;D;D	0.93953	-2.32;-2.32;-2.32;-2.32;-2.35;-3.32	5.4	5.4	0.78164	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.92208	0.7529	M	0.67397	2.05	0.58432	D	0.999992	B;B;P	0.36683	0.009;0.328;0.565	B;B;B	0.37550	0.017;0.085;0.253	D	0.91214	0.5001	9	.	.	.	.	15.5358	0.76001	0.0:0.8617:0.1383:0.0	.	124;124;124	A8MT20;P41594-2;P41594	.;.;GRM5_HUMAN	K	124	ENSP00000402912:E124K;ENSP00000405690:E124K;ENSP00000305905:E124K;ENSP00000306138:E124K;ENSP00000376975:E124K;ENSP00000376972:E124K	.	E	-	1	0	GRM5	88420319	1.000000	0.71417	0.933000	0.37362	0.624000	0.37722	4.793000	0.62474	2.514000	0.84764	0.563000	0.77884	GAA	GRM5	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_mtglu_rcpt_5		0.532	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM5	HGNC	protein_coding	OTTHUMT00000259226.1	C	NM_000842		88780671	-1	no_errors	ENST00000305447	ensembl	human	known	70_37	missense	SNP	1.000	T
GTF3C1	2975	genome.wustl.edu	37	16	27472703	27472703	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:27472703C>T	ENST00000356183.4	-	37	6313	c.6298G>A	c.(6298-6300)Gag>Aag	p.E2100K	GTF3C1_ENST00000567806.1_5'Flank|GTF3C1_ENST00000561623.1_Missense_Mutation_p.E2075K	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	2100					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CAGTTGACCTCGTGGGGGAAC	0.652																																																	0													60.0	61.0	61.0					16																	27472703		2197	4300	6497	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.6298G>A	16.37:g.27472703C>T	ENSP00000348510:p.Glu2100Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.E2100K	ENST00000356183.4	37	c.6298	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978744	0.74360	.	.	ENSG00000077235	ENST00000356183	T	0.30448	1.53	5.23	4.28	0.50868	.	0.125811	0.52532	D	0.000067	T	0.29061	0.0722	M	0.72118	2.19	0.35897	D	0.830103	B;B	0.34264	0.446;0.178	B;B	0.20384	0.027;0.029	T	0.43376	-0.9395	10	0.66056	D	0.02	-21.7821	10.6613	0.45704	0.0:0.911:0.0:0.089	.	2100;2075	Q12789;Q12789-3	TF3C1_HUMAN;.	K	2100	ENSP00000348510:E2100K	ENSP00000348510:E2100K	E	-	1	0	GTF3C1	27380204	0.999000	0.42202	0.689000	0.30133	0.994000	0.84299	4.199000	0.58426	1.218000	0.43458	0.561000	0.74099	GAG	GTF3C1	-	NULL		0.652	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	C	NM_001520		27472703	-1	no_errors	ENST00000356183	ensembl	human	known	70_37	missense	SNP	0.956	T
GTF3C1	2975	genome.wustl.edu	37	16	27517406	27517406	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:27517406C>G	ENST00000356183.4	-	10	1599	c.1584G>C	c.(1582-1584)ttG>ttC	p.L528F	GTF3C1_ENST00000561623.1_Missense_Mutation_p.L528F	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	528					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTGCTTTTTCAATGGGTGTA	0.547																																																	0													71.0	67.0	69.0					16																	27517406		2197	4300	6497	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1584G>C	16.37:g.27517406C>G	ENSP00000348510:p.Leu528Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.L528F	ENST00000356183.4	37	c.1584	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	11.87	1.766636	0.31228	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26223	1.75	5.5	1.04	0.20106	.	0.938994	0.08884	N	0.879553	T	0.32556	0.0833	L	0.56769	1.78	0.22719	N	0.998811	P;P	0.47604	0.528;0.898	B;P	0.50617	0.178;0.646	T	0.18903	-1.0322	10	0.37606	T	0.19	-5.0084	6.4213	0.21746	0.0:0.5186:0.3106:0.1708	.	528;528	Q12789;Q12789-3	TF3C1_HUMAN;.	F	528;526	ENSP00000348510:L528F	ENSP00000348510:L528F	L	-	3	2	GTF3C1	27424907	0.747000	0.28283	0.689000	0.30133	0.012000	0.07955	0.421000	0.21280	0.303000	0.22785	0.655000	0.94253	TTG	GTF3C1	-	NULL		0.547	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	C	NM_001520		27517406	-1	no_errors	ENST00000356183	ensembl	human	known	70_37	missense	SNP	0.372	G
HAPLN4	404037	genome.wustl.edu	37	19	19369519	19369519	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:19369519G>A	ENST00000291481.7	-	4	693	c.630C>T	c.(628-630)aaC>aaT	p.N210N	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	210	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	ACCAGCCCGCGTTGCACCAGT	0.751																																																	0													13.0	14.0	14.0					19																	19369519		2188	4249	6437	SO:0001819	synonymous_variant	404037			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.630C>T	19.37:g.19369519G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKW5|Q96PW2	Silent	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like,prints_Link	p.N210	ENST00000291481.7	37	c.630	CCDS12398.1	19																																																																																			HAPLN4	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link,prints_Link		0.751	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	HGNC	protein_coding	OTTHUMT00000460117.2	G	NM_023002		19369519	-1	no_errors	ENST00000291481	ensembl	human	known	70_37	silent	SNP	0.975	A
HDAC10	83933	genome.wustl.edu	37	22	50686384	50686384	+	Silent	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:50686384A>G	ENST00000216271.5	-	13	1624	c.1272T>C	c.(1270-1272)gtT>gtC	p.V424V	MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000498366.1_5'UTR|HDAC10_ENST00000349505.4_Silent_p.V404V|HDAC10_ENST00000448072.1_Silent_p.V374V	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	424					chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CAGGGGGCAGAACCAATGTGA	0.662																																																	0													42.0	40.0	41.0					22																	50686384		2203	4300	6503	SO:0001819	synonymous_variant	83933			AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.1272T>C	22.37:g.50686384A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Silent	SNP	pfam_His_deacetylse_dom,prints_His_deacetylse	p.V424	ENST00000216271.5	37	c.1272	CCDS14088.1	22																																																																																			HDAC10	-	NULL		0.662	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC10	HGNC	protein_coding	OTTHUMT00000104141.4	A	NM_032019		50686384	-1	no_errors	ENST00000216271	ensembl	human	known	70_37	silent	SNP	0.235	G
HILPDA	29923	genome.wustl.edu	37	7	128097963	128097964	+	3'UTR	INS	-	-	A	rs376818816		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:128097963_128097964insA	ENST00000257696.4	+	0	842_843				HILPDA_ENST00000435296.2_3'UTR|HILPDA_ENST00000481454.1_3'UTR|RP11-212P7.3_ENST00000462662.1_RNA|RP11-155G14.6_ENST00000493710.1_RNA	NM_001098786.1|NM_013332.3	NP_001092256.1|NP_037464.1	Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										gactccatctcaaaaaaaaaag	0.53																																																	0																																										SO:0001624	3_prime_UTR_variant	29923			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000257696.4:c.*450->A	7.37:g.128097973_128097973dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0Z5|Q52LY5|Q53HJ7	RNA	INS	-	NULL	ENST00000257696.4	37	NULL	CCDS5802.1	7																																																																																			HILPDA	-	-		0.530	HILPDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HILPDA	HGNC	protein_coding	OTTHUMT00000349450.1	-	NM_013332		128097964	+1	no_errors	ENST00000466473	ensembl	human	known	70_37	rna	INS	0.010:0.015	A
HIVEP2	3097	genome.wustl.edu	37	6	143091571	143091571	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:143091571C>T	ENST00000367604.1	-	4	4944	c.4305G>A	c.(4303-4305)ctG>ctA	p.L1435L	HIVEP2_ENST00000012134.2_Silent_p.L1435L|HIVEP2_ENST00000367603.2_Silent_p.L1435L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1435					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TGCTACCTCCCAGGGTGGCCA	0.512																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													90.0	90.0	90.0					6																	143091571		1966	4166	6132	SO:0001819	synonymous_variant	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4305G>A	6.37:g.143091571C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1435	ENST00000367604.1	37	c.4305	CCDS43510.1	6																																																																																			HIVEP2	-	NULL		0.512	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	C			143091571	-1	no_errors	ENST00000012134	ensembl	human	known	70_37	silent	SNP	0.074	T
HPR	3250	genome.wustl.edu	37	16	72110600	72110600	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:72110600G>A	ENST00000540303.2	+	5	699	c.667G>A	c.(667-669)Gtg>Atg	p.V223M	HPR_ENST00000561690.1_Intron|HPR_ENST00000356967.5_Missense_Mutation_p.V223M|HPR_ENST00000228226.8_Missense_Mutation_p.V260M	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	223	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				TGTGGGTTACGTGTCTGGCTG	0.453																																																	0													190.0	139.0	156.0					16																	72110600		2057	4186	6243	SO:0001583	missense	3250			BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.667G>A	16.37:g.72110600G>A	ENSP00000441828:p.Val223Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Complement_control_module,smart_Peptidase_S1_S6,pirsf_Haptoglobin,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V260M	ENST00000540303.2	37	c.778	CCDS42193.1	16	.	.	.	.	.	.	.	.	.	.	.	10.38	1.334252	0.24253	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	D;D;D	0.94828	-3.53;-3.53;-3.53	2.5	2.5	0.30297	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.074700	0.56097	D	0.000037	D	0.97334	0.9128	H	0.97051	3.93	0.37494	D	0.91651	D	0.60160	0.987	P	0.61201	0.885	D	0.97267	0.9908	10	0.87932	D	0	.	7.2984	0.26405	0.1436:0.0:0.8564:0.0	.	223	P00739	HPTR_HUMAN	M	223;223;260	ENSP00000349451:V223M;ENSP00000441828:V223M;ENSP00000228226:V260M	ENSP00000228226:V260M	V	+	1	0	HP	70668101	1.000000	0.71417	0.282000	0.24776	0.004000	0.04260	5.945000	0.70226	1.386000	0.46466	0.205000	0.17691	GTG	HPR	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Haptoglobin,pfscan_Peptidase_S1_S6		0.453	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPR	HGNC	protein_coding	OTTHUMT00000421696.1	G	NM_020995		72110600	+1	no_errors	ENST00000228226	ensembl	human	known	70_37	missense	SNP	0.970	A
HSP90AA1	3320	genome.wustl.edu	37	14	102552664	102552664	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:102552664C>T	ENST00000216281.8	-	2	257	c.52G>A	c.(52-54)Gag>Aag	p.E18K	HSP90AA1_ENST00000334701.7_Missense_Mutation_p.E140K|HSP90AA1_ENST00000441629.2_5'UTR	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	18					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	GCGAACGTCTCAACCTCCTCC	0.488																																																	0													100.0	100.0	100.0					14																	102552664		2203	4300	6503	SO:0001583	missense	3320			M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.52G>A	14.37:g.102552664C>T	ENSP00000216281:p.Glu18Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	pirsf_Hsp90,pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,prints_Hsp90_N	p.E140K	ENST00000216281.8	37	c.418	CCDS9967.1	14	.	.	.	.	.	.	.	.	.	.	C	17.10	3.304198	0.60305	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000553585	T;T;T	0.78595	-1.19;-1.19;-1.19	3.79	3.79	0.43588	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.065281	0.64402	U	0.000013	D	0.88213	0.6376	M	0.82823	2.61	0.80722	D	1	D;D	0.69078	0.997;0.983	D;D	0.74023	0.982;0.941	D	0.90735	0.4645	10	0.87932	D	0	.	16.0097	0.80391	0.0:1.0:0.0:0.0	.	140;18	P07900-2;P07900	.;HS90A_HUMAN	K	18;140;18	ENSP00000216281:E18K;ENSP00000335153:E140K;ENSP00000450712:E18K	ENSP00000216281:E18K	E	-	1	0	HSP90AA1	101622417	1.000000	0.71417	0.994000	0.49952	0.845000	0.48019	7.531000	0.81973	1.840000	0.53500	0.573000	0.79308	GAG	HSP90AA1	-	pirsf_Hsp90,superfamily_ATPase-like_ATP-bd,prints_Hsp90_N		0.488	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSP90AA1	HGNC	protein_coding	OTTHUMT00000414952.2	C	NM_005348		102552664	-1	no_errors	ENST00000334701	ensembl	human	known	70_37	missense	SNP	1.000	T
IL23R	149233	genome.wustl.edu	37	1	67705952	67705952	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:67705952C>T	ENST00000347310.5	+	9	1307	c.1136C>T	c.(1135-1137)tCa>tTa	p.S379L	AL109843.1_ENST00000408806.1_RNA|IL23R_ENST00000395227.1_Missense_Mutation_p.S124L|IL23R_ENST00000371002.1_Intron|IL23R_ENST00000473881.1_Intron	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	379					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						TTTAACAGATCATTCCGAACT	0.328																																																	0													176.0	157.0	164.0					1																	67705952		2203	4299	6502	SO:0001583	missense	149233			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.1136C>T	1.37:g.67705952C>T	ENSP00000321345:p.Ser379Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S379L	ENST00000347310.5	37	c.1136	CCDS637.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.00|17.00	3.277099|3.277099	0.59758|0.59758	.|.	.|.	ENSG00000162594|ENSG00000162594	ENST00000425614|ENST00000347310;ENST00000431791;ENST00000441823;ENST00000395227	.|T;T	.|0.55760	.|0.93;0.5	5.19|5.19	5.19|5.19	0.71726|0.71726	.|.	.|0.555068	.|0.16543	.|N	.|0.209851	T|T	0.50343|0.50343	0.1610|0.1610	M|M	0.62723|0.62723	1.935|1.935	0.28835|0.28835	N|N	0.896946|0.896946	.|P;P;P;P;B;P;P;P;P	.|0.52842	.|0.956;0.573;0.956;0.893;0.16;0.649;0.873;0.956;0.775	.|P;B;P;P;B;B;B;P;B	.|0.51016	.|0.656;0.22;0.656;0.563;0.082;0.344;0.356;0.656;0.436	T|T	0.50110|0.50110	-0.8866|-0.8866	5|10	.|0.87932	.|D	.|0	-16.6382|-16.6382	14.4119|14.4119	0.67119|0.67119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|125;203;203;137;208;233;286;124;379	.|Q5VWK5-2;B6HY71;B6HY89;E9PHX4;E9PG12;B6HY79;B6VNT7;Q5VWK5-6;Q5VWK5	.|.;.;.;.;.;.;.;.;IL23R_HUMAN	Y|L	141|379;208;137;124	.|ENSP00000321345:S379L;ENSP00000378652:S124L	.|ENSP00000321345:S379L	H|S	+|+	1|2	0|0	IL23R|IL23R	67478540|67478540	0.950000|0.950000	0.32346|0.32346	0.708000|0.708000	0.30435|0.30435	0.369000|0.369000	0.29798|0.29798	3.302000|3.302000	0.51849|0.51849	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	CAT|TCA	IL23R	-	NULL		0.328	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL23R	HGNC	protein_coding	OTTHUMT00000025199.2	C	NM_144701		67705952	+1	no_errors	ENST00000347310	ensembl	human	known	70_37	missense	SNP	0.676	T
IL2RB	3560	genome.wustl.edu	37	22	37531391	37531391	+	Silent	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:37531391G>T	ENST00000216223.5	-	8	993	c.795C>A	c.(793-795)atC>atA	p.I265I	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	265					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	TCCTGCAGTTGATCAGCAAGT	0.582																																																	0													167.0	164.0	165.0					22																	37531391		2203	4300	6503	SO:0001819	synonymous_variant	3560			M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.795C>A	22.37:g.37531391G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R765	Silent	SNP	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.I265	ENST00000216223.5	37	c.795	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	G	4.512	0.095031	0.08681	.	.	ENSG00000100385	ENST00000447922	.	.	.	3.95	2.83	0.33086	.	.	.	.	.	T	0.35189	0.0923	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.15206	-1.0445	4	.	.	.	-1.3731	8.9026	0.35503	0.0:0.2297:0.7703:0.0	.	.	.	.	K	20	.	.	Q	-	1	0	IL2RB	35861337	0.002000	0.14202	0.005000	0.12908	0.013000	0.08279	0.776000	0.26704	2.207000	0.71202	0.542000	0.68232	CAA	IL2RB	-	NULL		0.582	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	HGNC	protein_coding	OTTHUMT00000318792.1	G			37531391	-1	no_errors	ENST00000216223	ensembl	human	known	70_37	silent	SNP	0.001	T
IQGAP3	128239	genome.wustl.edu	37	1	156508623	156508623	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:156508623C>G	ENST00000361170.2	-	26	3269	c.3259G>C	c.(3259-3261)Gag>Cag	p.E1087Q	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1087	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTCTGGGCCTCAGTCTGGTTG	0.547																																																	0													102.0	86.0	91.0					1																	156508623		2203	4300	6503	SO:0001583	missense	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3259G>C	1.37:g.156508623C>G	ENSP00000354451:p.Glu1087Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.E1087Q	ENST00000361170.2	37	c.3259	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739813	0.89573	.	.	ENSG00000183856	ENST00000361170	T	0.80994	-1.44	4.71	4.71	0.59529	Rho GTPase activation protein (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.89483	0.6728	M	0.87381	2.88	0.58432	D	0.999998	D	0.76494	0.999	D	0.79784	0.993	D	0.91249	0.5028	10	0.87932	D	0	-25.2449	16.3785	0.83418	0.0:1.0:0.0:0.0	.	1087	Q86VI3	IQGA3_HUMAN	Q	1087	ENSP00000354451:E1087Q	ENSP00000354451:E1087Q	E	-	1	0	IQGAP3	154775247	1.000000	0.71417	0.975000	0.42487	0.986000	0.74619	7.647000	0.83462	2.434000	0.82447	0.591000	0.81541	GAG	IQGAP3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP		0.547	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	C	NM_178229		156508623	-1	no_errors	ENST00000361170	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM7A	80853	genome.wustl.edu	37	7	139810954	139810954	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:139810954C>G	ENST00000397560.2	-	11	1466	c.1369G>C	c.(1369-1371)Gac>Cac	p.D457H	JHDM1D_ENST00000006967.5_Missense_Mutation_p.D457H	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		457					histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					CTAACATTGTCTGGAATTTCA	0.294																																																	0													120.0	110.0	113.0					7																	139810954		1808	4077	5885	SO:0001583	missense	80853																														ENST00000397560.2:c.1369G>C	7.37:g.139810954C>G	ENSP00000380692:p.Asp457His	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.D457H	ENST00000397560.2	37	c.1369	CCDS43658.1	7	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545234	0.86022	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.59364	0.27;0.27	5.3	5.3	0.74995	.	0.047635	0.85682	D	0.000000	T	0.69223	0.3087	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.63381	0.914	T	0.71689	-0.4517	10	0.87932	D	0	-20.4434	19.3098	0.94182	0.0:1.0:0.0:0.0	.	457	Q6ZMT4	KDM7_HUMAN	H	457	ENSP00000380692:D457H;ENSP00000006967:D457H	ENSP00000006967:D457H	D	-	1	0	JHDM1D	139457423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.636000	0.89361	0.655000	0.94253	GAC	JHDM1D	-	NULL		0.294	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JHDM1D	HGNC	protein_coding	OTTHUMT00000348460.1	C			139810954	-1	no_errors	ENST00000397560	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNA1	3736	genome.wustl.edu	37	12	5020634	5020634	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:5020634C>T	ENST00000382545.3	+	2	1197	c.90C>T	c.(88-90)caC>caT	p.H30H	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	30					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	AGGCCGACCACGACGACCACG	0.682																																																	0													31.0	33.0	33.0					12																	5020634		2203	4300	6503	SO:0001819	synonymous_variant	3736			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.90C>T	12.37:g.5020634C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NM83|Q3MIQ9	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.H30	ENST00000382545.3	37	c.90	CCDS8535.1	12																																																																																			KCNA1	-	prints_K_chnl_volt-dep_Kv1.3		0.682	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	C	NM_000217		5020634	+1	no_errors	ENST00000382545	ensembl	human	known	70_37	silent	SNP	0.993	T
KCNN3	3782	genome.wustl.edu	37	1	154687452	154687452	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:154687452G>A	ENST00000271915.4	-	6	2044	c.1729C>T	c.(1729-1731)Cgg>Tgg	p.R577W	KCNN3_ENST00000361147.4_Missense_Mutation_p.R272W|KCNN3_ENST00000358505.2_Missense_Mutation_p.R264W	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	582	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	CATGTTTCCCGAAGGACATTG	0.403																																																	0													208.0	183.0	192.0					1																	154687452		2203	4300	6503	SO:0001583	missense	3782			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1729C>T	1.37:g.154687452G>A	ENSP00000271915:p.Arg577Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.R577W	ENST00000271915.4	37	c.1729	CCDS30880.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128461	0.77549	.	.	ENSG00000143603	ENST00000361147;ENST00000271915;ENST00000358505	T;T;T	0.26067	1.76;1.76;1.76	5.42	5.42	0.78866	Calmodulin-binding domain (2);	0.000000	0.53938	D	0.000056	T	0.53110	0.1776	M	0.87269	2.87	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.987	T	0.59674	-0.7410	10	0.87932	D	0	-31.081	19.0127	0.92881	0.0:0.0:1.0:0.0	.	582;272	Q9UGI6;Q9UGI6-2	KCNN3_HUMAN;.	W	272;577;264	ENSP00000354764:R272W;ENSP00000271915:R577W;ENSP00000351295:R264W	ENSP00000271915:R577W	R	-	1	2	KCNN3	152954076	0.997000	0.39634	0.990000	0.47175	0.987000	0.75469	2.593000	0.46180	2.824000	0.97209	0.492000	0.49549	CGG	KCNN3	-	pfam_CaM-bd_dom,superfamily_CaM-bd_dom		0.403	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	G	NM_002249		154687452	-1	no_errors	ENST00000271915	ensembl	human	known	70_37	missense	SNP	0.994	A
KDM2A	22992	genome.wustl.edu	37	11	66975147	66975147	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:66975147G>A	ENST00000529006.2	+	6	920	c.474G>A	c.(472-474)caG>caA	p.Q158Q	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Silent_p.Q158Q	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	158	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ATATGGTGCAGAGGCCCTCCA	0.478																																																	0													58.0	60.0	60.0					11																	66975147		1969	4150	6119	SO:0001819	synonymous_variant	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.474G>A	11.37:g.66975147G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.Q158	ENST00000529006.2	37	c.474	CCDS44657.1	11																																																																																			KDM2A	-	smart_JmjC_dom,pfscan_JmjC_dom		0.478	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	G	NM_012308		66975147	+1	no_errors	ENST00000529006	ensembl	human	known	70_37	silent	SNP	1.000	A
KDM3A	55818	genome.wustl.edu	37	2	86709185	86709185	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:86709185C>G	ENST00000409556.1	+	18	3010	c.2645C>G	c.(2644-2646)tCt>tGt	p.S882C	KDM3A_ENST00000409064.1_Missense_Mutation_p.S882C|KDM3A_ENST00000542128.1_Missense_Mutation_p.S830C|KDM3A_ENST00000312912.5_Missense_Mutation_p.S882C			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	882					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AACAACAATTCTGGTTTCCTC	0.413																																					NSCLC(96;1150 1523 6936 46253 49736)												0													135.0	131.0	132.0					2																	86709185		2203	4300	6503	SO:0001583	missense	55818			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2645C>G	2.37:g.86709185C>G	ENSP00000386660:p.Ser882Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S882C	ENST00000409556.1	37	c.2645	CCDS1990.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372975	0.82573	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	5.8	5.8	0.92144	.	0.081321	0.52532	D	0.000062	T	0.71239	0.3316	L	0.51422	1.61	0.45806	D	0.998689	D;D	0.67145	0.996;0.992	D;P	0.63703	0.917;0.827	T	0.72418	-0.4300	10	0.87932	D	0	.	19.0588	0.93078	0.0:1.0:0.0:0.0	.	830;882	F5H070;Q9Y4C1	.;KDM3A_HUMAN	C	882;882;882;882;830	ENSP00000386660:S882C;ENSP00000323659:S882C;ENSP00000386516:S882C;ENSP00000438324:S830C	ENSP00000323659:S882C	S	+	2	0	KDM3A	86562696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.167000	0.64972	2.744000	0.94065	0.655000	0.94253	TCT	KDM3A	-	NULL		0.413	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	C	NM_018433		86709185	+1	no_errors	ENST00000312912	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM5B	10765	genome.wustl.edu	37	1	202743752	202743752	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:202743752G>A	ENST00000367265.3	-	3	1558	c.394C>T	c.(394-396)Cag>Tag	p.Q132*	KDM5B_ENST00000367264.2_Nonsense_Mutation_p.Q132*	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	132	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						TTATTAAGCTGAAATAAGTCC	0.338																																																	0													85.0	85.0	85.0					1																	202743752		2203	4299	6502	SO:0001587	stop_gained	10765			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.394C>T	1.37:g.202743752G>A	ENSP00000356234:p.Gln132*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95811|Q15752|Q9Y3Q5	Nonsense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.Q132*	ENST00000367265.3	37	c.394	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.079741	0.94050	.	.	ENSG00000117139	ENST00000367265;ENST00000367264	.	.	.	5.36	5.36	0.76844	.	0.161147	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-19.8234	19.0886	0.93217	0.0:0.0:1.0:0.0	.	.	.	.	X	132	.	ENSP00000356233:Q132X	Q	-	1	0	KDM5B	201010375	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.150000	0.71801	2.504000	0.84457	0.557000	0.71058	CAG	KDM5B	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd		0.338	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	G	NM_006618		202743752	-1	no_errors	ENST00000367265	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ICE1	23379	genome.wustl.edu	37	5	5463228	5463228	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:5463228G>C	ENST00000296564.7	+	13	4003	c.3781G>C	c.(3781-3783)Gag>Cag	p.E1261Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1261					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AACTCTGTCTGAGGTTCTGAC	0.358																																																	0													32.0	33.0	32.0					5																	5463228		1841	4091	5932	SO:0001583	missense	23379																														ENST00000296564.7:c.3781G>C	5.37:g.5463228G>C	ENSP00000296564:p.Glu1261Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	superfamily_Vitellinogen_superhlx	p.E1261Q	ENST00000296564.7	37	c.3781	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998209	0.54147	.	.	ENSG00000164151	ENST00000296564	T	0.10860	2.83	4.78	0.129	0.14739	.	.	.	.	.	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	1	B	0.27932	0.194	B	0.26864	0.074	T	0.41484	-0.9506	9	0.27082	T	0.32	-5.7951	3.3414	0.07119	0.3927:0.2069:0.4004:0.0	.	1261	Q9Y2F5	K0947_HUMAN	Q	1261	ENSP00000296564:E1261Q	ENSP00000296564:E1261Q	E	+	1	0	KIAA0947	5516228	0.000000	0.05858	0.013000	0.15412	0.702000	0.40608	0.076000	0.14712	0.380000	0.24823	0.305000	0.20034	GAG	KIAA0947	-	NULL		0.358	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	G			5463228	+1	no_errors	ENST00000296564	ensembl	human	known	70_37	missense	SNP	0.003	C
KIAA1024L	100127206	genome.wustl.edu	37	5	129100597	129100597	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:129100597G>C	ENST00000564719.1	+	3	526	c.414G>C	c.(412-414)cgG>cgC	p.R138R	CTC-575N7.1_ENST00000503616.1_RNA|CTC-575N7.1_ENST00000515569.1_RNA|KIAA1024L_ENST00000334562.1_Silent_p.R55R	NM_001257308.1	NP_001244237.1	P59773	K102L_HUMAN	KIAA1024-like	138						integral component of membrane (GO:0016021)											ATGACCTGCGGTTTTGGTTGG	0.343																																																	0																																										SO:0001819	synonymous_variant	100127206				CCDS58966.1	5q23.3	2013-01-16			ENSG00000186367	ENSG00000186367			33914	protein-coding gene	gene with protein product							Standard	NM_001257308		Approved		uc031skx.1	P59773	OTTHUMG00000163041	ENST00000564719.1:c.414G>C	5.37:g.129100597G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	H3BM78	Silent	SNP	pfam_UPF0258	p.R138	ENST00000564719.1	37	c.414	CCDS58966.1	5																																																																																			KIAA1024L	-	pfam_UPF0258		0.343	KIAA1024L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1024L	HGNC	protein_coding	OTTHUMT00000371450.2	G	NM_001257308		129100597	+1	no_errors	ENST00000564719	ensembl	human	known	70_37	silent	SNP	0.998	C
KIAA0141	9812	genome.wustl.edu	37	5	141309764	141309764	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:141309764C>G	ENST00000432126.2	+	7	813	c.679C>G	c.(679-681)Ctt>Gtt	p.L227V	KIAA0141_ENST00000194118.4_Missense_Mutation_p.L227V	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	227					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCAAAAACTCTTTCCCTTGA	0.468																																																	0													68.0	71.0	70.0					5																	141309764		2203	4300	6503	SO:0001583	missense	9812			BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.679C>G	5.37:g.141309764C>G	ENSP00000396225:p.Leu227Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q969R4|Q96EU9	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.L227V	ENST00000432126.2	37	c.679	CCDS4268.1	5	.	.	.	.	.	.	.	.	.	.	C	6.220	0.408692	0.11812	.	.	ENSG00000081791	ENST00000432126;ENST00000194118;ENST00000508751	T;T;T	0.19806	2.62;2.62;2.12	4.73	1.81	0.25067	.	0.711573	0.13502	N	0.383163	T	0.17023	0.0409	L	0.43152	1.355	0.20638	N	0.999874	B	0.12013	0.005	B	0.08055	0.003	T	0.31916	-0.9926	10	0.13470	T	0.59	-0.2767	12.2866	0.54795	0.0:0.4879:0.5121:0.0	.	227	Q14154	DELE_HUMAN	V	227	ENSP00000396225:L227V;ENSP00000194118:L227V;ENSP00000422686:L227V	ENSP00000194118:L227V	L	+	1	0	KIAA0141	141289948	0.381000	0.25140	0.109000	0.21407	0.611000	0.37282	0.557000	0.23454	0.177000	0.19895	0.305000	0.20034	CTT	KIAA0141	-	NULL		0.468	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0141	HGNC	protein_coding	OTTHUMT00000251863.2	C	NM_014773		141309764	+1	no_errors	ENST00000194118	ensembl	human	known	70_37	missense	SNP	0.467	G
CEMIP	57214	genome.wustl.edu	37	15	81217005	81217005	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:81217005C>T	ENST00000394685.3	+	18	2665	c.2246C>T	c.(2245-2247)tCt>tTt	p.S749F	KIAA1199_ENST00000356249.5_Missense_Mutation_p.S749F|KIAA1199_ENST00000220244.3_Missense_Mutation_p.S749F|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		749					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ACCGAGGCCTCTGCCAAGGAC	0.542																																																	0													128.0	105.0	113.0					15																	81217005		2203	4300	6503	SO:0001583	missense	57214																														ENST00000394685.3:c.2246C>T	15.37:g.81217005C>T	ENSP00000378177:p.Ser749Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.S749F	ENST00000394685.3	37	c.2246	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395322	0.62066	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.54479	0.57;0.57;0.57	5.12	5.12	0.69794	Pectin lyase fold/virulence factor (1);	0.142433	0.42548	D	0.000681	T	0.67335	0.2882	M	0.70595	2.14	0.37067	D	0.898351	D	0.64830	0.994	P	0.60173	0.87	T	0.74429	-0.3668	10	0.59425	D	0.04	-18.7643	13.8309	0.63380	0.1531:0.8469:0.0:0.0	.	749	Q8WUJ3	K1199_HUMAN	F	749	ENSP00000220244:S749F;ENSP00000378177:S749F;ENSP00000348583:S749F	ENSP00000220244:S749F	S	+	2	0	KIAA1199	79004060	0.995000	0.38212	0.998000	0.56505	0.632000	0.37999	3.158000	0.50723	2.529000	0.85273	0.591000	0.81541	TCT	KIAA1199	-	superfamily_Pectin_lyase_fold/virulence		0.542	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	C			81217005	+1	no_errors	ENST00000220244	ensembl	human	known	70_37	missense	SNP	0.990	T
LDB2	9079	genome.wustl.edu	37	4	16590439	16590439	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:16590439C>G	ENST00000304523.5	-	4	748	c.425G>C	c.(424-426)aGa>aCa	p.R142T	LDB2_ENST00000503829.1_5'UTR|LDB2_ENST00000515064.1_Missense_Mutation_p.R142T|LDB2_ENST00000441778.2_Missense_Mutation_p.R142T|LDB2_ENST00000503178.2_Missense_Mutation_p.R18T|LDB2_ENST00000502640.1_Missense_Mutation_p.R142T	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	142					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						CAAGATCAGTCTGCCTTCTGT	0.443																																																	0													201.0	171.0	181.0					4																	16590439		2203	4300	6503	SO:0001583	missense	9079			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.425G>C	4.37:g.16590439C>G	ENSP00000306772:p.Arg142Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.R142T	ENST00000304523.5	37	c.425	CCDS3420.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.935570|4.935570	0.92458|0.92458	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000507464|ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178;ENST00000506732	.|.	.|.	.|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.83454|0.83454	0.5258|0.5258	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D	.|0.89917	.|1.0;0.985;1.0;0.999;0.997;0.996;0.995	.|D;D;D;D;D;D;D	.|0.91635	.|0.999;0.966;0.992;0.958;0.958;0.998;0.996	T|T	0.82112|0.82112	-0.0618|-0.0618	5|9	.|0.31617	.|T	.|0.26	-5.5168|-5.5168	18.4277|18.4277	0.90614|0.90614	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|18;108;142;142;142;142;118	.|B7Z2D3;B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3	.|.;.;.;.;.;LDB2_HUMAN;.	H|T	64|142;142;142;142;18;118	.|.	.|ENSP00000306772:R142T	D|R	-|-	1|2	0|0	LDB2|LDB2	16199537|16199537	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.776000|7.776000	0.85560|0.85560	2.672000|2.672000	0.90937|0.90937	0.655000|0.655000	0.94253|0.94253	GAC|AGA	LDB2	-	NULL		0.443	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	C			16590439	-1	no_errors	ENST00000304523	ensembl	human	known	70_37	missense	SNP	1.000	G
LINC00087	644596	genome.wustl.edu	37	X	134232432	134232432	+	lincRNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:134232432C>G	ENST00000433425.2	-	0	232					NR_024493.1				long intergenic non-protein coding RNA 87																		ggcgcTCACTCGATCCGCACT	0.716																																																	0																																												644596					Xq26.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000196972	ENSG00000196972		"""Long non-coding RNAs"""	34500	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 87"""	NCRNA00087			Standard	NR_024493		Approved	RP11-85L21.2	uc004eyh.2		OTTHUMG00000022468		X.37:g.134232432C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000433425.2	37	NULL		X																																																																																			LINC00087	-	-		0.716	LINC00087-002	KNOWN	basic	lincRNA	LINC00087	HGNC	lincRNA	OTTHUMT00000058396.2	C			134232432	-1	no_errors	ENST00000433425	ensembl	human	known	70_37	rna	SNP	1.000	G
LINC00273	649159	genome.wustl.edu	37	16	33961352	33961352	+	lincRNA	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:33961352G>A	ENST00000539813.1	-	0	1151				AC136932.1_ENST00000385251.1_RNA	NR_038368.1				long intergenic non-protein coding RNA 273											lung(1)	1						GGGAGGCTGCGCGAGCGGTGG	0.761																																																	0																																												649159			AY587847		16p11.2	2013-06-03	2011-08-11	2011-08-11	ENSG00000256642	ENSG00000256642		"""Long non-coding RNAs"""	38595	other	unknown	"""non-protein coding RNA 273-1"""		"""non-protein coding RNA 273"""	NCRNA00273			Standard	NR_038368		Approved	TOP, NCRNA00273-1	uc021thl.1		OTTHUMG00000176379		16.37:g.33961352G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.R363	ENST00000539813.1	37	c.1089		16																																																																																			LINC00273	-	NULL		0.761	LINC00273-001	KNOWN	basic	lincRNA	LINC00273	HGNC	lincRNA	OTTHUMT00000431840.1	G	NR_038368		33961352	-1	no_errors	ENST00000539813	ensembl	human	putative	70_37	silent	SNP	0.000	A
KIF28P	100130097	genome.wustl.edu	37	1	246954062	246954062	+	RNA	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:246954062C>T	ENST00000451123.1	-	0	0				RP11-439E19.3_ENST00000421003.1_RNA|RP11-439E19.3_ENST00000505748.1_RNA|RP11-439E19.3_ENST00000419361.1_RNA																							ACTTTACCGTCGGCATTTGTG	0.493																																																	0																																												149134																															1.37:g.246954062C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000451123.1	37	NULL		1																																																																																			RP11-439E19.3	-	-		0.493	RP11-439E19.8-002	KNOWN	basic|exp_conf	processed_transcript	LOC149134	Clone_based_vega_gene	pseudogene	OTTHUMT00000331247.2	C			246954062	+1	no_errors	ENST00000419361	ensembl	human	known	70_37	rna	SNP	0.929	T
LSP1	4046	genome.wustl.edu	37	11	1908067	1908067	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:1908067C>T	ENST00000311604.3	+	8	998	c.823C>T	c.(823-825)Cag>Tag	p.Q275*	LSP1_ENST00000485341.1_3'UTR|LSP1_ENST00000406638.2_Nonsense_Mutation_p.Q213*|LSP1_ENST00000381775.1_Nonsense_Mutation_p.Q403*|LSP1_ENST00000405957.2_Nonsense_Mutation_p.Q213*	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	275					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		GGTACAGGCTCAGTCTGCGGC	0.652																																																	0													35.0	38.0	37.0					11																	1908067		2202	4294	6496	SO:0001587	stop_gained	4046			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.823C>T	11.37:g.1908067C>T	ENSP00000308383:p.Gln275*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Nonsense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Lymphspecific	p.Q275*	ENST00000311604.3	37	c.823	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	.	28.9	4.963308	0.92791	.	.	ENSG00000130592	ENST00000311604;ENST00000381775;ENST00000405957;ENST00000457279;ENST00000406638;ENST00000417766;ENST00000432093	.	.	.	3.3	3.3	0.37823	.	0.000000	0.37393	N	0.002104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-33.6863	12.8897	0.58064	0.0:1.0:0.0:0.0	.	.	.	.	X	275;403;213;266;213;213;213	.	ENSP00000308383:Q275X	Q	+	1	0	LSP1	1864643	1.000000	0.71417	0.988000	0.46212	0.357000	0.29423	3.074000	0.50065	1.850000	0.53721	0.455000	0.32223	CAG	LSP1	-	pfam_Caldesmon_LSP,prints_Lymphspecific		0.652	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	HGNC	protein_coding	OTTHUMT00000034045.3	C	NM_002339		1908067	+1	no_errors	ENST00000311604	ensembl	human	known	70_37	nonsense	SNP	1.000	T
LRRC4C	57689	genome.wustl.edu	37	11	40137255	40137255	+	Silent	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:40137255C>A	ENST00000278198.2	-	2	2551	c.588G>T	c.(586-588)ctG>ctT	p.L196L	LRRC4C_ENST00000530763.1_Silent_p.L196L|LRRC4C_ENST00000528697.1_Silent_p.L196L|LRRC4C_ENST00000527150.1_Silent_p.L196L			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	196					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TCAAGTTGGACAGACCTTCAA	0.438																																																	0													94.0	91.0	92.0					11																	40137255		2203	4300	6503	SO:0001819	synonymous_variant	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.588G>T	11.37:g.40137255C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0T1|Q7L0N3	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L196	ENST00000278198.2	37	c.588	CCDS31464.1	11																																																																																			LRRC4C	-	smart_Leu-rich_rpt_typical-subtyp		0.438	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	C	NM_020929		40137255	-1	no_errors	ENST00000527150	ensembl	human	known	70_37	silent	SNP	1.000	A
LTBP2	4053	genome.wustl.edu	37	14	74994061	74994061	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:74994061G>C	ENST00000261978.4	-	13	2763	c.2377C>G	c.(2377-2379)Cag>Gag	p.Q793E	LTBP2_ENST00000556690.1_Missense_Mutation_p.Q793E	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	793					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGCCAGCCTGAGAGTCACCT	0.652																																																	0													61.0	56.0	57.0					14																	74994061		2201	4300	6501	SO:0001583	missense	4053				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2377C>G	14.37:g.74994061G>C	ENSP00000261978:p.Gln793Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q99907|Q9NS51	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.Q793E	ENST00000261978.4	37	c.2377	CCDS9831.1	14	.	.	.	.	.	.	.	.	.	.	G	3.673	-0.067080	0.07273	.	.	ENSG00000119681	ENST00000261978;ENST00000556690;ENST00000556359	T;T	0.76968	-1.06;-1.06	4.22	3.24	0.37175	.	1.419420	0.04875	N	0.446708	T	0.59945	0.2231	N	0.14661	0.345	0.18873	N	0.999989	B	0.02656	0.0	B	0.01281	0.0	T	0.48779	-0.9005	10	0.02654	T	1	.	9.3999	0.38426	0.0:0.2179:0.7821:0.0	.	793	Q14767	LTBP2_HUMAN	E	793;793;53	ENSP00000261978:Q793E;ENSP00000451477:Q793E	ENSP00000261978:Q793E	Q	-	1	0	LTBP2	74063814	0.983000	0.35010	0.843000	0.33291	0.921000	0.55340	2.930000	0.48924	2.340000	0.79590	0.511000	0.50034	CAG	LTBP2	-	NULL		0.652	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	G	NM_000428		74994061	-1	no_errors	ENST00000261978	ensembl	human	known	70_37	missense	SNP	0.543	C
MAGEB6	158809	genome.wustl.edu	37	X	26212431	26212431	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:26212431G>A	ENST00000379034.1	+	2	617	c.468G>A	c.(466-468)tcG>tcA	p.S156S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	156	Ser-rich.							p.S156S(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CCACTGGCTCGCCTGATGCAG	0.507																																																	1	Substitution - coding silent(1)	lung(1)											56.0	52.0	53.0					X																	26212431		2202	4300	6502	SO:0001819	synonymous_variant	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.468G>A	X.37:g.26212431G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GS19|Q9H219	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S156	ENST00000379034.1	37	c.468	CCDS14217.1	X																																																																																			MAGEB6	-	NULL		0.507	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	G	NM_173523		26212431	+1	no_errors	ENST00000379034	ensembl	human	known	70_37	silent	SNP	0.000	A
MAP2K1	5604	genome.wustl.edu	37	15	66782079	66782079	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:66782079G>A	ENST00000307102.5	+	10	1577	c.1046G>A	c.(1045-1047)aGa>aAa	p.R349K	CTD-3185P2.2_ENST00000602360.1_RNA|CTD-3185P2.1_ENST00000565387.1_RNA|MAP2K1_ENST00000566326.1_Missense_Mutation_p.R173K	NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	349	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CCCGCAGAGAGAGCAGATTTG	0.408																																																	0													169.0	167.0	168.0					15																	66782079		2201	4299	6500	SO:0001583	missense	5604			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.1046G>A	15.37:g.66782079G>A	ENSP00000302486:p.Arg349Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R349K	ENST00000307102.5	37	c.1046	CCDS10216.1	15	.	.	.	.	.	.	.	.	.	.	G	37	6.118263	0.97300	.	.	ENSG00000169032	ENST00000307102	D	0.99014	-5.33	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99588	0.9851	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98141	1.0436	10	0.87932	D	0	-20.5964	20.2159	0.98296	0.0:0.0:1.0:0.0	.	327;349	B4DFY5;Q02750	.;MP2K1_HUMAN	K	349	ENSP00000302486:R349K	ENSP00000302486:R349K	R	+	2	0	MAP2K1	64569133	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.394000	0.97261	2.882000	0.98803	0.655000	0.94253	AGA	MAP2K1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.408	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K1	HGNC	protein_coding	OTTHUMT00000256906.4	G			66782079	+1	no_errors	ENST00000307102	ensembl	human	known	70_37	missense	SNP	1.000	A
MAP2K7	5609	genome.wustl.edu	37	19	7977052	7977052	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:7977052G>A	ENST00000397979.3	+	10	1152	c.1098G>A	c.(1096-1098)agG>agA	p.R366R	CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000545011.1_Silent_p.R408R|MAP2K7_ENST00000397983.3_Silent_p.R382R|MAP2K7_ENST00000397981.3_Silent_p.R373R	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						AAGATCACAGGAAGAGACCAA	0.592																																																	0													91.0	100.0	97.0					19																	7977052		1985	4152	6137	SO:0001819	synonymous_variant	5609			AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.1098G>A	19.37:g.7977052G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R408	ENST00000397979.3	37	c.1224	CCDS42491.1	19																																																																																			MAP2K7	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.592	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	MAP2K7	HGNC	protein_coding	OTTHUMT00000267980.1	G			7977052	+1	no_errors	ENST00000545011	ensembl	human	known	70_37	silent	SNP	1.000	A
MAPK1	5594	genome.wustl.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:22127164C>T	ENST00000215832.6	-	7	1152	c.964G>A	c.(964-966)Gag>Aag	p.E322K	MAPK1_ENST00000544786.1_Missense_Mutation_p.E278K|MAPK1_ENST00000398822.3_Missense_Mutation_p.E322K	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.E322K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	GCTCTTACCTCGTCACTCGGG	0.478																																																	1	Substitution - Missense(1)	cervix(1)											165.0	132.0	143.0					22																	22127164		2203	4300	6503	SO:0001583	missense	5594			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.964G>A	22.37:g.22127164C>T	ENSP00000215832:p.Glu322Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8CZ64	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.E322K	ENST00000215832.6	37	c.964	CCDS13795.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.567659	0.96540	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.46063	0.88;0.88;0.88	4.9	4.9	0.64082	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.83275	0.905;0.996	D	0.87609	0.2502	10	0.87932	D	0	-8.3311	18.6384	0.91386	0.0:1.0:0.0:0.0	.	278;322	A8CZ64;P28482	.;MK01_HUMAN	K	322;310;322;278	ENSP00000215832:E322K;ENSP00000381803:E322K;ENSP00000440842:E278K	ENSP00000215832:E322K	E	-	1	0	MAPK1	20457164	1.000000	0.71417	0.999000	0.59377	0.862000	0.49288	7.564000	0.82326	2.706000	0.92434	0.655000	0.94253	GAG	MAPK1	-	superfamily_Kinase-like_dom,prints_MAPK_ERK1/2		0.478	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MAPK1	HGNC	protein_coding	OTTHUMT00000075396.2	C			22127164	-1	no_errors	ENST00000215832	ensembl	human	known	70_37	missense	SNP	1.000	T
MED12L	116931	genome.wustl.edu	37	3	151105723	151105723	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:151105723C>T	ENST00000474524.1	+	35	5147	c.5109C>T	c.(5107-5109)taC>taT	p.Y1703Y	MED12L_ENST00000273432.4_Silent_p.Y1563Y	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1703						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Y1703Y(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGATCAAGTACGAGGAGCAGC	0.592																																																	1	Substitution - coding silent(1)	ovary(1)											126.0	101.0	109.0					3																	151105723		2203	4300	6503	SO:0001819	synonymous_variant	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5109C>T	3.37:g.151105723C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.Y1703	ENST00000474524.1	37	c.5109	CCDS33876.1	3																																																																																			MED12L	-	NULL		0.592	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	C	NM_053002		151105723	+1	no_errors	ENST00000474524	ensembl	human	known	70_37	silent	SNP	0.205	T
MED14	9282	genome.wustl.edu	37	X	40588605	40588606	+	Intron	INS	-	-	A	rs200699843|rs369436436		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:40588605_40588606insA	ENST00000324817.1	-	2	334					NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTCTAAGAAGAAAAAAAAAAA	0.322																																																	0																																										SO:0001627	intron_variant	9282			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.216-8->T	X.37:g.40588616_40588616dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4KMR7|Q9UNB3	RNA	INS	-	NULL	ENST00000324817.1	37	NULL	CCDS14254.1	X																																																																																			MED14	-	-		0.322	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1	-	NM_004229		40588606	-1	no_errors	ENST00000463072	ensembl	human	known	70_37	rna	INS	0.000:0.000	A
MED24	9862	genome.wustl.edu	37	17	38183201	38183201	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:38183201G>A	ENST00000394128.2	-	17	1698	c.1617C>T	c.(1615-1617)atC>atT	p.I539I	MED24_ENST00000394127.2_Silent_p.I526I|SNORD124_ENST00000459577.1_RNA|MED24_ENST00000501516.3_Silent_p.I558I|MED24_ENST00000356271.3_Silent_p.I526I|MED24_ENST00000394126.1_Silent_p.I564I	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	539					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.I539I(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CAGGGTTCAGGATCTTGCCCT	0.602											OREG0024386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	lung(1)											55.0	51.0	52.0					17																	38183201		2203	4300	6503	SO:0001819	synonymous_variant	9862			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1617C>T	17.37:g.38183201G>A		Somatic	876	WXS	Illumina HiSeq	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.I539	ENST00000394128.2	37	c.1617	CCDS11359.1	17																																																																																			MED24	-	pfam_Mediator_Med24_N		0.602	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	G	NM_014815		38183201	-1	no_errors	ENST00000394128	ensembl	human	known	70_37	silent	SNP	1.000	A
MFAP1	4236	genome.wustl.edu	37	15	44102108	44102108	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:44102108C>T	ENST00000267812.3	-	7	1124	c.892G>A	c.(892-894)Gag>Aag	p.E298K		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	298					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TTCTCCTTCTCAAGCCTGTCC	0.418																																																	0													187.0	170.0	176.0					15																	44102108		2198	4298	6496	SO:0001583	missense	4236				CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.892G>A	15.37:g.44102108C>T	ENSP00000267812:p.Glu298Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86TG6	Missense_Mutation	SNP	pfam_MFAP1_C	p.E298K	ENST00000267812.3	37	c.892	CCDS10105.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.609712	0.96637	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.90542	3.125	0.80722	D	1	P	0.47604	0.898	P	0.53313	0.723	D	0.83690	0.0176	9	0.49607	T	0.09	-13.1428	18.1308	0.89600	0.0:1.0:0.0:0.0	.	298	P55081	MFAP1_HUMAN	K	298	.	ENSP00000267812:E298K	E	-	1	0	MFAP1	41889400	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.320000	0.79064	2.865000	0.98341	0.655000	0.94253	GAG	MFAP1	-	pfam_MFAP1_C		0.418	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP1	HGNC	protein_coding	OTTHUMT00000133491.2	C	NM_005926		44102108	-1	no_errors	ENST00000267812	ensembl	human	known	70_37	missense	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141768492	141768492	+	Intron	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:141768492G>A	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Missense_Mutation_p.D1684N	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCGTTGGTACGATTACTACAC	0.428																																																	0													70.0	58.0	62.0					7																	141768492		874	1939	2813	SO:0001627	intron_variant	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+3224G>A	7.37:g.141768492G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.D1684N	ENST00000549489.2	37	c.5050	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248408	0.39797	.	.	ENSG00000257335	ENST00000475668;ENST00000548812	.	.	.	3.96	2.12	0.27331	.	.	.	.	.	T	0.48909	0.1526	.	.	.	0.32388	N	0.553613	.	.	.	.	.	.	T	0.58978	-0.7540	5	0.62326	D	0.03	.	7.4901	0.27456	0.2198:0.0:0.7802:0.0	.	.	.	.	N	1684;1561	.	ENSP00000316431:D1561N	D	+	1	0	MGAM	141414961	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	4.975000	0.63777	0.658000	0.30925	-0.699000	0.03677	GAT	MGAM	-	pfam_Glyco_hydro_31		0.428	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	G			141768492	+1	no_errors	ENST00000475668	ensembl	human	putative	70_37	missense	SNP	1.000	A
MICAL3	57553	genome.wustl.edu	37	22	18314623	18314623	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:18314623C>A	ENST00000441493.2	-	21	3404	c.3052G>T	c.(3052-3054)Gaa>Taa	p.E1018*		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1018	Glu-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTCTGACCTTCACTGGActct	0.532																																																	0													129.0	108.0	114.0					22																	18314623		1499	3474	4973	SO:0001587	stop_gained	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3052G>T	22.37:g.18314623C>A	ENSP00000416015:p.Glu1018*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Nonsense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.E1018*	ENST00000441493.2	37	c.3052	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	C	37	6.507545	0.97624	.	.	ENSG00000093100	ENST00000441493	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	18.4865	0.90831	0.0:1.0:0.0:0.0	.	.	.	.	X	1018	.	ENSP00000416015:E1018X	E	-	1	0	XXbac-B461K10.4	16694623	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	7.792000	0.85828	2.463000	0.83235	0.551000	0.68910	GAA	MICAL3	-	NULL		0.532	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	C			18314623	-1	no_errors	ENST00000441493	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FAM184A	79632	genome.wustl.edu	37	6	119390228	119390228	+	Intron	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:119390228C>A	ENST00000338891.7	-	1	603				FAM184A_ENST00000368475.4_Intron|FAM184A_ENST00000522284.1_Intron|FAM184A_ENST00000521531.1_Intron|MIR548B_ENST00000385247.1_RNA|FAM184A_ENST00000352896.5_Intron	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A							extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						taggttggcacaaaagcaact	0.289																																																	0													25.0	26.0	25.0					6																	119390228		1451	3349	4800	SO:0001627	intron_variant	693128			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.159+9077G>T	6.37:g.119390228C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	RNA	SNP	-	NULL	ENST00000338891.7	37	NULL	CCDS43499.1	6																																																																																			MIR548B	-	-		0.289	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR548B	HGNC	protein_coding	OTTHUMT00000042009.3	C	NM_024581		119390228	-1	no_errors	ENST00000385247	ensembl	human	known	70_37	rna	SNP	0.072	A
MLEC	9761	genome.wustl.edu	37	12	121131974	121131974	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:121131974G>A	ENST00000228506.3	+	2	744	c.316G>A	c.(316-318)Gag>Aag	p.E106K	RP11-173P15.3_ENST00000541383.1_RNA|MLEC_ENST00000412616.2_Missense_Mutation_p.E106K	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	106					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						GCGGTACAATGAGGAGACCTT	0.498																																																	0													116.0	98.0	104.0					12																	121131974		2203	4300	6503	SO:0001583	missense	9761			BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.316G>A	12.37:g.121131974G>A	ENSP00000228506:p.Glu106Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Malectin	p.E106K	ENST00000228506.3	37	c.316	CCDS9206.1	12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990463	0.74589	.	.	ENSG00000110917	ENST00000228506;ENST00000412616;ENST00000545525	.	.	.	5.5	5.5	0.81552	Malectin (1);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	N	0.13098	0.295	0.80722	D	1	B	0.22414	0.069	B	0.25614	0.062	T	0.30357	-0.9981	9	0.12766	T	0.61	.	19.7862	0.96440	0.0:0.0:1.0:0.0	.	106	Q14165	MLEC_HUMAN	K	106;106;23	.	ENSP00000228506:E106K	E	+	1	0	MLEC	119616357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.406000	0.97321	2.769000	0.95229	0.655000	0.94253	GAG	MLEC	-	pfam_Malectin		0.498	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLEC	HGNC	protein_coding	OTTHUMT00000402781.2	G	NM_014730		121131974	+1	no_errors	ENST00000228506	ensembl	human	known	70_37	missense	SNP	1.000	A
MMEL1	79258	genome.wustl.edu	37	1	2526265	2526265	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:2526265C>T	ENST00000378412.3	-	17	1813	c.1652G>A	c.(1651-1653)aGc>aAc	p.S551N	MMEL1_ENST00000502556.1_Missense_Mutation_p.S394N|MMEL1_ENST00000288709.6_Missense_Mutation_p.S542N			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	551						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CTTCCTGAGGCTCCGCTGGGC	0.617																																																	0													74.0	79.0	77.0					1																	2526265		2203	4300	6503	SO:0001583	missense	79258			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1652G>A	1.37:g.2526265C>T	ENSP00000367668:p.Ser551Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.S551N	ENST00000378412.3	37	c.1652	CCDS30569.2	1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.579960	0.46006	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.81996	-1.56;-1.56;-1.56	4.91	3.98	0.46160	.	0.079815	0.85682	D	0.000000	T	0.69940	0.3167	L	0.28608	0.87	0.48288	D	0.999626	B	0.12630	0.006	B	0.14578	0.011	T	0.61983	-0.6950	10	0.07813	T	0.8	-53.711	11.7224	0.51689	0.0:0.9121:0.0:0.0879	.	551	Q495T6	MMEL1_HUMAN	N	394;542;551;394	ENSP00000288709:S542N;ENSP00000367668:S551N;ENSP00000422492:S394N	ENSP00000288709:S542N	S	-	2	0	MMEL1	2516125	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.181000	0.58303	2.419000	0.82065	0.655000	0.94253	AGC	MMEL1	-	NULL		0.617	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	C	NM_033467		2526265	-1	no_errors	ENST00000378412	ensembl	human	known	70_37	missense	SNP	1.000	T
MTMR11	10903	genome.wustl.edu	37	1	149900986	149900986	+	3'UTR	DEL	A	A	-	rs587745310|rs78362386	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:149900986delA	ENST00000439741.2	-	0	2415				MTMR11_ENST00000369140.3_Intron|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000406732.3_3'UTR|MTMR11_ENST00000361405.6_3'UTR|SF3B4_ENST00000271628.8_5'Flank	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11								phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GTGCAGATACAAAAAAAAAAA	0.453													|||unknown(LONG_INSERTION)	13	0.00259585	0.0083	0.0	5008	,	,		22980	0.0		0.002	False		,,,				2504	0.0																0													21.0	22.0	22.0					1																	149900986		691	1591	2282	SO:0001624	3_prime_UTR_variant	10903			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.*35T>-	1.37:g.149900986delA		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	RNA	DEL	-	NULL	ENST00000439741.2	37	NULL	CCDS53360.1	1																																																																																			MTMR11	-	-		0.453	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		A	NM_181873		149900986	-1	no_errors	ENST00000466496	ensembl	human	known	70_37	rna	DEL	0.000	-
MUC16	94025	genome.wustl.edu	37	19	9058848	9058848	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:9058848T>G	ENST00000397910.4	-	3	28801	c.28598A>C	c.(28597-28599)tAt>tCt	p.Y9533S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9535	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAAGAGGAATAGAGTTCCTC	0.493																																																	0													118.0	116.0	117.0					19																	9058848		1960	4146	6106	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28598A>C	19.37:g.9058848T>G	ENSP00000381008:p.Tyr9533Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.Y9533S	ENST00000397910.4	37	c.28598	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	4.267	0.048705	0.08243	.	.	ENSG00000181143	ENST00000397910	T	0.22134	1.97	2.3	-1.95	0.07548	.	.	.	.	.	T	0.10121	0.0248	N	0.14661	0.345	.	.	.	P	0.34977	0.478	B	0.34385	0.181	T	0.22277	-1.0221	8	0.87932	D	0	.	3.7505	0.08565	0.2195:0.0:0.4463:0.3342	.	9533	B5ME49	.	S	9533	ENSP00000381008:Y9533S	ENSP00000381008:Y9533S	Y	-	2	0	MUC16	8919848	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.005000	0.03674	-0.548000	0.06199	0.254000	0.18369	TAT	MUC16	-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	T	NM_024690		9058848	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.000	G
MUC2	4583	genome.wustl.edu	37	11	1093677	1093677	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:1093677C>T	ENST00000441003.2	+	30	5523	c.5496C>T	c.(5494-5496)agC>agT	p.S1832S	MUC2_ENST00000333592.6_Silent_p.S120S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCACTGGAAGCACGGGGCCCC	0.617																																																	0													147.0	189.0	175.0					11																	1093677		2111	4197	6308	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5496C>T	11.37:g.1093677C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S1832	ENST00000441003.2	37	c.5496		11																																																																																			MUC2	-	NULL		0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	C	NM_002457		1093677	+1	no_errors	ENST00000441003	ensembl	human	known	70_37	silent	SNP	0.000	T
MYH10	4628	genome.wustl.edu	37	17	8381688	8381688	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:8381688C>T	ENST00000269243.4	-	39	5719	c.5581G>A	c.(5581-5583)Gag>Aag	p.E1861K	MYH10_ENST00000360416.3_Missense_Mutation_p.E1892K|MYH10_ENST00000379980.4_Missense_Mutation_p.E1877K|NDEL1_ENST00000299734.7_Intron|MYH10_ENST00000396239.1_Missense_Mutation_p.E1882K	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1861					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TGTCGACGCTCATCCTCAACC	0.532																																																	0													159.0	130.0	140.0					17																	8381688		2203	4300	6503	SO:0001583	missense	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5581G>A	17.37:g.8381688C>T	ENSP00000269243:p.Glu1861Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1882K	ENST00000269243.4	37	c.5644	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430208	0.62844	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41	4.78	4.78	0.61160	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.88328	0.6407	M	0.93328	3.405	0.80722	D	1	B;B;B	0.26902	0.163;0.135;0.163	B;B;B	0.36766	0.232;0.149;0.232	D	0.89134	0.3512	10	0.87932	D	0	.	18.3727	0.90412	0.0:1.0:0.0:0.0	.	1870;1892;1861	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	K	1861;1892;1882;1877	ENSP00000269243:E1861K;ENSP00000353590:E1892K;ENSP00000379539:E1882K;ENSP00000369315:E1877K	ENSP00000269243:E1861K	E	-	1	0	MYH10	8322413	1.000000	0.71417	0.275000	0.24674	0.089000	0.18198	7.609000	0.82925	2.657000	0.90304	0.655000	0.94253	GAG	MYH10	-	pfam_Myosin_tail,superfamily_HR1_rho-bd		0.532	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	C			8381688	-1	no_errors	ENST00000396239	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10399833	10399833	+	Missense_Mutation	SNP	G	G	A	rs555367957	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:10399833G>A	ENST00000226207.5	-	34	4784	c.4690C>T	c.(4690-4692)Cgc>Tgc	p.R1564C	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1564					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AGCTGGATGCGCAGGATCTTT	0.393													G|||	3	0.000599042	0.0	0.0	5008	,	,		22230	0.0		0.0	False		,,,				2504	0.0031																0													94.0	94.0	94.0					17																	10399833		2203	4297	6500	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.4690C>T	17.37:g.10399833G>A	ENSP00000226207:p.Arg1564Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1564C	ENST00000226207.5	37	c.4690	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265365	0.59431	.	.	ENSG00000109061	ENST00000226207	D	0.84800	-1.9	5.52	5.52	0.82312	Myosin tail (1);	0.000000	0.44097	U	0.000487	D	0.94460	0.8217	M	0.93283	3.4	0.58432	D	0.999991	D	0.69078	0.997	D	0.67548	0.952	D	0.95317	0.8417	10	0.87932	D	0	.	19.7889	0.96450	0.0:0.0:1.0:0.0	.	1564	P12882	MYH1_HUMAN	C	1564	ENSP00000226207:R1564C	ENSP00000226207:R1564C	R	-	1	0	MYH1	10340558	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.124000	0.50461	2.734000	0.93682	0.655000	0.94253	CGC	MYH1	-	pfam_Myosin_tail		0.393	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	G	NM_005963		10399833	-1	no_errors	ENST00000226207	ensembl	human	known	70_37	missense	SNP	1.000	A
MYH11	4629	genome.wustl.edu	37	16	15832438	15832438	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:15832438C>G	ENST00000300036.5	-	24	3214	c.3105G>C	c.(3103-3105)atG>atC	p.M1035I	MYH11_ENST00000452625.2_Missense_Mutation_p.M1042I|MYH11_ENST00000576790.2_Missense_Mutation_p.M1035I|MYH11_ENST00000396324.3_Missense_Mutation_p.M1042I|AF001548.6_ENST00000577048.1_RNA	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1035					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GTTCTGAAATCATAGATTCAT	0.368			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													175.0	161.0	166.0					16																	15832438		2197	4300	6497	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3105G>C	16.37:g.15832438C>G	ENSP00000300036:p.Met1035Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M1042I	ENST00000300036.5	37	c.3126	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057384	0.36277	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.3	4.3	0.51218	.	0.089199	0.85682	D	0.000000	D	0.85173	0.5636	L	0.41415	1.275	0.58432	D	0.999999	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.10450	0.005;0.003;0.003;0.002;0.002	T	0.83113	-0.0122	10	0.66056	D	0.02	.	16.1203	0.81346	0.0:1.0:0.0:0.0	.	1042;1035;1042;1035;1042	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	I	1035;1035;1042;1042;1042	ENSP00000300036:M1035I;ENSP00000345136:M1035I;ENSP00000379616:M1042I;ENSP00000407821:M1042I	ENSP00000300036:M1035I	M	-	3	0	MYH11	15739939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.959000	0.70339	2.117000	0.64856	0.555000	0.69702	ATG	MYH11	-	superfamily_Prefoldin		0.368	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	C	NM_001040113		15832438	-1	no_errors	ENST00000396324	ensembl	human	known	70_37	missense	SNP	1.000	G
NCOA1	8648	genome.wustl.edu	37	2	24927964	24927964	+	Missense_Mutation	SNP	G	G	A	rs377618248		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:24927964G>A	ENST00000406961.1	+	12	1611	c.959G>A	c.(958-960)cGt>cAt	p.R320H	NCOA1_ENST00000348332.3_Missense_Mutation_p.R320H|NCOA1_ENST00000407230.1_Missense_Mutation_p.R169H|NCOA1_ENST00000538539.1_Missense_Mutation_p.R320H|NCOA1_ENST00000395856.3_Missense_Mutation_p.R320H|NCOA1_ENST00000405141.1_Missense_Mutation_p.R320H|NCOA1_ENST00000288599.5_Missense_Mutation_p.R320H			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	320					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGATGACTCGTGGCACTGCC	0.423			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0								G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	102.0	96.0	98.0		959,959,959	5.2	1.0	2		98	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	NCOA1	NM_003743.4,NM_147223.2,NM_147233.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	320/1442,320/1400,320/1441	24927964	1,13005	2203	4300	6503	SO:0001583	missense	8648			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.959G>A	2.37:g.24927964G>A	ENSP00000385216:p.Arg320His	Somatic		WXS	Illumina HiSeq	Phase_IV	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_dom	p.R320H	ENST00000406961.1	37	c.959	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	7.866	0.727089	0.15439	0.0	1.16E-4	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	6.06	5.18	0.71444	.	0.142943	0.64402	D	0.000004	T	0.08891	0.0220	N	0.04636	-0.2	0.49915	D	0.999833	P;B;B;B	0.34662	0.462;0.04;0.404;0.13	B;B;B;B	0.31016	0.102;0.022;0.123;0.01	T	0.31364	-0.9946	10	0.25751	T	0.34	.	16.4705	0.84111	0.0:0.0:0.8677:0.1323	.	320;320;320;169	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	H	320;320;169;320;320;320;320	ENSP00000385216:R320H;ENSP00000385097:R320H;ENSP00000385195:R169H;ENSP00000444039:R320H;ENSP00000320940:R320H;ENSP00000288599:R320H;ENSP00000379197:R320H	ENSP00000288599:R320H	R	+	2	0	NCOA1	24781468	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.629000	0.67798	1.549000	0.49425	0.650000	0.86243	CGT	NCOA1	-	pirsf_Nuclear_rcpt_coactivator		0.423	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3	G	NM_147223		24927964	+1	no_errors	ENST00000348332	ensembl	human	known	70_37	missense	SNP	1.000	A
NCK2	8440	genome.wustl.edu	37	2	106471654	106471654	+	Silent	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:106471654C>A	ENST00000233154.4	+	3	577	c.135C>A	c.(133-135)gcC>gcA	p.A45A	AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000522586.1_Silent_p.A45A|NCK2_ENST00000393349.2_Silent_p.A45A|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000451463.2_Silent_p.A45A|AC009505.2_ENST00000596418.1_RNA	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	45	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						GGAACGCGGCCAACAGGACGG	0.587																																																	0													94.0	81.0	86.0					2																	106471654		2203	4300	6503	SO:0001819	synonymous_variant	8440			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.135C>A	2.37:g.106471654C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVK1|Q9BWN9|Q9UIC3	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.A45	ENST00000233154.4	37	c.135	CCDS33266.1	2																																																																																			NCK2	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain		0.587	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	HGNC	protein_coding	OTTHUMT00000329634.1	C	NM_003581		106471654	+1	no_errors	ENST00000233154	ensembl	human	known	70_37	silent	SNP	1.000	A
NDST2	8509	genome.wustl.edu	37	10	75562497	75562497	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:75562497C>G	ENST00000309979.6	-	14	3017	c.2461G>C	c.(2461-2463)Gaa>Caa	p.E821Q	ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Missense_Mutation_p.L808F|NDST2_ENST00000299641.4_Missense_Mutation_p.E698Q			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	821	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					TTACCACCTTCAAGTCCCTGG	0.512																																																	0													99.0	96.0	97.0					10																	75562497		2203	4300	6503	SO:0001583	missense	8509			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.2461G>C	10.37:g.75562497C>G	ENSP00000310657:p.Glu821Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TB32|Q59H89	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.E821Q	ENST00000309979.6	37	c.2461	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	C	18.97	3.736061	0.69189	.	.	ENSG00000166507	ENST00000309979;ENST00000299641;ENST00000429742	T;T;T	0.54279	0.58;0.58;0.58	6.07	6.07	0.98685	Sulfotransferase domain (1);	0.091135	0.85682	D	0.000000	T	0.58935	0.2157	M	0.74881	2.28	0.49915	D	0.999836	B	0.33904	0.431	B	0.33750	0.169	T	0.59257	-0.7488	10	0.51188	T	0.08	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	821	P52849	NDST2_HUMAN	Q	821;698;102	ENSP00000310657:E821Q;ENSP00000299641:E698Q;ENSP00000392733:E102Q	ENSP00000299641:E698Q	E	-	1	0	NDST2	75232503	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.999000	0.70665	2.884000	0.98904	0.655000	0.94253	GAA	NDST2	-	pfam_Sulfotransferase_dom		0.512	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	C	NM_003635		75562497	-1	no_errors	ENST00000309979	ensembl	human	known	70_37	missense	SNP	1.000	G
NIPAL3	57185	genome.wustl.edu	37	1	24768628	24768628	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:24768628G>A	ENST00000374399.4	+	4	614	c.246G>A	c.(244-246)ctG>ctA	p.L82L	NIPAL3_ENST00000358028.4_Silent_p.L82L|NIPAL3_ENST00000339255.2_Silent_p.L82L|NIPAL3_ENST00000428131.1_Silent_p.L82L|NIPAL3_ENST00000003912.3_De_novo_Start_InFrame	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	82						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						GCCTGTTCCTGATGCTTCTGG	0.587																																																	0													124.0	112.0	116.0					1																	24768628		2203	4300	6503	SO:0001819	synonymous_variant	57185			BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.246G>A	1.37:g.24768628G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A298|Q6MZT9|Q9BVE6	Silent	SNP	pfam_Mg_trans_NIPA	p.L82	ENST00000374399.4	37	c.246	CCDS30631.1	1																																																																																			NIPAL3	-	pfam_Mg_trans_NIPA		0.587	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL3	HGNC	protein_coding	OTTHUMT00000276996.1	G	NM_020448		24768628	+1	no_errors	ENST00000374399	ensembl	human	known	70_37	silent	SNP	1.000	A
NLRX1	79671	genome.wustl.edu	37	11	119050704	119050704	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:119050704C>G	ENST00000409109.1	+	7	2561	c.1974C>G	c.(1972-1974)atC>atG	p.I658M	NLRX1_ENST00000292199.2_Missense_Mutation_p.I658M|NLRX1_ENST00000525863.1_Missense_Mutation_p.I658M|NLRX1_ENST00000409991.1_Missense_Mutation_p.I658M|NLRX1_ENST00000409265.4_Missense_Mutation_p.I658M	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	658	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCCAGGCCATCAAGAAGAAGC	0.597																																																	0													27.0	28.0	28.0					11																	119050704		2200	4294	6494	SO:0001583	missense	79671			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1974C>G	11.37:g.119050704C>G	ENSP00000387334:p.Ile658Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.I658M	ENST00000409109.1	37	c.1974	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703699	0.30232	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.74002	-0.75;-0.75;-0.8;-0.75;-0.8	5.33	3.11	0.35812	.	0.148018	0.47455	D	0.000233	T	0.51278	0.1665	N	0.12182	0.205	0.29918	N	0.822962	B;B	0.33637	0.42;0.209	B;B	0.32289	0.143;0.051	T	0.50890	-0.8774	10	0.33940	T	0.23	.	7.0165	0.24890	0.0:0.554:0.2593:0.1867	.	658;658	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	M	658	ENSP00000386851:I658M;ENSP00000292199:I658M;ENSP00000386858:I658M;ENSP00000387334:I658M;ENSP00000433442:I658M	ENSP00000292199:I658M	I	+	3	3	NLRX1	118555914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.470000	0.45119	1.255000	0.44051	0.561000	0.74099	ATC	NLRX1	-	NULL		0.597	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	C	NM_170722		119050704	+1	no_errors	ENST00000292199	ensembl	human	known	70_37	missense	SNP	1.000	G
NOTCH3	4854	genome.wustl.edu	37	19	15276805	15276805	+	Silent	SNP	G	G	A	rs114661066	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:15276805G>A	ENST00000263388.2	-	30	5535	c.5460C>T	c.(5458-5460)atC>atT	p.I1820I		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1820					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGTCGGAGATGATGCTAGCTG	0.597																																																	0													80.0	67.0	72.0					19																	15276805		2203	4300	6503	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5460C>T	19.37:g.15276805G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.I1820	ENST00000263388.2	37	c.5460	CCDS12326.1	19																																																																																			NOTCH3	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt-contain_dom		0.597	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15276805	-1	no_errors	ENST00000263388	ensembl	human	known	70_37	silent	SNP	1.000	A
NRDE2	55051	genome.wustl.edu	37	14	90798256	90798256	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:90798256G>C	ENST00000354366.3	-	0	225				NRDE2_ENST00000557106.1_5'UTR|NRDE2_ENST00000357904.3_5'UTR	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing																		CATGACCACAGGCCGTACCTC	0.627																																																	0													60.0	67.0	65.0					14																	90798256		2203	4300	6503	SO:0001623	5_prime_UTR_variant	55051			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.-8C>G	14.37:g.90798256G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DH71|Q4G0A7|Q9NWH6	RNA	SNP	-	NULL	ENST00000354366.3	37	NULL	CCDS9890.1	14																																																																																			NRDE2	-	-		0.627	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	HGNC	protein_coding	OTTHUMT00000411264.1	G	NM_017970		90798256	-1	no_errors	ENST00000557106	ensembl	human	known	70_37	rna	SNP	0.946	C
NXF4	55999	genome.wustl.edu	37	X	101818421	101818421	+	RNA	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:101818421C>T	ENST00000360035.2	+	0	1011					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						GGCTGCCACTCTGAAGATCAT	0.443																																																	0																																												55999			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101818421C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-		0.443	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	C			101818421	+1	no_errors	ENST00000360035	ensembl	human	known	70_37	rna	SNP	0.161	T
OLAH	55301	genome.wustl.edu	37	10	15089330	15089330	+	Intron	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:15089330C>T	ENST00000378228.3	+	2	286				OLAH_ENST00000378217.3_Intron	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase						fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)			endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						GCAGGCCACCCCTTGTGCCAC	0.557																																																	0													131.0	92.0	105.0					10																	15089330		2203	4300	6503	SO:0001627	intron_variant	55301			AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.32+11C>T	10.37:g.15089330C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUB6|Q9NUW1	Missense_Mutation	SNP	pfam_Thioesterase	p.P15S	ENST00000378228.3	37	c.43	CCDS31152.1	10	.	.	.	.	.	.	.	.	.	.	c	9.869	1.198471	0.22037	.	.	ENSG00000152463	ENST00000378225	.	.	.	2.86	0.595	0.17490	.	.	.	.	.	T	0.24851	0.0603	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25710	-1.0124	4	.	.	.	.	4.973	0.14125	0.0:0.6525:0.0:0.3475	.	.	.	.	S	15	.	.	P	+	1	0	OLAH	15129336	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.290000	0.08354	0.151000	0.19162	0.484000	0.47621	CCT	OLAH	-	NULL		0.557	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLAH	HGNC	protein_coding	OTTHUMT00000046964.1	C	NM_018324		15089330	+1	no_errors	ENST00000378225	ensembl	human	known	70_37	missense	SNP	0.000	T
OR10Q1	219960	genome.wustl.edu	37	11	57995864	57995864	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:57995864G>A	ENST00000316770.2	-	1	526	c.484C>T	c.(484-486)Cag>Tag	p.Q162*		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GCGGTGAGCTGCAGGGAGGGG	0.652																																																	0													54.0	48.0	50.0					11																	57995864		2201	4295	6496	SO:0001587	stop_gained	219960			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.484C>T	11.37:g.57995864G>A	ENSP00000314324:p.Gln162*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFG4	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q162*	ENST00000316770.2	37	c.484	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	G	11.38	1.620752	0.28889	.	.	ENSG00000180475	ENST00000316770	.	.	.	4.67	3.74	0.42951	.	0.587226	0.14167	N	0.336976	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	12.8933	0.58084	0.0:0.0:0.8361:0.1639	.	.	.	.	X	162	.	ENSP00000314324:Q162X	Q	-	1	0	OR10Q1	57752440	0.000000	0.05858	0.935000	0.37517	0.027000	0.11550	0.078000	0.14761	1.158000	0.42547	0.650000	0.86243	CAG	OR10Q1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.652	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	G	NM_001004471		57995864	-1	no_errors	ENST00000316770	ensembl	human	known	70_37	nonsense	SNP	0.966	A
OR6B3	150681	genome.wustl.edu	37	2	240984708	240984708	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:240984708C>T	ENST00000319423.4	-	1	781	c.782G>A	c.(781-783)cGg>cAg	p.R261Q	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GGCCTGGGGCCGGACATACAT	0.542																																																	0													86.0	94.0	91.0					2																	240984708		1970	4144	6114	SO:0001583	missense	150681				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.782G>A	2.37:g.240984708C>T	ENSP00000322435:p.Arg261Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFH3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R261Q	ENST00000319423.4	37	c.782	CCDS42837.1	2	.	.	.	.	.	.	.	.	.	.	c	16.12	3.033445	0.54896	.	.	ENSG00000178586	ENST00000319423	T	0.37235	1.21	4.09	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42294	D	0.000722	T	0.35595	0.0937	L	0.45285	1.41	0.27927	N	0.938036	P	0.41393	0.748	B	0.44315	0.446	T	0.16748	-1.0392	10	0.27785	T	0.31	.	14.6272	0.68629	0.0:1.0:0.0:0.0	.	261	Q8NGW1	OR6B3_HUMAN	Q	261	ENSP00000322435:R261Q	ENSP00000322435:R261Q	R	-	2	0	OR6B3	240633381	0.001000	0.12720	0.795000	0.32087	0.535000	0.34838	0.146000	0.16180	2.540000	0.85666	0.603000	0.83216	CGG	OR6B3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B3	HGNC	protein_coding	OTTHUMT00000326078.1	C			240984708	-1	no_errors	ENST00000319423	ensembl	human	known	70_37	missense	SNP	0.936	T
PAPD5	64282	genome.wustl.edu	37	16	50265073	50265073	+	3'UTR	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:50265073G>T	ENST00000436909.3	+	0	3966				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		CGTGTAAACTGTGGAAGATTT	0.269																																																	0																																										SO:0001624	3_prime_UTR_variant	64282			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*1834G>T	16.37:g.50265073G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			PAPD5	-	-		0.269	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423149.2	G	NM_022447		50265073	+1	no_errors	ENST00000573002	ensembl	human	known	70_37	rna	SNP	0.025	T
PAPPA2	60676	genome.wustl.edu	37	1	176762738	176762738	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:176762738C>G	ENST00000367662.3	+	20	6227	c.5063C>G	c.(5062-5064)cCc>cGc	p.P1688R		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1688	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCAGTGACCCCGTGATGCTA	0.478																																																	0													189.0	187.0	188.0					1																	176762738		1979	4157	6136	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5063C>G	1.37:g.176762738C>G	ENSP00000356634:p.Pro1688Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.P1688R	ENST00000367662.3	37	c.5063	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113421	0.56398	.	.	ENSG00000116183	ENST00000367662	T	0.01705	4.68	5.17	5.17	0.71159	.	0.124423	0.56097	D	0.000038	T	0.08088	0.0202	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	P	0.61328	0.887	T	0.01652	-1.1303	10	0.66056	D	0.02	-13.0916	15.5755	0.76380	0.0:1.0:0.0:0.0	.	1688	Q9BXP8	PAPP2_HUMAN	R	1688	ENSP00000356634:P1688R	ENSP00000356634:P1688R	P	+	2	0	PAPPA2	175029361	0.889000	0.30405	0.040000	0.18447	0.579000	0.36224	5.426000	0.66476	2.404000	0.81709	0.655000	0.94253	CCC	PAPPA2	-	NULL		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	C			176762738	+1	no_errors	ENST00000367662	ensembl	human	known	70_37	missense	SNP	0.728	G
PAX8	7849	genome.wustl.edu	37	2	113992973	113992973	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:113992973G>C	ENST00000429538.3	-	9	1279	c.1085C>G	c.(1084-1086)tCa>tGa	p.S362*	PAX8_ENST00000397647.3_Intron|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000422956.2_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000431844.2_RNA|PAX8_ENST00000263335.7_Intron|PAX8_ENST00000263334.5_Missense_Mutation_p.Q336E|PAX8_ENST00000348715.5_Missense_Mutation_p.Q336E|AC016683.6_ENST00000456685.1_RNA|AC016683.6_ENST00000437551.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	362					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						TGTCGTACCTGAGAGGAGGGC	0.667			T	PPARG	follicular thyroid		Thyroid dysgenesis																														Ovarian(188;7 2067 9084 29802 29892)			Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	0													15.0	17.0	17.0					2																	113992973		1894	4105	5999	SO:0001587	stop_gained	7849			X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.1085C>G	2.37:g.113992973G>C	ENSP00000395498:p.Ser362*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Nonsense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.S362*	ENST00000429538.3	37	c.1085	CCDS46398.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.484300|8.484300	0.98832|0.98832	.|.	.|.	ENSG00000125618|ENSG00000125618	ENST00000348715;ENST00000263334|ENST00000429538	D;D|.	0.97114|.	-4.25;-4.25|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.415891	.|0.24727	.|N	.|0.036090	T|.	0.64103|.	0.2568|.	.|.	.|.	.|.	0.32831|0.32831	D|D	0.504078|0.504078	B|.	0.31817|.	0.341|.	B|.	0.31101|.	0.124|.	T|.	0.69745|.	-0.5062|.	8|.	0.38643|0.42905	T|T	0.18|0.14	.|.	17.5992|17.5992	0.88021|0.88021	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	336|.	Q06710-3|.	.|.	E|X	336|362	ENSP00000314750:Q336E;ENSP00000263334:Q336E|.	ENSP00000263334:Q336E|ENSP00000395498:S362X	Q|S	-|-	1|2	0|0	PAX8|PAX8	113709444|113709444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	8.019000|8.019000	0.88732|0.88732	2.757000|2.757000	0.94681|0.94681	0.655000|0.655000	0.94253|0.94253	CAG|TCA	PAX8	-	pfam_Pax2_C		0.667	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX8	HGNC	protein_coding	OTTHUMT00000250353.5	G			113992973	-1	no_errors	ENST00000429538	ensembl	human	known	70_37	nonsense	SNP	1.000	C
PCDHA2	56146	genome.wustl.edu	37	5	140176361	140176361	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:140176361C>T	ENST00000526136.1	+	1	1812	c.1812C>T	c.(1810-1812)aaC>aaT	p.N604N	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Silent_p.N604N|PCDHA2_ENST00000520672.2_Silent_p.N604N	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	604	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N604N(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCTACAACGCGTGGCTTT	0.657																																																	2	Substitution - coding silent(2)	large_intestine(2)											154.0	139.0	144.0					5																	140176361		2203	4300	6503	SO:0001819	synonymous_variant	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1812C>T	5.37:g.140176361C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N604	ENST00000526136.1	37	c.1812	CCDS54914.1	5																																																																																			PCDHA2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	C	NM_018905		140176361	+1	no_errors	ENST00000526136	ensembl	human	known	70_37	silent	SNP	1.000	T
PCDHA3	56145	genome.wustl.edu	37	5	140182150	140182150	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:140182150G>A	ENST00000522353.2	+	1	1368	c.1368G>A	c.(1366-1368)tcG>tcA	p.S456S	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Silent_p.S456S|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	456	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCATTCTCGCAGTCCGAGT	0.672																																																	0													94.0	95.0	95.0					5																	140182150		2203	4300	6503	SO:0001819	synonymous_variant	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1368G>A	5.37:g.140182150G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O75286	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S456	ENST00000522353.2	37	c.1368	CCDS54915.1	5																																																																																			PCDHA3	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.672	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	G	NM_018906		140182150	+1	no_errors	ENST00000522353	ensembl	human	known	70_37	silent	SNP	0.004	A
PCDHA3	56145	genome.wustl.edu	37	5	140183041	140183041	+	Missense_Mutation	SNP	G	G	C	rs372857774		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:140183041G>C	ENST00000522353.2	+	1	2259	c.2259G>C	c.(2257-2259)caG>caC	p.Q753H	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.Q753H|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	753	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCGCAGCAGAGGCAGCAGA	0.647																																																	0								G	,,HIS/GLN,,HIS/GLN	0,4406		0,0,2203	90.0	96.0	94.0		,,2259,,2259	3.1	1.0	5		94	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense,intron,missense	PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_031411.1,NM_031497.1	,,24,,24	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	,,,,	,,753/951,,753/825	140183041	1,13005	2203	4300	6503	SO:0001583	missense	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.2259G>C	5.37:g.140183041G>C	ENSP00000429808:p.Gln753His	Somatic		WXS	Illumina HiSeq	Phase_IV	O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q753H	ENST00000522353.2	37	c.2259	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	g	12.81	2.050723	0.36181	0.0	1.16E-4	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.15017	2.46;2.46	4.03	3.13	0.36017	.	0.000000	0.39834	U	0.001259	T	0.26231	0.0640	M	0.91038	3.17	0.20638	N	0.999878	B;B	0.24186	0.099;0.06	B;B	0.26416	0.069;0.047	T	0.33904	-0.9850	10	0.66056	D	0.02	.	5.6531	0.17627	0.1975:0.2179:0.5847:0.0	.	753;753	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	H	753	ENSP00000429808:Q753H;ENSP00000434086:Q753H	ENSP00000429808:Q753H	Q	+	3	2	PCDHA3	140163225	0.758000	0.28405	0.980000	0.43619	0.961000	0.63080	0.249000	0.18216	0.778000	0.33520	0.313000	0.20887	CAG	PCDHA3	-	NULL		0.647	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	G	NM_018906		140183041	+1	no_errors	ENST00000522353	ensembl	human	known	70_37	missense	SNP	0.592	C
PCDHA13	56136	genome.wustl.edu	37	5	140263052	140263052	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:140263052C>G	ENST00000289272.2	+	1	1199	c.1199C>G	c.(1198-1200)aCc>aGc	p.T400S	PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.T400S	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	400	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGTCCACCTACAAGAAC	0.582																																					Melanoma(147;1739 1852 5500 27947 37288)												0													147.0	143.0	144.0					5																	140263052		2203	4300	6503	SO:0001583	missense	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1199C>G	5.37:g.140263052C>G	ENSP00000289272:p.Thr400Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T400S	ENST00000289272.2	37	c.1199	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	C	7.258	0.604581	0.14002	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.51325	0.71;0.71	5.33	4.44	0.53790	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43678	0.1258	N	0.11341	0.13	0.21762	N	0.999557	P;P;P	0.40302	0.712;0.51;0.664	P;B;P	0.56700	0.804;0.401;0.472	T	0.37103	-0.9720	9	0.10636	T	0.68	.	13.2765	0.60189	0.2876:0.7124:0.0:0.0	.	400;400;400	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	S	400	ENSP00000386821:T400S;ENSP00000289272:T400S	ENSP00000289272:T400S	T	+	2	0	PCDHA13	140243236	0.000000	0.05858	0.999000	0.59377	0.611000	0.37282	1.345000	0.33953	1.162000	0.42619	0.561000	0.74099	ACC	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.582	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	C	NM_018904		140263052	+1	no_errors	ENST00000289272	ensembl	human	known	70_37	missense	SNP	0.943	G
PDE4DIP	9659	genome.wustl.edu	37	1	144911895	144911895	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:144911895G>C	ENST00000369354.3	-	16	2403	c.2214C>G	c.(2212-2214)ccC>ccG	p.P738P	PDE4DIP_ENST00000369349.3_Silent_p.P738P|PDE4DIP_ENST00000524974.1_5'Flank|PDE4DIP_ENST00000313382.9_Silent_p.P804P|PDE4DIP_ENST00000530740.1_Silent_p.P875P|PDE4DIP_ENST00000529945.1_Silent_p.P901P|PDE4DIP_ENST00000369359.4_Silent_p.P875P|PDE4DIP_ENST00000369356.4_Silent_p.P738P|PDE4DIP_ENST00000369351.3_Silent_p.P738P|PDE4DIP_ENST00000479408.2_Silent_p.P525P|PDE4DIP_ENST00000313431.9_Silent_p.P901P			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	738					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATGTGGATCTGGGTATGCTGA	0.373			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													235.0	219.0	224.0					1																	144911895		2203	4300	6503	SO:0001819	synonymous_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2214C>G	1.37:g.144911895G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.P738	ENST00000369354.3	37	c.2214	CCDS30824.1	1																																																																																			PDE4DIP	-	NULL		0.373	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	G	NM_022359		144911895	-1	no_errors	ENST00000369356	ensembl	human	known	70_37	silent	SNP	0.649	C
PDHA2	5161	genome.wustl.edu	37	4	96761857	96761857	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:96761857G>T	ENST00000295266.4	+	1	619	c.556G>T	c.(556-558)Gag>Tag	p.E186*		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	186					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		AGGAAACGATGAGATCTGTTT	0.478																																																	0													62.0	67.0	65.0					4																	96761857		2203	4300	6503	SO:0001587	stop_gained	5161				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.556G>T	4.37:g.96761857G>T	ENSP00000295266:p.Glu186*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Nonsense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.E186*	ENST00000295266.4	37	c.556	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812902	0.50527	.	.	ENSG00000163114	ENST00000295266	.	.	.	4.77	2.04	0.26737	.	0.108661	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-23.425	6.3823	0.21542	0.176:0.1573:0.6667:0.0	.	.	.	.	X	186	.	ENSP00000295266:E186X	E	+	1	0	PDHA2	96980880	0.990000	0.36364	0.001000	0.08648	0.196000	0.23810	2.035000	0.41155	0.304000	0.22809	0.467000	0.42956	GAG	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y		0.478	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	G			96761857	+1	no_errors	ENST00000295266	ensembl	human	known	70_37	nonsense	SNP	0.182	T
PEAK1	79834	genome.wustl.edu	37	15	77407290	77407290	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:77407290C>T	ENST00000560626.2	-	7	4924	c.4449G>A	c.(4447-4449)ggG>ggA	p.G1483G	PEAK1_ENST00000312493.4_Silent_p.G1483G			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1483	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CAGGGCTTTTCCCATGCTGGG	0.522																																																	0													82.0	83.0	83.0					15																	77407290		2084	4214	6298	SO:0001819	synonymous_variant	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4449G>A	15.37:g.77407290C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.G1483	ENST00000560626.2	37	c.4449	CCDS42062.1	15																																																																																			PEAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom		0.522	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Uniprot_genename	protein_coding	OTTHUMT00000419483.3	C			77407290	-1	no_errors	ENST00000312493	ensembl	human	known	70_37	silent	SNP	0.028	T
PER3	8863	genome.wustl.edu	37	1	7890188	7890188	+	Missense_Mutation	SNP	G	G	A	rs113009468	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:7890188G>A	ENST00000361923.2	+	18	3329	c.3154G>A	c.(3154-3156)Gaa>Aaa	p.E1052K	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.E1061K	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1052	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTCCCAGCGAATCCCCATC	0.532																																																	0								A	LYS/GLU	0,4406		0,0,2203	111.0	94.0	100.0		3154	1.2	0.0	1	dbSNP_132	100	3,8597	3.0+/-9.4	0,3,4297	yes	missense	PER3	NM_016831.1	56	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	1052/1202	7890188	3,13003	2203	4300	6503	SO:0001583	missense	8863			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3154G>A	1.37:g.7890188G>A	ENSP00000355031:p.Glu1052Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.E1052K	ENST00000361923.2	37	c.3154	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	g	3.881	-0.026006	0.07589	0.0	3.49E-4	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.14640	2.49;2.49	2.17	1.24	0.21308	Period circadian-like, C-terminal (1);	10.663500	0.04599	U	0.398235	T	0.12263	0.0298	L	0.34521	1.04	0.09310	N	1	P;B;B;B;B	0.37914	0.611;0.088;0.088;0.072;0.088	B;B;B;B;B	0.38655	0.278;0.03;0.03;0.018;0.03	T	0.31696	-0.9934	10	0.33141	T	0.24	.	6.1906	0.20522	0.155:0.0:0.845:0.0	.	101;1052;1061;1061;1052	B4DR65;A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;.;PER3_HUMAN	K	1061;1052;245	ENSP00000366755:E1061K;ENSP00000355031:E1052K	ENSP00000355031:E1052K	E	+	1	0	PER3	7812775	0.024000	0.19004	0.000000	0.03702	0.001000	0.01503	0.402000	0.20965	0.140000	0.18849	-0.642000	0.03964	GAA	PER3	-	pfam_Period_circadian-like_C		0.532	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	G	NM_016831		7890188	+1	no_errors	ENST00000361923	ensembl	human	known	70_37	missense	SNP	0.005	A
PHLDB3	653583	genome.wustl.edu	37	19	43999435	43999435	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:43999435G>A	ENST00000292140.5	-	8	1368	c.1008C>T	c.(1006-1008)ttC>ttT	p.F336F		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	336							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TGGGCTCAGAGAAGTCCCCGC	0.577																																																	0													46.0	50.0	49.0					19																	43999435		2013	4170	6183	SO:0001819	synonymous_variant	653583				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1008C>T	19.37:g.43999435G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7Z4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F336	ENST00000292140.5	37	c.1008	CCDS12621.2	19																																																																																			PHLDB3	-	NULL		0.577	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	G			43999435	-1	no_errors	ENST00000292140	ensembl	human	known	70_37	silent	SNP	0.998	A
LRRC7	57554	genome.wustl.edu	37	1	70385044	70385044	+	Intron	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:70385044C>T	ENST00000035383.5	+	6	563				PIN1P1_ENST00000412108.1_RNA|LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GGAAAGATGGCGGACGAGGAG	0.483																																																	0																																										SO:0001627	intron_variant	5301				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-12146C>T	1.37:g.70385044C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	-	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			PIN1P1	-	-		0.483	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	HGNC	protein_coding	OTTHUMT00000131261.1	C	NM_020794		70385044	+1	no_errors	ENST00000412108	ensembl	human	known	70_37	rna	SNP	0.992	T
PLXNA4	91584	genome.wustl.edu	37	7	132169754	132169754	+	Intron	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:132169754G>T	ENST00000359827.3	-	3	2334				PLXNA4_ENST00000423507.2_Intron|PLXNA4_ENST00000378539.5_Missense_Mutation_p.Q464K|PLXNA4_ENST00000321063.4_Intron			Q9HCM2	PLXA4_HUMAN	plexin A4						anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATTCCCCCTTGTGGACCTGTG	0.438																																																	0													60.0	62.0	61.0					7																	132169754		2203	4300	6503	SO:0001627	intron_variant	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1371+4296C>A	7.37:g.132169754G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	p.Q464K	ENST00000359827.3	37	c.1390	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	G	2.761	-0.257814	0.05791	.	.	ENSG00000221866	ENST00000378539	T	0.04360	3.64	1.92	-1.24	0.09435	.	.	.	.	.	T	0.02342	0.0072	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.47911	-0.9080	9	0.07325	T	0.83	.	0.8511	0.01172	0.2057:0.3431:0.2808:0.1704	.	464	A4D1N6	.	K	464	ENSP00000367800:Q464K	ENSP00000367800:Q464K	Q	-	1	0	PLXNA4	131820294	0.001000	0.12720	0.001000	0.08648	0.029000	0.11900	-0.074000	0.11450	-0.417000	0.07461	-0.258000	0.10820	CAA	PLXNA4	-	superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.438	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	G	NM_181775		132169754	-1	no_errors	ENST00000378539	ensembl	human	known	70_37	missense	SNP	0.001	T
PLXNB2	23654	genome.wustl.edu	37	22	50726395	50726395	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:50726395G>C	ENST00000449103.1	-	6	1592	c.1452C>G	c.(1450-1452)ccC>ccG	p.P484P	PLXNB2_ENST00000359337.4_Silent_p.P484P|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	484					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGCCGCAGTAGGGGTCCTGGG	0.716																																																	0													8.0	12.0	11.0					22																	50726395		2003	4150	6153	SO:0001819	synonymous_variant	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1452C>G	22.37:g.50726395G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.P484	ENST00000449103.1	37	c.1452	CCDS43035.1	22																																																																																			PLXNB2	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like		0.716	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	G	NM_012401		50726395	-1	no_errors	ENST00000359337	ensembl	human	known	70_37	silent	SNP	0.946	C
PLXNC1	10154	genome.wustl.edu	37	12	94691184	94691184	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:94691184G>A	ENST00000258526.4	+	26	4308	c.4059G>A	c.(4057-4059)aaG>aaA	p.K1353K	PLXNC1_ENST00000547057.1_Silent_p.K400K|PLXNC1_ENST00000545312.1_Silent_p.K92K	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1353					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ATCTGACAAAGCTGCTGTCGA	0.418																																																	0													81.0	74.0	77.0					12																	94691184		2203	4300	6503	SO:0001819	synonymous_variant	10154			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4059G>A	12.37:g.94691184G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q59H25	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Plexin_repeat,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Plexin-like_fold,superfamily_Ig_E-set,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.K1353	ENST00000258526.4	37	c.4059	CCDS9049.1	12																																																																																			PLXNC1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.418	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	HGNC	protein_coding	OTTHUMT00000408126.2	G			94691184	+1	no_errors	ENST00000258526	ensembl	human	known	70_37	silent	SNP	1.000	A
POFUT1	23509	genome.wustl.edu	37	20	30797944	30797944	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:30797944G>C	ENST00000375749.3	+	2	257	c.195G>C	c.(193-195)ttG>ttC	p.L65F	POFUT1_ENST00000486717.1_Intron|PLAGL2_ENST00000246229.4_5'Flank|POFUT1_ENST00000539210.1_Intron|POFUT1_ENST00000375730.3_Missense_Mutation_p.L65F	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	65					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACCGTACCTTGGCTGTCCCTC	0.537																																																	0													254.0	205.0	222.0					20																	30797944		2203	4300	6503	SO:0001583	missense	23509			AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.195G>C	20.37:g.30797944G>C	ENSP00000364902:p.Leu65Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	pfam_GDP-Fuc_O-FucTrfase	p.L65F	ENST00000375749.3	37	c.195	CCDS13198.1	20	.	.	.	.	.	.	.	.	.	.	G	15.72	2.917549	0.52546	.	.	ENSG00000101346	ENST00000375749;ENST00000375730	T;T	0.73469	-0.75;-0.75	4.87	3.9	0.45041	.	0.000000	0.85682	D	0.000000	D	0.86066	0.5844	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85133	0.0976	10	0.87932	D	0	-34.9264	4.9586	0.14054	0.1853:0.0:0.6479:0.1668	.	65;65	Q9H488;Q9H488-2	OFUT1_HUMAN;.	F	65	ENSP00000364902:L65F;ENSP00000364882:L65F	ENSP00000364882:L65F	L	+	3	2	POFUT1	30261605	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	1.421000	0.34815	0.987000	0.38709	0.462000	0.41574	TTG	POFUT1	-	pfam_GDP-Fuc_O-FucTrfase		0.537	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT1	HGNC	protein_coding	OTTHUMT00000078613.1	G	NM_015352		30797944	+1	no_errors	ENST00000375749	ensembl	human	known	70_37	missense	SNP	1.000	C
PORCN	64840	genome.wustl.edu	37	X	48374454	48374454	+	Missense_Mutation	SNP	C	C	T	rs398124616		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:48374454C>T	ENST00000326194.6	+	12	1136	c.1093C>T	c.(1093-1095)Cgg>Tgg	p.R365W	PORCN_ENST00000359882.4_Missense_Mutation_p.R359W|PORCN_ENST00000537758.1_Missense_Mutation_p.R365W|PORCN_ENST00000355961.4_Missense_Mutation_p.R360W|PORCN_ENST00000361988.3_Missense_Mutation_p.R354W|PORCN_ENST00000355092.3_Missense_Mutation_p.R359W|PORCN_ENST00000367574.4_Missense_Mutation_p.R283W	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	365			R -> G (in FODH). {ECO:0000269|PubMed:17546030, ECO:0000269|PubMed:19309688}.|R -> Q (in FODH). {ECO:0000269|PubMed:18325042, ECO:0000269|PubMed:19309688, ECO:0000269|PubMed:19586929, ECO:0000269|PubMed:19863546, ECO:0000269|PubMed:21472892}.		glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTAGTCCTCCGGAAGCGCCT	0.642																																																	0			GRCh37	CM073268	PORCN	M							59.0	54.0	56.0					X																	48374454		2203	4300	6503	SO:0001583	missense	64840			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1093C>T	X.37:g.48374454C>T	ENSP00000322304:p.Arg365Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	pfam_MBOAT_fam	p.R365W	ENST00000326194.6	37	c.1093	CCDS14299.1	X	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535511	0.64972	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	5.53	2.49	0.30216	.	0.053129	0.64402	D	0.000001	D	0.83603	0.5290	M	0.86268	2.805	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.99;0.998;0.999;0.99;0.99	D	0.84359	0.0537	10	0.87932	D	0	-7.2856	11.4238	0.49998	0.4773:0.5227:0.0:0.0	.	359;365;283;354;360	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	W	359;365;283;360;354;365;359	ENSP00000352946:R359W;ENSP00000446401:R365W;ENSP00000356546:R283W;ENSP00000348233:R360W;ENSP00000354978:R354W;ENSP00000322304:R365W;ENSP00000347207:R359W	ENSP00000322304:R365W	R	+	1	2	PORCN	48259398	0.991000	0.36638	0.998000	0.56505	0.839000	0.47603	1.350000	0.34010	0.455000	0.26910	0.529000	0.55759	CGG	PORCN	-	pfam_MBOAT_fam		0.642	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	HGNC	protein_coding	OTTHUMT00000356990.1	C	NM_022825		48374454	+1	no_errors	ENST00000326194	ensembl	human	known	70_37	missense	SNP	1.000	T
PPP1R12A	4659	genome.wustl.edu	37	12	80266643	80266643	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:80266643C>T	ENST00000450142.2	-	2	579	c.313G>A	c.(313-315)Gaa>Aaa	p.E105K	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.E105K|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.E18K|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.E105K|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.E105K	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	105					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						ATCCAGCCTTCATTATCAGGT	0.358																																																	0													120.0	115.0	117.0					12																	80266643		1919	4185	6104	SO:0001583	missense	4659			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.313G>A	12.37:g.80266643C>T	ENSP00000389168:p.Glu105Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E105K	ENST00000450142.2	37	c.313	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.486675	0.96323	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000550510	T;T;T;D;T;T;T	0.82433	-0.16;-0.16;-0.16;-1.61;-0.16;-0.04;0.62	5.25	5.25	0.73442	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	L	0.31120	0.905	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.999;0.998	D;D;D;D	0.91635	0.988;0.999;0.993;0.993	D	0.88699	0.3214	10	0.87932	D	0	.	19.1984	0.93699	0.0:1.0:0.0:0.0	.	105;105;105;105	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	K	105;105;105;105;105;105;105;18;105;105;33	ENSP00000261207:E105K;ENSP00000389168:E105K;ENSP00000416769:E105K;ENSP00000449514:E18K;ENSP00000446855:E105K;ENSP00000446816:E105K;ENSP00000447338:E33K	ENSP00000261207:E105K	E	-	1	0	PPP1R12A	78790774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.857000	0.69525	2.596000	0.87737	0.585000	0.79938	GAA	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.358	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	C	NM_002480		80266643	-1	no_errors	ENST00000261207	ensembl	human	known	70_37	missense	SNP	1.000	T
PPP1R15A	23645	genome.wustl.edu	37	19	49377387	49377387	+	Silent	SNP	C	C	G	rs138608463		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:49377387C>G	ENST00000200453.5	+	2	1166	c.897C>G	c.(895-897)ctC>ctG	p.L299L		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	299	Glu-rich.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GGCCCCAGCTCAAGTCCTGGT	0.602																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	55.0	64.0	61.0		897	1.1	0.0	19	dbSNP_134	61	0,8600		0,0,4300	no	coding-synonymous	PPP1R15A	NM_014330.3		0,1,6502	GG,GC,CC		0.0,0.0227,0.0077		299/675	49377387	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.897C>G	19.37:g.49377387C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKQ3|Q6IA96|Q9NVU6	Silent	SNP	pfam_Prot_Pase1_reg-su15A/B_C	p.L299	ENST00000200453.5	37	c.897	CCDS12738.1	19																																																																																			PPP1R15A	-	NULL		0.602	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	HGNC	protein_coding	OTTHUMT00000466226.1	C	NM_014330		49377387	+1	no_errors	ENST00000200453	ensembl	human	known	70_37	silent	SNP	0.000	G
PPP1R9A	55607	genome.wustl.edu	37	7	94540010	94540010	+	Silent	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:94540010T>C	ENST00000433881.1	+	2	1117	c.585T>C	c.(583-585)acT>acC	p.T195T	PPP1R9A_ENST00000433360.1_Silent_p.T195T|PPP1R9A_ENST00000340694.4_Silent_p.T195T|PPP1R9A_ENST00000424654.1_Silent_p.T195T|PPP1R9A_ENST00000456331.2_Silent_p.T195T|PPP1R9A_ENST00000289495.5_Silent_p.T195T			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	195					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GCTCCCGAACTGAGGCTGTCT	0.483										HNSCC(28;0.073)																																							0													77.0	71.0	73.0					7																	94540010		2203	4300	6503	SO:0001819	synonymous_variant	55607			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.585T>C	7.37:g.94540010T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.T195	ENST00000433881.1	37	c.585	CCDS34683.1	7																																																																																			PPP1R9A	-	NULL		0.483	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	T	NM_001166160		94540010	+1	no_errors	ENST00000289495	ensembl	human	known	70_37	silent	SNP	0.000	C
PRX	57716	genome.wustl.edu	37	19	40902578	40902578	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:40902578C>T	ENST00000324001.7	-	7	1951	c.1681G>A	c.(1681-1683)Gag>Aag	p.E561K	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	561	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACAGCCACCTCTGACACCTCT	0.562																																																	0													97.0	111.0	107.0					19																	40902578		2200	4297	6497	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1681G>A	19.37:g.40902578C>T	ENSP00000326018:p.Glu561Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E561K	ENST00000324001.7	37	c.1681	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	9.322	1.058292	0.19987	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01947	4.54	4.58	4.58	0.56647	.	0.124126	0.36591	N	0.002507	T	0.07638	0.0192	M	0.70595	2.14	0.20873	N	0.999835	D	0.65815	0.995	D	0.63033	0.91	T	0.24764	-1.0151	10	0.11485	T	0.65	.	10.713	0.45995	0.0:0.8065:0.1935:0.0	.	561	Q9BXM0	PRAX_HUMAN	K	561	ENSP00000326018:E561K	ENSP00000326018:E561K	E	-	1	0	PRX	45594418	.	.	1.000000	0.80357	0.039000	0.13416	.	.	2.359000	0.80004	0.563000	0.77884	GAG	PRX	-	NULL		0.562	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	C	NM_020956		40902578	-1	no_errors	ENST00000324001	ensembl	human	known	70_37	missense	SNP	0.232	T
PSG11	5680	genome.wustl.edu	37	19	43529135	43529135	+	Silent	SNP	G	G	T	rs112359091	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:43529135G>T	ENST00000401740.1	-	2	241	c.138C>A	c.(136-138)tcC>tcA	p.S46S	PSG11_ENST00000320078.7_Silent_p.S46S|PSG11_ENST00000403486.1_Intron|PSG11_ENST00000306322.7_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	46	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				CCTTCCCCTCGGACACTTTGG	0.468																																																	0													194.0	198.0	197.0					19																	43529135		2201	4295	6496	SO:0001819	synonymous_variant	5680			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.138C>A	19.37:g.43529135G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S46	ENST00000401740.1	37	c.138	CCDS12614.2	19																																																																																			PSG11	-	pfam_Ig_V-set,smart_Ig_sub		0.468	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	HGNC	protein_coding	OTTHUMT00000323079.1	G	NM_002785		43529135	-1	no_errors	ENST00000320078	ensembl	human	known	70_37	silent	SNP	0.000	T
PPP5C	5536	genome.wustl.edu	37	19	46887119	46887119	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:46887119C>T	ENST00000012443.4	+	6	885	c.782C>T	c.(781-783)tCg>tTg	p.S261L	AC007193.9_ENST00000599645.1_RNA|PPP5C_ENST00000391919.1_Missense_Mutation_p.S133L	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	261	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		GGTTTACCCTCGGAGACCAAC	0.557																																																	0													131.0	123.0	126.0					19																	46887119		2203	4300	6503	SO:0001583	missense	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.782C>T	19.37:g.46887119C>T	ENSP00000012443:p.Ser261Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16722|Q53XV2	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_PPP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ser/Thr-sp_prot-phosphatase	p.S261L	ENST00000012443.4	37	c.782	CCDS12684.1	19	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883655	0.91740	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.06142	3.34;3.34	4.6	4.6	0.57074	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.32041	0.0816	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.986	D;D;P	0.69307	0.963;0.952;0.862	T	0.41360	-0.9513	10	0.62326	D	0.03	-5.1052	14.9379	0.70970	0.0:1.0:0.0:0.0	.	119;261;261	B7Z1I1;B2R6R6;P53041	.;.;PPP5_HUMAN	L	261;248;133	ENSP00000012443:S261L;ENSP00000375786:S133L	ENSP00000012443:S261L	S	+	2	0	PPP5C	51578959	1.000000	0.71417	0.979000	0.43373	0.984000	0.73092	7.468000	0.80943	2.111000	0.64477	0.467000	0.42956	TCG	PPP5C	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,prints_Ser/Thr-sp_prot-phosphatase		0.557	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	HGNC	protein_coding	OTTHUMT00000258969.2	C	NM_006247		46887119	+1	no_errors	ENST00000012443	ensembl	human	known	70_37	missense	SNP	0.996	T
PSKH2	85481	genome.wustl.edu	37	8	87076347	87076347	+	Silent	SNP	A	A	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:87076347A>C	ENST00000276616.2	-	2	773	c.699T>G	c.(697-699)gtT>gtG	p.V233V	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			TCCTTAGCAAAACCTCAGGAG	0.448																																																	0													90.0	88.0	88.0					8																	87076347		2203	4300	6503	SO:0001819	synonymous_variant	85481			AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.699T>G	8.37:g.87076347A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV22	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V233	ENST00000276616.2	37	c.699	CCDS6240.1	8																																																																																			PSKH2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.448	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH2	HGNC	protein_coding	OTTHUMT00000374628.1	A	NM_033126		87076347	-1	no_errors	ENST00000276616	ensembl	human	known	70_37	silent	SNP	0.841	C
PTCHD1	139411	genome.wustl.edu	37	X	23412156	23412157	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:23412156_23412157insT	ENST00000379361.4	+	3	3381_3382	c.2521_2522insT	c.(2521-2523)attfs	p.I841fs		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	841					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTGCTTTGCCATTTTACCTGTG	0.416																																																	0																																										SO:0001589	frameshift_variant	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2525dupT	X.37:g.23412160_23412160dupT	ENSP00000368666:p.Ile841fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQH0|Q0IJ60|Q6P6B8	Frame_Shift_Ins	INS	pfam_Patched,pfscan_SSD	p.L842fs	ENST00000379361.4	37	c.2521_2522	CCDS35215.2	X																																																																																			PTCHD1	-	pfam_Patched		0.416	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	-	NM_173495		23412157	+1	no_errors	ENST00000379361	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	T
RAD54L2	23132	genome.wustl.edu	37	3	51671320	51671320	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:51671320C>G	ENST00000409535.2	+	10	1608	c.1483C>G	c.(1483-1485)Ctg>Gtg	p.L495V	RAD54L2_ENST00000296477.3_Missense_Mutation_p.L189V	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	495	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TGGGTACCCTCTGCAAAACAA	0.562																																																	0													80.0	66.0	71.0					3																	51671320		2203	4300	6503	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.1483C>G	3.37:g.51671320C>G	ENSP00000386520:p.Leu495Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L495V	ENST00000409535.2	37	c.1483	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.34|18.34	3.602368|3.602368	0.66445|0.66445	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	D;D|.	0.93307|.	-3.2;-3.2|.	5.31|5.31	4.3|4.3	0.51218|0.51218	DEAD-like helicase (2);SNF2-related (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56731|0.56731	0.2005|0.2005	L|L	0.49640|0.49640	1.575|1.575	0.58432|0.58432	D|D	0.999994|0.999994	D;D|.	0.89917|.	1.0;0.995|.	D;D|.	0.97110|.	1.0;0.971|.	T|T	0.52624|0.52624	-0.8551|-0.8551	10|5	0.66056|.	D|.	0.02|.	-8.1768|-8.1768	7.9054|7.9054	0.29759|0.29759	0.0:0.785:0.0:0.215|0.0:0.785:0.0:0.215	.|.	495;86|.	Q9Y4B4;B3KV54|.	ARIP4_HUMAN;.|.	V|C	495;189|323	ENSP00000386520:L495V;ENSP00000296477:L189V|.	ENSP00000296477:L189V|.	L|S	+|+	1|2	2|0	RAD54L2|RAD54L2	51646360|51646360	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.256000|3.256000	0.51492|0.51492	0.992000|0.992000	0.38840|0.38840	0.561000|0.561000	0.74099|0.74099	CTG|TCT	RAD54L2	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.562	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	C	NM_015106		51671320	+1	no_errors	ENST00000409535	ensembl	human	known	70_37	missense	SNP	0.999	G
RANBP6	26953	genome.wustl.edu	37	9	6012865	6012865	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:6012865G>A	ENST00000259569.5	-	1	2753	c.2743C>T	c.(2743-2745)Cgg>Tgg	p.R915W	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	915					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATTGGCCACCGAAAATATTCT	0.443																																																	0													67.0	63.0	65.0					9																	6012865		2203	4300	6503	SO:0001583	missense	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2743C>T	9.37:g.6012865G>A	ENSP00000259569:p.Arg915Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.R915W	ENST00000259569.5	37	c.2743	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906956	0.33628	.	.	ENSG00000137040	ENST00000259569	T	0.68181	-0.31	4.46	2.6	0.31112	Armadillo-like helical (1);Armadillo-type fold (2);	0.151374	0.44688	D	0.000433	T	0.33876	0.0878	N	0.08118	0	0.32978	D	0.523207	P;P;P	0.44627	0.839;0.737;0.839	B;B;B	0.23275	0.045;0.031;0.045	T	0.52555	-0.8560	10	0.72032	D	0.01	-7.4196	7.5938	0.28035	0.0892:0.0:0.7465:0.1644	.	82;503;915	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	W	915	ENSP00000259569:R915W	ENSP00000259569:R915W	R	-	1	2	RANBP6	6002865	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.352000	0.59404	0.796000	0.33947	0.650000	0.86243	CGG	RANBP6	-	superfamily_ARM-type_fold		0.443	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1	G	NM_012416		6012865	-1	no_errors	ENST00000259569	ensembl	human	known	70_37	missense	SNP	1.000	A
RBM34	23029	genome.wustl.edu	37	1	235294965	235294965	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:235294965C>T	ENST00000408888.3	-	0	1586				TOMM20_ENST00000366607.4_5'Flank|RBM34_ENST00000366606.3_3'UTR|RBM34_ENST00000495224.1_5'UTR			P42696	RBM34_HUMAN	RNA binding motif protein 34							nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			ACGATGCTATCAGCAGATAAT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	23029				CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.*63G>A	1.37:g.235294965C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8J7|Q8N2Z8|Q9H5A1	RNA	SNP	-	NULL	ENST00000408888.3	37	NULL	CCDS41477.2	1																																																																																			RBM34	-	-		0.373	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM34	HGNC	protein_coding	OTTHUMT00000100146.1	C	NM_015014		235294965	-1	no_errors	ENST00000495224	ensembl	human	known	70_37	rna	SNP	0.002	T
RBM39	9584	genome.wustl.edu	37	20	34297229	34297229	+	Intron	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:34297229C>G	ENST00000253363.6	-	13	1198				RBM39_ENST00000407261.4_Intron|RBM39_ENST00000528062.3_Intron|RBM39_ENST00000361162.6_Intron			Q14498	RBM39_HUMAN	RNA binding motif protein 39						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TGAAGAGCCTCAACTAACAGG	0.398																																																	0													68.0	64.0	65.0					20																	34297229		2203	4300	6503	SO:0001627	intron_variant	9584			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1175-33G>C	20.37:g.34297229C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	RNA	SNP	-	NULL	ENST00000253363.6	37	NULL	CCDS13266.1	20																																																																																			RBM39	-	-		0.398	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	C	NM_184237		34297229	-1	no_errors	ENST00000476806	ensembl	human	known	70_37	rna	SNP	1.000	G
RFPL1	5988	genome.wustl.edu	37	22	29833658	29833658	+	5'Flank	SNP	C	C	T	rs554523541		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:29833658C>T	ENST00000354373.2	+	0	0				RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1								zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						GTGCCCCTTCCGCACAAGACC	0.522													-|||	1	0.000199681	0.0	0.0	5008	,	,		16385	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001631	upstream_gene_variant	10740			AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516		22.37:g.29833658C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IC06|Q9UJ97	RNA	SNP	-	NULL	ENST00000354373.2	37	NULL	CCDS13857.2	22																																																																																			RFPL1-AS1	-	-		0.522	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1-AS1	HGNC	protein_coding	OTTHUMT00000318719.1	C	NM_021026		29833658	-1	no_errors	ENST00000461286	ensembl	human	known	70_37	rna	SNP	0.001	T
RFX2	5990	genome.wustl.edu	37	19	6047497	6047497	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:6047497G>T	ENST00000303657.5	-	2	160	c.11C>A	c.(10-12)tCc>tAc	p.S4Y	RFX2_ENST00000359161.3_Missense_Mutation_p.S4Y|RFX2_ENST00000592546.1_Missense_Mutation_p.S4Y	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TCCACCCTCGGAATTCTGCAT	0.617											OREG0025192	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(38;171 817 19800 47433 48051)												0													25.0	24.0	24.0					19																	6047497		2190	4299	6489	SO:0001583	missense	5990				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.11C>A	19.37:g.6047497G>T	ENSP00000306335:p.Ser4Tyr	Somatic	631	WXS	Illumina HiSeq	Phase_IV	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.S4Y	ENST00000303657.5	37	c.11	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625210	0.87560	.	.	ENSG00000087903	ENST00000303657;ENST00000359161	T;T	0.43294	0.95;0.95	4.81	4.81	0.61882	RFX1 transcription activation region (1);	0.141154	0.49916	D	0.000121	T	0.61590	0.2359	M	0.73598	2.24	0.58432	D	0.999999	P;P	0.48503	0.891;0.911	P;P	0.57846	0.735;0.828	T	0.67317	-0.5701	10	0.87932	D	0	-20.7022	16.4655	0.84077	0.0:0.0:1.0:0.0	.	4;4	P48378-2;P48378	.;RFX2_HUMAN	Y	4	ENSP00000306335:S4Y;ENSP00000352076:S4Y	ENSP00000306335:S4Y	S	-	2	0	RFX2	5998497	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	6.918000	0.75788	2.180000	0.69256	0.591000	0.81541	TCC	RFX2	-	pfam_RFX1_trans_act		0.617	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	G	NM_000635		6047497	-1	no_errors	ENST00000303657	ensembl	human	known	70_37	missense	SNP	1.000	T
RFX3	5991	genome.wustl.edu	37	9	3275524	3275524	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:3275524C>G	ENST00000382004.3	-	10	1373	c.1062G>C	c.(1060-1062)caG>caC	p.Q354H	RFX3_ENST00000302303.1_Missense_Mutation_p.Q354H|RFX3_ENST00000358730.2_Missense_Mutation_p.Q354H	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	354					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TATAAAGACTCTGCAGTGACT	0.393																																																	0													122.0	115.0	117.0					9																	3275524		2203	4300	6503	SO:0001583	missense	5991			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1062G>C	9.37:g.3275524C>G	ENSP00000371434:p.Gln354His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.Q354H	ENST00000382004.3	37	c.1062	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162727	0.57368	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303	T;T;T	0.08370	3.1;3.1;3.1	5.72	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	M	0.72353	2.195	0.80722	D	1	D;B;B	0.69078	0.997;0.049;0.036	D;B;B	0.66716	0.946;0.077;0.022	T	0.08166	-1.0735	10	0.15499	T	0.54	-8.0888	14.694	0.69107	0.0:0.9305:0.0:0.0695	.	354;354;354	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	H	354	ENSP00000371434:Q354H;ENSP00000351574:Q354H;ENSP00000303847:Q354H	ENSP00000303847:Q354H	Q	-	3	2	RFX3	3265524	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.068000	0.57534	1.422000	0.47177	0.650000	0.86243	CAG	RFX3	-	NULL		0.393	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	C	NM_002919		3275524	-1	no_errors	ENST00000382004	ensembl	human	known	70_37	missense	SNP	1.000	G
RGS3	5998	genome.wustl.edu	37	9	116357919	116357919	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:116357919C>A	ENST00000374140.2	+	25	3494	c.3285C>A	c.(3283-3285)ttC>ttA	p.F1095L	RGS3_ENST00000374134.3_Missense_Mutation_p.F416L|RGS3_ENST00000342620.5_Missense_Mutation_p.F65L|RGS3_ENST00000394646.3_Missense_Mutation_p.F488L|RGS3_ENST00000343817.5_Missense_Mutation_p.F814L|RGS3_ENST00000350696.5_Missense_Mutation_p.F1095L|RGS3_ENST00000462403.1_Missense_Mutation_p.F208L|RGS3_ENST00000462143.1_Missense_Mutation_p.F416L	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	1095	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GCACTGAGTTCAGTGAGGAGA	0.507																																																	0													210.0	165.0	180.0					9																	116357919		2203	4300	6503	SO:0001583	missense	5998			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3285C>A	9.37:g.116357919C>A	ENSP00000363255:p.Phe1095Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_C2_Ca-dep,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,smart_Regulat_G_prot_signal,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.F1095L	ENST00000374140.2	37	c.3285	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555808	0.86231	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000394646;ENST00000474719;ENST00000462143;ENST00000342620;ENST00000374134;ENST00000462403	T;T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	5.37	-0.703	0.11261	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.54415	0.1857	M	0.84683	2.71	0.50632	D	0.999884	D;P;D;D;D;D	0.71674	0.994;0.944;0.997;0.997;0.998;0.996	D;D;D;D;D;D	0.79784	0.952;0.946;0.984;0.988;0.993;0.993	T	0.57590	-0.7785	10	0.87932	D	0	.	11.9604	0.53005	0.0:0.8515:0.0:0.1485	.	488;208;991;814;985;1095	B3KUB2;Q5VZ06;P49796-6;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	L	1095;1095;814;488;263;416;65;416;208	ENSP00000363255:F1095L;ENSP00000259406:F1095L;ENSP00000340284:F814L;ENSP00000378141:F488L;ENSP00000420356:F416L;ENSP00000343359:F65L;ENSP00000363249:F416L;ENSP00000436168:F208L	ENSP00000343359:F65L	F	+	3	2	RGS3	115397740	1.000000	0.71417	0.972000	0.41901	0.933000	0.57130	1.349000	0.33998	-0.416000	0.07473	0.456000	0.33151	TTC	RGS3	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal		0.507	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	C	NM_017790		116357919	+1	no_errors	ENST00000350696	ensembl	human	known	70_37	missense	SNP	1.000	A
RHBG	57127	genome.wustl.edu	37	1	156354578	156354578	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:156354578G>A	ENST00000368249.1	+	10	1357	c.1319G>A	c.(1318-1320)cGa>cAa	p.R440Q	RHBG_ENST00000400992.2_Missense_Mutation_p.R408Q|RHBG_ENST00000368246.2_Missense_Mutation_p.E439K|RHBG_ENST00000255013.3_Missense_Mutation_p.R371Q|RHBG_ENST00000494874.1_3'UTR	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	440					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.R440Q(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GGTGCCTGGCGAGCATGAGGA	0.602											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	large_intestine(1)											48.0	56.0	53.0					1																	156354578		2001	4156	6157	SO:0001583	missense	57127			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1319G>A	1.37:g.156354578G>A	ENSP00000357232:p.Arg440Gln	Somatic	1777	WXS	Illumina HiSeq	Phase_IV	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.E439K	ENST00000368249.1	37	c.1315		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.561|9.561	1.118492|1.118492	0.20877|0.20877	.|.	.|.	ENSG00000132677|ENSG00000132677	ENST00000368246|ENST00000368249;ENST00000400992;ENST00000255013	T|T;T;T	0.19532|0.24538	2.14|2.04;1.85;1.87	5.55|5.55	2.46|2.46	0.29980|0.29980	.|.	.|0.567013	.|0.17914	.|N	.|0.157760	T|T	0.02649|0.02649	0.0080|0.0080	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P;B	.|0.39071	.|0.658;0.305	.|B;B	.|0.26310	.|0.068;0.031	T|T	0.40117|0.40117	-0.9580|-0.9580	7|10	0.54805|0.16896	T|T	0.06|0.51	-15.2438|-15.2438	8.5837|8.5837	0.33644|0.33644	0.0:0.3185:0.5169:0.1646|0.0:0.3185:0.5169:0.1646	.|.	.|408;477	.|Q9H310-3;Q5SZW5	.|.;.	K|Q	439|440;408;371	ENSP00000357229:E439K|ENSP00000357232:R440Q;ENSP00000383777:R408Q;ENSP00000255013:R371Q	ENSP00000357229:E439K|ENSP00000255013:R371Q	E|R	+|+	1|2	0|0	RHBG|RHBG	154621202|154621202	0.176000|0.176000	0.23096|0.23096	0.046000|0.046000	0.18839|0.18839	0.117000|0.117000	0.20001|0.20001	2.039000|2.039000	0.41193|0.41193	0.702000|0.702000	0.31825|0.31825	-0.225000|-0.225000	0.12378|0.12378	GAG|CGA	RHBG	-	NULL		0.602	RHBG-001	NOVEL	basic	protein_coding	RHBG	HGNC	protein_coding	OTTHUMT00000060589.2	G	NM_001256395		156354578	+1	no_errors	ENST00000368246	ensembl	human	known	70_37	missense	SNP	0.010	A
RHNO1	83695	genome.wustl.edu	37	12	2997539	2997539	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:2997539G>C	ENST00000489288.2	+	3	783	c.631G>C	c.(631-633)Gtc>Ctc	p.V211L	TULP3_ENST00000397132.2_5'Flank|TULP3_ENST00000448120.2_5'Flank|RHNO1_ENST00000461997.2_Missense_Mutation_p.V197L|RHNO1_ENST00000464682.2_3'UTR	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	211					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											TGGAATAAAGGTCACATGGAG	0.512																																																	0													73.0	70.0	71.0					12																	2997539		2203	4300	6503	SO:0001583	missense	83695			AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.631G>C	12.37:g.2997539G>C	ENSP00000438590:p.Val211Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z989	Missense_Mutation	SNP	NULL	p.V211L	ENST00000489288.2	37	c.631	CCDS8518.1	12	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373208	0.61624	.	.	ENSG00000171792	ENST00000461997;ENST00000489288	.	.	.	5.21	4.32	0.51571	.	0.184740	0.37761	N	0.001949	T	0.62478	0.2431	.	.	.	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.51999	0.687;0.687	T	0.63070	-0.6719	8	0.41790	T	0.15	-13.1499	11.1196	0.48281	0.0866:0.0:0.9134:0.0	.	197;211	B7Z989;Q9BSD3	.;RHINO_HUMAN	L	197;211	.	ENSP00000438828:V197L	V	+	1	0	C12orf32	2867800	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	5.318000	0.65829	1.326000	0.45319	0.655000	0.94253	GTC	RHNO1	-	NULL		0.512	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHNO1	HGNC	protein_coding	OTTHUMT00000351286.2	G	NM_031465		2997539	+1	no_errors	ENST00000489288	ensembl	human	known	70_37	missense	SNP	1.000	C
RPRD1B	58490	genome.wustl.edu	37	20	36694563	36694563	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:36694563G>T	ENST00000373433.4	+	6	1138	c.736G>T	c.(736-738)Gca>Tca	p.A246S		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	246					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						GCGCCTGGCAGCAGAACTGGA	0.468																																																	0													86.0	100.0	95.0					20																	36694563		2203	4300	6503	SO:0001583	missense	58490			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.736G>T	20.37:g.36694563G>T	ENSP00000362532:p.Ala246Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q1WDE7|Q6PKF4	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.A246S	ENST00000373433.4	37	c.736	CCDS13301.1	20	.	.	.	.	.	.	.	.	.	.	G	31	5.077454	0.94000	.	.	ENSG00000101413	ENST00000373433;ENST00000449186	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.63850	0.2546	M	0.71581	2.175	0.80722	D	1	P	0.51057	0.941	P	0.45794	0.493	T	0.65713	-0.6101	9	0.44086	T	0.13	-11.4174	18.5892	0.91202	0.0:0.0:1.0:0.0	.	246	Q9NQG5	RPR1B_HUMAN	S	246;128	.	ENSP00000362532:A246S	A	+	1	0	RPRD1B	36127977	1.000000	0.71417	0.974000	0.42286	0.906000	0.53458	9.573000	0.98181	2.941000	0.99782	0.655000	0.94253	GCA	RPRD1B	-	NULL		0.468	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1B	HGNC	protein_coding	OTTHUMT00000079142.2	G	NM_021215		36694563	+1	no_errors	ENST00000373433	ensembl	human	known	70_37	missense	SNP	1.000	T
RTEL1	51750	genome.wustl.edu	37	20	62293291	62293291	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:62293291C>G	ENST00000360203.5	+	4	715	c.390C>G	c.(388-390)tcC>tcG	p.S130S	RTEL1_ENST00000370018.3_Silent_p.S130S|RTEL1_ENST00000508582.2_Silent_p.S130S|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.S130S|RTEL1_ENST00000318100.4_Silent_p.S130S					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGAACACCTCCTACCGGTGGG	0.562																																																	0													115.0	89.0	98.0					20																	62293291		2203	4300	6503	SO:0001819	synonymous_variant	51750			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.390C>G	20.37:g.62293291C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.S130	ENST00000360203.5	37	c.390		20																																																																																			RTEL1	-	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3		0.562	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	C	NM_032957		62293291	+1	no_errors	ENST00000318100	ensembl	human	known	70_37	silent	SNP	0.826	G
RTEL1	51750	genome.wustl.edu	37	20	62321665	62321665	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:62321665C>T	ENST00000360203.5	+	26	2609	c.2284C>T	c.(2284-2286)Cgg>Tgg	p.R762W	RTEL1_ENST00000370018.3_Missense_Mutation_p.R762W|RTEL1_ENST00000370003.1_Missense_Mutation_p.R7W|RTEL1_ENST00000508582.2_Missense_Mutation_p.R786W|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R762W|RTEL1_ENST00000318100.4_Missense_Mutation_p.R762W					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GCCGGCCCCCCGGGCTACAGC	0.632																																																	0													38.0	41.0	40.0					20																	62321665		2194	4293	6487	SO:0001583	missense	51750			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2284C>T	20.37:g.62321665C>T	ENSP00000353332:p.Arg762Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R762W	ENST00000360203.5	37	c.2284		20	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846560	0.51164	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000425905;ENST00000370003	T;T;T;T;T;T	0.50001	2.89;2.89;2.89;2.89;2.89;0.76	4.16	-0.392	0.12442	.	1.346290	0.04295	N	0.346333	T	0.55369	0.1916	L	0.46157	1.445	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.994;0.998	P;P;P;P	0.57776	0.799;0.827;0.696;0.784	T	0.46442	-0.9191	10	0.72032	D	0.01	-2.1439	7.0443	0.25037	0.4154:0.501:0.0:0.0836	.	786;7;762;762	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	W	762;762;786;762;155;7	ENSP00000359035:R762W;ENSP00000322287:R762W;ENSP00000424307:R786W;ENSP00000353332:R762W;ENSP00000388063:R155W;ENSP00000359020:R7W	ENSP00000353332:R762W	R	+	1	2	AL353715.1	61792109	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.041000	0.13927	-0.219000	0.10003	-0.251000	0.11542	CGG	RTEL1	-	NULL		0.632	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	C	NM_032957		62321665	+1	no_errors	ENST00000318100	ensembl	human	known	70_37	missense	SNP	0.002	T
RTN4	57142	genome.wustl.edu	37	2	55253894	55253894	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:55253894G>A	ENST00000337526.6	-	3	1584	c.1341C>T	c.(1339-1341)ttC>ttT	p.F447F	RTN4_ENST00000405240.1_Silent_p.F241F|RTN4_ENST00000404909.1_Silent_p.F241F|RTN4_ENST00000354474.6_Silent_p.F215F|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Silent_p.F241F|RTN4_ENST00000394611.2_Silent_p.F241F|RTN4_ENST00000357732.4_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	447					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GCGTACTGGGGAAAGAAGTAT	0.393																																																	0													221.0	211.0	214.0					2																	55253894		2203	4300	6503	SO:0001819	synonymous_variant	57142			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1341C>T	2.37:g.55253894G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Silent	SNP	pfam_Reticulon,pfscan_Reticulon	p.F447	ENST00000337526.6	37	c.1341	CCDS42684.1	2																																																																																			RTN4	-	NULL		0.393	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	G			55253894	-1	no_errors	ENST00000337526	ensembl	human	known	70_37	silent	SNP	0.931	A
RUSC2	9853	genome.wustl.edu	37	9	35548064	35548064	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:35548064C>T	ENST00000455600.1	+	2	2115	c.1546C>T	c.(1546-1548)Cgt>Tgt	p.R516C		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	516						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			CTCGCTGGAACGTATGTTGAG	0.657																																																	0													33.0	34.0	34.0					9																	35548064		2203	4300	6503	SO:0001583	missense	9853			AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1546C>T	9.37:g.35548064C>T	ENSP00000393922:p.Arg516Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.R516C	ENST00000455600.1	37	c.1546	CCDS35008.1	9	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076872	0.76415	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.48522	0.81;0.81	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63642	-0.6591	10	0.87932	D	0	-17.0841	18.3278	0.90260	0.0:1.0:0.0:0.0	.	516	Q8N2Y8	RUSC2_HUMAN	C	516	ENSP00000355177:R516C;ENSP00000393922:R516C	ENSP00000355177:R516C	R	+	1	0	RUSC2	35538064	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.353000	0.79414	2.569000	0.86673	0.655000	0.94253	CGT	RUSC2	-	NULL		0.657	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	HGNC	protein_coding	OTTHUMT00000052309.1	C	XM_048462		35548064	+1	no_errors	ENST00000361226	ensembl	human	known	70_37	missense	SNP	1.000	T
RXRA	6256	genome.wustl.edu	37	9	137300845	137300845	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:137300845C>T	ENST00000481739.1	+	4	542	c.490C>T	c.(490-492)Cgc>Tgc	p.R164C	RXRA_ENST00000540193.1_Missense_Mutation_p.R67C|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	164					camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCGGACGGTGCGCAAGGACCT	0.642																																																	0													129.0	106.0	113.0					9																	137300845		2203	4300	6503	SO:0001583	missense	6256			X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.490C>T	9.37:g.137300845C>T	ENSP00000419692:p.Arg164Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_DUF3345,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoic_acid_rcpt	p.R164C	ENST00000481739.1	37	c.490	CCDS35172.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933824	0.73442	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.97480	-4.4;-4.4	4.25	3.34	0.38264	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.98397	0.9467	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98314	1.0525	10	0.87932	D	0	.	9.0199	0.36193	0.1456:0.7731:0.0:0.0812	.	164	P19793	RXRA_HUMAN	C	164;67	ENSP00000419692:R164C;ENSP00000442123:R67C	ENSP00000419692:R164C	R	+	1	0	RXRA	136440666	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	2.934000	0.48956	0.883000	0.36040	0.561000	0.74099	CGC	RXRA	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt		0.642	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	HGNC	protein_coding	OTTHUMT00000054949.1	C	NM_002957		137300845	+1	no_errors	ENST00000481739	ensembl	human	known	70_37	missense	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	38990352	38990352	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:38990352C>T	ENST00000359596.3	+	44	7105	c.7105C>T	c.(7105-7107)Cgg>Tgg	p.R2369W	RYR1_ENST00000360985.3_Missense_Mutation_p.R2369W|RYR1_ENST00000355481.4_Missense_Mutation_p.R2369W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2369	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACCCGCCCTGCGGGGTGAGGG	0.692																																																	0													32.0	28.0	30.0					19																	38990352		2203	4299	6502	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7105C>T	19.37:g.38990352C>T	ENSP00000352608:p.Arg2369Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R2369W	ENST00000359596.3	37	c.7105	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830185	0.50845	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97811	-4.55;-4.55;-4.55	3.99	0.109	0.14578	.	0.000000	0.64402	U	0.000001	D	0.98353	0.9453	M	0.83384	2.64	0.40669	D	0.982194	D;D	0.89917	1.0;0.999	D;P	0.83275	0.996;0.781	D	0.98450	1.0591	10	0.87932	D	0	.	12.4635	0.55745	0.5485:0.4515:0.0:0.0	.	2369;2369	P21817-2;P21817	.;RYR1_HUMAN	W	2369	ENSP00000352608:R2369W;ENSP00000347667:R2369W;ENSP00000354254:R2369W	ENSP00000347667:R2369W	R	+	1	2	RYR1	43682192	0.730000	0.28100	0.972000	0.41901	0.986000	0.74619	0.025000	0.13577	0.308000	0.22923	0.297000	0.19635	CGG	RYR1	-	NULL		0.692	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	C			38990352	+1	no_errors	ENST00000359596	ensembl	human	known	70_37	missense	SNP	0.999	T
SAMD10	140700	genome.wustl.edu	37	20	62608706	62608706	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:62608706C>T	ENST00000369886.3	-	2	319	c.145G>A	c.(145-147)Gag>Aag	p.E49K	ZNF512B_ENST00000450537.1_Intron|ZNF512B_ENST00000217130.3_Intron|SAMD10_ENST00000498830.1_5'UTR	NM_080621.4	NP_542188.1	Q9BYL1	SAM10_HUMAN	sterile alpha motif domain containing 10	49										kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	7	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGATGCTCTCAGCTGACACC	0.652																																																	0													70.0	70.0	70.0					20																	62608706		2203	4300	6503	SO:0001583	missense	140700				CCDS13549.1	20q13.33	2013-01-10	2004-07-15	2004-07-16	ENSG00000130590	ENSG00000130590		"""Sterile alpha motif (SAM) domain containing"""	16129	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 136"""	C20orf136			Standard	NM_080621		Approved		uc002yhm.2	Q9BYL1	OTTHUMG00000033011	ENST00000369886.3:c.145G>A	20.37:g.62608706C>T	ENSP00000358902:p.Glu49Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E49K	ENST00000369886.3	37	c.145	CCDS13549.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.189206	0.94923	.	.	ENSG00000130590	ENST00000369886;ENST00000450107	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.66096	0.2755	L	0.34521	1.04	0.54753	D	0.999988	D	0.63880	0.993	D	0.70935	0.971	T	0.69665	-0.5084	9	0.62326	D	0.03	-22.7545	15.6883	0.77430	0.0:1.0:0.0:0.0	.	49	Q9BYL1	SAM10_HUMAN	K	49;88	.	ENSP00000358902:E49K	E	-	1	0	SAMD10	62079150	1.000000	0.71417	0.947000	0.38551	0.900000	0.52787	5.261000	0.65496	2.135000	0.66039	0.313000	0.20887	GAG	SAMD10	-	NULL		0.652	SAMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD10	HGNC	protein_coding	OTTHUMT00000080255.1	C	NM_080621		62608706	-1	no_errors	ENST00000369886	ensembl	human	known	70_37	missense	SNP	1.000	T
SBNO1	55206	genome.wustl.edu	37	12	123818692	123818692	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:123818692C>T	ENST00000602398.1	-	7	944	c.817G>A	c.(817-819)Gat>Aat	p.D273N	SBNO1_ENST00000267176.4_Missense_Mutation_p.D272N|SBNO1_ENST00000420886.2_Missense_Mutation_p.D273N|SBNO1_ENST00000602750.1_Missense_Mutation_p.D272N			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	273					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TACCAAACATCAGGAGGAGTA	0.378																																																	0													66.0	61.0	62.0					12																	123818692		2203	4300	6503	SO:0001583	missense	55206			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.817G>A	12.37:g.123818692C>T	ENSP00000473665:p.Asp273Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.D273N	ENST00000602398.1	37	c.817	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375697	0.82682	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.35048	1.33;1.33	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.49355	0.1552	M	0.84683	2.71	0.80722	D	1	B;B;P	0.37330	0.057;0.01;0.59	B;B;B	0.37304	0.035;0.021;0.246	T	0.54774	-0.8243	10	0.48119	T	0.1	-34.0568	19.9162	0.97063	0.0:1.0:0.0:0.0	.	273;272;271	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	N	273;272;272	ENSP00000387361:D273N;ENSP00000267176:D272N	ENSP00000267176:D272N	D	-	1	0	SBNO1	122384645	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.950000	0.70265	2.710000	0.92621	0.650000	0.86243	GAT	SBNO1	-	NULL		0.378	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	C	NM_018183		123818692	-1	no_errors	ENST00000420886	ensembl	human	known	70_37	missense	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167298100	167298100	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:167298100C>G	ENST00000409855.1	-	14	2089	c.1963G>C	c.(1963-1965)Gaa>Caa	p.E655Q		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	655					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CAGACAAATTCTTCATAATTC	0.443																																																	0													109.0	116.0	114.0					2																	167298100		2203	4300	6503	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1963G>C	2.37:g.167298100C>G	ENSP00000386796:p.Glu655Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.E655Q	ENST00000409855.1	37	c.1963	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995017	0.35226	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98381	-4.9;-4.9	4.79	-5.86	0.02304	Ion transport (1);	2.153780	0.01766	N	0.030897	D	0.96297	0.8792	L	0.47716	1.5	0.09310	N	1	B	0.24043	0.096	B	0.31390	0.129	D	0.91464	0.5191	10	0.72032	D	0.01	.	8.5349	0.33357	0.0:0.2909:0.1107:0.5984	.	655	Q01118	SCN7A_HUMAN	Q	655	ENSP00000386796:E655Q;ENSP00000413699:E655Q	ENSP00000259060:E655Q	E	-	1	0	SCN7A	167006346	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.025000	0.13577	-1.476000	0.01874	-0.964000	0.02622	GAA	SCN7A	-	pfam_Ion_trans_dom		0.443	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	C			167298100	-1	no_errors	ENST00000409855	ensembl	human	known	70_37	missense	SNP	0.000	G
SEMA5B	54437	genome.wustl.edu	37	3	122634439	122634439	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:122634439G>A	ENST00000357599.3	-	14	2222	c.1836C>T	c.(1834-1836)ttC>ttT	p.F612F	SEMA5B_ENST00000195173.4_Silent_p.F612F|SEMA5B_ENST00000451055.2_Silent_p.F666F	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	612					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		ACCATGGGCCGAAGCCCCCAT	0.577																																																	0													60.0	58.0	59.0					3																	122634439		2203	4300	6503	SO:0001819	synonymous_variant	54437			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1836C>T	3.37:g.122634439G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.F666	ENST00000357599.3	37	c.1998	CCDS35491.1	3																																																																																			SEMA5B	-	superfamily_Thrombospondin_1_rpt		0.577	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	G	NM_001031702		122634439	-1	no_errors	ENST00000451055	ensembl	human	known	70_37	silent	SNP	0.966	A
SERPINB11	89778	genome.wustl.edu	37	18	61387323	61387323	+	RNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr18:61387323C>G	ENST00000382749.5	+	0	797				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000538847.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				CCATATATTTCAAAGGACAAT	0.323																																					Ovarian(27;496 784 5942 8975 23930)												0													65.0	67.0	66.0					18																	61387323		1818	4085	5903			89778					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61387323C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.F9L	ENST00000382749.5	37	c.27		18	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757894	0.69648	.	.	ENSG00000206072	ENST00000544088;ENST00000536691	D;D	0.92149	-2.98;-2.98	5.5	3.69	0.42338	Serpin domain (3);	.	.	.	.	D	0.94082	0.8103	M	0.90814	3.15	0.24966	N	0.991698	P;P;D	0.52996	0.707;0.897;0.957	B;B;P	0.50490	0.415;0.357;0.642	D	0.88451	0.3049	9	0.87932	D	0	.	6.7942	0.23717	0.0:0.6474:0.1345:0.2182	.	9;184;184	F5GWT8;F5GYW9;Q96P15	.;.;SPB11_HUMAN	L	184;9	ENSP00000441497:F184L;ENSP00000441708:F9L	ENSP00000421854:F184L	F	+	3	2	SERPINB11	59538303	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	1.341000	0.33907	1.460000	0.47911	-0.251000	0.11542	TTC	SERPINB11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.323	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3	C	NM_080475		61387323	+1	no_errors	ENST00000536691	ensembl	human	known	70_37	missense	SNP	1.000	G
SGMS1	259230	genome.wustl.edu	37	10	52067007	52067007	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:52067007C>G	ENST00000361781.2	-	11	2096	c.1137G>C	c.(1135-1137)aaG>aaC	p.K379N	SGMS1_ENST00000429490.1_Missense_Mutation_p.K210N	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	385					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CTTGGACATTCTTTTCAAAGT	0.473																																																	0													119.0	104.0	109.0					10																	52067007		2203	4300	6503	SO:0001583	missense	259230			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.1137G>C	10.37:g.52067007C>G	ENSP00000354829:p.Lys379Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.K379N	ENST00000361781.2	37	c.1137	CCDS7240.1	10	.	.	.	.	.	.	.	.	.	.	C	6.898	0.535227	0.13188	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T	0.46063	0.88	5.58	5.58	0.84498	.	0.165319	0.56097	D	0.000038	T	0.33702	0.0872	L	0.34521	1.04	0.80722	D	1	P;P	0.36789	0.565;0.57	B;B	0.35114	0.156;0.196	T	0.05517	-1.0880	10	0.20519	T	0.43	-21.1088	17.4347	0.87548	0.0:1.0:0.0:0.0	.	210;385	B4DJU2;Q86VZ5	.;SMS1_HUMAN	N	179;379;210	ENSP00000354829:K379N	ENSP00000354829:K379N	K	-	3	2	SGMS1	51737013	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.985000	0.49362	2.782000	0.95742	0.655000	0.94253	AAG	SGMS1	-	NULL		0.473	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2	C	NM_147156		52067007	-1	no_errors	ENST00000361781	ensembl	human	known	70_37	missense	SNP	1.000	G
SIN3A	25942	genome.wustl.edu	37	15	75705130	75705130	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:75705130G>C	ENST00000394947.3	-	5	1044	c.730C>G	c.(730-732)Cag>Gag	p.Q244E	SIN3A_ENST00000360439.4_Missense_Mutation_p.Q244E|SIN3A_ENST00000394949.4_Missense_Mutation_p.Q244E	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GGTGggggctgaggagctggc	0.552																																																	0													81.0	75.0	77.0					15																	75705130		2197	4294	6491	SO:0001583	missense	25942			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.730C>G	15.37:g.75705130G>C	ENSP00000378402:p.Gln244Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.Q244E	ENST00000394947.3	37	c.730	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228716	0.39399	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.48522	0.81;0.81;0.81	6.04	5.12	0.69794	.	0.098566	0.64402	D	0.000001	T	0.39036	0.1063	L	0.51422	1.61	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28490	-1.0042	10	0.06099	T	0.92	-11.3013	14.2887	0.66263	0.0708:0.0:0.9292:0.0	.	244	Q96ST3	SIN3A_HUMAN	E	244	ENSP00000378402:Q244E;ENSP00000378403:Q244E;ENSP00000353622:Q244E	ENSP00000353622:Q244E	Q	-	1	0	SIN3A	73492183	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.867000	0.99620	1.557000	0.49525	0.561000	0.74099	CAG	SIN3A	-	NULL		0.552	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	G	NM_015477		75705130	-1	no_errors	ENST00000360439	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC12A2	6558	genome.wustl.edu	37	5	127507426	127507426	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:127507426C>G	ENST00000262461.2	+	19	2980	c.2791C>G	c.(2791-2793)Ctt>Gtt	p.L931V	SLC12A2_ENST00000343225.4_Missense_Mutation_p.L931V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	931					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TATATCTCATCTTCAAGGACA	0.294																																																	0													108.0	118.0	114.0					5																	127507426		2203	4297	6500	SO:0001583	missense	6558				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2791C>G	5.37:g.127507426C>G	ENSP00000262461:p.Leu931Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N713|Q8WWH7	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.L931V	ENST00000262461.2	37	c.2791	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	C	7.685	0.689804	0.14973	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.93133	-3.17;-3.17	5.0	5.0	0.66597	.	0.062767	0.64402	D	0.000004	D	0.89979	0.6872	L	0.35288	1.05	0.53005	D	0.999961	P;B	0.46327	0.876;0.319	B;B	0.43123	0.409;0.045	D	0.87731	0.2579	10	0.18276	T	0.48	.	18.8491	0.92220	0.0:1.0:0.0:0.0	.	931;931	P55011-3;P55011	.;S12A2_HUMAN	V	931	ENSP00000262461:L931V;ENSP00000340878:L931V	ENSP00000262461:L931V	L	+	1	0	SLC12A2	127535325	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	5.607000	0.67648	2.765000	0.95021	0.650000	0.86243	CTT	SLC12A2	-	tigrfam_Na/K/Cl_cotransptS		0.294	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1	C	NM_001046		127507426	+1	no_errors	ENST00000262461	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC16A11	162515	genome.wustl.edu	37	17	6945799	6945799	+	Silent	SNP	G	G	T	rs543474396		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:6945799G>T	ENST00000308009.1	-	3	1039	c.702C>A	c.(700-702)ctC>ctA	p.L234L	SLC16A11_ENST00000447225.1_Silent_p.L210L	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	234					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						GACTCAGGCCGAGGGCAGCTA	0.662																																																	0													10.0	8.0	9.0					17																	6945799		2166	4247	6413	SO:0001819	synonymous_variant	162515			AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.702C>A	17.37:g.6945799G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L234	ENST00000308009.1	37	c.702	CCDS11086.1	17																																																																																			SLC16A11	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.662	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC16A11	HGNC	protein_coding	OTTHUMT00000219921.1	G	NM_153357		6945799	-1	no_errors	ENST00000308009	ensembl	human	known	70_37	silent	SNP	0.395	T
SLC16A4	9122	genome.wustl.edu	37	1	110921794	110921794	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:110921794G>C	ENST00000369779.4	-	6	960	c.711C>G	c.(709-711)atC>atG	p.I237M	SLC16A4_ENST00000437429.2_Missense_Mutation_p.I127M|SLC16A4_ENST00000472422.2_Missense_Mutation_p.I189M|SLC16A4_ENST00000541986.1_Missense_Mutation_p.I175M|SLC16A4_ENST00000497687.1_5'UTR|SLC16A4_ENST00000369781.4_Intron	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	237					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	TACTGTCCTTGATGGTAGACT	0.433																																																	0													223.0	209.0	214.0					1																	110921794		2203	4300	6503	SO:0001583	missense	9122			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.711C>G	1.37:g.110921794G>C	ENSP00000358794:p.Ile237Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I237M	ENST00000369779.4	37	c.711	CCDS823.1	1	.	.	.	.	.	.	.	.	.	.	g	12.44	1.938716	0.34189	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000437429;ENST00000541986;ENST00000467986	T;T;T;T;T	0.34859	2.53;2.38;1.92;2.52;1.34	5.63	1.08	0.20341	Major facilitator superfamily domain, general substrate transporter (1);	2.550830	0.00841	N	0.001758	T	0.21267	0.0512	L	0.47716	1.5	0.09310	N	1	B;B;B;B	0.33919	0.108;0.074;0.432;0.074	B;B;B;B	0.43575	0.052;0.055;0.424;0.034	T	0.27971	-1.0058	10	0.35671	T	0.21	.	6.7999	0.23746	0.2933:0.1279:0.5788:0.0	.	127;175;189;237	E7EPY8;B4DJ67;G3V175;O15374	.;.;.;MOT5_HUMAN	M	237;189;127;175;4	ENSP00000358794:I237M;ENSP00000432495:I189M;ENSP00000394790:I127M;ENSP00000446087:I175M;ENSP00000435768:I4M	ENSP00000358794:I237M	I	-	3	3	SLC16A4	110723317	0.000000	0.05858	0.001000	0.08648	0.595000	0.36748	0.815000	0.27253	0.323000	0.23307	0.651000	0.88453	ATC	SLC16A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.433	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A4	HGNC	protein_coding	OTTHUMT00000031115.3	G	NM_004696		110921794	-1	no_errors	ENST00000369779	ensembl	human	known	70_37	missense	SNP	0.000	C
SLC25A17	10478	genome.wustl.edu	37	22	41166798	41166798	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:41166798C>T	ENST00000435456.2	-	0	1097				SLC25A17_ENST00000402844.3_3'UTR|SLC25A17_ENST00000544408.1_3'UTR|SLC25A17_ENST00000491545.1_5'UTR	NM_006358.2	NP_006349.1	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17						ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|cellular lipid metabolic process (GO:0044255)|coenzyme A transmembrane transport (GO:0035349)|FAD transmembrane transport (GO:0035350)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|fatty acid transport (GO:0015908)|NAD transport (GO:0043132)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|chaperone binding (GO:0051087)|coenzyme A transmembrane transporter activity (GO:0015228)|FAD transmembrane transporter activity (GO:0015230)|FMN transmembrane transporter activity (GO:0044610)|NAD transporter activity (GO:0051724)			central_nervous_system(1)|large_intestine(4)|lung(2)|skin(1)	8						GAGGAAACCTCCCTCTTGAGC	0.507																																																	0													72.0	70.0	70.0					22																	41166798		2203	4300	6503	SO:0001624	3_prime_UTR_variant	10478			Y12860	CCDS14005.1, CCDS74868.1	22q13.2	2013-05-22	2002-08-29		ENSG00000100372	ENSG00000100372		"""Solute carriers"""	10987	protein-coding gene	gene with protein product	"""peroxisomal membrane protein (34kD)"""	606795	"""solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kD), member 17"""			9874197	Standard	NM_006358		Approved	PMP34	uc003azc.3	O43808	OTTHUMG00000151139	ENST00000435456.2:c.*40G>A	22.37:g.41166798C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA59|Q5TFL0|Q9UGW8|Q9UGY7	RNA	SNP	-	NULL	ENST00000435456.2	37	NULL	CCDS14005.1	22																																																																																			SLC25A17	-	-		0.507	SLC25A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A17	HGNC	protein_coding	OTTHUMT00000321487.1	C	NM_006358		41166798	-1	no_errors	ENST00000491545	ensembl	human	known	70_37	rna	SNP	0.000	T
SLC35B1	10237	genome.wustl.edu	37	17	47780371	47780371	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:47780371G>T	ENST00000240333.6	-	8	886	c.765C>A	c.(763-765)agC>agA	p.S255R	SLC35B1_ENST00000415270.2_Missense_Mutation_p.S292R			P78383	S35B1_HUMAN	solute carrier family 35, member B1	255					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)			endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						TAAAGATGAAGCTCTAGAGAA	0.463																																																	0													116.0	117.0	117.0					17																	47780371		2203	4300	6503	SO:0001583	missense	10237			D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.765C>A	17.37:g.47780371G>T	ENSP00000240333:p.Ser255Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DEC4|J3KQV4|Q96EW7	Missense_Mutation	SNP	pfam_UAA,pfam_DMT,pfam_DUF250	p.S292R	ENST00000240333.6	37	c.876	CCDS11552.1	17	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438141	0.25900	.	.	ENSG00000121073	ENST00000240333;ENST00000415270;ENST00000504260;ENST00000502406;ENST00000503334	T;T;T	0.69685	-0.42;-0.42;1.6	5.16	2.13	0.27403	.	0.046027	0.85682	D	0.000000	T	0.59115	0.2170	L	0.36672	1.1	0.46609	D	0.99912	P;P	0.34909	0.475;0.475	B;B	0.43889	0.356;0.435	T	0.49476	-0.8936	10	0.28530	T	0.3	-0.0386	8.9987	0.36068	0.3028:0.0:0.6972:0.0	.	188;255	D3DTX1;P78383	.;S35B1_HUMAN	R	255;292;131;131;188	ENSP00000240333:S255R;ENSP00000409548:S292R;ENSP00000423323:S188R	ENSP00000240333:S255R	S	-	3	2	SLC35B1	45135370	0.990000	0.36364	1.000000	0.80357	0.886000	0.51366	0.245000	0.18142	0.340000	0.23745	0.655000	0.94253	AGC	SLC35B1	-	pfam_UAA,pfam_DMT,pfam_DUF250		0.463	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B1	HGNC	protein_coding	OTTHUMT00000365564.2	G	NM_005827		47780371	-1	no_errors	ENST00000415270	ensembl	human	known	70_37	missense	SNP	0.997	T
SLC38A8	146167	genome.wustl.edu	37	16	84065527	84065527	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:84065527C>T	ENST00000299709.3	-	4	576	c.577G>A	c.(577-579)Gtg>Atg	p.V193M		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	193					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TAGTACTGCACGGTGATGACC	0.622																																																	0													145.0	115.0	125.0					16																	84065527		2200	4300	6500	SO:0001583	missense	146167				CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.577G>A	16.37:g.84065527C>T	ENSP00000299709:p.Val193Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.V193M	ENST00000299709.3	37	c.577	CCDS32495.1	16	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139508	0.56936	.	.	ENSG00000166558	ENST00000299709	T	0.02498	4.27	4.92	3.97	0.46021	.	0.334050	0.28706	N	0.014420	T	0.09555	0.0235	M	0.68952	2.095	0.31577	N	0.655582	D	0.67145	0.996	P	0.61397	0.888	T	0.02385	-1.1167	10	0.46703	T	0.11	.	8.7386	0.34543	0.0:0.7522:0.1628:0.0849	.	193	A6NNN8	S38A8_HUMAN	M	193	ENSP00000299709:V193M	ENSP00000299709:V193M	V	-	1	0	SLC38A8	82623028	0.000000	0.05858	0.921000	0.36526	0.635000	0.38103	0.166000	0.16583	1.226000	0.43582	0.549000	0.68633	GTG	SLC38A8	-	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease		0.622	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	HGNC	protein_coding	OTTHUMT00000432623.1	C	NM_001080442		84065527	-1	no_errors	ENST00000299709	ensembl	human	known	70_37	missense	SNP	0.986	T
SLC6A6	6533	genome.wustl.edu	37	3	14499524	14499524	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:14499524C>G	ENST00000454876.2	+	6	995	c.666C>G	c.(664-666)ctC>ctG	p.L222L	SLC6A6_ENST00000360861.3_Silent_p.L222L|SLC6A6_ENST00000484191.1_3'UTR			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	222					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						ACCTCGCTCTCTGCCTTCTTT	0.562																																																	0													246.0	195.0	212.0					3																	14499524		2203	4300	6503	SO:0001819	synonymous_variant	6533				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.666C>G	3.37:g.14499524C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_taurine	p.L222	ENST00000454876.2	37	c.666	CCDS33705.1	3																																																																																			SLC6A6	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.562	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	HGNC	protein_coding	OTTHUMT00000340507.1	C	NM_003043		14499524	+1	no_errors	ENST00000360861	ensembl	human	known	70_37	silent	SNP	1.000	G
SLC6A7	6534	genome.wustl.edu	37	5	149583535	149583535	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:149583535G>A	ENST00000230671.2	+	10	1637	c.1266G>A	c.(1264-1266)aaG>aaA	p.K422K	SLC6A7_ENST00000524041.1_Silent_p.K422K	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	422					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	TGCGGCCCAAGAAGGCGGTGT	0.572																																																	0													98.0	69.0	79.0					5																	149583535		2203	4300	6503	SO:0001819	synonymous_variant	6534			S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.1266G>A	5.37:g.149583535G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VG81|Q52LU6	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.K422	ENST00000230671.2	37	c.1266	CCDS4305.1	5																																																																																			SLC6A7	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.572	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A7	HGNC	protein_coding	OTTHUMT00000252325.1	G	NM_014228		149583535	+1	no_errors	ENST00000230671	ensembl	human	known	70_37	silent	SNP	1.000	A
SLC7A3	84889	genome.wustl.edu	37	X	70148314	70148314	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:70148314G>A	ENST00000374299.3	-	4	843	c.699C>T	c.(697-699)gaC>gaT	p.D233D	SLC7A3_ENST00000298085.4_Silent_p.D233D			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	233					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	ACCTATAGGTGTCATTGAGTT	0.493																																																	0													67.0	49.0	55.0					X																	70148314		2203	4299	6502	SO:0001819	synonymous_variant	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.699C>T	X.37:g.70148314G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.D233	ENST00000374299.3	37	c.699	CCDS14404.1	X																																																																																			SLC7A3	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease		0.493	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A3	HGNC	protein_coding	OTTHUMT00000057080.1	G	NM_032803		70148314	-1	no_errors	ENST00000298085	ensembl	human	known	70_37	silent	SNP	0.580	A
SLC6A8	6535	genome.wustl.edu	37	X	152955984	152955984	+	Intron	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:152955984C>T	ENST00000253122.5	+	2	870				SLC6A8_ENST00000430077.2_Intron	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8						cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	TGGCCAGCCTCAGGGACTGCC	0.592																																																	0													24.0	18.0	20.0					X																	152955984		2173	4259	6432	SO:0001627	intron_variant	6535				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.394+23C>T	X.37:g.152955984C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	RNA	SNP	-	NULL	ENST00000253122.5	37	NULL	CCDS14726.1	X																																																																																			SLC6A8	-	-		0.592	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	HGNC	protein_coding	OTTHUMT00000061003.1	C			152955984	+1	no_errors	ENST00000476466	ensembl	human	known	70_37	rna	SNP	0.000	T
SNORD114-1	767577	genome.wustl.edu	37	14	101416185	101416185	+	RNA	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr14:101416185G>C	ENST00000362705.1	+	0	16				SNORD114-2_ENST00000363953.1_RNA	NR_003193.1				small nucleolar RNA, C/D box 114-1																		CTATGATGATGACTGGTGGCG	0.353																																																	0													84.0	74.0	77.0					14																	101416185		876	1991	2867			767577					14q32.31	2013-09-05			ENSG00000199575	ENSG00000199575		"""ncRNAs / Small nucleolar RNAs : C/D box containing"""	32989	non-coding RNA	RNA, small nucleolar		613651				12045206	Standard	NR_003193		Approved	14q(II-1)	uc001yir.3				14.37:g.101416185G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000362705.1	37	NULL		14																																																																																			SNORD114-1	-	-		0.353	SNORD114-1-201	KNOWN	basic	snoRNA	SNORD114-1	HGNC	snoRNA		G	NR_003193.1		101416185	+1	no_errors	ENST00000362705	ensembl	human	known	70_37	rna	SNP	0.000	C
SOBP	55084	genome.wustl.edu	37	6	107955149	107955149	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:107955149G>A	ENST00000317357.5	+	6	1760	c.1101G>A	c.(1099-1101)caG>caA	p.Q367Q		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TCTCCGTCCAGCCACCTGCTA	0.627																																																	0													88.0	97.0	94.0					6																	107955149		2066	4201	6267	SO:0001819	synonymous_variant	55084			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.1101G>A	6.37:g.107955149G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.Q367	ENST00000317357.5	37	c.1101	CCDS43488.1	6																																																																																			SOBP	-	NULL		0.627	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOBP	HGNC	protein_coding	OTTHUMT00000041693.2	G	NM_018013		107955149	+1	no_errors	ENST00000317357	ensembl	human	known	70_37	silent	SNP	1.000	A
SON	6651	genome.wustl.edu	37	21	34948919	34948919	+	3'UTR	SNP	C	C	G	rs188609379		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr21:34948919C>G	ENST00000356577.4	+	0	7945				SON_ENST00000381692.2_3'UTR|SON_ENST00000290239.6_3'UTR|DONSON_ENST00000303113.6_Intron|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000470533.1_3'UTR	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GAATTTTACTCTGCATCACAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.*189C>G	21.37:g.34948919C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	RNA	SNP	-	NULL	ENST00000356577.4	37	NULL	CCDS13629.1	21																																																																																			SON	-	-		0.353	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	C	NM_138927		34948919	+1	no_errors	ENST00000470533	ensembl	human	known	70_37	rna	SNP	1.000	G
SPEG	10290	genome.wustl.edu	37	2	220342149	220342149	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:220342149G>C	ENST00000312358.7	+	20	4843	c.4711G>C	c.(4711-4713)Gag>Cag	p.E1571Q	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1571	Ig-like 8.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTGCAAAGCAGAGTTGGCTGT	0.612																																																	0													32.0	38.0	36.0					2																	220342149		2082	4217	6299	SO:0001583	missense	10290			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4711G>C	2.37:g.220342149G>C	ENSP00000311684:p.Glu1571Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E1571Q	ENST00000312358.7	37	c.4711	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173472	0.78452	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.68765	-0.35	5.35	5.35	0.76521	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.457119	0.16376	N	0.217101	T	0.73822	0.3636	N	0.25647	0.755	0.80722	D	1	D	0.56035	0.974	D	0.66351	0.943	T	0.76135	-0.3070	10	0.66056	D	0.02	.	19.0677	0.93119	0.0:0.0:1.0:0.0	.	1571	Q15772	SPEG_HUMAN	Q	1571	ENSP00000311684:E1571Q	ENSP00000265327:E1571Q	E	+	1	0	SPEG	220050393	1.000000	0.71417	0.967000	0.41034	0.995000	0.86356	9.613000	0.98350	2.506000	0.84524	0.655000	0.94253	GAG	SPEG	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like		0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	G	NM_005876		220342149	+1	no_errors	ENST00000312358	ensembl	human	novel	70_37	missense	SNP	1.000	C
SPHKAP	80309	genome.wustl.edu	37	2	228860311	228860311	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:228860311G>T	ENST00000392056.3	-	8	4594	c.4548C>A	c.(4546-4548)agC>agA	p.S1516R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1516R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1516						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGCTGCCTGTGCTCTCCTCGC	0.577																																																	0													147.0	126.0	133.0					2																	228860311		2203	4300	6503	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4548C>A	2.37:g.228860311G>T	ENSP00000375909:p.Ser1516Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S1516R	ENST00000392056.3	37	c.4548	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047014	0.75846	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.36520	1.72;1.25	6.06	3.12	0.35913	.	0.209202	0.53938	D	0.000044	T	0.56307	0.1976	M	0.78637	2.42	0.45005	D	0.998029	D;D	0.89917	1.0;1.0	D;D	0.91635	0.973;0.999	T	0.56189	-0.8020	10	0.56958	D	0.05	.	8.5161	0.33246	0.275:0.0:0.725:0.0	.	1516;1516	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	1516	ENSP00000375909:S1516R;ENSP00000339886:S1516R	ENSP00000339886:S1516R	S	-	3	2	SPHKAP	228568555	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	2.843000	0.48238	0.791000	0.33826	0.655000	0.94253	AGC	SPHKAP	-	NULL		0.577	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	G	NM_030623		228860311	-1	no_errors	ENST00000392056	ensembl	human	known	70_37	missense	SNP	1.000	T
SPOCD1	90853	genome.wustl.edu	37	1	32280449	32280449	+	Silent	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:32280449G>C	ENST00000360482.2	-	2	615	c.486C>G	c.(484-486)ctC>ctG	p.L162L	SPOCD1_ENST00000373648.2_Silent_p.L162L|SPOCD1_ENST00000533231.1_Silent_p.L162L|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	162					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CCCTGGGCCTGAGGCAGCTCA	0.612																																																	0													61.0	64.0	63.0					1																	32280449		2201	4299	6500	SO:0001819	synonymous_variant	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.486C>G	1.37:g.32280449G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.L162	ENST00000360482.2	37	c.486	CCDS347.1	1																																																																																			SPOCD1	-	NULL		0.612	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	HGNC	protein_coding	OTTHUMT00000381912.1	G	NM_144569		32280449	-1	no_errors	ENST00000360482	ensembl	human	known	70_37	silent	SNP	0.043	C
SPP1	6696	genome.wustl.edu	37	4	88904114	88904114	+	3'UTR	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:88904114G>A	ENST00000395080.3	+	0	1138				SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000360804.4_3'UTR|SPP1_ENST00000237623.7_3'UTR	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1						biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		ATAGCAAAATGAAAGAGAACA	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	6696				CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.*66G>A	4.37:g.88904114G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	RNA	SNP	-	NULL	ENST00000395080.3	37	NULL	CCDS43250.1	4																																																																																			SPP1	-	-		0.284	SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP1	HGNC	protein_coding	OTTHUMT00000253048.3	G			88904114	+1	no_errors	ENST00000509659	ensembl	human	known	70_37	rna	SNP	0.001	A
SRMS	6725	genome.wustl.edu	37	20	62178747	62178747	+	Missense_Mutation	SNP	C	C	T	rs543252716		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:62178747C>T	ENST00000217188.1	-	1	110	c.70G>A	c.(70-72)Ggc>Agc	p.G24S		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	24	N-terminal.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TCCGGCTCGCCGCCCGCCGGC	0.711													C|||	1	0.000199681	0.0	0.0	5008	,	,		12034	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	6725				CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.70G>A	20.37:g.62178747C>T	ENSP00000217188:p.Gly24Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.G24S	ENST00000217188.1	37	c.70	CCDS13525.1	20	.	.	.	.	.	.	.	.	.	.	C	2.529	-0.308933	0.05458	.	.	ENSG00000125508	ENST00000217188	T	0.74002	-0.8	3.94	-0.624	0.11552	.	1.755790	0.03363	N	0.197902	T	0.47078	0.1426	N	0.14661	0.345	0.09310	N	1	P	0.45986	0.87	B	0.23574	0.047	T	0.48980	-0.8986	10	0.27785	T	0.31	.	4.5771	0.12240	0.1428:0.468:0.0:0.3892	.	24	Q9H3Y6	SRMS_HUMAN	S	24	ENSP00000217188:G24S	ENSP00000217188:G24S	G	-	1	0	SRMS	61649191	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.726000	0.04936	-0.057000	0.13199	-1.141000	0.01876	GGC	SRMS	-	NULL		0.711	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SRMS	HGNC	protein_coding	OTTHUMT00000080148.1	C	NM_080823		62178747	-1	no_errors	ENST00000217188	ensembl	human	known	70_37	missense	SNP	0.000	T
SRP14	6727	genome.wustl.edu	37	15	40331051	40331051	+	Intron	SNP	C	C	T	rs373846182		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:40331051C>T	ENST00000267884.6	-	2	169				SRP14-AS1_ENST00000504245.1_lincRNA|SRP14_ENST00000558527.1_Intron|SRP14_ENST00000559081.1_Intron|SRP14_ENST00000560773.1_Intron|SRP14_ENST00000558720.1_Intron	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		CAGGGAGCATCGCCCGGCTCC	0.622																																																	0													16.0	21.0	20.0					15																	40331051		1919	4114	6033	SO:0001627	intron_variant	6727				CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108		ENST00000267884.6:c.97+25G>A	15.37:g.40331051C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BUF5|Q6B0K5|Q96Q14	RNA	SNP	-	NULL	ENST00000267884.6	37	NULL	CCDS42017.1	15																																																																																			SRP14	-	-		0.622	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP14	HGNC	protein_coding	OTTHUMT00000418262.2	C	NM_003134		40331051	-1	no_errors	ENST00000559439	ensembl	human	known	70_37	rna	SNP	0.000	T
STAT5A	6776	genome.wustl.edu	37	17	40453318	40453318	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:40453318C>T	ENST00000345506.4	+	10	1657	c.1015C>T	c.(1015-1017)Cct>Tct	p.P339S	STAT5A_ENST00000452307.2_Missense_Mutation_p.P339S|STAT5A_ENST00000588868.1_Missense_Mutation_p.P339S|STAT5A_ENST00000546010.2_Missense_Mutation_p.P309S|STAT5A_ENST00000590949.1_Missense_Mutation_p.P339S	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	339					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GAAGCAGCCTCCTCAGGTCCT	0.602																																																	0													163.0	143.0	150.0					17																	40453318		2203	4300	6503	SO:0001583	missense	6776			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1015C>T	17.37:g.40453318C>T	ENSP00000341208:p.Pro339Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q1KLZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.P339S	ENST00000345506.4	37	c.1015	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934975	0.92458	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.96168	-3.93;-3.93;-3.93	4.87	4.87	0.63330	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.98055	0.9359	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.986;1.0;1.0	D	0.99260	1.0890	10	0.87932	D	0	-9.3342	18.0732	0.89417	0.0:1.0:0.0:0.0	.	309;341;339	Q1KLZ6;Q59GY7;P42229	.;.;STA5A_HUMAN	S	339;309;341;339	ENSP00000341208:P339S;ENSP00000443107:P309S;ENSP00000400320:P339S	ENSP00000341208:P339S	P	+	1	0	STAT5A	37706844	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.696000	0.84270	2.274000	0.75844	0.306000	0.20318	CCT	STAT5A	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.602	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	C	NM_003152		40453318	+1	no_errors	ENST00000345506	ensembl	human	known	70_37	missense	SNP	1.000	T
JMJD8	339123	genome.wustl.edu	37	16	731466	731466	+	IGR	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr16:731466G>A	ENST00000293882.4	-	0	2123				LA16c-313D11.9_ENST00000567091.1_RNA|STUB1_ENST00000566181.2_3'UTR|STUB1_ENST00000564370.1_Silent_p.L57L|STUB1_ENST00000219548.4_Silent_p.L129L|STUB1_ENST00000565677.1_Silent_p.L57L|LA16c-313D11.9_ENST00000571933.1_RNA			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						AGCAGCGGCTGAACTTCGGGG	0.652																																																	0													35.0	36.0	35.0					16																	731466		2196	4298	6494	SO:0001628	intergenic_variant	10273				CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16			16.37:g.731466G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Silent	SNP	pfam_Ubox_domain,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ubox_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L129	ENST00000293882.4	37	c.387		16																																																																																			STUB1	-	NULL		0.652	JMJD8-201	KNOWN	basic	protein_coding	STUB1	HGNC	protein_coding		G	NM_001005920		731466	+1	no_errors	ENST00000219548	ensembl	human	known	70_37	silent	SNP	1.000	A
TAF11	6882	genome.wustl.edu	37	6	34848131	34848131	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:34848131C>A	ENST00000361288.4	-	3	474	c.343G>T	c.(343-345)Gag>Tag	p.E115*	TAF11_ENST00000420584.2_Nonsense_Mutation_p.E115*|UHRF1BP1_ENST00000452449.2_Intron	NM_005643.3	NP_005634.1	Q15544	TAF11_HUMAN	TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa	115					gene expression (GO:0010467)|positive regulation by host of viral transcription (GO:0043923)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6						AGCTGCTCCTCAGAAAAAGAA	0.403																																																	0													104.0	106.0	105.0					6																	34848131		2203	4300	6503	SO:0001587	stop_gained	6882			X83928	CCDS4797.1, CCDS59014.1	6p21	2008-02-05	2002-08-29	2001-12-07	ENSG00000064995	ENSG00000064995			11544	protein-coding gene	gene with protein product		600772	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, I, 28kD"""	TAF2I		7729427, 8820923	Standard	NM_005643		Approved	TAFII28	uc003ojw.2	Q15544	OTTHUMG00000014556	ENST00000361288.4:c.343G>T	6.37:g.34848131C>A	ENSP00000354633:p.Glu115*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8R3|B4DY18|Q9UHS0	Nonsense_Mutation	SNP	pfam_TAFII28,pfam_CBFA_NFYB_domain,superfamily_Histone-fold	p.E115*	ENST00000361288.4	37	c.343	CCDS4797.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.813593	0.96975	.	.	ENSG00000064995	ENST00000361288;ENST00000420584	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	X	115	.	ENSP00000354633:E115X	E	-	1	0	TAF11	34956109	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.554000	0.82212	2.890000	0.99128	0.650000	0.86243	GAG	TAF11	-	pfam_TAFII28,superfamily_Histone-fold		0.403	TAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF11	HGNC	protein_coding	OTTHUMT00000040259.1	C	NM_005643		34848131	-1	no_errors	ENST00000361288	ensembl	human	known	70_37	nonsense	SNP	1.000	A
TAS2R41	259287	genome.wustl.edu	37	7	143175196	143175197	+	Frame_Shift_Ins	INS	-	-	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:143175196_143175197insG	ENST00000408916.1	+	1	231_232	c.231_232insG	c.(232-234)gggfs	p.G78fs	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	78					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					TCGAGTACTCTGGGGGTCTCGG	0.54																																																	0																																										SO:0001589	frameshift_variant	259287			AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.236dupG	7.37:g.143175201_143175201dupG	ENSP00000386201:p.Gly78fs	Somatic		WXS	Illumina HiSeq	Phase_IV	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Frame_Shift_Ins	INS	pfam_TAS2_rcpt	p.L79fs	ENST00000408916.1	37	c.231_232	CCDS43663.1	7																																																																																			TAS2R41	-	pfam_TAS2_rcpt		0.540	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R41	HGNC	protein_coding	OTTHUMT00000342149.1	-			143175197	+1	no_errors	ENST00000408916	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.000	G
TBC1D9	23158	genome.wustl.edu	37	4	141543434	141543434	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:141543434C>T	ENST00000442267.2	-	21	3790	c.3716G>A	c.(3715-3717)aGg>aAg	p.R1239K		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1239							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ACTGGTAATCCTGGCCATCAT	0.587																																																	0													71.0	72.0	72.0					4																	141543434		2011	4179	6190	SO:0001583	missense	23158			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3716G>A	4.37:g.141543434C>T	ENSP00000411197:p.Arg1239Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.R1239K	ENST00000442267.2	37	c.3716	CCDS47136.1	4	.	.	.	.	.	.	.	.	.	.	C	4.506	0.093919	0.08632	.	.	ENSG00000109436	ENST00000442267	T	0.05649	3.41	5.22	4.38	0.52667	.	0.102126	0.64402	D	0.000003	T	0.02848	0.0085	N	0.05487	-0.04	0.35833	D	0.825468	B	0.02656	0.0	B	0.06405	0.002	T	0.29150	-1.0021	10	0.02654	T	1	.	9.8947	0.41311	0.0:0.8454:0.0:0.1546	.	1239	Q6ZT07	TBCD9_HUMAN	K	1239	ENSP00000411197:R1239K	ENSP00000411197:R1239K	R	-	2	0	TBC1D9	141762884	0.656000	0.27385	1.000000	0.80357	0.998000	0.95712	3.373000	0.52394	1.194000	0.43101	0.655000	0.94253	AGG	TBC1D9	-	NULL		0.587	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	HGNC	protein_coding	OTTHUMT00000364806.1	C	NM_015130		141543434	-1	no_errors	ENST00000442267	ensembl	human	known	70_37	missense	SNP	0.998	T
TCTN2	79867	genome.wustl.edu	37	12	124171412	124171412	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:124171412C>T	ENST00000303372.5	+	6	722	c.594C>T	c.(592-594)ttC>ttT	p.F198F	TCTN2_ENST00000426174.2_Silent_p.F197F	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	198					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CAACGCTGTTCAGACGGTCCT	0.527																																																	0													187.0	147.0	160.0					12																	124171412		2203	4300	6503	SO:0001819	synonymous_variant	79867			AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.594C>T	12.37:g.124171412C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7Y8|B3KPW5|Q9H966	Silent	SNP	pfam_DUF1619	p.F198	ENST00000303372.5	37	c.594	CCDS9253.1	12																																																																																			TCTN2	-	pfam_DUF1619		0.527	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCTN2	HGNC	protein_coding	OTTHUMT00000400652.1	C	NM_024809		124171412	+1	no_errors	ENST00000303372	ensembl	human	known	70_37	silent	SNP	0.874	T
TDH	157739	genome.wustl.edu	37	8	11197165	11197165	+	IGR	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:11197165C>T								SLC35G5 (7448 upstream) : AF131216.5 (6091 downstream)																							gacctctgctctggaacgtca	0.468																																																	0																																										SO:0001628	intergenic_variant	157739																															8.37:g.11197165C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		8																																																																																			TDH	-	-	0	0.468					TDH	HGNC			C			11197165	+1	no_errors	ENST00000525246	ensembl	human	known	70_37	rna	SNP	0.045	T
TDRD12	91646	genome.wustl.edu	37	19	33247088	33247088	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:33247088G>T	ENST00000444215.2	+	7	1092		c.e7+1		TDRD12_ENST00000421545.2_Splice_Site			Q587J7	TDR12_HUMAN	tudor domain containing 12						cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					GGAATGGAAGGTGAGTAGATT	0.343																																																	0													75.0	59.0	64.0					19																	33247088		692	1590	2282	SO:0001630	splice_region_variant	91646			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.772+1G>T	19.37:g.33247088G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	e7+1	ENST00000444215.2	37	c.772+1		19	.	.	.	.	.	.	.	.	.	.	G	10.85	1.465860	0.26335	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8854	0.79244	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDRD12	37938928	1.000000	0.71417	0.994000	0.49952	0.081000	0.17604	3.521000	0.53472	2.558000	0.86282	0.555000	0.69702	.	TDRD12	-	-		0.343	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	G	NM_001015890	Intron	33247088	+1	no_errors	ENST00000444215	ensembl	human	known	70_37	splice_site	SNP	1.000	T
TECTA	7007	genome.wustl.edu	37	11	121060587	121060587	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:121060587G>A	ENST00000392793.1	+	23	6636	c.6365G>A	c.(6364-6366)aGa>aAa	p.R2122K	TECTA_ENST00000264037.2_Missense_Mutation_p.R2122K			O75443	TECTA_HUMAN	tectorin alpha	2122					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AAGAGCTGCAGAGGTAGACAC	0.572																																																	0													80.0	73.0	76.0					11																	121060587		2203	4299	6502	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6365G>A	11.37:g.121060587G>A	ENSP00000376543:p.Arg2122Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.R2122K	ENST00000392793.1	37	c.6365	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545582	0.65198	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.95447	-3.71;-3.71	5.71	5.71	0.89125	Epidermal growth factor-like (1);	0.061365	0.64402	D	0.000006	D	0.91236	0.7238	N	0.16602	0.42	0.40179	D	0.977271	P	0.38827	0.649	B	0.36186	0.219	D	0.91670	0.5349	10	0.51188	T	0.08	.	19.4679	0.94950	0.0:0.0:1.0:0.0	.	2122	O75443	TECTA_HUMAN	K	2122	ENSP00000376543:R2122K;ENSP00000264037:R2122K	ENSP00000264037:R2122K	R	+	2	0	TECTA	120565797	1.000000	0.71417	0.987000	0.45799	0.796000	0.44982	4.440000	0.59975	2.698000	0.92095	0.561000	0.74099	AGA	TECTA	-	smart_EG-like_dom		0.572	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	G	NM_005422		121060587	+1	no_errors	ENST00000264037	ensembl	human	known	70_37	missense	SNP	1.000	A
TEKT4	150483	genome.wustl.edu	37	2	95542304	95542304	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:95542304G>A	ENST00000295201.4	+	6	1235	c.1098G>A	c.(1096-1098)ttG>ttA	p.L366L	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	366					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCAGGCTGTTGAGTGAGGTGG	0.612																																																	0													27.0	24.0	25.0					2																	95542304		2203	4300	6503	SO:0001819	synonymous_variant	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1098G>A	2.37:g.95542304G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Tektin,prints_Tektin	p.L366	ENST00000295201.4	37	c.1098	CCDS2005.1	2																																																																																			TEKT4	-	pfam_Tektin,prints_Tektin		0.612	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	HGNC	protein_coding	OTTHUMT00000252777.1	G	NM_144705		95542304	+1	no_errors	ENST00000295201	ensembl	human	known	70_37	silent	SNP	0.962	A
TENC1	23371	genome.wustl.edu	37	12	53451366	53451366	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:53451366C>T	ENST00000314250.6	+	12	1151	c.861C>T	c.(859-861)ttC>ttT	p.F287F	TENC1_ENST00000546602.1_Silent_p.F287F|TENC1_ENST00000379902.3_Silent_p.F163F|TENC1_ENST00000451358.1_Silent_p.F287F|TENC1_ENST00000549700.1_Silent_p.F287F|TENC1_ENST00000314276.3_Silent_p.F297F|TENC1_ENST00000552570.1_Silent_p.F287F	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	287	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						TCAGCTACTTCAGTGGGCTGC	0.517																																																	0													201.0	195.0	197.0					12																	53451366		2203	4300	6503	SO:0001819	synonymous_variant	23371			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.861C>T	12.37:g.53451366C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Silent	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F297	ENST00000314250.6	37	c.891	CCDS8843.1	12																																																																																			TENC1	-	pfscan_Phosphatase_tensin-typ		0.517	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1	C	NM_170754		53451366	+1	no_errors	ENST00000314276	ensembl	human	known	70_37	silent	SNP	1.000	T
TEX11	56159	genome.wustl.edu	37	X	69774555	69774555	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:69774555C>T	ENST00000395889.2	-	27	2436	c.2281G>A	c.(2281-2283)Gaa>Aaa	p.E761K	TEX11_ENST00000344304.3_Missense_Mutation_p.E761K|TEX11_ENST00000374320.2_Missense_Mutation_p.E436K|TEX11_ENST00000374333.2_Missense_Mutation_p.E746K	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	761					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					CACACTGATTCCAGGAAGCTT	0.378																																																	0													88.0	76.0	80.0					X																	69774555		2203	4300	6503	SO:0001583	missense	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2281G>A	X.37:g.69774555C>T	ENSP00000379226:p.Glu761Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.E761K	ENST00000395889.2	37	c.2281	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301435	0.60195	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.46451	1.44;1.45;0.87;1.45	4.43	3.55	0.40652	.	0.140627	0.46758	D	0.000271	T	0.48040	0.1478	L	0.50333	1.59	0.29815	N	0.831283	D;D	0.56035	0.974;0.957	P;P	0.54270	0.747;0.563	T	0.48210	-0.9055	9	.	.	.	-2.6411	11.5241	0.50569	0.0:0.8225:0.1775:0.0	.	746;761	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	K	746;761;436;761	ENSP00000363453:E746K;ENSP00000379226:E761K;ENSP00000363440:E436K;ENSP00000340995:E761K	.	E	-	1	0	TEX11	69691280	1.000000	0.71417	0.486000	0.27416	0.663000	0.39108	3.489000	0.53237	0.974000	0.38366	0.600000	0.82982	GAA	TEX11	-	NULL		0.378	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	C			69774555	-1	no_errors	ENST00000344304	ensembl	human	known	70_37	missense	SNP	0.989	T
TEX15	56154	genome.wustl.edu	37	8	30704643	30704643	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:30704643C>T	ENST00000256246.2	-	1	1965	c.1891G>A	c.(1891-1893)Gaa>Aaa	p.E631K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	631					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E631K(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TCTGGACTTTCAGAAGAACAA	0.323																																																	1	Substitution - Missense(1)	lung(1)											63.0	62.0	63.0					8																	30704643		2202	4300	6502	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1891G>A	8.37:g.30704643C>T	ENSP00000256246:p.Glu631Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E631K	ENST00000256246.2	37	c.1891	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	18.50	3.638501	0.67130	.	.	ENSG00000133863	ENST00000256246	T	0.12672	2.66	5.36	1.25	0.21368	.	0.981047	0.08340	N	0.961098	T	0.10723	0.0262	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.17433	0.018	T	0.35748	-0.9776	10	0.87932	D	0	.	6.2204	0.20677	0.0:0.5503:0.2872:0.1625	.	631	Q9BXT5	TEX15_HUMAN	K	631	ENSP00000256246:E631K	ENSP00000256246:E631K	E	-	1	0	TEX15	30824185	0.000000	0.05858	0.001000	0.08648	0.734000	0.41952	0.578000	0.23773	0.326000	0.23384	0.655000	0.94253	GAA	TEX15	-	NULL		0.323	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	C			30704643	-1	no_errors	ENST00000256246	ensembl	human	known	70_37	missense	SNP	0.000	T
TEX15	56154	genome.wustl.edu	37	8	30705057	30705057	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr8:30705057C>G	ENST00000256246.2	-	1	1551	c.1477G>C	c.(1477-1479)Gaa>Caa	p.E493Q	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	493					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATGTTGTTTTCTACACATGAA	0.313																																																	0													140.0	130.0	134.0					8																	30705057		2202	4299	6501	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1477G>C	8.37:g.30705057C>G	ENSP00000256246:p.Glu493Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E493Q	ENST00000256246.2	37	c.1477	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123708	0.37436	.	.	ENSG00000133863	ENST00000256246	T	0.12984	2.63	5.43	3.55	0.40652	.	0.300651	0.28488	N	0.015162	T	0.12135	0.0295	L	0.36672	1.1	0.22500	N	0.99904	P	0.50943	0.94	B	0.43301	0.415	T	0.10543	-1.0625	10	0.87932	D	0	.	9.2952	0.37811	0.0:0.7673:0.1491:0.0836	.	493	Q9BXT5	TEX15_HUMAN	Q	493	ENSP00000256246:E493Q	ENSP00000256246:E493Q	E	-	1	0	TEX15	30824599	0.966000	0.33281	0.668000	0.29813	0.026000	0.11368	1.393000	0.34497	1.382000	0.46385	0.585000	0.79938	GAA	TEX15	-	NULL		0.313	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	C			30705057	-1	no_errors	ENST00000256246	ensembl	human	known	70_37	missense	SNP	0.946	G
TM2D3	80213	genome.wustl.edu	37	15	102190346	102190346	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:102190346G>T	ENST00000333202.3	-	3	193	c.188C>A	c.(187-189)cCt>cAt	p.P63H	TM2D3_ENST00000347970.3_Missense_Mutation_p.P37H|RNU6-807P_ENST00000516805.1_RNA|TM2D3_ENST00000428002.2_Missense_Mutation_p.P37H|TM2D3_ENST00000561373.1_5'UTR|TM2D3_ENST00000559107.1_Missense_Mutation_p.P63H	NM_078474.2	NP_510883.2	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3	63						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)	10	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CATCACATAAGGTGGGATTTC	0.423																																																	0													138.0	128.0	131.0					15																	102190346		2203	4300	6503	SO:0001583	missense	80213			AK094955	CCDS10392.1, CCDS10393.1	15q26.3	2014-02-12			ENSG00000184277	ENSG00000184277			24128	protein-coding gene	gene with protein product		610014				11278849	Standard	XM_005254980		Approved	BLP2, FLJ22604	uc002bxi.3	Q9BRN9	OTTHUMG00000149872	ENST00000333202.3:c.188C>A	15.37:g.102190346G>T	ENSP00000330433:p.Pro63His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDK9|Q9H046|Q9H651	Missense_Mutation	SNP	pfam_TM2	p.P63H	ENST00000333202.3	37	c.188	CCDS10393.1	15	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673680	0.67928	.	.	ENSG00000184277	ENST00000428002;ENST00000347970;ENST00000333202	T;T;T	0.73897	-0.79;-0.79;-0.79	5.53	4.61	0.57282	.	0.479577	0.23235	N	0.050417	T	0.79209	0.4407	L	0.54323	1.7	0.80722	D	1	D;D;P;D	0.76494	0.999;0.997;0.895;0.993	D;P;P;P	0.63192	0.912;0.891;0.537;0.711	T	0.79060	-0.1958	10	0.62326	D	0.03	-19.0723	7.4029	0.26975	0.085:0.0:0.75:0.165	.	63;37;37;63	B4DKG4;E7EPS7;Q9BRN9-2;Q9BRN9	.;.;.;TM2D3_HUMAN	H	37;37;63	ENSP00000402179:P37H;ENSP00000327584:P37H;ENSP00000330433:P63H	ENSP00000330433:P63H	P	-	2	0	TM2D3	100007869	1.000000	0.71417	0.976000	0.42696	0.998000	0.95712	4.657000	0.61490	1.323000	0.45263	0.655000	0.94253	CCT	TM2D3	-	NULL		0.423	TM2D3-002	KNOWN	basic|CCDS	protein_coding	TM2D3	HGNC	protein_coding	OTTHUMT00000313623.1	G	NM_078474		102190346	-1	no_errors	ENST00000333202	ensembl	human	known	70_37	missense	SNP	0.988	T
TMC2	117532	genome.wustl.edu	37	20	2597838	2597838	+	Silent	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:2597838A>G	ENST00000358864.1	+	16	2076	c.2061A>G	c.(2059-2061)aaA>aaG	p.K687K	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	687					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GCGTGTTCAAAGCCTCCCGAT	0.597																																																	0													200.0	136.0	157.0					20																	2597838		2203	4300	6503	SO:0001819	synonymous_variant	117532			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.2061A>G	20.37:g.2597838A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Silent	SNP	pfam_TMC	p.K687	ENST00000358864.1	37	c.2061	CCDS13029.2	20																																																																																			TMC2	-	pfam_TMC		0.597	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	A			2597838	+1	no_errors	ENST00000358864	ensembl	human	known	70_37	silent	SNP	0.956	G
TMEM254	80195	genome.wustl.edu	37	10	81838622	81838622	+	Intron	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:81838622G>A	ENST00000372281.3	+	1	117				TMEM254_ENST00000372275.1_Intron|TMEM254-AS1_ENST00000448729.2_RNA|TMEM254_ENST00000372277.3_Intron|TMEM254-AS1_ENST00000412298.1_RNA|TMEM254-AS1_ENST00000432070.2_RNA|TMEM254_ENST00000372274.1_Intron	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254							integral component of membrane (GO:0016021)											CTCACAGGCCGCGGGCCGGGG	0.652																																																	0																																										SO:0001627	intron_variant	219347			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.87+80G>A	10.37:g.81838622G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	RNA	SNP	-	NULL	ENST00000372281.3	37	NULL	CCDS7363.1	10																																																																																			TMEM254-AS1	-	-		0.652	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254-AS1	HGNC	protein_coding	OTTHUMT00000049030.1	G	NM_025125		81838622	-1	no_errors	ENST00000412298	ensembl	human	known	70_37	rna	SNP	0.000	A
TNFRSF8	943	genome.wustl.edu	37	1	12202343	12202343	+	Splice_Site	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:12202343G>A	ENST00000263932.2	+	15	1765		c.e15-1		TNFRSF8_ENST00000479933.2_Splice_Site|TNFRSF8_ENST00000417814.2_Splice_Site|TNFRSF8_ENST00000413146.2_Splice_Site	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8						cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	TTGCCTTGCAGAGAAAATCTA	0.637																																																	0													12.0	12.0	12.0					1																	12202343		2188	4280	6468	SO:0001630	splice_region_variant	943			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.1544-1G>A	1.37:g.12202343G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Splice_Site	SNP	-	e15-1	ENST00000263932.2	37	c.1544-1	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829587	0.71258	.	.	ENSG00000120949	ENST00000263932;ENST00000417814;ENST00000413146	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9994	0.71459	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNFRSF8	12124930	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.636000	0.54317	2.600000	0.87896	0.655000	0.94253	.	TNFRSF8	-	-		0.637	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1	G		Intron	12202343	+1	no_errors	ENST00000263932	ensembl	human	known	70_37	splice_site	SNP	1.000	A
TNIP3	79931	genome.wustl.edu	37	4	122071296	122071296	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr4:122071296C>T	ENST00000509841.1	-	9	880	c.802G>A	c.(802-804)Gag>Aag	p.E268K	TNIP3_ENST00000507879.1_Missense_Mutation_p.E261K|TNIP3_ENST00000057513.3_Missense_Mutation_p.E191K|TNIP3_ENST00000454328.1_Missense_Mutation_p.E191K|TNIP3_ENST00000511909.1_5'Flank	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						CTCATCTCCTCATGGCAGAAT	0.438																																																	0													117.0	99.0	105.0					4																	122071296		2203	4300	6503	SO:0001583	missense	79931			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.802G>A	4.37:g.122071296C>T	ENSP00000426613:p.Glu268Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E191K	ENST00000509841.1	37	c.571	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753134	0.69648	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.53	3.78	0.43462	.	0.581634	0.16673	N	0.204267	T	0.71617	0.3361	M	0.75264	2.295	0.09310	N	0.999998	B;D	0.56746	0.091;0.977	B;P	0.55871	0.027;0.786	T	0.62932	-0.6749	10	0.66056	D	0.02	-2.9587	9.3838	0.38329	0.1426:0.7844:0.0:0.073	.	261;191	B4DVF5;Q96KP6	.;TNIP3_HUMAN	K	191;191;261;268	ENSP00000057513:E191K;ENSP00000411817:E191K;ENSP00000427106:E261K;ENSP00000426613:E268K	ENSP00000057513:E191K	E	-	1	0	TNIP3	122290746	0.551000	0.26497	0.240000	0.24138	0.648000	0.38561	2.357000	0.44125	0.775000	0.33450	0.585000	0.79938	GAG	TNIP3	-	NULL		0.438	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	C	NM_024873		122071296	-1	no_errors	ENST00000057513	ensembl	human	known	70_37	missense	SNP	0.463	T
TNK2	10188	genome.wustl.edu	37	3	195608929	195608929	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:195608929A>G	ENST00000333602.6	-	6	1497	c.880T>C	c.(880-882)Ttc>Ctc	p.F294L	TNK2_ENST00000428187.1_Missense_Mutation_p.F326L|TNK2_ENST00000316664.3_Missense_Mutation_p.F294L|TNK2_ENST00000392400.1_Missense_Mutation_p.F294L|TNK2_ENST00000381916.2_Missense_Mutation_p.F357L|TNK2_ENST00000468819.1_Intron	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CACCAGGCGAAGGGCACCTTG	0.602																																																	0													80.0	61.0	67.0					3																	195608929		2203	4300	6503	SO:0001583	missense	10188			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.880T>C	3.37:g.195608929A>G	ENSP00000329425:p.Phe294Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_GTPase_binding,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F357L	ENST00000333602.6	37	c.1069	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	A	29.1	4.979523	0.92982	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	N	0.01742	-0.745	0.80722	D	1	P;D;D;P	0.76494	0.801;0.999;0.998;0.956	P;D;D;P	0.73380	0.566;0.98;0.92;0.766	T	0.83097	-0.0130	10	0.72032	D	0.01	.	13.7443	0.62865	1.0:0.0:0.0:0.0	.	170;294;357;326	Q59FX1;Q07912;Q07912-3;C9J1X3	.;ACK1_HUMAN;.;.	L	294;357;326;294;294	ENSP00000329425:F294L;ENSP00000371341:F357L;ENSP00000392546:F326L;ENSP00000376201:F294L;ENSP00000323216:F294L	ENSP00000323216:F294L	F	-	1	0	TNK2	197093326	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.598000	0.90852	2.181000	0.69327	0.533000	0.62120	TTC	TNK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.602	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3	A	NM_005781		195608929	-1	no_errors	ENST00000381916	ensembl	human	known	70_37	missense	SNP	1.000	G
TNRC6B	23112	genome.wustl.edu	37	22	40677147	40677147	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr22:40677147G>C	ENST00000454349.2	+	11	3647	c.3436G>C	c.(3436-3438)Gat>Cat	p.D1146H	TNRC6B_ENST00000497559.1_Intron|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Intron|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1146					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CTCCAATCAAGATGGGTGCCT	0.512																																																	0													151.0	129.0	136.0					22																	40677147		692	1591	2283	SO:0001583	missense	23112			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3436G>C	22.37:g.40677147G>C	ENSP00000401946:p.Asp1146His	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.D1146H	ENST00000454349.2	37	c.3436	CCDS54533.1	22	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135810	0.37728	.	.	ENSG00000100354	ENST00000454349	T	0.14893	2.47	5.92	5.92	0.95590	.	.	.	.	.	T	0.30634	0.0771	L	0.39898	1.24	0.33886	D	0.636799	D	0.65815	0.995	P	0.58013	0.831	T	0.04579	-1.0941	9	0.28530	T	0.3	.	20.3167	0.98654	0.0:0.0:1.0:0.0	.	1146	Q9UPQ9	TNR6B_HUMAN	H	1146	ENSP00000401946:D1146H	ENSP00000401946:D1146H	D	+	1	0	TNRC6B	39007093	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	8.685000	0.91246	2.809000	0.96659	0.557000	0.71058	GAT	TNRC6B	-	NULL		0.512	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		G			40677147	+1	no_errors	ENST00000454349	ensembl	human	known	70_37	missense	SNP	1.000	C
TPRN	286262	genome.wustl.edu	37	9	140087025	140087027	+	In_Frame_Del	DEL	TCC	TCC	-	rs376810326		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr9:140087025_140087027delTCC	ENST00000409012.4	-	2	1928_1930	c.1842_1844delGGA	c.(1840-1845)gaggaa>gaa	p.614_615EE>E	TPRN_ENST00000541945.1_5'Flank|TPRN_ENST00000321773.2_In_Frame_Del_p.553_554EE>E	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	614	Glu-rich.				sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)		p.E315delE(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						ctcttcctcttcctcctcctcct	0.596																																																	1	Deletion - In frame(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	286262			AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1842_1844delGGA	9.37:g.140087034_140087036delTCC	ENSP00000387100:p.Glu621del	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	In_Frame_Del	DEL	NULL	p.E618in_frame_del	ENST00000409012.4	37	c.1844_1842	CCDS56594.1	9																																																																																			TPRN	-	NULL		0.596	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPRN	HGNC	protein_coding	OTTHUMT00000055323.3	TCC	NM_173691		140087027	-1	no_errors	ENST00000409012	ensembl	human	known	70_37	in_frame_del	DEL	0.745:0.829:0.911	-
TRIM11	81559	genome.wustl.edu	37	1	228589841	228589841	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:228589841C>G	ENST00000284551.6	-	2	708	c.430G>C	c.(430-432)Gag>Cag	p.E144Q	TRIM11_ENST00000366699.3_Missense_Mutation_p.E144Q|TRIM11_ENST00000460651.1_5'Flank|TRIM11_ENST00000493030.2_Missense_Mutation_p.E19Q	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	144					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CGGAGATGCTCCAGTGACTTC	0.617																																																	0													73.0	62.0	66.0					1																	228589841		2203	4300	6503	SO:0001583	missense	81559			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.430G>C	1.37:g.228589841C>G	ENSP00000284551:p.Glu144Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E144Q	ENST00000284551.6	37	c.430	CCDS31048.1	1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.726955	0.69074	.	.	ENSG00000154370	ENST00000284551;ENST00000366699	T;T	0.57907	0.37;0.37	4.56	4.56	0.56223	.	0.314642	0.22966	N	0.053486	T	0.59032	0.2164	L	0.43701	1.375	0.30366	N	0.783308	P;D;B	0.62365	0.906;0.991;0.107	P;P;B	0.62382	0.668;0.901;0.065	T	0.55075	-0.8197	10	0.19590	T	0.45	.	13.2353	0.59967	0.0:1.0:0.0:0.0	.	144;144;144	Q96F44-3;Q96F44-2;Q96F44	.;.;TRI11_HUMAN	Q	144	ENSP00000284551:E144Q;ENSP00000355660:E144Q	ENSP00000284551:E144Q	E	-	1	0	TRIM11	226656464	0.987000	0.35691	1.000000	0.80357	0.583000	0.36354	3.098000	0.50259	2.241000	0.73720	0.557000	0.71058	GAG	TRIM11	-	NULL		0.617	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM11	HGNC	protein_coding	OTTHUMT00000095995.3	C	NM_145214		228589841	-1	no_errors	ENST00000284551	ensembl	human	known	70_37	missense	SNP	1.000	G
TRPC4AP	26133	genome.wustl.edu	37	20	33603935	33603935	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:33603935C>T	ENST00000252015.2	-	10	1315	c.1226G>A	c.(1225-1227)aGa>aAa	p.R409K	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.R370K|TRPC4AP_ENST00000539834.1_Missense_Mutation_p.R11K|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.R401K			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	409					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGCAATCATTCTGTGAACCTG	0.403																																																	0													102.0	93.0	96.0					20																	33603935		2203	4300	6503	SO:0001583	missense	26133			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.1226G>A	20.37:g.33603935C>T	ENSP00000252015:p.Arg409Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.R409K	ENST00000252015.2	37	c.1226	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	C	8.750	0.921033	0.17982	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	5.14	2.92	0.33932	.	0.047932	0.85682	D	0.000000	T	0.15392	0.0371	N	0.02802	-0.49	0.80722	D	1	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.08055	0.001;0.003;0.002	T	0.25117	-1.0141	9	0.07482	T	0.82	.	2.6026	0.04870	0.0:0.4417:0.2991:0.2592	.	370;401;409	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	K	409;401;11;370;394	.	ENSP00000252015:R409K	R	-	2	0	TRPC4AP	33067596	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.084000	0.57650	2.382000	0.81193	0.655000	0.94253	AGA	TRPC4AP	-	pfam_DUF3689		0.403	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	C	NM_015638		33603935	-1	no_errors	ENST00000252015	ensembl	human	known	70_37	missense	SNP	1.000	T
TSEN2	80746	genome.wustl.edu	37	3	12544918	12544919	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:12544918_12544919GG>AA	ENST00000284995.6	+	5	853_854	c.466_467GG>AA	c.(466-468)GGa>AAa	p.G156K	TSEN2_ENST00000402228.3_Missense_Mutation_p.G156K|TSEN2_ENST00000454502.2_Missense_Mutation_p.G156K|RNU6-404P_ENST00000515968.1_RNA|TSEN2_ENST00000314571.7_Missense_Mutation_p.G156K|TSEN2_ENST00000415684.1_Missense_Mutation_p.G156K|TSEN2_ENST00000444864.1_Missense_Mutation_p.G156K|TSEN2_ENST00000383797.5_Missense_Mutation_p.G156K	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	156					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						GCTTAACTCTGGAATGGTTTCC	0.52																																																	0																																										SO:0001583	missense	80746			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	Exception_encountered	3.37:g.12544918_12544919delinsAA	ENSP00000284995:p.Gly156Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.G156R|p.G156E	ENST00000284995.6	37	c.466|c.467	CCDS2611.1	3																																																																																			TSEN2	-	pirsf_tRNA_splic_SEN2		0.520	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	G	NM_025265		12544918|12544919	+1	no_errors	ENST00000284995	ensembl	human	known	70_37	missense	SNP	0.000	A
TTC30A	92104	genome.wustl.edu	37	2	178482347	178482347	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:178482347G>A	ENST00000355689.5	-	1	1347	c.1083C>T	c.(1081-1083)ttC>ttT	p.F361F	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	361					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			GGGCATCTAAGAAGTCATAGA	0.473																																																	0													124.0	129.0	127.0					2																	178482347		2203	4300	6503	SO:0001819	synonymous_variant	92104			AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.1083C>T	2.37:g.178482347G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8N0|Q8IVP2	Silent	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.F361	ENST00000355689.5	37	c.1083	CCDS2276.1	2																																																																																			TTC30A	-	NULL		0.473	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30A	HGNC	protein_coding	OTTHUMT00000255728.2	G	NM_152275		178482347	-1	no_errors	ENST00000355689	ensembl	human	known	70_37	silent	SNP	1.000	A
TTLL13	440307	genome.wustl.edu	37	15	90799080	90799080	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr15:90799080T>C	ENST00000339615.5	+	5	801	c.511T>C	c.(511-513)Tac>Cac	p.Y171H	RP11-697E2.6_ENST00000561573.1_Intron|TTLL13_ENST00000438251.1_Missense_Mutation_p.Y171H	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13											NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TCCCTCTGAGTACAACATCTT	0.547																																																	0													253.0	247.0	249.0					15																	90799080		2199	4298	6497	SO:0001583	missense	440307			BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.511T>C	15.37:g.90799080T>C	ENSP00000345294:p.Tyr171His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.Y171H	ENST00000339615.5	37	c.511	CCDS32328.1	15	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987911	0.74589	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	T;T	0.05513	3.43;3.43	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000004	T	0.37404	0.1002	H	0.96142	3.775	0.46499	D	0.999076	D	0.76494	0.999	D	0.78314	0.991	T	0.55366	-0.8152	10	0.87932	D	0	.	14.5795	0.68278	0.0:0.0:0.0:1.0	.	171	A6NNM8-2	.	H	171	ENSP00000413362:Y171H;ENSP00000345294:Y171H	ENSP00000345294:Y171H	Y	+	1	0	TTLL13	88600084	1.000000	0.71417	0.996000	0.52242	0.534000	0.34807	7.371000	0.79600	2.230000	0.72887	0.533000	0.62120	TAC	TTLL13	-	pfam_Tub_tyr_ligase		0.547	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL13	HGNC	protein_coding	OTTHUMT00000435854.1	T	NM_001029964		90799080	+1	no_errors	ENST00000438251	ensembl	human	known	70_37	missense	SNP	1.000	C
ULBP1	80329	genome.wustl.edu	37	6	150290316	150290316	+	Missense_Mutation	SNP	C	C	G	rs186848532	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:150290316C>G	ENST00000229708.3	+	3	488	c.445C>G	c.(445-447)Ctc>Gtc	p.L149V		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	149	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		ACAGAAGTTCCTCCTCTTTGA	0.517																																																	0													89.0	87.0	88.0					6																	150290316		2203	4300	6503	SO:0001583	missense	80329			AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.445C>G	6.37:g.150290316C>G	ENSP00000229708:p.Leu149Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VY81|Q8IZW3|Q8IZX6	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.L149V	ENST00000229708.3	37	c.445	CCDS5223.1	6	.	.	.	.	.	.	.	.	.	.	c	12.84	2.059954	0.36373	.	.	ENSG00000111981	ENST00000367345;ENST00000229708	T;T	0.12255	2.7;2.7	2.29	2.29	0.28610	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.19525	0.0469	M	0.70903	2.155	0.09310	N	1	D	0.63880	0.993	D	0.71414	0.973	T	0.02144	-1.1206	9	0.87932	D	0	.	8.1967	0.31400	0.0:1.0:0.0:0.0	.	149	Q9BZM6	N2DL1_HUMAN	V	149	ENSP00000356314:L149V;ENSP00000229708:L149V	ENSP00000229708:L149V	L	+	1	0	ULBP1	150332009	0.000000	0.05858	0.002000	0.10522	0.116000	0.19942	-0.550000	0.06034	1.599000	0.50093	0.454000	0.30748	CTC	ULBP1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.517	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP1	HGNC	protein_coding	OTTHUMT00000042677.2	C			150290316	+1	no_errors	ENST00000229708	ensembl	human	known	70_37	missense	SNP	0.002	G
URB2	9816	genome.wustl.edu	37	1	229773070	229773070	+	Silent	SNP	T	T	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:229773070T>C	ENST00000258243.2	+	4	2846	c.2710T>C	c.(2710-2712)Tta>Cta	p.L904L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	904						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GATTTCTGCCTTACAGCTGGA	0.507																																																	0													191.0	183.0	186.0					1																	229773070		2203	4300	6503	SO:0001819	synonymous_variant	9816			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2710T>C	1.37:g.229773070T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYC9	Silent	SNP	pfam_Urb2/Npa2_C	p.L904	ENST00000258243.2	37	c.2710	CCDS31052.1	1																																																																																			URB2	-	NULL		0.507	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	T	NM_014777		229773070	+1	no_errors	ENST00000258243	ensembl	human	known	70_37	silent	SNP	0.018	C
URB2	9816	genome.wustl.edu	37	1	229773087	229773087	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:229773087C>G	ENST00000258243.2	+	4	2863	c.2727C>G	c.(2725-2727)ctC>ctG	p.L909L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	909						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TGGACAGCCTCTTGCCACCCT	0.507																																																	0													214.0	205.0	208.0					1																	229773087		2203	4300	6503	SO:0001819	synonymous_variant	9816			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2727C>G	1.37:g.229773087C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYC9	Silent	SNP	pfam_Urb2/Npa2_C	p.L909	ENST00000258243.2	37	c.2727	CCDS31052.1	1																																																																																			URB2	-	NULL		0.507	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	C	NM_014777		229773087	+1	no_errors	ENST00000258243	ensembl	human	known	70_37	silent	SNP	0.143	G
USP15	9958	genome.wustl.edu	37	12	62775325	62775325	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr12:62775325G>A	ENST00000280377.5	+	9	1028	c.970G>A	c.(970-972)Gaa>Aaa	p.E324K	USP15_ENST00000393654.3_Missense_Mutation_p.E299K|USP15_ENST00000353364.3_Missense_Mutation_p.E295K	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	324	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TAAGTATCAAGAAGAACTGAA	0.333																																					Melanoma(181;615 2041 39364 49691 50001)												0													127.0	117.0	120.0					12																	62775325		2203	4300	6503	SO:0001583	missense	9958			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.970G>A	12.37:g.62775325G>A	ENSP00000280377:p.Glu324Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.E324K	ENST00000280377.5	37	c.970	CCDS58251.1	12	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778779	0.49891	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.30182	1.54;1.54;1.54	5.09	5.09	0.68999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.222050	0.46442	D	0.000284	T	0.13457	0.0326	N	0.03608	-0.345	0.43313	D	0.995323	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.16512	-1.0400	9	.	.	.	-20.2094	12.0553	0.53531	0.0785:0.0:0.9215:0.0	.	324;295	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	K	295;324;299	ENSP00000258123:E295K;ENSP00000280377:E324K;ENSP00000377264:E299K	.	E	+	1	0	USP15	61061592	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.860000	0.86993	2.648000	0.89879	0.585000	0.79938	GAA	USP15	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.333	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	G	NM_006313		62775325	+1	no_errors	ENST00000280377	ensembl	human	known	70_37	missense	SNP	1.000	A
USP43	124739	genome.wustl.edu	37	17	9583647	9583647	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr17:9583647C>G	ENST00000285199.7	+	6	1165	c.1069C>G	c.(1069-1071)Caa>Gaa	p.Q357E	USP43_ENST00000570827.2_3'UTR|USP43_ENST00000570475.1_Missense_Mutation_p.Q357E	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	357	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						GTATGCCTTTCAAGTTCCTCC	0.463																																																	0													116.0	108.0	111.0					17																	9583647		1880	4111	5991	SO:0001583	missense	124739			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.1069C>G	17.37:g.9583647C>G	ENSP00000285199:p.Gln357Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.Q357E	ENST00000285199.7	37	c.1069	CCDS45610.1	17	.	.	.	.	.	.	.	.	.	.	C	9.721	1.159665	0.21454	.	.	ENSG00000154914	ENST00000285199	T	0.06294	3.32	5.64	4.62	0.57501	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.070605	0.56097	D	0.000022	T	0.04907	0.0132	N	0.05306	-0.075	0.48696	D	0.999692	P;P;B	0.52170	0.951;0.94;0.034	P;P;B	0.51297	0.665;0.535;0.041	T	0.38265	-0.9669	10	0.02654	T	1	-1.1461	13.7578	0.62948	0.0:0.8448:0.1552:0.0	.	357;46;357	B7ZVX5;Q70EL4-3;Q70EL4	.;.;UBP43_HUMAN	E	357	ENSP00000285199:Q357E	ENSP00000285199:Q357E	Q	+	1	0	USP43	9524372	1.000000	0.71417	0.990000	0.47175	0.873000	0.50193	3.413000	0.52686	2.666000	0.90696	0.591000	0.81541	CAA	USP43	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.463	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	HGNC	protein_coding	OTTHUMT00000439855.3	C	NM_153210		9583647	+1	no_errors	ENST00000285199	ensembl	human	known	70_37	missense	SNP	1.000	G
UTS2B	257313	genome.wustl.edu	37	3	190993043	190993043	+	Missense_Mutation	SNP	C	C	A	rs150179146	byFrequency	TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:190993043C>A	ENST00000340524.5	-	8	1118	c.332G>T	c.(331-333)cGa>cTa	p.R111L	UTS2B_ENST00000427544.2_Missense_Mutation_p.R111L	NM_198152.3	NP_937795.2	Q765I0	UTS2B_HUMAN	urotensin 2B	111					regulation of blood pressure (GO:0008217)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)											AAGCTTACCTCGTTTGCTAGG	0.368																																																	0													160.0	163.0	162.0					3																	190993043		2203	4300	6503	SO:0001583	missense	257313			AB116021	CCDS3300.1	3q28	2013-02-28	2013-02-28	2013-02-28	ENSG00000188958	ENSG00000188958		"""Endogenous ligands"""	30894	protein-coding gene	gene with protein product	"""prepro-URP"""		"""urotensin 2 domain containing"""	UTS2D		14550283	Standard	NM_198152		Approved	URP, U2B	uc003fsu.3	Q765I0	OTTHUMG00000156192	ENST00000340524.5:c.332G>T	3.37:g.190993043C>A	ENSP00000340526:p.Arg111Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQY8|D3DNW1|Q2M1Z2	Missense_Mutation	SNP	NULL	p.R111L	ENST00000340524.5	37	c.332	CCDS3300.1	3	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924565	0.34002	.	.	ENSG00000188958	ENST00000340524;ENST00000427544	T;T	0.55052	0.54;0.54	4.78	1.8	0.24995	.	0.173078	0.27262	N	0.020163	T	0.54902	0.1887	L	0.36672	1.1	0.48288	D	0.999627	D	0.71674	0.998	D	0.68483	0.958	T	0.54214	-0.8327	10	0.72032	D	0.01	-4.1104	5.4902	0.16771	0.0:0.6435:0.0:0.3565	.	111	Q765I0	UTS2B_HUMAN	L	111	ENSP00000340526:R111L;ENSP00000398761:R111L	ENSP00000340526:R111L	R	-	2	0	UTS2D	192475737	0.007000	0.16637	0.958000	0.39756	0.032000	0.12392	-0.708000	0.05035	0.627000	0.30340	0.591000	0.81541	CGA	UTS2D	-	NULL		0.368	UTS2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTS2D	HGNC	protein_coding	OTTHUMT00000343353.1	C	NM_198152		190993043	-1	no_errors	ENST00000446788	ensembl	human	known	70_37	missense	SNP	0.965	A
WDR36	134430	genome.wustl.edu	37	5	110442995	110442995	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr5:110442995G>A	ENST00000513710.2	+	12	1355	c.1351G>A	c.(1351-1353)Gaa>Aaa	p.E451K	WDR36_ENST00000505303.1_Missense_Mutation_p.E395K|WDR36_ENST00000506538.2_Missense_Mutation_p.E451K			Q8NI36	WDR36_HUMAN	WD repeat domain 36	451					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CGTTTTAGAGGAAGCTCGTGA	0.343																																																	0													73.0	69.0	70.0					5																	110442995		2201	4299	6500	SO:0001583	missense	134430			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1351G>A	5.37:g.110442995G>A	ENSP00000424628:p.Glu451Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E451K	ENST00000513710.2	37	c.1351	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404825	0.25378	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.67523	-0.27;-0.27;0.29	4.81	3.92	0.45320	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.518967	0.22790	N	0.055613	T	0.62925	0.2468	L	0.58583	1.82	0.36680	D	0.878975	B	0.21905	0.062	B	0.19148	0.024	T	0.70594	-0.4829	10	0.87932	D	0	-15.5063	13.917	0.63905	0.0785:0.0:0.9215:0.0	.	451	Q8NI36	WDR36_HUMAN	K	451;451;395	ENSP00000423067:E451K;ENSP00000424628:E451K;ENSP00000422158:E395K	ENSP00000422158:E395K	E	+	1	0	WDR36	110470894	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.461000	0.45040	2.389000	0.81357	0.467000	0.42956	GAA	WDR36	-	superfamily_Quinonprotein_ADH-like,pfscan_WD40_repeat_dom		0.343	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	G	NM_139281		110442995	+1	no_errors	ENST00000506538	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR37	22884	genome.wustl.edu	37	10	1142135	1142135	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:1142135C>T	ENST00000358220.1	+	9	819	c.675C>T	c.(673-675)atC>atT	p.I225I	WDR37_ENST00000381329.1_Silent_p.I225I|WDR37_ENST00000263150.4_Silent_p.I225I			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	225			I -> V (in dbSNP:rs2306407).							breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CTGCTCATATCTGGAGATACG	0.512																																																	0													130.0	113.0	119.0					10																	1142135		2203	4300	6503	SO:0001819	synonymous_variant	22884			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.675C>T	10.37:g.1142135C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I225	ENST00000358220.1	37	c.675	CCDS7057.1	10																																																																																			WDR37	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.512	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	HGNC	protein_coding	OTTHUMT00000046418.1	C	NM_014023		1142135	+1	no_errors	ENST00000263150	ensembl	human	known	70_37	silent	SNP	1.000	T
WDR4	10785	genome.wustl.edu	37	21	44273714	44273714	+	Silent	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr21:44273714G>A	ENST00000398208.2	-	9	999	c.940C>T	c.(940-942)Ctg>Ttg	p.L314L	WDR4_ENST00000330317.2_Silent_p.L314L|WDR4_ENST00000492742.1_5'UTR	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		TAGAGCACCAGGGGGGCTTCC	0.647																																																	0													27.0	27.0	27.0					21																	44273714		2203	4300	6503	SO:0001819	synonymous_variant	10785			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.940C>T	21.37:g.44273714G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L314	ENST00000398208.2	37	c.940	CCDS13691.1	21																																																																																			WDR4	-	NULL		0.647	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR4	HGNC	protein_coding	OTTHUMT00000195479.1	G			44273714	-1	no_errors	ENST00000330317	ensembl	human	known	70_37	silent	SNP	0.069	A
XDH	7498	genome.wustl.edu	37	2	31570422	31570422	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:31570422G>A	ENST00000379416.3	-	29	3290	c.3242C>T	c.(3241-3243)tCt>tTt	p.S1081F		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1081					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AGCGCTGACAGAGGCAGCCGT	0.582																																					Colon(66;682 1445 30109 40147)												0													93.0	95.0	94.0					2																	31570422		2203	4300	6503	SO:0001583	missense	7498			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3242C>T	2.37:g.31570422G>A	ENSP00000368727:p.Ser1081Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.S1081F	ENST00000379416.3	37	c.3242	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766794	0.69878	.	.	ENSG00000158125	ENST00000379416	T	0.71461	-0.57	5.85	5.85	0.93711	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.000000	0.85682	D	0.000000	D	0.90889	0.7137	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93632	0.6957	10	0.87932	D	0	.	19.7753	0.96389	0.0:0.0:1.0:0.0	.	1081	P47989	XDH_HUMAN	F	1081	ENSP00000368727:S1081F	ENSP00000368727:S1081F	S	-	2	0	XDH	31423926	1.000000	0.71417	0.905000	0.35620	0.039000	0.13416	9.812000	0.99227	2.753000	0.94483	0.655000	0.94253	TCT	XDH	-	pfam_AldOxase/xan_DH_Mopterin-bd,superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH		0.582	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	G	NM_000379		31570422	-1	no_errors	ENST00000379416	ensembl	human	known	70_37	missense	SNP	1.000	A
DAW1	164781	genome.wustl.edu	37	2	228786123	228786123	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:228786123C>T	ENST00000309931.2	+	12	1142	c.1059C>T	c.(1057-1059)ttC>ttT	p.F353F	DAW1_ENST00000373666.2_3'UTR|DAW1_ENST00000545118.1_Silent_p.F338F	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	353						cilium (GO:0005929)											AGATTTCTTTCAACCCTCAAG	0.393																																																	0													76.0	77.0	76.0					2																	228786123		2203	4300	6503	SO:0001819	synonymous_variant	164781				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.1059C>T	2.37:g.228786123C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRY1|Q8N776	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F353	ENST00000309931.2	37	c.1059	CCDS2470.1	2																																																																																			WDR69	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.393	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR69	HGNC	protein_coding	OTTHUMT00000331745.1	C	NM_178821		228786123	+1	no_errors	ENST00000309931	ensembl	human	known	70_37	silent	SNP	1.000	T
TSIX	9383	genome.wustl.edu	37	X	73042609	73042609	+	lincRNA	SNP	C	C	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chrX:73042609C>A	ENST00000604411.1	+	0	30570				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CATCAATACTCGTATGAACGA	0.343																																																	0													42.0	44.0	43.0					X																	73042609		875	1991	2866			7503					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73042609C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-		0.343	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	C	NR_003255		73042609	-1	no_errors	ENST00000429829	ensembl	human	known	70_37	rna	SNP	0.001	A
XRRA1	143570	genome.wustl.edu	37	11	74656099	74656099	+	5'UTR	DEL	T	T	-			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr11:74656099delT	ENST00000340360.6	-	0	291				AP001992.1_ENST00000578538.1_RNA|XRRA1_ENST00000321448.8_Intron|XRRA1_ENST00000527087.1_5'UTR|XRRA1_ENST00000533598.1_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						CTTAACTTCCTTTTTTTTTTG	0.368																																																	0																																										SO:0001623	5_prime_UTR_variant	143570			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.-41A>-	11.37:g.74656099delT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000340360.6	37	NULL	CCDS44680.1	11																																																																																			XRRA1	-	-		0.368	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	T	NM_182969		74656099	-1	no_errors	ENST00000524430	ensembl	human	known	70_37	rna	DEL	0.998	-
ZAN	7455	genome.wustl.edu	37	7	100361686	100361686	+	RNA	SNP	C	C	G	rs377380617		TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:100361686C>G	ENST00000348028.3	+	0	4299				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F1378F(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTTCCTTCTTCGACAGCTGCA	0.612																																																	1	Substitution - coding silent(1)	large_intestine(1)											64.0	63.0	63.0					7																	100361686		2154	4254	6408			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100361686C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.F1378L	ENST00000348028.3	37	c.4134		7	.	.	.	.	.	.	.	.	.	.	C	11.73	1.724442	0.30593	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.75704	-0.96;-0.96;-0.96	4.01	-4.92	0.03075	Uncharacterised domain, cysteine-rich (2);	0.220912	0.23312	N	0.049547	T	0.61652	0.2364	L	0.49778	1.585	0.80722	D	1	B;B	0.29253	0.201;0.239	B;B	0.34824	0.119;0.19	T	0.35919	-0.9769	10	0.37606	T	0.19	.	6.3119	0.21169	0.0:0.3308:0.1322:0.537	.	1378;1378	F5H0T8;Q9Y493	.;ZAN_HUMAN	L	1378	ENSP00000445943:F1378L;ENSP00000445091:F1378L;ENSP00000444427:F1378L	ENSP00000423579:F1378L	F	+	3	2	ZAN	100199622	0.002000	0.14202	0.032000	0.17829	0.745000	0.42441	-0.055000	0.11807	-1.320000	0.02283	-0.291000	0.09656	TTC	ZAN	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.612	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	C	NM_003386		100361686	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	missense	SNP	0.944	G
ZAN	7455	genome.wustl.edu	37	7	100364824	100364824	+	RNA	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:100364824G>A	ENST00000348028.3	+	0	4969				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CATCAAAGCCGTCCACGTGAC	0.587																																																	0													52.0	53.0	52.0					7																	100364824		2105	4218	6323			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100364824G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.V1602I	ENST00000348028.3	37	c.4804		7	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334260	0.60853	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	4.63	4.63	0.57726	von Willebrand factor, type D domain (3);	0.000000	0.37623	N	0.002003	T	0.75554	0.3865	M	0.66297	2.02	0.23533	N	0.997471	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.66376	-0.5939	10	0.40728	T	0.16	.	13.6909	0.62544	0.0:0.0:1.0:0.0	.	1602;1602	F5H0T8;Q9Y493	.;ZAN_HUMAN	I	1602;1602;1602;179	ENSP00000445943:V1602I;ENSP00000445091:V1602I;ENSP00000444427:V1602I;ENSP00000441117:V179I	ENSP00000423579:V1602I	V	+	1	0	ZAN	100202760	0.998000	0.40836	0.076000	0.20297	0.017000	0.09413	3.307000	0.51888	2.517000	0.84864	0.561000	0.74099	GTC	ZAN	-	pfam_VWF_type-D,smart_VWF_type-D		0.587	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	G	NM_003386		100364824	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	missense	SNP	0.926	A
ZBTB17	7709	genome.wustl.edu	37	1	16271698	16271698	+	Splice_Site	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr1:16271698C>T	ENST00000375743.4	-	7	894		c.e7-1		ZBTB17_ENST00000375733.2_Splice_Site|ZBTB17_ENST00000479282.1_5'Flank|ZBTB17_ENST00000448462.2_Splice_Site|ZBTB17_ENST00000537142.1_Splice_Site	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTCCATTTCTGCGGAGAAA	0.637																																																	0													54.0	45.0	48.0					1																	16271698		2123	4194	6317	SO:0001630	splice_region_variant	7709			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.662-1G>A	1.37:g.16271698C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Splice_Site	SNP	-	e5-1	ENST00000375743.4	37	c.662-1	CCDS165.1	1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151631	0.38021	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000448462	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3448	0.66654	0.0:0.8516:0.1484:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZBTB17	16144285	0.997000	0.39634	0.998000	0.56505	0.404000	0.30871	2.448000	0.44926	2.514000	0.84764	0.561000	0.74099	.	ZBTB17	-	-		0.637	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB17	HGNC	protein_coding	OTTHUMT00000025998.1	C	NM_003443	Intron	16271698	-1	no_errors	ENST00000375733	ensembl	human	known	70_37	splice_site	SNP	0.970	T
ZC3H15	55854	genome.wustl.edu	37	2	187351166	187351166	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:187351166G>C	ENST00000337859.6	+	1	284	c.57G>C	c.(55-57)aaG>aaC	p.K19N	ZC3H15_ENST00000544130.1_5'UTR	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	19					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			AGCAAAAAAAGAAGGAGAAGA	0.622																																																	0													59.0	75.0	70.0					2																	187351166		1899	4099	5998	SO:0001583	missense	55854				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.57G>C	2.37:g.187351166G>C	ENSP00000338788:p.Lys19Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.K19N	ENST00000337859.6	37	c.57	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120725	0.77436	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.65364	-0.15	5.38	4.51	0.55191	.	0.171105	0.48767	D	0.000164	T	0.79713	0.4493	M	0.88775	2.98	0.80722	D	1	P	0.51653	0.947	D	0.67231	0.95	T	0.81844	-0.0746	10	0.66056	D	0.02	-11.0911	10.0723	0.42341	0.0923:0.0:0.9077:0.0	.	19	Q8WU90	ZC3HF_HUMAN	N	19	ENSP00000338788:K19N	ENSP00000338788:K19N	K	+	3	2	ZC3H15	187059411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.085000	0.57657	1.263000	0.44181	0.655000	0.94253	AAG	ZC3H15	-	NULL		0.622	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	G	NM_018471		187351166	+1	no_errors	ENST00000337859	ensembl	human	known	70_37	missense	SNP	1.000	C
ZHX3	23051	genome.wustl.edu	37	20	39831615	39831615	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr20:39831615C>T	ENST00000309060.3	-	4	2357	c.1942G>A	c.(1942-1944)Gaa>Aaa	p.E648K	ZHX3_ENST00000544979.2_Missense_Mutation_p.E648K|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.E648K|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.E648K|ZHX3_ENST00000432768.2_Missense_Mutation_p.E648K|ZHX3_ENST00000540170.1_Missense_Mutation_p.E648K			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	648					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				ATTTTGGTTTCACTTCTCAGG	0.493																																																	0													140.0	151.0	147.0					20																	39831615		2203	4300	6503	SO:0001583	missense	23051			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1942G>A	20.37:g.39831615C>T	ENSP00000312222:p.Glu648Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain	p.E648K	ENST00000309060.3	37	c.1942	CCDS13315.1	20	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226153	0.79576	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262	D;D;D	0.95788	-3.81;-3.81;-3.81	6.06	6.06	0.98353	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96312	0.8797	L	0.33093	0.98	0.51482	D	0.99992	D;D;D	0.76494	0.994;0.999;0.998	D;D;D	0.79108	0.973;0.992;0.974	D	0.95066	0.8200	10	0.33940	T	0.23	-20.7029	20.6244	0.99512	0.0:1.0:0.0:0.0	.	648;648;648	A8K8Q0;Q9H4I2;F5H820	.;ZHX3_HUMAN;.	K	648;648;648;648;426	ENSP00000362360:E648K;ENSP00000442290:E648K;ENSP00000443783:E648K	ENSP00000312222:E648K	E	-	1	0	ZHX3	39265029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.760000	0.68793	2.879000	0.98667	0.650000	0.86243	GAA	ZHX3	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.493	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZHX3	HGNC	protein_coding	OTTHUMT00000079262.3	C	NM_015035		39831615	-1	no_errors	ENST00000373263	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF177	7730	genome.wustl.edu	37	19	9491916	9491916	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:9491916G>A	ENST00000589262.1	+	6	975	c.909G>A	c.(907-909)atG>atA	p.M303I	ZNF177_ENST00000343499.4_Missense_Mutation_p.M143I|ZNF177_ENST00000434737.2_Missense_Mutation_p.M303I|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000602738.1_Missense_Mutation_p.M143I|ZNF177_ENST00000541595.2_Missense_Mutation_p.M143I	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	303					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						AGAAACACATGAGATCTCATA	0.448																																																	0													94.0	87.0	90.0					19																	9491916		2203	4300	6503	SO:0001583	missense	7730			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.909G>A	19.37:g.9491916G>A	ENSP00000468531:p.Met303Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M303I	ENST00000589262.1	37	c.909	CCDS54214.1	19	.	.	.	.	.	.	.	.	.	.	G	9.994	1.231661	0.22626	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	T;T;T	0.17213	2.86;2.86;2.29	2.64	-0.767	0.11016	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09113	0.0225	N	0.20483	0.58	0.23550	N	0.997439	B;B	0.10296	0.003;0.003	B;B	0.15484	0.004;0.013	T	0.30238	-0.9985	8	0.66056	D	0.02	.	2.5253	0.04689	0.2546:0.0:0.3414:0.404	.	303;143	B4DY57;Q13360	.;ZN177_HUMAN	I	143;143;303	ENSP00000445323:M143I;ENSP00000341497:M143I;ENSP00000415070:M303I	ENSP00000341497:M143I	M	+	3	0	ZNF177	9352916	0.000000	0.05858	0.001000	0.08648	0.992000	0.81027	-0.385000	0.07379	-0.069000	0.12931	0.563000	0.77884	ATG	ZNF177	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.448	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	HGNC	protein_coding	OTTHUMT00000449028.1	G	NM_003451		9491916	+1	no_errors	ENST00000434737	ensembl	human	known	70_37	missense	SNP	0.244	A
ZKSCAN8	7745	genome.wustl.edu	37	6	28121105	28121105	+	Silent	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr6:28121105C>T	ENST00000330236.6	+	6	1231	c.1047C>T	c.(1045-1047)ccC>ccT	p.P349P	ZKSCAN8_ENST00000457389.2_Silent_p.P349P	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	349					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGGAGAAACCCTATCAGTGTA	0.458																																																	0													221.0	216.0	218.0					6																	28121105		2203	4300	6503	SO:0001819	synonymous_variant	7745				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.1047C>T	6.37:g.28121105C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P349	ENST00000330236.6	37	c.1047	CCDS4645.1	6																																																																																			ZNF192	-	pfscan_Znf_C2H2		0.458	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF192	HGNC	protein_coding	OTTHUMT00000040178.2	C			28121105	+1	no_errors	ENST00000330236	ensembl	human	known	70_37	silent	SNP	0.999	T
ZNF385B	151126	genome.wustl.edu	37	2	180634480	180634480	+	Start_Codon_SNP	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr2:180634480C>T	ENST00000410066.1	-	3	606	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	1	Required for induction of apoptosis.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TTGCCATATTCATGATTCCAT	0.388																																					Colon(155;204 2491 32774 51842)												0													53.0	56.0	55.0					2																	180634480		2203	4300	6503	SO:0001582	initiator_codon_variant	151126			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.3G>A	2.37:g.180634480C>T	ENSP00000386845:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.M1I	ENST00000410066.1	37	c.3	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971203	0.34754	.	.	ENSG00000144331	ENST00000410066;ENST00000451732;ENST00000438871	T	0.32023	1.47	5.38	4.5	0.54988	.	0.086237	0.49916	D	0.000126	T	0.28333	0.0700	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06826	-1.0805	9	0.87932	D	0	-1.4991	13.2708	0.60159	0.0:0.9239:0.0:0.0761	.	1	Q569K4	Z385B_HUMAN	I	1	ENSP00000386845:M1I	ENSP00000386845:M1I	M	-	3	0	ZNF385B	180342725	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.396000	0.52565	1.270000	0.44297	0.561000	0.74099	ATG	ZNF385B	-	NULL		0.388	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	C	NM_152520	Missense_Mutation	180634480	-1	no_errors	ENST00000410066	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF501	115560	genome.wustl.edu	37	3	44776538	44776538	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr3:44776538G>C	ENST00000396048.2	+	3	1062	c.625G>C	c.(625-627)Gaa>Caa	p.E209Q	KIAA1143_ENST00000484437.1_5'Flank	NM_001258280.1|NM_145044.3	NP_001245209.1|NP_659481.2	Q96CX3	ZN501_HUMAN	zinc finger protein 501	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E209K(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)		TGTTGAACATGAAAGGACTCA	0.418																																																	1	Substitution - Missense(1)	lung(1)											72.0	76.0	74.0					3																	44776538		2129	4272	6401	SO:0001583	missense	115560			BC013762	CCDS2720.2	3p21.32	2013-01-08			ENSG00000186446	ENSG00000186446		"""Zinc fingers, C2H2-type"""	23717	protein-coding gene	gene with protein product			"""zinc finger protein 52"""	ZNF52		1505991	Standard	NM_145044		Approved	MGC21738	uc003cnu.2	Q96CX3	OTTHUMG00000133048	ENST00000396048.2:c.625G>C	3.37:g.44776538G>C	ENSP00000379363:p.Glu209Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DLY7|Q96NU9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E209Q	ENST00000396048.2	37	c.625	CCDS2720.2	3	.	.	.	.	.	.	.	.	.	.	G	0.632	-0.816803	0.02776	.	.	ENSG00000186446	ENST00000396048;ENST00000332489	T	0.36157	1.27	2.94	0.851	0.18989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10508	0.0257	N	0.03209	-0.39	0.09310	N	0.999997	B	0.06786	0.001	B	0.09377	0.004	T	0.33523	-0.9865	9	0.02654	T	1	.	0.555	0.00669	0.2511:0.1896:0.3653:0.1941	.	209	Q96CX3	ZN501_HUMAN	Q	209;153	ENSP00000379363:E209Q	ENSP00000330388:E153Q	E	+	1	0	ZNF501	44751542	0.000000	0.05858	0.990000	0.47175	0.990000	0.78478	0.447000	0.21710	0.552000	0.29026	0.563000	0.77884	GAA	ZNF501	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF501-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF501	HGNC	protein_coding	OTTHUMT00000256654.4	G	NM_145044		44776538	+1	no_errors	ENST00000396048	ensembl	human	known	70_37	missense	SNP	0.694	C
ZNF536	9745	genome.wustl.edu	37	19	30935520	30935520	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:30935520G>A	ENST00000355537.3	+	2	1198	c.1051G>A	c.(1051-1053)Ggt>Agt	p.G351S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	351					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGAGGTGTGCGGTCAGGTGTT	0.652																																																	0													101.0	110.0	107.0					19																	30935520		2203	4300	6503	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1051G>A	19.37:g.30935520G>A	ENSP00000347730:p.Gly351Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G351S	ENST00000355537.3	37	c.1051	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104669	0.77096	.	.	ENSG00000198597	ENST00000355537	T	0.58358	0.34	5.59	5.59	0.84812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	L	0.45581	1.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70063	-0.4975	10	0.72032	D	0.01	-27.6561	19.5661	0.95393	0.0:0.0:1.0:0.0	.	351;351	A7E228;O15090	.;ZN536_HUMAN	S	351	ENSP00000347730:G351S	ENSP00000347730:G351S	G	+	1	0	ZNF536	35627360	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.965000	0.87945	2.631000	0.89168	0.491000	0.48974	GGT	ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	G	NM_014717		30935520	+1	no_errors	ENST00000355537	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF733P	643955	genome.wustl.edu	37	7	62752082	62752082	+	RNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr7:62752082C>G	ENST00000331425.6	-	0	1353					NR_003952.1				zinc finger protein 733, pseudogene																		TAGGGTCTCTCTCCAGTGTGA	0.428																																																	0																																												643955					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752082C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-		0.428	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	C			62752082	-1	no_errors	ENST00000331425	ensembl	human	known	70_37	rna	SNP	1.000	G
ZNF833P	401898	genome.wustl.edu	37	19	11796196	11796196	+	lincRNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:11796196C>G	ENST00000344893.3	+	0	2195					NR_028594.1		Q6ZTB9	ZN833_HUMAN	zinc finger protein 833, pseudogene								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5						TGTTCCAGTTCCATTCGAAAA	0.348																																																	0													52.0	55.0	54.0					19																	11796196		2203	4300	6503			401898			BC137336		19p13.2	2010-08-03	2010-08-03	2010-08-03	ENSG00000197332	ENSG00000197332			33819	pseudogene	pseudogene			"""zinc finger protein 833"""	ZNF833			Standard	NR_028594		Approved		uc021upi.1	Q6ZTB9	OTTHUMG00000156530		19.37:g.11796196C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPA0	RNA	SNP	-	NULL	ENST00000344893.3	37	NULL		19																																																																																			ZNF833P	-	-		0.348	ZNF833P-001	KNOWN	basic|readthrough_transcript	lincRNA	ZNF833P	HGNC	lincRNA	OTTHUMT00000458891.1	C	NM_001013691		11796196	+1	no_errors	ENST00000344893	ensembl	human	known	70_37	rna	SNP	0.000	G
ZNF833P	401898	genome.wustl.edu	37	19	11797029	11797029	+	lincRNA	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:11797029C>G	ENST00000344893.3	+	0	3028					NR_028594.1		Q6ZTB9	ZN833_HUMAN	zinc finger protein 833, pseudogene								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5						TTCAGTTTCTCTTGAATAAag	0.343																																																	0																																												401898			BC137336		19p13.2	2010-08-03	2010-08-03	2010-08-03	ENSG00000197332	ENSG00000197332			33819	pseudogene	pseudogene			"""zinc finger protein 833"""	ZNF833			Standard	NR_028594		Approved		uc021upi.1	Q6ZTB9	OTTHUMG00000156530		19.37:g.11797029C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPA0	RNA	SNP	-	NULL	ENST00000344893.3	37	NULL		19																																																																																			ZNF833P	-	-		0.343	ZNF833P-001	KNOWN	basic|readthrough_transcript	lincRNA	ZNF833P	HGNC	lincRNA	OTTHUMT00000458891.1	C	NM_001013691		11797029	+1	no_errors	ENST00000344893	ensembl	human	known	70_37	rna	SNP	0.001	G
ZNF99	7652	genome.wustl.edu	37	19	22951113	22951113	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:22951113G>A	ENST00000596209.1	-	3	310	c.220C>T	c.(220-222)Ccc>Tcc	p.P74S	ZNF99_ENST00000397104.3_Missense_Mutation_p.P95S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATACCTGGGGGTTTAGTTACC	0.423																																																	0													62.0	63.0	63.0					19																	22951113		2162	4293	6455	SO:0001583	missense	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.220C>T	19.37:g.22951113G>A	ENSP00000472969:p.Pro74Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P95S	ENST00000596209.1	37	c.283	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.700522	0.00725	.	.	ENSG00000213973	ENST00000397104	T	0.05855	3.38	0.428	-0.855	0.10700	Krueppel-associated box (1);	.	.	.	.	T	0.03095	0.0091	N	0.16833	0.445	0.09310	N	1	B	0.33826	0.427	B	0.30716	0.119	T	0.45571	-0.9252	8	0.21014	T	0.42	.	.	.	.	.	95	A8MXY4	ZNF99_HUMAN	S	95	ENSP00000380293:P95S	ENSP00000380293:P95S	P	-	1	0	ZNF99	22742953	0.016000	0.18221	0.042000	0.18584	0.039000	0.13416	-0.193000	0.09573	-0.504000	0.06577	-0.515000	0.04445	CCC	ZNF99	-	pfscan_Krueppel-associated_box		0.423	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	G	XM_065124		22951113	-1	no_errors	ENST00000397104	ensembl	human	known	70_37	missense	SNP	0.056	A
ZNF865	100507290	genome.wustl.edu	37	19	56126826	56126826	+	Silent	SNP	C	C	G			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:56126826C>G	ENST00000568956.1	+	2	2196	c.1842C>G	c.(1840-1842)gtC>gtG	p.V614V		NM_001195605.1	NP_001182534.1	P0CJ78	ZN865_HUMAN	zinc finger protein 865	614					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCGGCAAGGTCTTCGGCTACC	0.697																																																	0																																										SO:0001819	synonymous_variant	100507290				CCDS58681.1	19q13.42	2013-01-08			ENSG00000261221	ENSG00000261221		"""Zinc fingers, C2H2-type"""	38705	protein-coding gene	gene with protein product							Standard	NM_001195605		Approved		uc021vca.1	P0CJ78	OTTHUMG00000177108	ENST00000568956.1:c.1842C>G	19.37:g.56126826C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V614	ENST00000568956.1	37	c.1842	CCDS58681.1	19																																																																																			ZNF865	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.697	ZNF865-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF865	HGNC	protein_coding	OTTHUMT00000435399.1	C	NM_001195605		56126826	+1	no_errors	ENST00000568956	ensembl	human	novel	70_37	silent	SNP	0.999	G
ZSCAN5A	79149	genome.wustl.edu	37	19	56733133	56733133	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:56733133G>T	ENST00000587340.1	-	7	1997	c.1302C>A	c.(1300-1302)caC>caA	p.H434Q	ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.H288Q|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.H434Q|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.H433Q|ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.H317Q			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	434					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TCTCCCCTGTGTGGCTTCTCT	0.547																																																	0													54.0	50.0	52.0					19																	56733133		2203	4297	6500	SO:0001583	missense	79149			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.1302C>A	19.37:g.56733133G>T	ENSP00000467631:p.His434Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.H434Q	ENST00000587340.1	37	c.1302	CCDS12941.1	19	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218709	0.58560	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.66995	-0.24;-0.24	2.73	2.73	0.32206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84247	0.5430	M	0.93420	3.415	0.50039	D	0.999843	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.87284	0.2294	9	0.87932	D	0	.	11.2261	0.48884	0.0:0.0:1.0:0.0	.	317;434	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	Q	434;317	ENSP00000375593:H434Q;ENSP00000254165:H317Q	ENSP00000254165:H317Q	H	-	3	2	ZSCAN5A	61424945	1.000000	0.71417	0.220000	0.23810	0.021000	0.10359	3.967000	0.56802	1.549000	0.49425	0.491000	0.48974	CAC	ZSCAN5A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.547	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN5A	HGNC	protein_coding	OTTHUMT00000458110.1	G	NM_024303		56733133	-1	no_errors	ENST00000391713	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF835	90485	genome.wustl.edu	37	19	57175591	57175591	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr19:57175591G>A	ENST00000537055.2	-	2	1207	c.976C>T	c.(976-978)Cgc>Tgc	p.R326C		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	326					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GTGTGGATGCGCCGGTGCTCG	0.701																																																	0													18.0	18.0	18.0					19																	57175591		2201	4298	6499	SO:0001583	missense	90485			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.976C>T	19.37:g.57175591G>A	ENSP00000444747:p.Arg326Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R326C	ENST00000537055.2	37	c.976	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584676	0.46110	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.25749	1.78	2.27	-1.73	0.08081	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53029	0.1771	M	0.90082	3.085	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.46610	-0.9179	9	0.87932	D	0	.	10.2739	0.43499	0.0:0.0:0.3577:0.6423	.	348	Q9Y2P0	ZN835_HUMAN	C	348;326	ENSP00000444747:R326C	ENSP00000341756:R348C	R	-	1	0	ZNF835	61867403	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-2.230000	0.01207	-0.277000	0.09193	-0.314000	0.08810	CGC	ZNF835	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.701	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	G	NM_001005850		57175591	-1	no_errors	ENST00000537055	ensembl	human	known	70_37	missense	SNP	0.003	A
ZSWIM8	23053	genome.wustl.edu	37	10	75560667	75560667	+	Intron	SNP	C	C	T			TCGA-EK-A2RA-01A-11D-A18J-09	TCGA-EK-A2RA-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5d134e2a-722b-4e87-93bc-5e9dae4c51c1	a36cc751-6ac0-464c-98a1-9e29735c1962	g.chr10:75560667C>T	ENST00000605216.1	+	25	5348				ZSWIM8_ENST00000604729.1_Intron|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Intron|ZSWIM8_ENST00000603114.1_Intron|ZSWIM8_ENST00000604524.1_Intron|ZSWIM8_ENST00000398706.2_Intron	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8								zinc ion binding (GO:0008270)										TACCTCAGCTCCTGGGGTGGA	0.642																																																	0																																										SO:0001627	intron_variant	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.5132-108C>T	10.37:g.75560667C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	RNA	SNP	-	NULL	ENST00000605216.1	37	NULL		10																																																																																			ZSWIM8	-	-		0.642	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8	HGNC	protein_coding	OTTHUMT00000468545.1	C	NM_001242487		75560667	+1	no_errors	ENST00000466568	ensembl	human	known	70_37	rna	SNP	1.000	T
