#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AGAP6	414189	genome.wustl.edu	37	10	51769259	51769259	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr10:51769259G>A	ENST00000374056.4	+	7	1703	c.1305G>A	c.(1303-1305)ctG>ctA	p.L435L	AGAP6_ENST00000412531.3_Silent_p.L458L			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	435					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						AGTCCCAGCTGACCAGCCAGA	0.597																																																	0																																										SO:0001819	synonymous_variant	414189				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.1305G>A	10.37:g.51769259G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.L458	ENST00000374056.4	37	c.1374		10																																																																																			AGAP6	-	NULL		0.597	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	AGAP6	HGNC	protein_coding		G	NM_001077665		51769259	+1	no_errors	ENST00000374056	ensembl	human	known	70_37	silent	SNP	1.000	A
AHCTF1	25909	genome.wustl.edu	37	1	247016504	247016504	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:247016504C>T	ENST00000391829.2	-	32	4575	c.4452G>A	c.(4450-4452)ctG>ctA	p.L1484L	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Silent_p.L1493L|AHCTF1_ENST00000366508.1_Silent_p.L1519L			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1484	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CTTTTAAGTTCAGCGCTACTT	0.448																																					Colon(145;197 1800 4745 15099 26333)												0													36.0	35.0	35.0					1																	247016504		2203	4296	6499	SO:0001819	synonymous_variant	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4452G>A	1.37:g.247016504C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.L1493	ENST00000391829.2	37	c.4479		1																																																																																			AHCTF1	-	NULL		0.448	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		C	NM_015446		247016504	-1	no_errors	ENST00000326225	ensembl	human	known	70_37	silent	SNP	0.000	T
ANKHD1	54882	genome.wustl.edu	37	5	139892455	139892455	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:139892455C>G	ENST00000360839.2	+	23	4301	c.4147C>G	c.(4147-4149)Cag>Gag	p.Q1383E	ANKHD1_ENST00000297183.6_Missense_Mutation_p.Q1383E|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.Q1383E	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1383						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAGTAAATCAGTTCCCTTC	0.303																																																	0													123.0	130.0	128.0					5																	139892455		2203	4299	6502	SO:0001583	missense	54882			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.4147C>G	5.37:g.139892455C>G	ENSP00000354085:p.Gln1383Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.Q1383E	ENST00000360839.2	37	c.4147	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.45|19.45	3.829221|3.829221	0.71258|0.71258	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000246149|ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000431508;ENST00000532219	.|T;T;T;T;T;T	.|0.68331	.|-0.29;-0.32;-0.14;-0.21;1.05;-0.32	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77170|0.77170	0.4091|0.4091	L|L	0.45352|0.45352	1.415|1.415	0.80722|0.80722	D|D	1|1	.|D;P;D;D;D;D	.|0.60160	.|0.977;0.933;0.987;0.969;0.985;0.963	.|D;P;D;D;D;D	.|0.73708	.|0.974;0.869;0.97;0.93;0.981;0.973	T|T	0.76727|0.76727	-0.2853|-0.2853	5|10	.|0.48119	.|T	.|0.1	.|.	19.1644|19.1644	0.93548|0.93548	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1383;594;1383;1402;1383;1383	.|E9PF56;E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.|.;.;.;.;.;ANKH1_HUMAN	M|E	608|1383;1416;1383;1383;917;594;1402;536;39;1383	.|ENSP00000354085:Q1383E;ENSP00000297183:Q1383E;ENSP00000394489:Q1402E;ENSP00000405602:Q536E;ENSP00000393204:Q39E;ENSP00000432016:Q1383E	.|ENSP00000432016:Q1383E	I|Q	+|+	3|1	3|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139872639|139872639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.776000|7.776000	0.85560|0.85560	2.606000|2.606000	0.88127|0.88127	0.558000|0.558000	0.71614|0.71614	ATC|CAG	ANKHD1	-	smart_Ankyrin_rpt		0.303	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	C	NM_017747		139892455	+1	no_errors	ENST00000297183	ensembl	human	known	70_37	missense	SNP	1.000	G
ANKIB1	54467	genome.wustl.edu	37	7	91936869	91936869	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:91936869G>C	ENST00000265742.3	+	3	761	c.385G>C	c.(385-387)Gac>Cac	p.D129H		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	129							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGCAAAACTTGACCAGGGTGA	0.458																																																	0													90.0	88.0	89.0					7																	91936869		1916	4124	6040	SO:0001583	missense	54467			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.385G>C	7.37:g.91936869G>C	ENSP00000265742:p.Asp129His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.D129H	ENST00000265742.3	37	c.385	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355822	0.82243	.	.	ENSG00000001629	ENST00000265742;ENST00000442183	T;T	0.56444	0.46;1.28	5.71	5.71	0.89125	Ankyrin repeat-containing domain (4);	0.048483	0.85682	D	0.000000	T	0.68146	0.2969	L	0.54323	1.7	0.80722	D	1	D	0.61697	0.99	P	0.61722	0.893	T	0.69420	-0.5150	10	0.87932	D	0	.	19.8516	0.96743	0.0:0.0:1.0:0.0	.	129	Q9P2G1	AKIB1_HUMAN	H	129	ENSP00000265742:D129H;ENSP00000407002:D129H	ENSP00000265742:D129H	D	+	1	0	ANKIB1	91774805	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.685000	0.91497	0.585000	0.79938	GAC	ANKIB1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.458	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1	G			91936869	+1	no_errors	ENST00000265742	ensembl	human	known	70_37	missense	SNP	1.000	C
ARHGAP6	395	genome.wustl.edu	37	X	11204449	11204449	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:11204449C>T	ENST00000337414.4	-	5	2052	c.1180G>A	c.(1180-1182)Gaa>Aaa	p.E394K	ARHGAP6_ENST00000534860.1_Missense_Mutation_p.E219K|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.E203K|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.E426K|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.E191K|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.E394K|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.E191K	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	394					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CTGGCTTTTTCCTTTTTACTT	0.438																																																	0													164.0	143.0	150.0					X																	11204449		2203	4300	6503	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1180G>A	X.37:g.11204449C>T	ENSP00000338967:p.Glu394Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E394K	ENST00000337414.4	37	c.1180	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940967	0.52972	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.22945	1.93;1.95;1.95;1.96;1.93;1.94;1.98;1.99	5.51	2.61	0.31194	.	0.110174	0.39834	N	0.001259	T	0.11367	0.0277	N	0.03608	-0.345	0.50813	D	0.999895	B;B;B;B;B	0.21309	0.001;0.029;0.054;0.021;0.021	B;B;B;B;B	0.20184	0.001;0.017;0.028;0.018;0.012	T	0.10268	-1.0637	10	0.09084	T	0.74	.	16.0178	0.80455	0.0:0.6345:0.3655:0.0	.	203;191;394;394;394	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	K	219;191;191;394;230;394;203;426	ENSP00000438135:E219K;ENSP00000370112:E191K;ENSP00000302312:E191K;ENSP00000338967:E394K;ENSP00000370093:E230K;ENSP00000370094:E394K;ENSP00000389394:E203K;ENSP00000370108:E426K	ENSP00000302312:E191K	E	-	1	0	ARHGAP6	11114370	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	1.380000	0.34351	0.489000	0.27749	0.600000	0.82982	GAA	ARHGAP6	-	NULL		0.438	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	C	NM_013427		11204449	-1	no_errors	ENST00000337414	ensembl	human	known	70_37	missense	SNP	1.000	T
ATG3	64422	genome.wustl.edu	37	3	112260686	112260686	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:112260686C>T	ENST00000283290.5	-	7	873	c.439G>A	c.(439-441)Gaa>Aaa	p.E147K	ATG3_ENST00000402314.2_Missense_Mutation_p.E147K|ATG3_ENST00000495756.1_5'UTR	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	147					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						TCTTCATCTTCTTCCTCTTCA	0.299																																																	0													168.0	155.0	160.0					3																	112260686		2203	4300	6503	SO:0001583	missense	64422				CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.439G>A	3.37:g.112260686C>T	ENSP00000283290:p.Glu147Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PKC5|Q9H6L9	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_3_N,pfam_Autophagy-rel_prot_3,pfam_Autophagy-rel_prot_3_C	p.E147K	ENST00000283290.5	37	c.439	CCDS2966.1	3	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070225	0.76301	.	.	ENSG00000144848	ENST00000283290;ENST00000402314;ENST00000492886	.	.	.	5.27	5.27	0.74061	Autophagy-related protein 3, N-terminal (1);	0.283555	0.38111	N	0.001807	T	0.60919	0.2306	L	0.46741	1.465	0.41657	D	0.989163	B;B;B	0.26081	0.13;0.083;0.141	B;B;B	0.35353	0.037;0.201;0.127	T	0.56038	-0.8045	9	0.16896	T	0.51	-4.2219	18.8782	0.92346	0.0:1.0:0.0:0.0	.	60;147;147	C9JNW8;Q9NT62;Q9NT62-2	.;ATG3_HUMAN;.	K	147;147;60	.	ENSP00000283290:E147K	E	-	1	0	ATG3	113743376	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	6.118000	0.71583	2.466000	0.83321	0.467000	0.42956	GAA	ATG3	-	pfam_Autophagy-rel_prot_3_N		0.299	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG3	HGNC	protein_coding	OTTHUMT00000354147.1	C	NM_022488		112260686	-1	no_errors	ENST00000283290	ensembl	human	known	70_37	missense	SNP	1.000	T
ATP2B4	493	genome.wustl.edu	37	1	203696628	203696628	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:203696628G>C	ENST00000357681.5	+	20	4361	c.3238G>C	c.(3238-3240)Gac>Cac	p.D1080H	ATP2B4_ENST00000466407.1_3'UTR|ATP2B4_ENST00000391954.2_Missense_Mutation_p.D1044H|ATP2B4_ENST00000367219.3_Missense_Mutation_p.D1068H|SNORA77_ENST00000408716.1_RNA|ATP2B4_ENST00000341360.2_Missense_Mutation_p.D1080H|ATP2B4_ENST00000367218.3_Missense_Mutation_p.D1080H	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1080					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGATGAGATTGACCATGCTGA	0.572																																																	0													162.0	149.0	154.0					1																	203696628		2203	4300	6503	SO:0001583	missense	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3238G>C	1.37:g.203696628G>C	ENSP00000350310:p.Asp1080His	Somatic		WXS	Illumina HiSeq	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.D1080H	ENST00000357681.5	37	c.3238	CCDS1440.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.027773|4.027773	0.75390|0.75390	.|.	.|.	ENSG00000058668|ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360|ENST00000458092;ENST00000356729	D;D;D;D;D|.	0.95171|.	-3.26;-3.3;-3.31;-3.63;-3.3|.	5.76|5.76	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.52532|.	D|.	0.000067|.	T|T	0.77025|0.77025	0.4070|0.4070	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;1.0|.	D;D;D|.	0.87578|.	0.998;0.937;0.996|.	T|T	0.79480|0.79480	-0.1786|-0.1786	10|5	0.87932|.	D|.	0|.	-34.3202|-34.3202	14.5601|14.5601	0.68130|0.68130	0.0707:0.0:0.9293:0.0|0.0707:0.0:0.9293:0.0	.|.	1080;1080;1080|.	P23634;P23634-6;B1APW5|.	AT2B4_HUMAN;.;.|.	H|F	1080;1080;1068;1044;1080|66;44	ENSP00000350310:D1080H;ENSP00000356187:D1080H;ENSP00000356188:D1068H;ENSP00000375816:D1044H;ENSP00000340930:D1080H|.	ENSP00000340930:D1080H|.	D|L	+|+	1|3	0|2	ATP2B4|ATP2B4	201963251|201963251	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.555000|0.555000	0.35460|0.35460	9.863000|9.863000	0.99569|0.99569	1.441000|1.441000	0.47550|0.47550	0.555000|0.555000	0.69702|0.69702	GAC|TTG	ATP2B4	-	NULL		0.572	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	G	NM_001001396		203696628	+1	no_errors	ENST00000357681	ensembl	human	known	70_37	missense	SNP	1.000	C
AXIN2	8313	genome.wustl.edu	37	17	63533495	63533495	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:63533495C>T	ENST00000375702.5	-	5	1767	c.1659G>A	c.(1657-1659)tcG>tcA	p.S553S	AXIN2_ENST00000307078.5_Silent_p.S553S			Q9Y2T1	AXIN2_HUMAN	axin 2	553					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TTTTGCATTTCGAGTAGCAGT	0.627									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								0													113.0	106.0	108.0					17																	63533495		2203	4300	6503	SO:0001819	synonymous_variant	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1659G>A	17.37:g.63533495C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJ88|Q9H3M6|Q9UH84	Silent	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.S553	ENST00000375702.5	37	c.1659		17																																																																																			AXIN2	-	NULL		0.627	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	C	NM_004655		63533495	-1	no_errors	ENST00000307078	ensembl	human	known	70_37	silent	SNP	0.001	T
BICD2	23299	genome.wustl.edu	37	9	95480097	95480097	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:95480097C>T	ENST00000375512.3	-	6	2307	c.2240G>A	c.(2239-2241)cGt>cAt	p.R747H	BICD2_ENST00000356884.6_Missense_Mutation_p.R747H	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	747	Interacts with RAB6A. {ECO:0000250}.				cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						AAACATAGCACGCAGCGAGGA	0.577																																																	0													186.0	111.0	137.0					9																	95480097		2203	4300	6503	SO:0001583	missense	23299			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.2240G>A	9.37:g.95480097C>T	ENSP00000364662:p.Arg747His	Somatic		WXS	Illumina HiSeq	Phase_IV	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc	p.R747H	ENST00000375512.3	37	c.2240	CCDS6700.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.120645	0.94385	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.67698	-0.28;-0.28	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.83427	0.5252	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.84965	0.0879	10	0.52906	T	0.07	-11.9454	16.645	0.85174	0.0:1.0:0.0:0.0	.	747;747	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	H	747	ENSP00000349351:R747H;ENSP00000364662:R747H	ENSP00000349351:R747H	R	-	2	0	BICD2	94519918	1.000000	0.71417	0.789000	0.31954	0.863000	0.49368	7.714000	0.84703	2.624000	0.88883	0.561000	0.74099	CGT	BICD2	-	pfam_Bicaudal-D_microtubule-assoc		0.577	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1	C	NM_015250		95480097	-1	no_errors	ENST00000356884	ensembl	human	known	70_37	missense	SNP	0.998	T
BMPR1B	658	genome.wustl.edu	37	4	96073848	96073848	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:96073848C>G	ENST00000515059.1	+	12	1590	c.1307C>G	c.(1306-1308)tCt>tGt	p.S436C	BMPR1B_ENST00000440890.2_Missense_Mutation_p.S466C|BMPR1B_ENST00000394931.1_Missense_Mutation_p.S436C|BMPR1B_ENST00000264568.4_Missense_Mutation_p.S436C	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		AGTGACCCCTCTTATGAGGAC	0.413																																																	0													80.0	72.0	75.0					4																	96073848		2203	4300	6503	SO:0001583	missense	658			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.1307C>G	4.37:g.96073848C>G	ENSP00000426617:p.Ser436Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R953|B4DSV1|P78366	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.S466C	ENST00000515059.1	37	c.1397	CCDS3642.1	4	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847839	0.91277	.	.	ENSG00000138696	ENST00000515059;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000264568;ENST00000394931	D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96513	0.8862	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96344	0.9253	10	0.87932	D	0	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	436	O00238	BMR1B_HUMAN	C	436;436;436;466;436;436	ENSP00000426617:S436C;ENSP00000425444:S436C;ENSP00000421671:S436C;ENSP00000401907:S466C;ENSP00000264568:S436C;ENSP00000378389:S436C	ENSP00000264568:S436C	S	+	2	0	BMPR1B	96292871	1.000000	0.71417	0.860000	0.33809	0.946000	0.59487	7.818000	0.86416	2.822000	0.97130	0.650000	0.86243	TCT	BMPR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.413	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1B	HGNC	protein_coding	OTTHUMT00000253609.3	C	NM_001203		96073848	+1	no_errors	ENST00000440890	ensembl	human	known	70_37	missense	SNP	1.000	G
BMX	660	genome.wustl.edu	37	X	15552383	15552383	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:15552383G>C	ENST00000357607.2	+	12	1256	c.1068G>C	c.(1066-1068)gaG>gaC	p.E356D	BMX_ENST00000348343.6_Missense_Mutation_p.E356D|BMX_ENST00000342014.6_Missense_Mutation_p.E356D			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	356	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					CAAATGCTGAGAACAAATTAT	0.299																																																	0													132.0	128.0	130.0					X																	15552383		2203	4298	6501	SO:0001583	missense	660			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.1068G>C	X.37:g.15552383G>C	ENSP00000350224:p.Glu356Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_Znf_Btk_motif	p.E356D	ENST00000357607.2	37	c.1068	CCDS14168.1	X	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166176	0.38217	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.24350	1.86;1.86;1.86	4.96	0.656	0.17844	SH2 motif (4);	0.000000	0.64402	D	0.000011	T	0.12561	0.0305	N	0.04768	-0.165	0.33533	D	0.593879	P	0.50819	0.939	P	0.48488	0.579	T	0.23476	-1.0187	10	0.10636	T	0.68	.	8.0351	0.30488	0.5496:0.0:0.4504:0.0	.	356	P51813	BMX_HUMAN	D	356	ENSP00000350224:E356D;ENSP00000308774:E356D;ENSP00000340082:E356D	ENSP00000340082:E356D	E	+	3	2	BMX	15462304	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	0.661000	0.25023	0.261000	0.21753	0.600000	0.82982	GAG	BMX	-	pfam_SH2,smart_SH2,pfscan_SH2		0.299	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	BMX	HGNC	protein_coding	OTTHUMT00000055877.1	G	NM_001721		15552383	+1	no_errors	ENST00000342014	ensembl	human	known	70_37	missense	SNP	0.999	C
BSDC1	55108	genome.wustl.edu	37	1	32842233	32842233	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:32842233C>T	ENST00000455895.2	-	9	819	c.786G>A	c.(784-786)gaG>gaA	p.E262E	BSDC1_ENST00000449308.1_Silent_p.E262E|BSDC1_ENST00000446293.2_Silent_p.E279E|BSDC1_ENST00000526031.1_Silent_p.E167E|BSDC1_ENST00000341071.7_Silent_p.E279E|BSDC1_ENST00000463967.1_5'Flank|BSDC1_ENST00000413080.1_Silent_p.E201E|BSDC1_ENST00000419121.2_Silent_p.E206E	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	262										breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TCACCAGATTCTCTTCACAGG	0.547																																																	0													90.0	95.0	93.0					1																	32842233		2203	4300	6503	SO:0001819	synonymous_variant	55108			BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.786G>A	1.37:g.32842233C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Silent	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.E279	ENST00000455895.2	37	c.837	CCDS363.2	1																																																																																			BSDC1	-	NULL		0.547	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3	C	NM_018045		32842233	-1	no_errors	ENST00000341071	ensembl	human	known	70_37	silent	SNP	0.194	T
RITA1	84934	genome.wustl.edu	37	12	113629176	113629176	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:113629176G>A	ENST00000548278.1	+	4	1056	c.364G>A	c.(364-366)Gcc>Acc	p.A122T	RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000549621.1_Missense_Mutation_p.A122T|C12orf52_ENST00000552495.1_Missense_Mutation_p.A146T	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		122					negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						ATCTGAAGGCGCCAGCTTCGG	0.632																																																	0													38.0	39.0	39.0					12																	113629176		2203	4300	6503	SO:0001583	missense	84934																														ENST00000548278.1:c.364G>A	12.37:g.113629176G>A	ENSP00000449841:p.Ala122Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Missense_Mutation	SNP	NULL	p.A122T	ENST00000548278.1	37	c.364	CCDS9166.1	12	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.276113	0.01410	.	.	ENSG00000139405	ENST00000549621;ENST00000548278;ENST00000552495;ENST00000436053;ENST00000299731;ENST00000266813	T;T;T	0.28895	1.6;1.6;1.59	4.39	-5.16	0.02857	.	1.558950	0.03835	N	0.269616	T	0.06508	0.0167	N	0.00823	-1.155	0.09310	N	1	B;B;B	0.19706	0.009;0.038;0.009	B;B;B	0.10450	0.005;0.005;0.005	T	0.23440	-1.0188	10	0.02654	T	1	0.2111	1.8435	0.03155	0.4877:0.136:0.239:0.1373	.	122;146;122	Q96K30-2;F8VRG5;Q96K30	.;.;RITA_HUMAN	T	122;122;146;122;122;119	ENSP00000448289:A122T;ENSP00000449841:A122T;ENSP00000448680:A146T	ENSP00000266813:A119T	A	+	1	0	C12orf52	112113559	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-2.882000	0.00714	-0.826000	0.04284	0.655000	0.94253	GCC	C12orf52	-	NULL		0.632	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf52	HGNC	protein_coding	OTTHUMT00000405239.1	G			113629176	+1	no_errors	ENST00000436053	ensembl	human	known	70_37	missense	SNP	0.000	A
C16orf54	283897	genome.wustl.edu	37	16	29755964	29755964	+	Silent	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:29755964C>G	ENST00000329410.3	-	2	404	c.309G>C	c.(307-309)ctG>ctC	p.L103L	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	103						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						CCCGATCTGTCAGCAGGGGGA	0.672																																																	0													9.0	10.0	10.0					16																	29755964		2168	4255	6423	SO:0001819	synonymous_variant	283897			AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.309G>C	16.37:g.29755964C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJR6|Q8NAB0	Silent	SNP	NULL	p.L103	ENST00000329410.3	37	c.309	CCDS10652.1	16																																																																																			C16orf54	-	NULL		0.672	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf54	HGNC	protein_coding	OTTHUMT00000255158.1	C	NM_175900		29755964	-1	no_errors	ENST00000329410	ensembl	human	known	70_37	silent	SNP	0.178	G
C17orf105	284067	genome.wustl.edu	37	17	41857845	41857845	+	Silent	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:41857845G>T	ENST00000449302.3	+	1	43	c.15G>T	c.(13-15)ctG>ctT	p.L5L	RP5-905N1.2_ENST00000591540.1_RNA|DUSP3_ENST00000226004.3_5'Flank|DUSP3_ENST00000591618.1_5'Flank|DUSP3_ENST00000397937.2_5'Flank	NM_001136483.1	NP_001129955.1	B2RV13	CQ105_HUMAN	chromosome 17 open reading frame 105	5																	ACAATTCCCTGGATTATCTGG	0.458																																																	0													136.0	116.0	122.0					17																	41857845		692	1591	2283	SO:0001819	synonymous_variant	284067				CCDS45695.1	17q21.31	2012-10-23			ENSG00000231256	ENSG00000231256			37241	protein-coding gene	gene with protein product							Standard	NM_001136483		Approved		uc002ieg.3	B2RV13	OTTHUMG00000180890	ENST00000449302.3:c.15G>T	17.37:g.41857845G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.L5	ENST00000449302.3	37	c.15	CCDS45695.1	17																																																																																			C17orf105	-	NULL		0.458	C17orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf105	HGNC	protein_coding	OTTHUMT00000453508.1	G	NM_001136483		41857845	+1	no_errors	ENST00000449302	ensembl	human	known	70_37	silent	SNP	1.000	T
C1orf228	339541	genome.wustl.edu	37	1	45163829	45163829	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:45163829G>A	ENST00000458657.2	+	5	677	c.370G>A	c.(370-372)Gaa>Aaa	p.E124K	C1orf228_ENST00000444751.1_Intron|C1orf228_ENST00000535358.1_Missense_Mutation_p.E124K			Q6PIY5	CA228_HUMAN	chromosome 1 open reading frame 228	124										central_nervous_system(1)	1						GGCCAAGAAGGAATCTGTCAA	0.448																																																	0													170.0	141.0	149.0					1																	45163829		692	1591	2283	SO:0001583	missense	339541			AL122004, AY254217, BC026115	CCDS53311.1	1p34.1	2011-02-22	2009-03-17	2009-03-17	ENSG00000198520	ENSG00000198520			34345	protein-coding gene	gene with protein product			"""non-protein coding RNA 82"""	NCRNA00082		12477932	Standard	NM_001145636		Approved	MGC33556, p40	uc001cmf.2	Q6PIY5	OTTHUMG00000007834	ENST00000458657.2:c.370G>A	1.37:g.45163829G>A	ENSP00000420716:p.Glu124Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A1KXE5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E124K	ENST00000458657.2	37	c.370	CCDS53311.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994403	0.74703	.	.	ENSG00000198520	ENST00000458657;ENST00000441519;ENST00000535358;ENST00000445071	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.053180	0.64402	D	0.000001	T	0.69495	0.3117	M	0.71036	2.16	0.54753	D	0.999981	D	0.89917	1.0	D	0.74023	0.982	T	0.71059	-0.4702	10	0.66056	D	0.02	-6.8113	19.3152	0.94208	0.0:0.0:1.0:0.0	.	124	Q6PIY5	CA228_HUMAN	K	124	ENSP00000420716:E124K;ENSP00000420664:E124K;ENSP00000440524:E124K;ENSP00000417998:E124K	ENSP00000420664:E124K	E	+	1	0	C1orf228	44936416	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	6.213000	0.72194	2.661000	0.90470	0.561000	0.74099	GAA	C1orf228	-	superfamily_ARM-type_fold		0.448	C1orf228-013	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf228	HGNC	protein_coding	OTTHUMT00000023125.2	G	NM_001145636		45163829	+1	no_errors	ENST00000458657	ensembl	human	known	70_37	missense	SNP	1.000	A
C1orf106	55765	genome.wustl.edu	37	1	200880636	200880636	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:200880636C>T	ENST00000367342.4	+	9	1470	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R339C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	424										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CTTTCCCCGCCGCCGCCCCAC	0.657																																																	0													93.0	119.0	110.0					1																	200880636		2203	4299	6502	SO:0001583	missense	55765			AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1270C>T	1.37:g.200880636C>T	ENSP00000356311:p.Arg424Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	pfam_DUF3338	p.R424C	ENST00000367342.4	37	c.1270		1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491871	0.84962	.	.	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.62105	0.05;0.1	4.88	4.88	0.63580	.	0.428825	0.23178	N	0.051052	T	0.69296	0.3095	L	0.29908	0.895	0.49299	D	0.999775	D	0.89917	1.0	D	0.80764	0.994	T	0.72261	-0.4345	10	0.62326	D	0.03	-14.8916	15.0201	0.71624	0.0:1.0:0.0:0.0	.	424	Q3KP66	CA106_HUMAN	C	424;339	ENSP00000356311:R424C;ENSP00000392105:R339C	ENSP00000356311:R424C	R	+	1	0	C1orf106	199147259	0.981000	0.34729	1.000000	0.80357	0.998000	0.95712	1.772000	0.38552	2.268000	0.75426	0.549000	0.68633	CGC	C1orf106	-	NULL		0.657	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	HGNC	protein_coding	OTTHUMT00000087057.2	C	NM_018265		200880636	+1	no_errors	ENST00000367342	ensembl	human	known	70_37	missense	SNP	1.000	T
C2orf73	129852	genome.wustl.edu	37	2	54587431	54587431	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:54587431C>G	ENST00000398634.2	+	5	638	c.596C>G	c.(595-597)tCa>tGa	p.S199*	C2orf73_ENST00000405749.1_Intron|C2orf73_ENST00000491538.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	199										breast(2)	2						ACTCCAGGGTCACGTTCATCA	0.453																																																	0													49.0	47.0	48.0					2																	54587431		1916	4115	6031	SO:0001587	stop_gained	129852			BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.596C>G	2.37:g.54587431C>G	ENSP00000381631:p.Ser199*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV79|A0AV81|Q8N7V4	Nonsense_Mutation	SNP	NULL	p.S199*	ENST00000398634.2	37	c.596	CCDS46285.1	2	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830543	0.50845	.	.	ENSG00000177994	ENST00000486488;ENST00000398634;ENST00000447328	.	.	.	5.35	3.43	0.39272	.	0.528673	0.17166	N	0.184462	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.6652	10.0362	0.42131	0.1372:0.7908:0.0:0.072	.	.	.	.	X	205;199;141	.	ENSP00000381631:S199X	S	+	2	0	C2orf73	54440935	0.303000	0.24463	0.291000	0.24904	0.960000	0.62799	1.239000	0.32719	1.394000	0.46624	0.650000	0.86243	TCA	C2orf73	-	NULL		0.453	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf73	HGNC	protein_coding	OTTHUMT00000324075.2	C	NM_001100396		54587431	+1	no_errors	ENST00000398634	ensembl	human	known	70_37	nonsense	SNP	0.031	G
KIAA1958	158405	genome.wustl.edu	37	9	115248878	115248878	+	5'Flank	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:115248878C>T	ENST00000337530.6	+	0	0				KIAA1958_ENST00000536272.1_5'Flank|C9orf147_ENST00000457681.1_Intron|C9orf147_ENST00000463223.1_5'UTR|KIAA1958_ENST00000374244.3_5'Flank	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958											endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						GCTCCAACCTCTCGGTCCAGC	0.682																																																	0																																										SO:0001631	upstream_gene_variant	100133204			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508		9.37:g.115248878C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	RNA	SNP	-	NULL	ENST00000337530.6	37	NULL	CCDS35108.1	9																																																																																			C9orf147	-	-		0.682	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	C9orf147	HGNC	protein_coding	OTTHUMT00000053690.1	C	NM_133465		115248878	-1	no_errors	ENST00000463223	ensembl	human	known	70_37	rna	SNP	0.003	T
CACNB4	785	genome.wustl.edu	37	2	152830219	152830219	+	Intron	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:152830219G>T	ENST00000539935.1	-	3	215				CACNB4_ENST00000427385.1_Intron|CACNB4_ENST00000534999.1_Missense_Mutation_p.D3E|CACNB4_ENST00000475848.1_5'UTR|CACNB4_ENST00000360283.6_Missense_Mutation_p.D3E|CACNB4_ENST00000201943.5_Intron|CACNB4_ENST00000397327.2_5'UTR	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTACAAATTGTCATACATGG	0.448																																																	0													68.0	66.0	67.0					2																	152830219		1880	4114	5994	SO:0001627	intron_variant	785			AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.148-90335C>A	2.37:g.152830219G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b3su	p.D3E	ENST00000539935.1	37	c.9	CCDS46426.1	2	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127809	0.37533	.	.	ENSG00000182389	ENST00000360283;ENST00000534999	T;T	0.72615	-0.67;-0.67	5.78	5.78	0.91487	.	.	.	.	.	T	0.81465	0.4828	L	0.51422	1.61	0.23708	N	0.997051	B;D	0.61697	0.001;0.99	B;D	0.70935	0.001;0.971	T	0.73582	-0.3937	9	0.48119	T	0.1	.	18.7857	0.91954	0.0:0.0:1.0:0.0	.	3;3	E7DBM8;O00305-2	.;.	E	3	ENSP00000353425:D3E;ENSP00000443893:D3E	ENSP00000353425:D3E	D	-	3	2	CACNB4	152538465	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.342000	0.59341	2.740000	0.93945	0.313000	0.20887	GAC	CACNB4	-	prints_VDCC_L_b3su		0.448	CACNB4-001	KNOWN	basic|CCDS	protein_coding	CACNB4	HGNC	protein_coding	OTTHUMT00000338385.4	G	NM_000726.3		152830219	-1	no_errors	ENST00000360283	ensembl	human	known	70_37	missense	SNP	1.000	T
CCDC159	126075	genome.wustl.edu	37	19	11465310	11465310	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:11465310C>T	ENST00000588790.1	+	12	1274	c.827C>T	c.(826-828)tCc>tTc	p.S276F	CCDC159_ENST00000458408.1_Missense_Mutation_p.S276F|DKFZP761J1410_ENST00000591608.1_5'Flank|DKFZP761J1410_ENST00000251473.5_5'Flank			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	391										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GACTCTGACTCCGACTGTGAC	0.647																																																	0													32.0	39.0	36.0					19																	11465310		2200	4295	6495	SO:0001583	missense	126075			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.827C>T	19.37:g.11465310C>T	ENSP00000468232:p.Ser276Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	NULL	p.S276F	ENST00000588790.1	37	c.827	CCDS45976.1	19	.	.	.	.	.	.	.	.	.	.	C	17.32	3.358983	0.61403	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.55413	0.52	4.2	4.2	0.49525	.	.	.	.	.	T	0.67335	0.2882	L	0.59436	1.845	0.09310	N	1	D;D	0.76494	0.999;0.994	D;P	0.85130	0.997;0.857	T	0.55945	-0.8060	9	0.46703	T	0.11	-9.3614	12.2252	0.54455	0.0:1.0:0.0:0.0	.	391;276	P0C7I6;P0C7I6-2	CC159_HUMAN;.	F	276;391	ENSP00000402239:S276F	ENSP00000390400:S391F	S	+	2	0	CCDC159	11326310	0.032000	0.19561	0.023000	0.16930	0.099000	0.18886	2.065000	0.41442	2.349000	0.79799	0.491000	0.48974	TCC	CCDC159	-	NULL		0.647	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC159	HGNC	protein_coding	OTTHUMT00000458761.1	C	NM_001080503		11465310	+1	no_errors	ENST00000458408	ensembl	human	known	70_37	missense	SNP	0.016	T
CCDC175	729665	genome.wustl.edu	37	14	60035021	60035021	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr14:60035021C>T	ENST00000537690.2	-	4	488	c.433G>A	c.(433-435)Gaa>Aaa	p.E145K	CCDC175_ENST00000281581.4_Missense_Mutation_p.E145K	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	145																	AGCTCTATTTCATTCTCTGTC	0.348																																																	0													169.0	139.0	148.0					14																	60035021		692	1591	2283	SO:0001583	missense	729665				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.433G>A	14.37:g.60035021C>T	ENSP00000453940:p.Glu145Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.E145K	ENST00000537690.2	37	c.433	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392272	0.83011	.	.	ENSG00000151838	ENST00000555041	.	.	.	5.62	4.68	0.58851	.	0.078765	0.53938	D	0.000047	T	0.59676	0.2211	M	0.61703	1.905	0.33385	D	0.575317	.	.	.	.	.	.	T	0.68179	-0.5477	6	.	.	.	-29.0256	12.0028	0.53241	0.0:0.8261:0.1739:0.0	.	.	.	.	K	145	.	.	E	-	1	0	C14orf38	59104774	0.208000	0.23494	0.734000	0.30879	0.238000	0.25445	1.263000	0.33004	2.809000	0.96659	0.655000	0.94253	GAA	CCDC175	-	NULL		0.348	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1	C	NM_001164399		60035021	-1	no_errors	ENST00000281581	ensembl	human	known	70_37	missense	SNP	0.830	T
CCNL2	81669	genome.wustl.edu	37	1	1333624	1333624	+	Silent	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:1333624C>G	ENST00000400809.3	-	3	467	c.462G>C	c.(460-462)ctG>ctC	p.L154L	CCNL2_ENST00000408952.5_5'UTR|RP4-758J18.2_ENST00000576232.1_5'Flank|CCNL2_ENST00000408918.4_Silent_p.L154L|RP4-758J18.2_ENST00000444362.1_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	154	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		TTTTGTCTCTCAGCTGTCGAA	0.443																																																	0													184.0	158.0	166.0					1																	1333624		2203	4300	6503	SO:0001819	synonymous_variant	81669			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.462G>C	1.37:g.1333624C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	NULL	p.E165Q	ENST00000400809.3	37	c.493	CCDS30557.1	1																																																																																			CCNL2	-	NULL		0.443	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	C	NM_030937		1333624	-1	no_errors	ENST00000425598	ensembl	human	known	70_37	missense	SNP	0.152	G
CD1E	913	genome.wustl.edu	37	1	158325178	158325178	+	Silent	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:158325178G>C	ENST00000368167.3	+	3	683	c.444G>C	c.(442-444)ctG>ctC	p.L148L	CD1E_ENST00000368161.3_Silent_p.L148L|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000444681.2_Silent_p.L49L|CD1E_ENST00000434258.1_Silent_p.L146L|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368160.3_Silent_p.L148L|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368163.3_Silent_p.L148L|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368156.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	148					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CAGATTTCCTGAGTTTCCAAG	0.463																																																	0													101.0	98.0	99.0					1																	158325178		1836	4093	5929	SO:0001819	synonymous_variant	913			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.444G>C	1.37:g.158325178G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.L148	ENST00000368167.3	37	c.444	CCDS41417.1	1																																																																																			CD1E	-	superfamily_MHC_I/II-like_Ag-recog		0.463	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	G	NM_030893		158325178	+1	no_errors	ENST00000368167	ensembl	human	known	70_37	silent	SNP	1.000	C
CCSAP	126731	genome.wustl.edu	37	1	229462517	229462517	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:229462517G>A	ENST00000366687.1	-	2	655	c.604C>T	c.(604-606)Cac>Tac	p.H202Y	CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000366686.1_Missense_Mutation_p.H88Y|CCSAP_ENST00000284617.2_Missense_Mutation_p.H202Y			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	202					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											CAGACGTTGTGAGTCTTCTGG	0.517																																																	0													216.0	179.0	191.0					1																	229462517		2203	4300	6503	SO:0001583	missense	126731			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.604C>T	1.37:g.229462517G>A	ENSP00000355648:p.His202Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Missense_Mutation	SNP	NULL	p.H202Y	ENST00000366687.1	37	c.604	CCDS1577.1	1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821325	0.71028	.	.	ENSG00000154429	ENST00000366687;ENST00000284617;ENST00000366686	T;T;T	0.59364	0.27;0.27;0.37	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.75213	0.3819	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.68039	0.955	T	0.77236	-0.2662	10	0.87932	D	0	-35.4761	18.0216	0.89257	0.0:0.0:1.0:0.0	.	202	Q6IQ19	CA096_HUMAN	Y	202;202;88	ENSP00000355648:H202Y;ENSP00000284617:H202Y;ENSP00000355647:H88Y	ENSP00000284617:H202Y	H	-	1	0	C1orf96	227529140	1.000000	0.71417	0.988000	0.46212	0.445000	0.32107	7.209000	0.77916	2.683000	0.91414	0.655000	0.94253	CAC	CCSAP	-	NULL		0.517	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1	G	NM_145257		229462517	-1	no_errors	ENST00000284617	ensembl	human	known	70_37	missense	SNP	1.000	A
CD8A	925	genome.wustl.edu	37	2	87016475	87016475	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:87016475G>A	ENST00000409511.2	-	7	1626	c.596C>T	c.(595-597)tCa>tTa	p.S199L	CD8A_ENST00000538832.1_Missense_Mutation_p.S240L|CD8A_ENST00000352580.3_Intron|CD8A_ENST00000456996.2_Intron|CD8A_ENST00000283635.3_Missense_Mutation_p.S199L|CD8A_ENST00000409781.1_Missense_Mutation_p.S162L	NM_001145873.1	NP_001139345.1	P01732	CD8A_HUMAN	CD8a molecule	199					antigen processing and presentation (GO:0019882)|cytotoxic T cell differentiation (GO:0045065)|defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of calcium-mediated signaling (GO:0050850)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|T cell mediated immunity (GO:0002456)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	8						GATAACCAGTGACAGGAGAAG	0.617																																																	0													85.0	88.0	87.0					2																	87016475		2203	4300	6503	SO:0001583	missense	925				CCDS1992.1, CCDS1993.1	2p12	2014-09-17	2006-03-28		ENSG00000153563	ENSG00000153563		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1706	protein-coding gene	gene with protein product		186910	"""CD8 antigen, alpha polypeptide (p32)"", ""T-cell surface glycoprotein CD8 alpha chain"""	CD8		1541829	Standard	NM_171827		Approved		uc002sru.3	P01732	OTTHUMG00000130265	ENST00000409511.2:c.596C>T	2.37:g.87016475G>A	ENSP00000386559:p.Ser199Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DT80|D6W5M8|Q13970|Q4ZG17	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S240L	ENST00000409511.2	37	c.719	CCDS1992.1	2	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293331	0.40594	.	.	ENSG00000153563	ENST00000283635;ENST00000409511;ENST00000442577;ENST00000538832;ENST00000409781	T;T;T;T	0.76709	-0.99;-0.99;-1.04;-1.02	4.67	4.67	0.58626	.	0.208429	0.41097	D	0.000957	T	0.64549	0.2608	N	0.20574	0.59	0.80722	D	1	B;B	0.25521	0.107;0.128	B;B	0.23275	0.021;0.045	T	0.64972	-0.6281	10	0.56958	D	0.05	-13.4651	13.2411	0.59997	0.0:0.0:1.0:0.0	.	240;199	B4DT80;P01732	.;CD8A_HUMAN	L	199;199;184;240;162	ENSP00000283635:S199L;ENSP00000386559:S199L;ENSP00000438371:S240L;ENSP00000387314:S162L	ENSP00000283635:S199L	S	-	2	0	CD8A	86869986	0.947000	0.32204	0.704000	0.30370	0.721000	0.41392	2.715000	0.47210	2.583000	0.87209	0.491000	0.48974	TCA	CD8A	-	NULL		0.617	CD8A-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	CD8A	HGNC	protein_coding	OTTHUMT00000330784.3	G	NM_001768		87016475	-1	no_errors	ENST00000538832	ensembl	human	known	70_37	missense	SNP	0.812	A
CDC42EP1	11135	genome.wustl.edu	37	22	37964430	37964430	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr22:37964430C>G	ENST00000249014.4	+	3	1199	c.779C>G	c.(778-780)tCa>tGa	p.S260*		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	260	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GCAAACCCCTCAGCACCTGCC	0.667																																																	0													12.0	11.0	11.0					22																	37964430		2188	4223	6411	SO:0001587	stop_gained	11135			M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.779C>G	22.37:g.37964430C>G	ENSP00000249014:p.Ser260*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K825|Q96GN1	Nonsense_Mutation	SNP	pfam_PAK_box_Rho-bd,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	p.S260*	ENST00000249014.4	37	c.779	CCDS13949.1	22	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860489	0.91433	.	.	ENSG00000128283	ENST00000249014	.	.	.	1.93	-0.897	0.10553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	4.6029	0.12363	0.2134:0.6457:0.0:0.1408	.	.	.	.	X	260	.	ENSP00000249014:S260X	S	+	2	0	CDC42EP1	36294376	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.059000	0.11731	-0.338000	0.08413	0.205000	0.17691	TCA	CDC42EP1	-	NULL		0.667	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP1	HGNC	protein_coding	OTTHUMT00000318993.1	C	NM_152243		37964430	+1	no_errors	ENST00000249014	ensembl	human	known	70_37	nonsense	SNP	0.213	G
CDK5RAP3	80279	genome.wustl.edu	37	17	46048633	46048633	+	Intron	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:46048633C>G	ENST00000338399.4	+	2	112				RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Intron	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CCGTTCTGGCCCTGCAGGGTG	0.677																																																	0																																										SO:0001627	intron_variant	80279			AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.7-95C>G	17.37:g.46048633C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	NULL	p.P41A	ENST00000338399.4	37	c.121	CCDS42356.1	17																																																																																			CDK5RAP3	-	NULL		0.677	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	HGNC	protein_coding	OTTHUMT00000442913.1	C	NM_176096		46048633	+1	no_errors	ENST00000583363	ensembl	human	known	70_37	missense	SNP	0.042	G
CDKN2AIP	55602	genome.wustl.edu	37	4	184367300	184367300	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:184367300G>C	ENST00000504169.1	+	3	670	c.463G>C	c.(463-465)Gag>Cag	p.E155Q	CDKN2AIP_ENST00000506835.1_3'UTR|CDKN2AIP_ENST00000302350.4_3'UTR	NM_017632.2	NP_060102.1	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	155					negative regulation of cell growth (GO:0030308)|positive regulation of signal transduction (GO:0009967)|regulation of protein stability (GO:0031647)	cytoplasm (GO:0005737)|granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	p53 binding (GO:0002039)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TTCTGCAGTTGAGCAAGATCA	0.418																																																	0													88.0	89.0	89.0					4																	184367300		2203	4300	6503	SO:0001583	missense	55602			AK000043	CCDS34110.1	4q35.1	2008-02-05			ENSG00000168564	ENSG00000168564			24325	protein-coding gene	gene with protein product	"""collaborates/cooperates with ARF (alternate reading frame) protein"""	615914				12154087, 16803988	Standard	NM_017632		Approved	FLJ20036, CARF	uc003ivp.1	Q9NXV6	OTTHUMG00000160626	ENST00000504169.1:c.463G>C	4.37:g.184367300G>C	ENSP00000427108:p.Glu155Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TBM5|Q9NYH0	Missense_Mutation	SNP	pfam_DUF3469,pfscan_Ds-RNA-bd	p.E155Q	ENST00000504169.1	37	c.463	CCDS34110.1	4	.	.	.	.	.	.	.	.	.	.	G	7.150	0.583643	0.13749	.	.	ENSG00000168564	ENST00000504169	.	.	.	5.33	4.48	0.54585	.	0.180621	0.37437	N	0.002092	T	0.40372	0.1114	N	0.24115	0.695	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.21690	-1.0238	9	0.30078	T	0.28	-8.1328	9.3595	0.38186	0.0757:0.1462:0.7781:0.0	.	155	Q9NXV6	CARF_HUMAN	Q	155	.	ENSP00000427108:E155Q	E	+	1	0	CDKN2AIP	184604294	0.997000	0.39634	1.000000	0.80357	0.113000	0.19764	0.862000	0.27899	1.459000	0.47892	-0.176000	0.13171	GAG	CDKN2AIP	-	NULL		0.418	CDKN2AIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2AIP	HGNC	protein_coding	OTTHUMT00000361488.1	G	NM_017632		184367300	+1	no_errors	ENST00000504169	ensembl	human	known	70_37	missense	SNP	0.999	C
CERS4	79603	genome.wustl.edu	37	19	8321838	8321838	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:8321838C>G	ENST00000251363.5	+	9	918	c.618C>G	c.(616-618)ttC>ttG	p.F206L	CERS4_ENST00000559336.1_Missense_Mutation_p.F206L|CERS4_ENST00000595722.1_3'UTR|CERS4_ENST00000558331.1_Missense_Mutation_p.F155L|CERS4_ENST00000559450.1_Missense_Mutation_p.F206L	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	206	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TGCAGGATTTCAAGGAGCAGG	0.572																																																	0													266.0	258.0	261.0					19																	8321838		2203	4300	6503	SO:0001583	missense	79603				CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.618C>G	19.37:g.8321838C>G	ENSP00000251363:p.Phe206Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W665	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeodomain	p.F206L	ENST00000251363.5	37	c.618	CCDS12197.1	19	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410906	0.42817	.	.	ENSG00000090661	ENST00000251363	D	0.86030	-2.06	4.92	1.31	0.21738	TRAM/LAG1/CLN8 homology domain (3);	0.105629	0.64402	N	0.000003	D	0.87755	0.6257	M	0.90870	3.155	0.58432	D	0.999998	P;B	0.41848	0.763;0.332	P;B	0.48571	0.582;0.211	D	0.84040	0.0364	10	0.62326	D	0.03	-28.0353	2.0734	0.03618	0.1604:0.5072:0.1556:0.1768	.	206;206	Q53HF9;Q9HA82	.;CERS4_HUMAN	L	206	ENSP00000251363:F206L	ENSP00000251363:F206L	F	+	3	2	CERS4	8227838	0.998000	0.40836	0.999000	0.59377	0.041000	0.13682	0.451000	0.21779	0.449000	0.26747	-0.254000	0.11334	TTC	CERS4	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom		0.572	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS4	HGNC	protein_coding	OTTHUMT00000419200.1	C	NM_024552		8321838	+1	no_errors	ENST00000251363	ensembl	human	known	70_37	missense	SNP	1.000	G
CES1P1	51716	genome.wustl.edu	37	16	55807361	55807361	+	RNA	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:55807361G>C	ENST00000571348.1	+	0	782					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										GGCCATTTCTGAGAGTGGCGT	0.577																																																	0																																												51716			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55807361G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-		0.577	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	G	NR_003276		55807361	+1	no_errors	ENST00000571348	ensembl	human	known	70_37	rna	SNP	0.999	C
CHI3L1	1116	genome.wustl.edu	37	1	203148611	203148611	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:203148611G>A	ENST00000255409.3	-	10	1239	c.1114C>T	c.(1114-1116)Ctc>Ttc	p.L372F		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	372					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						GCATTGGTGAGAGGGAAGCGC	0.637																																																	0													63.0	66.0	65.0					1																	203148611		2203	4300	6503	SO:0001583	missense	1116			BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.1114C>T	1.37:g.203148611G>A	ENSP00000255409:p.Leu372Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7B0|P30923|Q8IVA4|Q96HI7	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.L372F	ENST00000255409.3	37	c.1114	CCDS1435.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.052573|4.052573	0.75960|0.75960	.|.	.|.	ENSG00000133048|ENSG00000133048	ENST00000255409|ENST00000404436	T|.	0.37235|.	1.21|.	4.54|4.54	4.54|4.54	0.55810|0.55810	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);|.	0.000000|.	0.40469|.	N|.	0.001086|.	D|D	0.86602|0.86602	0.5972|0.5972	H|H	0.95539|0.95539	3.685|3.685	0.58432|0.58432	D|D	0.999994|0.999994	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.90777|0.90777	0.4676|0.4676	10|5	0.87932|.	D|.	0|.	-19.1542|-19.1542	14.7756|14.7756	0.69729|0.69729	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	372|.	P36222|.	CH3L1_HUMAN|.	F|F	372|140	ENSP00000255409:L372F|.	ENSP00000255409:L372F|.	L|S	-|-	1|2	0|0	CHI3L1|CHI3L1	201415234|201415234	1.000000|1.000000	0.71417|0.71417	0.606000|0.606000	0.28943|0.28943	0.715000|0.715000	0.41141|0.41141	5.282000|5.282000	0.65615|0.65615	2.079000|2.079000	0.62486|0.62486	0.491000|0.491000	0.48974|0.48974	CTC|TCT	CHI3L1	-	superfamily_Glycoside_hydrolase_SF		0.637	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHI3L1	HGNC	protein_coding	OTTHUMT00000100265.1	G	NM_001276		203148611	-1	no_errors	ENST00000255409	ensembl	human	known	70_37	missense	SNP	0.986	A
CLCF1	23529	genome.wustl.edu	37	11	67134998	67134998	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:67134998G>C	ENST00000312438.7	-	2	313	c.116C>G	c.(115-117)tCc>tGc	p.S39C	CLCF1_ENST00000528474.1_Missense_Mutation_p.S29C|AP003419.11_ENST00000543494.1_RNA|CLCF1_ENST00000533438.1_Missense_Mutation_p.S29C	NM_013246.2	NP_037378.1	Q9UBD9	CLCF1_HUMAN	cardiotrophin-like cytokine factor 1	39					B cell differentiation (GO:0030183)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)	CNTFR-CLCF1 complex (GO:0097059)|CRLF-CLCF1 complex (GO:0097058)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	ciliary neurotrophic factor receptor binding (GO:0005127)|cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			endometrium(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;2.39e-06)			TTTCTGGATGGAGGGGCCAGG	0.622																																																	0													136.0	114.0	121.0					11																	67134998		2200	4295	6495	SO:0001583	missense	23529			BC012939	CCDS31617.1, CCDS53666.1	11q13.3	2014-01-28	2006-07-03		ENSG00000175505	ENSG00000175505			17412	protein-coding gene	gene with protein product	"""B-cell stimulating factor 3"", ""cold-induced sweating syndrome 2"", ""novel neurotrophin-1"""	607672	"""CRLF1 associated cytokine-like factor 1"""			10500198, 10448081, 16782820	Standard	NM_001166212		Approved	NNT1, BSF3, CLC, NR6, CISS2, BSF-3, NNT-1	uc010rpp.2	Q9UBD9	OTTHUMG00000167669	ENST00000312438.7:c.116C>G	11.37:g.67134998G>C	ENSP00000309338:p.Ser39Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNT4|Q6NZA4	Missense_Mutation	SNP	pfam_PRF,pfam_Ciliary_neurotrophic_fac_CNTF,superfamily_4_helix_cytokine-like_core	p.S39C	ENST00000312438.7	37	c.116	CCDS31617.1	11	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613060	0.66672	.	.	ENSG00000175505	ENST00000312438;ENST00000533438;ENST00000528474	T;T;T	0.38077	1.16;1.16;1.16	5.21	5.21	0.72293	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.071969	0.56097	D	0.000026	T	0.30070	0.0753	N	0.08118	0	0.50813	D	0.999896	D	0.56746	0.977	P	0.48368	0.575	T	0.34625	-0.9821	10	0.87932	D	0	-0.2595	18.7397	0.91769	0.0:0.0:1.0:0.0	.	39	Q9UBD9	CLCF1_HUMAN	C	39;29;29	ENSP00000309338:S39C;ENSP00000434122:S29C;ENSP00000432553:S29C	ENSP00000309338:S39C	S	-	2	0	CLCF1	66891574	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.289000	0.89923	2.611000	0.88343	0.591000	0.81541	TCC	CLCF1	-	superfamily_4_helix_cytokine-like_core		0.622	CLCF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCF1	HGNC	protein_coding	OTTHUMT00000395478.1	G	NM_013246		67134998	-1	no_errors	ENST00000312438	ensembl	human	known	70_37	missense	SNP	1.000	C
CMYA5	202333	genome.wustl.edu	37	5	79031279	79031279	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:79031279G>A	ENST00000446378.2	+	2	6722	c.6691G>A	c.(6691-6693)Gag>Aag	p.E2231K		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2231					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TAATGTAGCTGAGAAACCAGC	0.388																																																	0													120.0	117.0	118.0					5																	79031279		1844	4095	5939	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6691G>A	5.37:g.79031279G>A	ENSP00000394770:p.Glu2231Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.E2231K	ENST00000446378.2	37	c.6691	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	6.447	0.450588	0.12223	.	.	ENSG00000164309	ENST00000446378	T	0.20463	2.07	6.16	2.22	0.28083	.	0.379722	0.22625	N	0.057651	T	0.15305	0.0369	L	0.41824	1.3	0.09310	N	1	B	0.15141	0.012	B	0.17979	0.02	T	0.20207	-1.0282	10	0.44086	T	0.13	.	5.9185	0.19067	0.1676:0.2941:0.5383:0.0	.	2231	Q8N3K9	CMYA5_HUMAN	K	2231	ENSP00000394770:E2231K	ENSP00000394770:E2231K	E	+	1	0	CMYA5	79067035	0.174000	0.23070	0.001000	0.08648	0.024000	0.10985	0.434000	0.21494	0.114000	0.18032	0.650000	0.86243	GAG	CMYA5	-	NULL		0.388	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	G	NM_153610		79031279	+1	no_errors	ENST00000446378	ensembl	human	known	70_37	missense	SNP	0.019	A
CPED1	79974	genome.wustl.edu	37	7	120691043	120691043	+	Intron	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:120691043C>T	ENST00000310396.5	+	4	1007				CPED1_ENST00000450913.2_Intron|CPED1_ENST00000495036.1_3'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1							endoplasmic reticulum (GO:0005783)											TAAACCTGCTCCTGCAAAAGT	0.493																																																	0																																										SO:0001627	intron_variant	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.540+3996C>T	7.37:g.120691043C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	RNA	SNP	-	NULL	ENST00000310396.5	37	NULL	CCDS34739.1	7																																																																																			CPED1	-	-		0.493	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	C	NM_024913		120691043	+1	no_errors	ENST00000495036	ensembl	human	known	70_37	rna	SNP	0.984	T
CSMD3	114788	genome.wustl.edu	37	8	114111003	114111003	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:114111003G>A	ENST00000297405.5	-	5	1143	c.899C>T	c.(898-900)tCt>tTt	p.S300F	CSMD3_ENST00000352409.3_Missense_Mutation_p.S300F|CSMD3_ENST00000455883.2_Missense_Mutation_p.S300F|CSMD3_ENST00000343508.3_Missense_Mutation_p.S260F|CSMD3_ENST00000519485.1_5'UTR	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	300	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S300F(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGGTGGCTCAGAACCTTCTAT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											96.0	97.0	97.0					8																	114111003		2203	4299	6502	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.899C>T	8.37:g.114111003G>A	ENSP00000297405:p.Ser300Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S300F	ENST00000297405.5	37	c.899	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153308	0.78114	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.4	4.53	0.55603	CUB (5);	0.000000	0.64402	D	0.000001	D	0.95755	0.8619	M	0.62266	1.93	0.34938	D	0.750077	P;B;D;D	0.89917	0.493;0.001;1.0;0.958	B;B;D;P	0.91635	0.215;0.003;0.999;0.759	D	0.99320	1.0906	10	0.87932	D	0	.	14.4022	0.67056	0.0714:0.0:0.9286:0.0	.	300;300;300;260	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	F	260;300;300;300	ENSP00000345799:S260F;ENSP00000297405:S300F;ENSP00000412263:S300F;ENSP00000343124:S300F	ENSP00000297405:S300F	S	-	2	0	CSMD3	114180179	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.752000	0.98900	1.431000	0.47355	-0.142000	0.14014	TCT	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	G	NM_052900		114111003	-1	no_errors	ENST00000297405	ensembl	human	known	70_37	missense	SNP	1.000	A
CTDP1	9150	genome.wustl.edu	37	18	77457866	77457866	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:77457866G>A	ENST00000299543.7	+	4	646	c.499G>A	c.(499-501)Gaa>Aaa	p.E167K	CTDP1_ENST00000075430.7_Missense_Mutation_p.E167K	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	167					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		GTAGCAAGCTGAACAGCTGGG	0.443																																																	0													75.0	74.0	74.0					18																	77457866		2203	4300	6503	SO:0001583	missense	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.499G>A	18.37:g.77457866G>A	ENSP00000299543:p.Glu167Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	pfam_FCP1_C,pfam_NIF,superfamily_HAD-like_dom,superfamily_BRCT_dom,superfamily_Single_hybrid_motif,smart_NIF,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_NIF,tigrfam_FCP1_euk	p.E167K	ENST00000299543.7	37	c.499	CCDS12017.1	18	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864639	0.32977	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.11385	2.81;2.78	4.91	3.08	0.35506	.	0.096580	0.64402	N	0.000001	T	0.08044	0.0201	L	0.31065	0.9	0.58432	D	0.999993	B;P;P	0.47302	0.198;0.893;0.629	B;B;B	0.42030	0.133;0.373;0.129	T	0.38585	-0.9654	10	0.17832	T	0.49	-23.1059	10.975	0.47461	0.1539:0.0:0.8461:0.0	.	48;167;167	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	K	167	ENSP00000299543:E167K;ENSP00000075430:E167K	ENSP00000075430:E167K	E	+	1	0	CTDP1	75558854	1.000000	0.71417	0.013000	0.15412	0.003000	0.03518	4.731000	0.62022	1.192000	0.43071	0.655000	0.94253	GAA	CTDP1	-	NULL		0.443	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDP1	HGNC	protein_coding	OTTHUMT00000256432.1	G	NM_004715		77457866	+1	no_errors	ENST00000299543	ensembl	human	known	70_37	missense	SNP	0.963	A
CUX2	23316	genome.wustl.edu	37	12	111747986	111747986	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:111747986G>C	ENST00000261726.6	+	15	1554	c.1400G>C	c.(1399-1401)aGc>aCc	p.S467T		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	467	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CTGGGCCCCAGCTTGGGGCCT	0.692																																																	0													16.0	20.0	19.0					12																	111747986		1884	4096	5980	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1400G>C	12.37:g.111747986G>C	ENSP00000261726:p.Ser467Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.S467T	ENST00000261726.6	37	c.1400	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	3.640	-0.073800	0.07184	.	.	ENSG00000111249	ENST00000261726	T	0.49139	0.79	4.81	3.91	0.45181	.	0.590653	0.19499	N	0.112791	T	0.38825	0.1055	L	0.50333	1.59	0.09310	N	1	B	0.23058	0.079	B	0.18263	0.021	T	0.25882	-1.0119	10	0.37606	T	0.19	-1.1572	7.9977	0.30277	0.0869:0.1602:0.7528:0.0	.	467	O14529	CUX2_HUMAN	T	467	ENSP00000261726:S467T	ENSP00000261726:S467T	S	+	2	0	CUX2	110232369	0.045000	0.20229	0.424000	0.26647	0.044000	0.14063	2.156000	0.42310	1.012000	0.39366	0.313000	0.20887	AGC	CUX2	-	NULL		0.692	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	G	NM_015267		111747986	+1	no_errors	ENST00000261726	ensembl	human	known	70_37	missense	SNP	0.279	C
CUX2	23316	genome.wustl.edu	37	12	111747997	111747997	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:111747997G>A	ENST00000261726.6	+	15	1565	c.1411G>A	c.(1411-1413)Gac>Aac	p.D471N		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	471	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CTTGGGGCCTGACGGCACTCG	0.701																																																	0													17.0	20.0	19.0					12																	111747997		1893	4100	5993	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1411G>A	12.37:g.111747997G>A	ENSP00000261726:p.Asp471Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.D471N	ENST00000261726.6	37	c.1411	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	G	8.686	0.906374	0.17833	.	.	ENSG00000111249	ENST00000261726	T	0.50001	0.76	4.8	4.8	0.61643	.	0.353172	0.32687	N	0.005772	T	0.36853	0.0982	L	0.29908	0.895	0.29925	N	0.822383	P	0.35433	0.501	B	0.33042	0.157	T	0.26258	-1.0108	10	0.22706	T	0.39	-15.1529	17.8477	0.88736	0.0:0.0:1.0:0.0	.	471	O14529	CUX2_HUMAN	N	471	ENSP00000261726:D471N	ENSP00000261726:D471N	D	+	1	0	CUX2	110232380	1.000000	0.71417	0.048000	0.18961	0.021000	0.10359	6.181000	0.71988	2.218000	0.71995	0.313000	0.20887	GAC	CUX2	-	NULL		0.701	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	G	NM_015267		111747997	+1	no_errors	ENST00000261726	ensembl	human	known	70_37	missense	SNP	0.643	A
DCAF4L2	138009	genome.wustl.edu	37	8	88885044	88885044	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:88885044G>A	ENST00000319675.3	-	1	1252	c.1156C>T	c.(1156-1158)Cgg>Tgg	p.R386W		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	386										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						AGGTCCTCCCGGACAGCCATG	0.547																																																	0													43.0	48.0	46.0					8																	88885044		2203	4300	6503	SO:0001583	missense	138009			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1156C>T	8.37:g.88885044G>A	ENSP00000316496:p.Arg386Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R386W	ENST00000319675.3	37	c.1156	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673003	0.47781	.	.	ENSG00000176566	ENST00000319675	T	0.27402	1.67	0.841	-0.124	0.13523	.	0.579100	0.18356	N	0.143715	T	0.32041	0.0816	L	0.51422	1.61	0.20975	N	0.999811	D	0.69078	0.997	P	0.55260	0.772	T	0.17592	-1.0364	10	0.72032	D	0.01	.	1.6881	0.02845	0.2567:0.0:0.414:0.3293	.	386	Q8NA75	DC4L2_HUMAN	W	386	ENSP00000316496:R386W	ENSP00000316496:R386W	R	-	1	2	DCAF4L2	88954160	0.974000	0.33945	0.210000	0.23637	0.403000	0.30841	0.591000	0.23969	-0.076000	0.12775	0.467000	0.42956	CGG	DCAF4L2	-	NULL		0.547	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	G	NM_152418		88885044	-1	no_errors	ENST00000319675	ensembl	human	known	70_37	missense	SNP	0.994	A
DCHS1	8642	genome.wustl.edu	37	11	6662746	6662748	+	In_Frame_Del	DEL	CAG	CAG	-	rs370785084|rs372916982		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:6662746_6662748delCAG	ENST00000299441.3	-	2	508_510	c.97_99delCTG	c.(97-99)ctgdel	p.L33del		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	33					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L33_G34insL(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCCAGCCCCcagcagcagcagc	0.635																																																	1	Insertion - In frame(1)	prostate(1)								54,415,3471		8,0,38,73,269,1582						5.3	1.0		dbSNP_130	8	588,630,6394		117,13,341,89,439,2807	no	codingComplex	DCHS1	NM_003737.2		125,13,379,162,708,4389	A1A1,A1A2,A1R,A2A2,A2R,RR		16.0011,11.9036,14.6035				642,1045,9865				SO:0001651	inframe_deletion	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.97_99delCTG	11.37:g.6662755_6662757delCAG	ENSP00000299441:p.Leu33del	Somatic		WXS	Illumina HiSeq	Phase_IV	O15098	In_Frame_Del	DEL	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L33in_frame_del	ENST00000299441.3	37	c.99_97	CCDS7771.1	11																																																																																			DCHS1	-	NULL		0.635	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	CAG	NM_003737		6662748	-1	no_errors	ENST00000299441	ensembl	human	known	70_37	in_frame_del	DEL	1.000:1.000:1.000	-
DDX42	11325	genome.wustl.edu	37	17	61895487	61895487	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:61895487G>A	ENST00000578681.1	+	19	3147	c.2546G>A	c.(2545-2547)aGc>aAc	p.S849N	DDX42_ENST00000583590.1_Missense_Mutation_p.S849N|DDX42_ENST00000359353.5_Missense_Mutation_p.S730N|DDX42_ENST00000457800.2_Missense_Mutation_p.S849N|DDX42_ENST00000389924.2_Missense_Mutation_p.S849N|DDX42_ENST00000582985.1_Intron	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	849	Gly-rich.|His-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						CATCCAGAAAGCAGCAGCCGT	0.592																																																	0													69.0	68.0	68.0					17																	61895487		2203	4300	6503	SO:0001583	missense	11325			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2546G>A	17.37:g.61895487G>A	ENSP00000464050:p.Ser849Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S849N	ENST00000578681.1	37	c.2546	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	G	9.210	1.030696	0.19512	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.19532	2.14;2.14	4.98	4.98	0.66077	.	1.305700	0.04604	N	0.399079	T	0.27663	0.0680	L	0.47716	1.5	0.38903	D	0.957373	P;B	0.38922	0.651;0.18	B;B	0.35859	0.212;0.025	T	0.31641	-0.9936	10	0.56958	D	0.05	-7.7773	17.418	0.87506	0.0:0.0:1.0:0.0	.	395;849	B3KV84;Q86XP3	.;DDX42_HUMAN	N	849;849;566	ENSP00000374574:S849N;ENSP00000390121:S849N	ENSP00000352308:S566N	S	+	2	0	DDX42	59249219	0.995000	0.38212	0.954000	0.39281	0.433000	0.31745	3.566000	0.53805	2.585000	0.87301	0.467000	0.42956	AGC	DDX42	-	NULL		0.592	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX42	HGNC	protein_coding	OTTHUMT00000444368.1	G	NM_007372		61895487	+1	no_errors	ENST00000389924	ensembl	human	known	70_37	missense	SNP	0.996	A
DEFB134	613211	genome.wustl.edu	37	8	11851600	11851600	+	Missense_Mutation	SNP	C	C	G	rs372085598		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:11851600C>G	ENST00000526438.1	-	2	150	c.90G>C	c.(88-90)aaG>aaC	p.K30N	DEFB134_ENST00000382205.4_Missense_Mutation_p.K30N	NM_001033019.1	NP_001028191.1	Q4QY38	DB134_HUMAN	defensin, beta 134	30					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		TATAGCATTTCTTGTGCATTT	0.368																																																	0								C	ASN/LYS	0,4406		0,0,2203	114.0	110.0	111.0		90	1.4	0.0	8		111	2,8598	2.2+/-6.3	0,2,4298	no	missense	DEFB134	NM_001033019.1	94	0,2,6501	GG,GC,CC		0.0233,0.0,0.0154	probably-damaging	30/67	11851600	2,13004	2203	4300	6503	SO:0001583	missense	613211			AY621331, DQ012024	CCDS34847.1	8p23.1	2010-04-15			ENSG00000205882	ENSG00000205882		"""Defensins, beta"""	32399	protein-coding gene	gene with protein product						16033865	Standard	NM_001033019		Approved		uc011kxn.2	Q4QY38	OTTHUMG00000158718	ENST00000526438.1:c.90G>C	8.37:g.11851600C>G	ENSP00000435010:p.Lys30Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4A4	Missense_Mutation	SNP	NULL	p.K30N	ENST00000526438.1	37	c.90	CCDS34847.1	8	.	.	.	.	.	.	.	.	.	.	C	9.852	1.193844	0.22037	0.0	2.33E-4	ENSG00000205882	ENST00000526438;ENST00000382205	.	.	.	3.58	1.44	0.22558	.	0.649838	0.13534	N	0.380720	T	0.25044	0.0608	.	.	.	0.09310	N	1	P	0.44877	0.845	B	0.38655	0.278	T	0.13818	-1.0495	8	0.72032	D	0.01	-9.6939	4.9894	0.14207	0.0:0.6603:0.0:0.3397	.	30	Q4QY38	DB134_HUMAN	N	30;23	.	ENSP00000371640:K23N	K	-	3	2	DEFB134	11889009	0.043000	0.20138	0.001000	0.08648	0.314000	0.28054	-0.164000	0.09983	0.352000	0.24053	0.563000	0.77884	AAG	DEFB134	-	NULL		0.368	DEFB134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB134	HGNC	protein_coding	OTTHUMT00000351887.2	C	NM_001033019		11851600	-1	no_errors	ENST00000526438	ensembl	human	known	70_37	missense	SNP	0.001	G
DEFB134	613211	genome.wustl.edu	37	8	11851611	11851611	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:11851611C>T	ENST00000526438.1	-	2	139	c.79G>A	c.(79-81)Gaa>Aaa	p.E27K	DEFB134_ENST00000382205.4_Missense_Mutation_p.E27K	NM_001033019.1	NP_001028191.1	Q4QY38	DB134_HUMAN	defensin, beta 134	27					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		TTGTGCATTTCTGATGATAAT	0.358																																																	0													102.0	100.0	101.0					8																	11851611		2203	4300	6503	SO:0001583	missense	613211			AY621331, DQ012024	CCDS34847.1	8p23.1	2010-04-15			ENSG00000205882	ENSG00000205882		"""Defensins, beta"""	32399	protein-coding gene	gene with protein product						16033865	Standard	NM_001033019		Approved		uc011kxn.2	Q4QY38	OTTHUMG00000158718	ENST00000526438.1:c.79G>A	8.37:g.11851611C>T	ENSP00000435010:p.Glu27Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4A4	Splice_Site	SNP	-	e2-1	ENST00000526438.1	37	c.59-1	CCDS34847.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|C	8.953|8.953	0.968713|0.968713	0.18659|0.18659	.|.	.|.	ENSG00000205882|ENSG00000205882	ENST00000382205|ENST00000526438	.|.	.|.	.|.	3.58|3.58	1.71|1.71	0.24356|0.24356	.|.	.|0.500610	.|0.16893	.|N	.|0.195242	.|T	.|0.24005	.|0.0581	.|.	.|.	.|.	0.21147|0.21147	N|N	0.999777|0.999777	.|P	.|0.43750	.|0.816	.|B	.|0.38264	.|0.269	.|T	.|0.16748	.|-1.0392	.|8	.|0.87932	.|D	.|0	.|-9.2763	4.0269|4.0269	0.09692|0.09692	0.2337:0.6421:0.0:0.1242|0.2337:0.6421:0.0:0.1242	.|.	.|27	.|Q4QY38	.|DB134_HUMAN	.|K	-1|27	.|.	.|ENSP00000435010:E27K	.|E	-|-	.|1	.|0	DEFB134|DEFB134	11889020|11889020	0.015000|0.015000	0.18098|0.18098	0.014000|0.014000	0.15608|0.15608	0.348000|0.348000	0.29142|0.29142	1.054000|1.054000	0.30455|0.30455	0.479000|0.479000	0.27511|0.27511	0.563000|0.563000	0.77884|0.77884	.|GAA	DEFB134	-	-		0.358	DEFB134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB134	HGNC	protein_coding	OTTHUMT00000351887.2	C	NM_001033019		11851611	-1	no_errors	ENST00000382205	ensembl	human	novel	70_37	splice_site	SNP	0.017	T
DENND3	22898	genome.wustl.edu	37	8	142176354	142176354	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:142176354C>T	ENST00000262585.2	+	12	1657	c.1379C>T	c.(1378-1380)tCg>tTg	p.S460L	DENND3_ENST00000424248.1_Missense_Mutation_p.S408L|DENND3_ENST00000519811.1_Missense_Mutation_p.S540L	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	460					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			CGGAAGTCCTCGCACCTGCAT	0.552																																																	0													129.0	139.0	135.0					8																	142176354		2203	4300	6503	SO:0001583	missense	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1379C>T	8.37:g.142176354C>T	ENSP00000262585:p.Ser460Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_WD40_repeat,pfam_uDENN_dom,superfamily_WD40_repeat_dom,smart_DENN_dom,smart_dDENN_dom,smart_WD40_repeat,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_WD40_repeat_dom	p.S460L	ENST00000262585.2	37	c.1379	CCDS34947.1	8	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150169	0.37923	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811	T;T;T	0.15603	2.82;2.41;2.81	4.94	4.94	0.65067	.	0.437887	0.25762	N	0.028474	T	0.14743	0.0356	L	0.59436	1.845	0.09310	N	1	P;P;P	0.43973	0.729;0.823;0.729	B;B;B	0.33890	0.083;0.172;0.083	T	0.33675	-0.9859	10	0.59425	D	0.04	-11.8227	8.6699	0.34143	0.2373:0.6204:0.1423:0.0	.	540;408;460	E9PF32;A2RUS2-2;A2RUS2	.;.;DEND3_HUMAN	L	460;408;540	ENSP00000262585:S460L;ENSP00000410594:S408L;ENSP00000428714:S540L	ENSP00000262585:S460L	S	+	2	0	DENND3	142245536	0.000000	0.05858	0.008000	0.14137	0.001000	0.01503	0.383000	0.20651	2.436000	0.82500	0.561000	0.74099	TCG	DENND3	-	NULL		0.552	DENND3-201	KNOWN	basic|CCDS	protein_coding	DENND3	HGNC	protein_coding		C	NM_014957		142176354	+1	no_errors	ENST00000262585	ensembl	human	known	70_37	missense	SNP	0.001	T
DMD	1756	genome.wustl.edu	37	X	31747811	31747811	+	Missense_Mutation	SNP	C	C	T	rs369583884		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:31747811C>T	ENST00000357033.4	-	52	7803	c.7597G>A	c.(7597-7599)Gct>Act	p.A2533T	DMD_ENST00000343523.2_Missense_Mutation_p.A73T|DMD_ENST00000474231.1_Missense_Mutation_p.A73T|DMD_ENST00000378707.3_Missense_Mutation_p.A73T|DMD_ENST00000359836.1_Missense_Mutation_p.A73T|DMD_ENST00000378677.2_Missense_Mutation_p.A2529T|DMD_ENST00000541735.1_Missense_Mutation_p.A73T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2533					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.A1192T(1)|p.A73T(1)|p.A2528T(1)|p.A2529T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTTGGGCAGCGGTAATGAGT	0.428																																																	4	Substitution - Missense(4)	large_intestine(4)											223.0	190.0	201.0					X																	31747811		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7597G>A	X.37:g.31747811C>T	ENSP00000354923:p.Ala2533Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.A2533T	ENST00000357033.4	37	c.7597	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.958087|3.958087	0.73902|0.73902	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.47528|.	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	0.000000|.	0.34725|.	U|.	0.003738|.	T|T	0.68439|0.68439	0.3001|0.3001	L|L	0.46741|0.46741	1.465|1.465	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;D;D;P;D;D;D;D|.	0.89917|.	0.983;1.0;0.999;1.0;1.0;0.576;0.991;0.991;0.999;0.999|.	P;D;D;D;D;B;P;P;D;D|.	0.91635|.	0.766;0.999;0.996;0.999;0.999;0.095;0.887;0.887;0.996;0.994|.	T|T	0.65504|0.65504	-0.6152|-0.6152	10|5	0.20519|.	T|.	0.43|.	.|.	18.1287|18.1287	0.89595|0.89595	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2525;2533;2529;1192;1189;73;73;73;73;73|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	T|H	2525;1192;1189;229;2529;2533;73;73;2533;2410;73;73;73|261	ENSP00000350765:A229T;ENSP00000367948:A2529T;ENSP00000354923:A2533T;ENSP00000352894:A73T;ENSP00000340057:A73T;ENSP00000367979:A73T;ENSP00000444119:A73T;ENSP00000417123:A73T|.	ENSP00000340057:A73T|.	A|R	-|-	1|2	0|0	DMD|DMD	31657732|31657732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.586000|6.586000	0.74067|0.74067	2.304000|2.304000	0.77564|0.77564	0.506000|0.506000	0.49869|0.49869	GCT|CGC	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.428	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	C	NM_004006		31747811	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH11	8701	genome.wustl.edu	37	7	21639599	21639599	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:21639599G>A	ENST00000409508.3	+	15	2893	c.2862G>A	c.(2860-2862)gaG>gaA	p.E954E	DNAH11_ENST00000328843.6_Silent_p.E954E	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	954	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGCCTCCTGAGATTGTGTTTA	0.403									Kartagener syndrome																																								0													79.0	75.0	76.0					7																	21639599		1847	4092	5939	SO:0001819	synonymous_variant	8701	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2862G>A	7.37:g.21639599G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UJ82	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E954	ENST00000409508.3	37	c.2862		7																																																																																			DNAH11	-	NULL		0.403	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	G	NM_003777		21639599	+1	no_errors	ENST00000328843	ensembl	human	known	70_37	silent	SNP	1.000	A
DOCK11	139818	genome.wustl.edu	37	X	117676770	117676770	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:117676770G>A	ENST00000276202.7	+	2	248	c.185G>A	c.(184-186)cGa>cAa	p.R62Q	DOCK11_ENST00000276204.6_Missense_Mutation_p.R62Q	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	62					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GACCCCCTCCGAGATCTGCTT	0.393																																																	0													128.0	126.0	127.0					X																	117676770		2203	4300	6503	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.185G>A	X.37:g.117676770G>A	ENSP00000276202:p.Arg62Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R62Q	ENST00000276202.7	37	c.185	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664342	0.88251	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.49720	0.77;0.77	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.69151	0.3079	M	0.78801	2.425	0.51482	D	0.999922	D	0.89917	1.0	D	0.72982	0.979	T	0.70029	-0.4984	10	0.40728	T	0.16	-34.4192	16.8511	0.85994	0.0:0.0:1.0:0.0	.	62	Q5JSL3	DOC11_HUMAN	Q	62	ENSP00000276204:R62Q;ENSP00000276202:R62Q	ENSP00000276202:R62Q	R	+	2	0	DOCK11	117560798	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.604000	0.90877	2.239000	0.73571	0.596000	0.82720	CGA	DOCK11	-	pfam_DOCK_C/D_N		0.393	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	G	NM_144658		117676770	+1	no_errors	ENST00000276202	ensembl	human	known	70_37	missense	SNP	1.000	A
DSCAM	1826	genome.wustl.edu	37	21	42080577	42080577	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr21:42080577G>A	ENST00000400454.1	-	2	641	c.164C>T	c.(163-165)aCt>aTt	p.T55I		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	55	Ig-like C2-type 1.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCATCTGAGAGTCACAGGAGG	0.597																																					Melanoma(134;970 1778 1785 21664 32388)												0													94.0	100.0	98.0					21																	42080577		2027	4181	6208	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.164C>T	21.37:g.42080577G>A	ENSP00000383303:p.Thr55Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T55I	ENST00000400454.1	37	c.164	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002496	0.54254	.	.	ENSG00000171587	ENST00000400454	T	0.12879	2.64	5.1	5.1	0.69264	Immunoglobulin-like fold (1);	0.145266	0.45361	D	0.000380	T	0.19725	0.0474	L	0.48362	1.52	0.38482	D	0.947758	B	0.33044	0.395	B	0.41619	0.361	T	0.04915	-1.0918	10	0.31617	T	0.26	.	17.0669	0.86561	0.0:0.0:1.0:0.0	.	55	O60469	DSCAM_HUMAN	I	55	ENSP00000383303:T55I	ENSP00000383303:T55I	T	-	2	0	DSCAM	41002447	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.302000	0.96175	2.547000	0.85894	0.585000	0.79938	ACT	DSCAM	-	smart_Ig_sub2		0.597	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	G	NM_001389		42080577	-1	no_errors	ENST00000400454	ensembl	human	known	70_37	missense	SNP	1.000	A
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875157	+	3'UTR	DEL	A	A	-			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:221875157delA	ENST00000366899.3	-	0	2284				DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	11221			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597T>-	1.37:g.221875157delA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-		0.353	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	A	NM_007207		221875157	-1	no_errors	ENST00000468085	ensembl	human	known	70_37	rna	DEL	0.000	-
DYNC1I2	1781	genome.wustl.edu	37	2	172569303	172569303	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:172569303C>T	ENST00000397119.3	+	6	529	c.362C>T	c.(361-363)tCa>tTa	p.S121L	DYNC1I2_ENST00000409317.1_Missense_Mutation_p.S115L|DYNC1I2_ENST00000534253.2_Missense_Mutation_p.S121L|DYNC1I2_ENST00000409197.1_Intron|DYNC1I2_ENST00000340296.4_Intron|DYNC1I2_ENST00000409773.1_Missense_Mutation_p.S121L|DYNC1I2_ENST00000508530.1_Intron|DYNC1I2_ENST00000358002.6_Intron|DYNC1I2_ENST00000263811.4_Missense_Mutation_p.S115L|DYNC1I2_ENST00000410079.3_Intron|DYNC1I2_ENST00000409453.1_Missense_Mutation_p.S121L|AC068039.1_ENST00000598148.1_5'Flank	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	121					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			ACAGATCCATCAGTTCTTCAG	0.363																																																	0													203.0	189.0	193.0					2																	172569303		1845	4098	5943	SO:0001583	missense	1781			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.362C>T	2.37:g.172569303C>T	ENSP00000380308:p.Ser121Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S121L	ENST00000397119.3	37	c.362	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914775	0.92178	.	.	ENSG00000077380	ENST00000452242;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000438879;ENST00000409317;ENST00000409773;ENST00000411953;ENST00000409453;ENST00000443458;ENST00000422646	T;T;T;T;T;T	0.77750	-1.12;-0.99;-0.99;-0.99;-0.99;-0.85	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.84678	0.5525	L	0.43152	1.355	0.80722	D	1	D;D	0.76494	0.999;0.991	D;D	0.91635	0.999;0.992	D	0.86398	0.1740	10	0.72032	D	0.01	-6.3228	18.1587	0.89702	0.0:1.0:0.0:0.0	.	115;121	Q13409-2;Q13409	.;DC1I2_HUMAN	L	115;121;115;121;133;115;121;133;121;121;115	ENSP00000433791:S121L;ENSP00000263811:S115L;ENSP00000380308:S121L;ENSP00000386591:S115L;ENSP00000386415:S121L;ENSP00000386886:S121L	ENSP00000263811:S115L	S	+	2	0	DYNC1I2	172277549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.599000	0.82757	2.306000	0.77630	0.591000	0.81541	TCA	DYNC1I2	-	NULL		0.363	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	HGNC	protein_coding	OTTHUMT00000333683.2	C	NM_001378		172569303	+1	no_errors	ENST00000397119	ensembl	human	known	70_37	missense	SNP	1.000	T
DYNC1I2	1781	genome.wustl.edu	37	2	172569311	172569311	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:172569311C>T	ENST00000397119.3	+	6	537	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	DYNC1I2_ENST00000409317.1_Nonsense_Mutation_p.Q118*|DYNC1I2_ENST00000534253.2_Nonsense_Mutation_p.Q124*|DYNC1I2_ENST00000409197.1_Intron|DYNC1I2_ENST00000340296.4_Intron|DYNC1I2_ENST00000409773.1_Nonsense_Mutation_p.Q124*|DYNC1I2_ENST00000508530.1_Intron|DYNC1I2_ENST00000358002.6_Intron|DYNC1I2_ENST00000263811.4_Nonsense_Mutation_p.Q118*|DYNC1I2_ENST00000410079.3_Intron|DYNC1I2_ENST00000409453.1_Nonsense_Mutation_p.Q124*|AC068039.1_ENST00000598148.1_5'Flank	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	124					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			ATCAGTTCTTCAGCTTCACTC	0.353																																																	0													200.0	187.0	191.0					2																	172569311		1842	4091	5933	SO:0001587	stop_gained	1781			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.370C>T	2.37:g.172569311C>T	ENSP00000380308:p.Gln124*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Nonsense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.Q124*	ENST00000397119.3	37	c.370	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.371147	0.95923	.	.	ENSG00000077380	ENST00000452242;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000438879;ENST00000409317;ENST00000409773;ENST00000411953;ENST00000409453;ENST00000443458;ENST00000422646	.	.	.	4.93	4.93	0.64822	.	0.061464	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-5.3916	18.1391	0.89633	0.0:1.0:0.0:0.0	.	.	.	.	X	118;124;118;124;136;118;124;136;124;124;118	.	ENSP00000263811:Q118X	Q	+	1	0	DYNC1I2	172277557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.599000	0.82757	2.301000	0.77427	0.585000	0.79938	CAG	DYNC1I2	-	NULL		0.353	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	HGNC	protein_coding	OTTHUMT00000333683.2	C	NM_001378		172569311	+1	no_errors	ENST00000397119	ensembl	human	known	70_37	nonsense	SNP	1.000	T
EBF3	253738	genome.wustl.edu	37	10	131761042	131761042	+	Intron	SNP	C	C	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr10:131761042C>A	ENST00000355311.5	-	3	428				EBF3_ENST00000368648.3_Intron			Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		ATGTGAAGTGCCATCGACTTA	0.358																																																	0																																										SO:0001627	intron_variant	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.355+163G>T	10.37:g.131761042C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUY1|Q5T6H9|Q9H4W5	RNA	SNP	-	NULL	ENST00000355311.5	37	NULL		10																																																																																			EBF3	-	-		0.358	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	HGNC	protein_coding	OTTHUMT00000051015.2	C	NM_001005463		131761042	-1	no_errors	ENST00000471715	ensembl	human	known	70_37	rna	SNP	1.000	A
EIF2B4	8890	genome.wustl.edu	37	2	27590059	27590059	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:27590059C>G	ENST00000347454.4	-	10	1066	c.895G>C	c.(895-897)Gaa>Caa	p.E299Q	EIF2B4_ENST00000493344.2_Missense_Mutation_p.E320Q|EIF2B4_ENST00000445933.2_Missense_Mutation_p.E298Q|EIF2B4_ENST00000451130.2_Missense_Mutation_p.E319Q|AC074117.10_ENST00000412749.1_RNA	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	299					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTCGAAGTTCTGACTTGGCC	0.423																																																	0													157.0	139.0	145.0					2																	27590059		2203	4300	6503	SO:0001583	missense	8890			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.895G>C	2.37:g.27590059C>G	ENSP00000233552:p.Glu299Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	pfam_IF-2B-related	p.E299Q	ENST00000347454.4	37	c.895	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	C	3.671	-0.067569	0.07273	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	5.97	4.11	0.48088	.	0.286130	0.45126	N	0.000392	T	0.79782	0.4505	N	0.11698	0.16	0.32475	N	0.542236	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.10450	0.003;0.003;0.005;0.003	T	0.71537	-0.4563	10	0.12430	T	0.62	-10.1866	4.6702	0.12685	0.2742:0.5194:0.1335:0.0728	.	296;298;299;319	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	Q	299;296;298;319;320	ENSP00000233552:E299Q;ENSP00000394397:E298Q;ENSP00000394869:E319Q;ENSP00000429323:E320Q	ENSP00000233552:E299Q	E	-	1	0	EIF2B4	27443563	0.990000	0.36364	1.000000	0.80357	0.682000	0.39822	2.513000	0.45494	1.526000	0.49068	0.655000	0.94253	GAA	EIF2B4	-	pfam_IF-2B-related		0.423	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	HGNC	protein_coding	OTTHUMT00000324448.1	C			27590059	-1	no_errors	ENST00000347454	ensembl	human	known	70_37	missense	SNP	0.888	G
EIF2S3	1968	genome.wustl.edu	37	X	24094872	24094872	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:24094872G>A	ENST00000253039.4	+	12	1642	c.1389G>A	c.(1387-1389)gtG>gtA	p.V463V		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	463					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						GAAGAGGAGTGACAATCAAGC	0.353																																																	0													213.0	184.0	194.0					X																	24094872		2203	4300	6503	SO:0001819	synonymous_variant	1968			L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1389G>A	X.37:g.24094872G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BTZ4	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_TIF2_gsu_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_EF_GTP-bd_dom	p.V463	ENST00000253039.4	37	c.1389	CCDS14210.1	X																																																																																			EIF2S3	-	NULL		0.353	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S3	HGNC	protein_coding	OTTHUMT00000056079.1	G	NM_001415		24094872	+1	no_errors	ENST00000253039	ensembl	human	known	70_37	silent	SNP	1.000	A
ELOVL4	6785	genome.wustl.edu	37	6	80626468	80626468	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:80626468G>A	ENST00000369816.4	-	6	1102	c.802C>T	c.(802-804)Cgg>Tgg	p.R268W		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	268					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)			central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	TTGTATGTCCGAATGTAGAAG	0.403																																																	0													106.0	97.0	100.0					6																	80626468		2203	4300	6503	SO:0001583	missense	6785			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.802C>T	6.37:g.80626468G>A	ENSP00000358831:p.Arg268Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.R268W	ENST00000369816.4	37	c.802	CCDS4992.1	6	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765481	0.69878	.	.	ENSG00000118402	ENST00000369816	T	0.24723	1.84	5.95	5.06	0.68205	.	0.266403	0.44902	D	0.000410	T	0.42832	0.1220	M	0.82323	2.585	0.52501	D	0.999953	D	0.69078	0.997	P	0.62382	0.901	T	0.53947	-0.8366	10	0.87932	D	0	-32.048	15.4346	0.75137	0.0:0.0:0.8601:0.1399	.	268	Q9GZR5	ELOV4_HUMAN	W	268	ENSP00000358831:R268W	ENSP00000358831:R268W	R	-	1	2	ELOVL4	80683187	1.000000	0.71417	0.899000	0.35326	0.970000	0.65996	8.000000	0.88501	1.485000	0.48380	0.650000	0.86243	CGG	ELOVL4	-	pfam_GNS1_SUR4		0.403	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL4	HGNC	protein_coding	OTTHUMT00000041315.1	G			80626468	-1	no_errors	ENST00000369816	ensembl	human	known	70_37	missense	SNP	1.000	A
ENPEP	2028	genome.wustl.edu	37	4	111398096	111398096	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:111398096G>A	ENST00000265162.5	+	1	868	c.526G>A	c.(526-528)Gag>Aag	p.E176K		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	176					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GGCGGAGGAAGAGCTTACCCC	0.597																																																	0													79.0	87.0	84.0					4																	111398096		2203	4300	6503	SO:0001583	missense	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.526G>A	4.37:g.111398096G>A	ENSP00000265162:p.Glu176Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E176K	ENST00000265162.5	37	c.526	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354158	0.24512	.	.	ENSG00000138792	ENST00000265162	T	0.02525	4.26	5.43	1.53	0.23141	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.675194	0.15798	N	0.244117	T	0.02929	0.0087	L	0.41124	1.26	0.27347	N	0.956339	P	0.40534	0.72	B	0.41374	0.355	T	0.27536	-1.0071	10	0.07175	T	0.84	.	10.9017	0.47056	0.0679:0.3644:0.5677:0.0	.	176	Q07075	AMPE_HUMAN	K	176	ENSP00000265162:E176K	ENSP00000265162:E176K	E	+	1	0	ENPEP	111617545	0.345000	0.24835	0.136000	0.22124	0.233000	0.25261	0.478000	0.22212	0.198000	0.20407	0.561000	0.74099	GAG	ENPEP	-	pfam_Peptidase_M1_N		0.597	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	G			111398096	+1	no_errors	ENST00000265162	ensembl	human	known	70_37	missense	SNP	0.485	A
SNORA70	26778	genome.wustl.edu	37	5	170793156	170793156	+	RNA	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:170793156C>T	ENST00000384182.1	+	0	35									small nucleolar RNA, H/ACA box 70																		TTCCTTTCCTCATGGGGGCCC	0.478																																																	0																																												0			Y11164		Xq28	2013-09-05	2006-04-05	2006-04-05	ENSG00000207165	ENSG00000207165		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	10231	non-coding RNA	RNA, small nucleolar			"""RNA, U70 small nucleolar"""	RNU70		9106664, 15199136	Standard	NR_000011		Approved	U70, DXS648E	uc021raw.1				5.37:g.170793156C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000384182.1	37	NULL		5																																																																																			SNORA70	-	-		0.478	SNORA70.9-201	NOVEL	basic	snoRNA	ENSG00000206909	RFAM	snoRNA		C	NR_000011		170793156	+1	no_errors	ENST00000384182	ensembl	human	novel	70_37	rna	SNP	0.998	T
MUC3A	4584	genome.wustl.edu	37	7	100608123	100608124	+	Intron	INS	-	-	G	rs111295588		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:100608123_100608124insG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000420080.1_RNA|RP11-395B7.2_ENST00000434775.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CAGCATTTCCCGATGGCTGAAG	0.589																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-183->G	7.37:g.100608124_100608124dupG		Somatic		WXS	Illumina HiSeq	Phase_IV	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-		0.589	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	-	XM_001725354		100608124	-1	no_errors	ENST00000420080	ensembl	human	known	70_37	rna	INS	0.000:0.037	G
IRF2BP2	359948	genome.wustl.edu	37	1	234742800	234742801	+	3'UTR	DEL	AT	AT	-	rs142351268		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:234742800_234742801delAT	ENST00000366609.3	-	0	1876_1877				IRF2BP2_ENST00000491430.1_5'Flank|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_3'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CTTGTCTTGGATATATATATAT	0.287																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.*83AT>-	1.37:g.234742810_234742811delAT		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	RNA	DEL	-	NULL	ENST00000366609.3	37	NULL	CCDS1602.1	1																																																																																			RP4-781K5.2	-	-		0.287	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	ENSG00000228830	Clone_based_vega_gene	protein_coding	OTTHUMT00000092705.1	AT	NM_182972		234742801	+1	no_errors	ENST00000436039	ensembl	human	putative	70_37	rna	DEL	1.000:1.000	-
ZNF57	126295	genome.wustl.edu	37	19	2915683	2915683	+	Intron	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:2915683G>A	ENST00000306908.5	+	2	278				ZNF57_ENST00000523428.1_Intron|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTTTTTAATGAACTCATTTC	0.463																																					NSCLC(150;910 1964 4303 10464 26498)												0													98.0	89.0	92.0					19																	2915683		2203	4300	6503	SO:0001627	intron_variant	0			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.130+37G>A	19.37:g.2915683G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6R9	RNA	SNP	-	NULL	ENST00000306908.5	37	NULL	CCDS12098.1	19																																																																																			AC006277.2	-	-		0.463	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253392	Clone_based_vega_gene	protein_coding	OTTHUMT00000378969.1	G	NM_173480		2915683	-1	no_errors	ENST00000520090	ensembl	human	known	70_37	rna	SNP	0.000	A
BBS1	582	genome.wustl.edu	37	11	66297298	66297298	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:66297298C>T	ENST00000318312.7	+	14	1399	c.1348C>T	c.(1348-1350)Cgg>Tgg	p.R450W	BBS1_ENST00000455748.2_Missense_Mutation_p.R353W|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.R487W|ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000393994.2_Missense_Mutation_p.R321W	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	450					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						AGCCATGCACCGGGCCTTCCA	0.687									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0													89.0	61.0	71.0					11																	66297298		2200	4295	6495	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1348C>T	11.37:g.66297298C>T	ENSP00000317469:p.Arg450Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.R487W	ENST00000318312.7	37	c.1459	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.206794	0.95033	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748;ENST00000393994	D;D;D;D	0.97430	-4.31;-4.38;-4.19;-4.13	4.46	4.46	0.54185	.	.	.	.	.	D	0.98289	0.9433	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999	D;D;D;D;P;P	0.74023	0.963;0.971;0.982;0.923;0.832;0.855	D	0.99267	1.0892	9	0.87932	D	0	.	14.9687	0.71217	0.0:1.0:0.0:0.0	.	125;353;321;338;450;487	B4DH75;E7EQH1;Q32MM9;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;.;.;BBS1_HUMAN;.	W	487;450;353;321	ENSP00000398526:R487W;ENSP00000317469:R450W;ENSP00000405764:R353W;ENSP00000377563:R321W	ENSP00000317469:R450W	R	+	1	2	BBS1;CTD-3074O7.11	66053874	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.324000	0.52022	2.200000	0.70718	0.655000	0.94253	CGG	BBS1	-	NULL		0.687	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256349	Uniprot_genename	protein_coding	OTTHUMT00000393235.2	C			66297298	+1	no_errors	ENST00000419755	ensembl	human	known	70_37	missense	SNP	1.000	T
CTXN2	399697	genome.wustl.edu	37	15	48493744	48493744	+	3'UTR	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:48493744G>C	ENST00000417307.2	+	0	619				CTXN2_ENST00000541248.1_3'UTR|RP11-605F22.1_ENST00000559875.1_RNA	NM_001145668.1	NP_001139140.1	P0C2S0	CTXN2_HUMAN	cortexin 2							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2						ACTCGCGTGAGAGTTCCAGCT	0.433																																																	0													220.0	192.0	201.0					15																	48493744		687	1588	2275	SO:0001624	3_prime_UTR_variant	0			BK004876	CCDS45254.1	15q21.1	2013-09-20			ENSG00000233932	ENSG00000233932			31109	protein-coding gene	gene with protein product							Standard	NM_001145668		Approved		uc001zwm.1	P0C2S0	OTTHUMG00000172152	ENST00000417307.2:c.*1G>C	15.37:g.48493744G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000417307.2	37	NULL	CCDS45254.1	15																																																																																			RP11-605F22.1	-	-		0.433	CTXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259385	Clone_based_vega_gene	protein_coding	OTTHUMT00000417125.1	G			48493744	-1	no_errors	ENST00000559875	ensembl	human	known	70_37	rna	SNP	0.026	C
SPN	6693	genome.wustl.edu	37	16	29680166	29680166	+	3'UTR	DEL	A	A	-			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:29680166delA	ENST00000360121.3	+	0	5209					NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin						anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						atacataattaaaaaaaaaaa	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	0			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.*3914A>-	16.37:g.29680166delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	RNA	DEL	-	NULL	ENST00000360121.3	37	NULL	CCDS10650.1	16																																																																																			RP11-368N21.4	-	-		0.483	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260043	Clone_based_vega_gene	protein_coding	OTTHUMT00000215001.2	A			29680166	+1	no_errors	ENST00000561857	ensembl	human	known	70_37	rna	DEL	0.001	-
EZR	7430	genome.wustl.edu	37	6	159190392	159190392	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:159190392C>T	ENST00000367075.3	-	12	1478	c.1310G>A	c.(1309-1311)cGc>cAc	p.R437H	EZR_ENST00000392177.4_Missense_Mutation_p.R405H|EZR_ENST00000337147.7_Missense_Mutation_p.R437H	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	437	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		ATCCTCCTTGCGCCTCCGCGC	0.602			T	ROS1	NSCLC																																			Dom	yes		6	6q25.3	7430	ezrin		E	0													81.0	69.0	73.0					6																	159190392		2203	4300	6503	SO:0001583	missense	7430			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1310G>A	6.37:g.159190392C>T	ENSP00000356042:p.Arg437His	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin,prints_Band_41_fam	p.R437H	ENST00000367075.3	37	c.1310	CCDS5258.1	6	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463712	0.84425	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.83591	-1.74;-1.74;-1.74	5.08	4.15	0.48705	Ezrin/radixin/moesin, C-terminal (1);	0.107097	0.64402	D	0.000005	T	0.82121	0.4968	L	0.59436	1.845	0.54753	D	0.999987	P;P	0.46064	0.792;0.872	P;P	0.55161	0.505;0.77	D	0.83818	0.0245	10	0.62326	D	0.03	.	10.1785	0.42952	0.1524:0.7003:0.1473:0.0	.	405;437	E7EQR4;P15311	.;EZRI_HUMAN	H	437;437;405	ENSP00000338934:R437H;ENSP00000356042:R437H;ENSP00000376016:R405H	ENSP00000338934:R437H	R	-	2	0	EZR	159110380	0.920000	0.31207	0.998000	0.56505	0.991000	0.79684	0.856000	0.27818	2.372000	0.80975	0.561000	0.74099	CGC	EZR	-	pirsf_ERM,pfam_ERM_C		0.602	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	HGNC	protein_coding	OTTHUMT00000042878.1	C	NM_003379		159190392	-1	no_errors	ENST00000337147	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM86C2P	645332	genome.wustl.edu	37	11	67559472	67559472	+	RNA	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:67559472G>A	ENST00000528089.1	-	0	2278							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		TCCAGGGCACGAAGTGTGGGA	0.592																																																	0																																												645332					11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67559472G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000528089.1	37	NULL		11																																																																																			FAM86C2P	-	-		0.592	FAM86C2P-004	KNOWN	basic	processed_transcript	FAM86C2P	HGNC	pseudogene	OTTHUMT00000393796.1	G			67559472	-1	no_errors	ENST00000528089	ensembl	human	known	70_37	rna	SNP	0.000	A
FANCB	2187	genome.wustl.edu	37	X	14863135	14863135	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:14863135G>A	ENST00000324138.3	-	7	1923	c.1770C>T	c.(1768-1770)ttC>ttT	p.F590F	FANCB_ENST00000398334.1_Silent_p.F590F	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	590					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					AAAATTTACTGAATGTTAAAA	0.358								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													128.0	120.0	123.0					X																	14863135		2203	4300	6503	SO:0001819	synonymous_variant	2187	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1770C>T	X.37:g.14863135G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMZ4|Q7Z2U2|Q86XG1	Silent	SNP	NULL	p.F590	ENST00000324138.3	37	c.1770	CCDS14161.1	X																																																																																			FANCB	-	NULL		0.358	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	G	NM_152633		14863135	-1	no_errors	ENST00000324138	ensembl	human	known	70_37	silent	SNP	0.001	A
FBXO34	55030	genome.wustl.edu	37	14	55817459	55817459	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr14:55817459delG	ENST00000313833.4	+	2	596	c.351delG	c.(349-351)aagfs	p.K117fs	FBXO34_ENST00000555087.1_3'UTR|FBXO34_ENST00000440021.1_Frame_Shift_Del_p.K117fs	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	117								p.K117N(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						GAAATACCAAGGAAAAAATTG	0.408																																																	1	Substitution - Missense(1)	kidney(1)											58.0	62.0	60.0					14																	55817459		2203	4300	6503	SO:0001589	frameshift_variant	55030			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.351delG	14.37:g.55817459delG	ENSP00000313159:p.Lys117fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2VPB5|Q4VBP5|Q86TY4	Frame_Shift_Del	DEL	superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.E118fs	ENST00000313833.4	37	c.351	CCDS32086.1	14																																																																																			FBXO34	-	NULL		0.408	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	G			55817459	+1	no_errors	ENST00000313833	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
FCRLA	84824	genome.wustl.edu	37	1	161680547	161680547	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:161680547C>T	ENST00000470841.1	+	0	469				FCRLA_ENST00000367957.2_Intron|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000367953.3_Intron|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000349527.4_Intron|FCRLA_ENST00000367950.1_Intron|FCRLA_ENST00000540521.1_Intron|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000236938.6_Intron|FCRLA_ENST00000540926.1_Intron|FCRLA_ENST00000367959.2_Intron|FCRLA_ENST00000367949.2_Intron			Q7L513	FCRLA_HUMAN	Fc receptor-like A						cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			ATGCCCTCTTCAGCTGCCAGT	0.527																																																	0													54.0	49.0	51.0					1																	161680547		2203	4300	6503	SO:0001624	3_prime_UTR_variant	84824			AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000470841.1:c.*466C>T	1.37:g.161680547C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	RNA	SNP	-	NULL	ENST00000470841.1	37	NULL		1																																																																																			FCRLA	-	-		0.527	FCRLA-009	KNOWN	basic	processed_transcript	FCRLA	HGNC	protein_coding	OTTHUMT00000083582.1	C	NM_032738		161680547	+1	no_errors	ENST00000470841	ensembl	human	known	70_37	rna	SNP	0.121	T
FGA	2243	genome.wustl.edu	37	4	155505486	155505486	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:155505486C>G	ENST00000302053.3	-	6	2469	c.2391G>C	c.(2389-2391)gaG>gaC	p.E797D		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	797	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CTGCACAGTTCTCTTCCCACT	0.517																																					NSCLC(143;340 1922 20892 22370 48145)												0													131.0	122.0	125.0					4																	155505486		2203	4300	6503	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.2391G>C	4.37:g.155505486C>G	ENSP00000306361:p.Glu797Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E797D	ENST00000302053.3	37	c.2391	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978027	0.34942	.	.	ENSG00000171560	ENST00000302053	T	0.76968	-1.06	5.85	3.11	0.35812	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.091975	0.64402	D	0.000001	T	0.62696	0.2449	L	0.31207	0.915	0.80722	D	1	B	0.06786	0.001	B	0.16289	0.015	T	0.54616	-0.8267	10	0.36615	T	0.2	.	6.5372	0.22361	0.0:0.5515:0.2595:0.189	.	797	P02671	FIBA_HUMAN	D	797	ENSP00000306361:E797D	ENSP00000306361:E797D	E	-	3	2	FGA	155724936	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.794000	0.26958	0.780000	0.33566	0.650000	0.86243	GAG	FGA	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C		0.517	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	C	NM_000508		155505486	-1	no_errors	ENST00000302053	ensembl	human	known	70_37	missense	SNP	1.000	G
FRMD3	257019	genome.wustl.edu	37	9	85863159	85863159	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:85863159C>T	ENST00000304195.3	-	14	1674	c.1468G>A	c.(1468-1470)Gaa>Aaa	p.E490K	FRMD3_ENST00000376438.1_Missense_Mutation_p.E490K|FRMD3_ENST00000465485.1_5'UTR|FRMD3_ENST00000376434.1_Missense_Mutation_p.E296K|FRMD3_ENST00000328788.1_Missense_Mutation_p.E147K	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	490						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						AAGGCGTTTTCATCTGCTTCC	0.483																																																	0													146.0	143.0	144.0					9																	85863159		1969	4161	6130	SO:0001583	missense	257019			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1468G>A	9.37:g.85863159C>T	ENSP00000303508:p.Glu490Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.E490K	ENST00000304195.3	37	c.1468	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997481	0.35226	.	.	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000328788;ENST00000304195	D;D;T;D	0.86562	-1.72;-2.14;0.76;-1.71	5.72	5.72	0.89469	.	0.051398	0.85682	D	0.000000	D	0.91372	0.7278	L	0.59436	1.845	0.48185	D	0.999602	P;P;D	0.71674	0.895;0.879;0.998	B;B;D	0.78314	0.281;0.324;0.991	D	0.86525	0.1818	10	0.07813	T	0.8	.	19.8861	0.96913	0.0:1.0:0.0:0.0	.	490;490;147	A2A2Y4;A2A2Y4-2;A2A2Y4-4	FRMD3_HUMAN;.;.	K	490;296;147;490	ENSP00000365621:E490K;ENSP00000365617:E296K;ENSP00000328615:E147K;ENSP00000303508:E490K	ENSP00000303508:E490K	E	-	1	0	FRMD3	85052979	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	4.116000	0.57871	2.711000	0.92665	0.655000	0.94253	GAA	FRMD3	-	NULL		0.483	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	C	NM_174938		85863159	-1	no_errors	ENST00000304195	ensembl	human	known	70_37	missense	SNP	1.000	T
FRRS1L	23732	genome.wustl.edu	37	9	111903843	111903843	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:111903843G>A	ENST00000561981.2	-	4	641	c.642C>T	c.(640-642)gtC>gtT	p.V214V		NM_014334.2	NP_055149.2	Q9P0K9	FRS1L_HUMAN	ferric-chelate reductase 1-like	214	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)											TGTCATCATGGACGCAGGCCA	0.433																																																	0													85.0	81.0	82.0					9																	111903843		2203	4300	6503	SO:0001819	synonymous_variant	23732			AF155065	CCDS35098.1	9q31.3	2014-07-16	2012-03-06	2012-03-06	ENSG00000260230	ENSG00000260230			1362	protein-coding gene	gene with protein product		604574	"""chromosome 9 open reading frame 4"""	C9orf4		10603000	Standard	NM_014334		Approved	CG-6	uc004bdw.1	Q9P0K9	OTTHUMG00000020468	ENST00000561981.2:c.642C>T	9.37:g.111903843G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T4G4	Silent	SNP	pfam_DOMON_domain,smart_DOMON_domain,pfscan_DOMON_domain	p.V214	ENST00000561981.2	37	c.642	CCDS35098.1	9																																																																																			FRRS1L	-	pfam_DOMON_domain,smart_DOMON_domain,pfscan_DOMON_domain		0.433	FRRS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRRS1L	HGNC	protein_coding	OTTHUMT00000053586.2	G	NM_014334		111903843	-1	no_errors	ENST00000374581	ensembl	human	known	70_37	silent	SNP	1.000	A
FZD10	11211	genome.wustl.edu	37	12	130648279	130648279	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:130648279C>T	ENST00000229030.4	+	1	1276	c.792C>T	c.(790-792)atC>atT	p.I264I	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.L232F			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	264					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GCCCCATCATCTTCCTCTCCA	0.662																																																	0													116.0	110.0	112.0					12																	130648279		2203	4300	6503	SO:0001819	synonymous_variant	11211			AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.792C>T	12.37:g.130648279C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.L232F	ENST00000229030.4	37	c.694	CCDS9267.1	12	.	.	.	.	.	.	.	.	.	.	C	12.05	1.821323	0.32237	.	.	ENSG00000111432	ENST00000539839	.	.	.	4.87	3.96	0.45880	.	.	.	.	.	T	0.73644	0.3613	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76958	-0.2766	5	0.87932	D	0	.	13.4818	0.61340	0.0:0.9221:0.0:0.0779	.	.	.	.	F	232	.	ENSP00000438460:L232F	L	+	1	0	FZD10	129214232	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.767000	0.62286	0.999000	0.39023	0.561000	0.74099	CTT	FZD10	-	NULL		0.662	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD10	HGNC	protein_coding		C			130648279	+1	no_errors	ENST00000539839	ensembl	human	known	70_37	missense	SNP	1.000	T
GABRA6	2559	genome.wustl.edu	37	5	161128681	161128681	+	Nonsense_Mutation	SNP	C	C	T	rs372922965		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:161128681C>T	ENST00000274545.5	+	9	1697	c.1264C>T	c.(1264-1266)Cga>Tga	p.R422*	GABRA6_ENST00000523217.1_Nonsense_Mutation_p.R412*			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	422					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CCAGTATTCTCGAATTCTCTT	0.458										TCGA Ovarian(5;0.080)																																							0								C	stop/ARG	0,4406		0,0,2203	132.0	119.0	123.0		1264	4.2	1.0	5		123	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	GABRA6	NM_000811.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		422/454	161128681	1,13005	2203	4300	6503	SO:0001587	stop_gained	2559				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1264C>T	5.37:g.161128681C>T	ENSP00000274545:p.Arg422*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K096|Q4VAV2	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R422*	ENST00000274545.5	37	c.1264	CCDS4356.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.800112	0.97849	0.0	1.16E-4	ENSG00000145863	ENST00000274545;ENST00000523217	.	.	.	5.16	4.16	0.48862	.	0.105878	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8411	0.46715	0.4108:0.5892:0.0:0.0	.	.	.	.	X	422;412	.	ENSP00000274545:R422X	R	+	1	2	GABRA6	161061259	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	2.664000	0.46783	2.571000	0.86741	0.655000	0.94253	CGA	GABRA6	-	superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt		0.458	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2	C			161128681	+1	no_errors	ENST00000274545	ensembl	human	known	70_37	nonsense	SNP	1.000	T
GDPD4	220032	genome.wustl.edu	37	11	76928352	76928352	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:76928352C>T	ENST00000376217.2	-	16	1783	c.1533G>A	c.(1531-1533)caG>caA	p.Q511Q	GDPD4_ENST00000315938.4_Silent_p.Q511Q			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	511					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TACTTCCACTCTGAGTATCTG	0.423																																																	0													169.0	148.0	156.0					11																	76928352		2200	4292	6492	SO:0001819	synonymous_variant	220032			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1533G>A	11.37:g.76928352C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z5B0	Silent	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.Q511	ENST00000376217.2	37	c.1533		11																																																																																			GDPD4	-	NULL		0.423	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	C	NM_182833		76928352	-1	no_errors	ENST00000376217	ensembl	human	known	70_37	silent	SNP	0.000	T
GGT7	2686	genome.wustl.edu	37	20	33448099	33448099	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr20:33448099C>T	ENST00000336431.5	-	5	745	c.701G>A	c.(700-702)gGa>gAa	p.G234E		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	234					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						CTTCACCATTCCGGGAACCCC	0.642																																																	0													60.0	57.0	58.0					20																	33448099		2203	4300	6503	SO:0001583	missense	2686			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.701G>A	20.37:g.33448099C>T	ENSP00000338964:p.Gly234Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.G234E	ENST00000336431.5	37	c.701	CCDS13242.2	20	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761970	0.89932	.	.	ENSG00000131067	ENST00000336431	T	0.28454	1.61	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81331	-0.0981	10	0.87932	D	0	-25.5559	18.5639	0.91111	0.0:1.0:0.0:0.0	.	234;234	A4FU32;Q9UJ14	.;GGT7_HUMAN	E	234	ENSP00000338964:G234E	ENSP00000338964:G234E	G	-	2	0	GGT7	32911760	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.205000	0.77881	2.448000	0.82819	0.462000	0.41574	GGA	GGT7	-	pfam_GGT_peptidase,prints_GGT_peptidase		0.642	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GGT7	HGNC	protein_coding	OTTHUMT00000078816.2	C	NM_178026		33448099	-1	no_errors	ENST00000336431	ensembl	human	novel	70_37	missense	SNP	1.000	T
GLIS2	84662	genome.wustl.edu	37	16	4387454	4387454	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:4387454G>A	ENST00000262366.3	+	8	2325	c.1504G>A	c.(1504-1506)Gag>Aag	p.E502K	RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron|GLIS2_ENST00000433375.1_Missense_Mutation_p.E502K			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	502					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						CAGCAGCCCAGAGGCGTTGGC	0.692																																																	0													11.0	11.0	11.0					16																	4387454		2170	4250	6420	SO:0001583	missense	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.1504G>A	16.37:g.4387454G>A	ENSP00000262366:p.Glu502Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KX84	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E502K	ENST00000262366.3	37	c.1504	CCDS10511.1	16	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347285	0.61183	.	.	ENSG00000126603	ENST00000262366;ENST00000433375	T;T	0.16324	2.35;2.35	5.52	5.52	0.82312	.	0.195954	0.45867	D	0.000332	T	0.12178	0.0296	N	0.24115	0.695	0.80722	D	1	P	0.42692	0.787	B	0.38056	0.264	T	0.02307	-1.1179	10	0.72032	D	0.01	.	11.6712	0.51401	0.0821:0.0:0.9179:0.0	.	502	Q9BZE0	GLIS2_HUMAN	K	502	ENSP00000262366:E502K;ENSP00000395547:E502K	ENSP00000262366:E502K	E	+	1	0	GLIS2	4327455	1.000000	0.71417	0.996000	0.52242	0.764000	0.43329	5.158000	0.64917	2.586000	0.87340	0.655000	0.94253	GAG	GLIS2	-	NULL		0.692	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	G	NM_032575		4387454	+1	no_errors	ENST00000262366	ensembl	human	known	70_37	missense	SNP	0.999	A
GPC2	221914	genome.wustl.edu	37	7	99767912	99767912	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:99767912G>A	ENST00000292377.2	-	10	1848	c.1681C>T	c.(1681-1683)Cac>Tac	p.H561Y	GAL3ST4_ENST00000360039.4_5'Flank|GAL3ST4_ENST00000423751.1_5'Flank|GPC2_ENST00000471050.1_5'UTR|GAL3ST4_ENST00000482469.1_5'Flank	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	561					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTTTGGGTGTGAAAACCAATA	0.602																																																	0													65.0	50.0	55.0					7																	99767912		2200	4298	6498	SO:0001583	missense	221914			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.1681C>T	7.37:g.99767912G>A	ENSP00000292377:p.His561Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2A7	Missense_Mutation	SNP	pfam_Glypican	p.H561Y	ENST00000292377.2	37	c.1681	CCDS5689.1	7	.	.	.	.	.	.	.	.	.	.	G	6.752	0.507641	0.12883	.	.	ENSG00000213420	ENST00000292377	T	0.38401	1.14	4.77	3.89	0.44902	.	0.456782	0.23600	N	0.046441	T	0.21227	0.0511	N	0.08118	0	0.09310	N	1	B	0.25351	0.124	B	0.34346	0.18	T	0.21793	-1.0235	10	0.33940	T	0.23	-18.551	9.0609	0.36433	0.1004:0.0:0.8996:0.0	.	561	Q8N158	GPC2_HUMAN	Y	561	ENSP00000292377:H561Y	ENSP00000292377:H561Y	H	-	1	0	GPC2	99605848	0.992000	0.36948	0.014000	0.15608	0.035000	0.12851	5.277000	0.65586	1.381000	0.46364	0.561000	0.74099	CAC	GPC2	-	NULL		0.602	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	G	NM_152742		99767912	-1	no_errors	ENST00000292377	ensembl	human	known	70_37	missense	SNP	0.034	A
GPR116	221395	genome.wustl.edu	37	6	46851983	46851983	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:46851983G>C	ENST00000283296.7	-	5	642	c.354C>G	c.(352-354)atC>atG	p.I118M	GPR116_ENST00000362015.4_Missense_Mutation_p.I118M|GPR116_ENST00000478711.1_5'Flank|GPR116_ENST00000456426.2_Missense_Mutation_p.I118M|GPR116_ENST00000265417.7_Missense_Mutation_p.I118M	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	118					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			AGGAGCACCAGATTTCATTTC	0.498																																					NSCLC(59;410 1274 8751 36715 50546)												0													110.0	98.0	102.0					6																	46851983		2203	4300	6503	SO:0001583	missense	221395			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.354C>G	6.37:g.46851983G>C	ENSP00000283296:p.Ile118Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.I118M	ENST00000283296.7	37	c.354	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	G	6.175	0.400470	0.11696	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.26518	1.73;2.11;1.73;1.73	5.41	2.27	0.28462	.	0.727233	0.12423	N	0.470250	T	0.07369	0.0186	L	0.41236	1.265	0.09310	N	0.999998	B;B;B	0.17465	0.022;0.006;0.022	B;B;B	0.11329	0.004;0.006;0.004	T	0.33085	-0.9882	10	0.34782	T	0.22	-5.9342	7.0486	0.25061	0.1021:0.3258:0.5721:0.0	.	118;118;118	A8K0D8;Q8IZF2-3;Q8IZF2	.;.;GP116_HUMAN	M	118	ENSP00000283296:I118M;ENSP00000354563:I118M;ENSP00000412866:I118M;ENSP00000265417:I118M	ENSP00000265417:I118M	I	-	3	3	GPR116	46959942	0.300000	0.24435	0.626000	0.29213	0.282000	0.26991	0.041000	0.13927	0.664000	0.31047	0.655000	0.94253	ATC	GPR116	-	NULL		0.498	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	G	NM_015234		46851983	-1	no_errors	ENST00000265417	ensembl	human	known	70_37	missense	SNP	0.150	C
GSTCD	79807	genome.wustl.edu	37	4	106630022	106630022	+	5'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:106630022C>T	ENST00000515279.1	+	0	48				INTS12_ENST00000451321.2_5'UTR|GSTCD_ENST00000360505.5_5'Flank|GSTCD_ENST00000394730.3_5'UTR|INTS12_ENST00000340139.5_5'Flank|GSTCD_ENST00000515255.1_3'UTR|INTS12_ENST00000394735.1_5'Flank|GSTCD_ENST00000507281.1_5'UTR			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing							extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		TGTCGTTTTTCTCCTGGCGTC	0.607																																																	0																																										SO:0001623	5_prime_UTR_variant	79807			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.-173C>T	4.37:g.106630022C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8J0|A8MVD3|H9KV97|Q9H8S3	RNA	SNP	-	NULL	ENST00000515279.1	37	NULL	CCDS43257.1	4																																																																																			GSTCD	-	-		0.607	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	C	NM_024751		106630022	+1	no_errors	ENST00000515255	ensembl	human	known	70_37	rna	SNP	0.000	T
HMGB1	3146	genome.wustl.edu	37	13	31037714	31037714	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr13:31037714G>A	ENST00000405805.1	-	2	1044	c.104C>T	c.(103-105)tCa>tTa	p.S35L	HMGB1_ENST00000399489.1_Missense_Mutation_p.S35L|HMGB1_ENST00000326004.4_Missense_Mutation_p.S35L|HMGB1_ENST00000339872.4_Missense_Mutation_p.S35L|HMGB1_ENST00000399494.1_Missense_Mutation_p.S35L|HMGB1_ENST00000468384.1_5'UTR|HMGB1_ENST00000341423.5_Missense_Mutation_p.S35L			P09429	HMGB1_HUMAN	high mobility group box 1	35					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		GAAGTTGACTGAAGCATCTGG	0.418																																																	0													119.0	124.0	122.0					13																	31037714		2203	4297	6500	SO:0001583	missense	3146			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.104C>T	13.37:g.31037714G>A	ENSP00000384678:p.Ser35Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.S35L	ENST00000405805.1	37	c.104	CCDS9335.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.524202	0.96431	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399489;ENST00000399494;ENST00000426225;ENST00000326004;ENST00000398908	T;T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1;2.1	5.53	5.53	0.82687	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.153979	0.30419	N	0.009672	T	0.51787	0.1695	M	0.90870	3.155	0.80722	D	1	B;P;B	0.36616	0.108;0.561;0.138	B;P;B	0.50617	0.303;0.646;0.415	T	0.54689	-0.8256	10	0.44086	T	0.13	.	19.4593	0.94910	0.0:0.0:1.0:0.0	.	35;35;35	B7Z965;P09429;Q5T7C4	.;HMGB1_HUMAN;.	L	35	ENSP00000384678:S35L;ENSP00000343040:S35L;ENSP00000345347:S35L;ENSP00000382412:S35L;ENSP00000382417:S35L;ENSP00000369904:S35L;ENSP00000410465:S35L	ENSP00000369904:S35L	S	-	2	0	HMGB1	29935714	1.000000	0.71417	0.971000	0.41717	0.998000	0.95712	9.710000	0.98732	2.596000	0.87737	0.549000	0.68633	TCA	HMGB1	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily		0.418	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB1	HGNC	protein_coding	OTTHUMT00000303998.2	G	NM_002128		31037714	-1	no_errors	ENST00000339872	ensembl	human	known	70_37	missense	SNP	1.000	A
HOXB1	3211	genome.wustl.edu	37	17	46607954	46607954	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:46607954C>T	ENST00000239174.6	-	1	405	c.313G>A	c.(313-315)Gaa>Aaa	p.E105K	HOXB1_ENST00000577092.1_Missense_Mutation_p.E105K	NM_002144.3	NP_002135.2	P14653	HXB1_HUMAN	homeobox B1	105					anatomical structure formation involved in morphogenesis (GO:0048646)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|multicellular organismal development (GO:0007275)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)	p.E105*(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCGTCTCCTTCTGATTGACCC	0.662																																																	1	Substitution - Nonsense(1)	large_intestine(1)											64.0	66.0	65.0					17																	46607954		2203	4300	6503	SO:0001583	missense	3211				CCDS32675.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120094	ENSG00000120094		"""Homeoboxes / ANTP class : HOXL subclass"""	5111	protein-coding gene	gene with protein product		142968	"""homeo box B1"""	HOX2, HOX2I		1973146, 1358459	Standard	NM_002144		Approved		uc002ink.1	P14653	OTTHUMG00000159929	ENST00000239174.6:c.313G>A	17.37:g.46607954C>T	ENSP00000355140:p.Glu105Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VB03	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.E105K	ENST00000239174.6	37	c.313	CCDS32675.1	17	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064561	0.55432	.	.	ENSG00000120094	ENST00000239174	D	0.89343	-2.5	4.37	4.37	0.52481	.	0.152027	0.30791	N	0.008876	D	0.88507	0.6455	L	0.58810	1.83	0.50632	D	0.99988	P	0.52316	0.952	P	0.47075	0.536	D	0.86637	0.1889	10	0.21540	T	0.41	.	16.7235	0.85416	0.0:1.0:0.0:0.0	.	105	P14653	HXB1_HUMAN	K	105	ENSP00000355140:E105K	ENSP00000355140:E105K	E	-	1	0	HOXB1	43962953	1.000000	0.71417	0.926000	0.36857	0.701000	0.40568	6.968000	0.76086	2.266000	0.75297	0.643000	0.83706	GAA	HOXB1	-	NULL		0.662	HOXB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB1	HGNC	protein_coding	OTTHUMT00000358383.3	C			46607954	-1	no_errors	ENST00000239174	ensembl	human	known	70_37	missense	SNP	0.999	T
IFT52	51098	genome.wustl.edu	37	20	42223455	42223455	+	Missense_Mutation	SNP	G	G	C	rs202221752		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr20:42223455G>C	ENST00000373030.3	+	2	247	c.117G>C	c.(115-117)caG>caC	p.Q39H	IFT52_ENST00000373039.4_Missense_Mutation_p.Q39H	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	39					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGAAGATTCAGAGGTGACTGA	0.363																																																	0													105.0	104.0	104.0					20																	42223455		2203	4300	6503	SO:0001583	missense	51098			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.117G>C	20.37:g.42223455G>C	ENSP00000362121:p.Gln39His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	pfam_ABC_transp_unknown	p.Q39H	ENST00000373030.3	37	c.117	CCDS33470.1	20	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829321	0.50845	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.85	5.85	0.93711	ABC-type uncharacterised transport system (1);	0.054742	0.85682	D	0.000000	T	0.56834	0.2012	L	0.35854	1.095	0.58432	D	0.999999	B	0.14012	0.009	B	0.16722	0.016	T	0.48736	-0.9009	9	0.44086	T	0.13	-17.3325	19.3175	0.94220	0.0:0.0:1.0:0.0	.	39	Q9Y366	IFT52_HUMAN	H	39	.	ENSP00000362121:Q39H	Q	+	3	2	IFT52	41656869	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.284000	0.51708	2.941000	0.99782	0.655000	0.94253	CAG	IFT52	-	pfam_ABC_transp_unknown		0.363	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	G	NM_016004		42223455	+1	no_errors	ENST00000373030	ensembl	human	known	70_37	missense	SNP	1.000	C
IL18RAP	8807	genome.wustl.edu	37	2	103040318	103040318	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:103040318G>C	ENST00000264260.2	+	4	707	c.118G>C	c.(118-120)Gag>Cag	p.E40Q	IL18RAP_ENST00000409369.1_Intron	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	40					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						AAGGAGTGAAGAGGAATTTGT	0.378																																																	0													55.0	56.0	55.0					2																	103040318		2203	4300	6503	SO:0001583	missense	8807			AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.118G>C	2.37:g.103040318G>C	ENSP00000264260:p.Glu40Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1	p.E40Q	ENST00000264260.2	37	c.118	CCDS2061.1	2	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603770	0.28534	.	.	ENSG00000115607	ENST00000264260;ENST00000450855	T	0.03272	3.99	5.41	4.54	0.55810	.	0.088660	0.48767	D	0.000174	T	0.14141	0.0342	M	0.69823	2.125	0.41391	D	0.987616	D	0.67145	0.996	D	0.66497	0.944	T	0.00331	-1.1811	10	0.87932	D	0	.	10.5921	0.45316	0.0896:0.0:0.9104:0.0	.	40	O95256	I18RA_HUMAN	Q	40	ENSP00000264260:E40Q	ENSP00000264260:E40Q	E	+	1	0	IL18RAP	102406750	0.883000	0.30277	0.023000	0.16930	0.010000	0.07245	1.985000	0.40668	1.412000	0.46977	0.563000	0.77884	GAG	IL18RAP	-	NULL		0.378	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18RAP	HGNC	protein_coding	OTTHUMT00000253291.2	G	NM_003853		103040318	+1	no_errors	ENST00000264260	ensembl	human	known	70_37	missense	SNP	0.107	C
INHBA	3624	genome.wustl.edu	37	7	41730110	41730110	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:41730110A>G	ENST00000242208.4	-	3	665	c.419T>C	c.(418-420)aTt>aCt	p.I140T	INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.I140T	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	140					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TTCCTTGGAAATCTCGAAGTG	0.493										TSP Lung(11;0.080)																																							0													52.0	48.0	49.0					7																	41730110		2203	4300	6503	SO:0001583	missense	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.419T>C	7.37:g.41730110A>G	ENSP00000242208:p.Ile140Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14599	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.I140T	ENST00000242208.4	37	c.419	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	22.0	4.227577	0.79576	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.66815	-0.23;-0.23	6.06	4.9	0.64082	Transforming growth factor-beta, N-terminal (1);	0.105460	0.64402	D	0.000005	T	0.76463	0.3991	M	0.68317	2.08	0.58432	D	0.999996	D	0.61697	0.99	P	0.60236	0.871	T	0.76699	-0.2863	10	0.48119	T	0.1	-10.4421	12.7326	0.57206	0.8767:0.0:0.0:0.1233	.	140	P08476	INHBA_HUMAN	T	140	ENSP00000242208:I140T;ENSP00000397197:I140T	ENSP00000242208:I140T	I	-	2	0	INHBA	41696635	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.226000	0.95229	1.095000	0.41419	0.533000	0.62120	ATT	INHBA	-	pfam_TGF-b_N		0.493	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	A			41730110	-1	no_errors	ENST00000242208	ensembl	human	known	70_37	missense	SNP	1.000	G
INTS4L1	285905	genome.wustl.edu	37	7	64646871	64646871	+	RNA	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:64646871C>T	ENST00000587624.1	+	0	1121							Q96LV5	IN4L1_HUMAN	integrator complex subunit 4-like 1																		TCTTTCTCATCTTGTTCCTGC	0.428																																																	0																																												285905					7q11.21	2013-03-26			ENSG00000164669	ENSG00000164669			21925	other	unknown							Standard	XR_426205		Approved	FLJ25037		Q96LV5	OTTHUMG00000156510		7.37:g.64646871C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000587624.1	37	NULL		7																																																																																			INTS4L1	-	-		0.428	INTS4L1-002	KNOWN	non_canonical_conserved|basic	processed_transcript	INTS4L1	HGNC	pseudogene	OTTHUMT00000460821.1	C	XR_041315		64646871	+1	no_errors	ENST00000587624	ensembl	human	known	70_37	rna	SNP	1.000	T
ITM2A	9452	genome.wustl.edu	37	X	78616654	78616654	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:78616654C>G	ENST00000373298.2	-	6	867	c.724G>C	c.(724-726)Gat>Cat	p.D242H	ITM2A_ENST00000469541.1_5'UTR|ITM2A_ENST00000434584.2_Missense_Mutation_p.D198H	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	242						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						CAGCATTTATCAATGGCACGT	0.368																																																	0													61.0	49.0	53.0					X																	78616654		2203	4299	6502	SO:0001583	missense	9452			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.724G>C	X.37:g.78616654C>G	ENSP00000362395:p.Asp242His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7X5|B4E062|Q6IBC9	Missense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.D242H	ENST00000373298.2	37	c.724	CCDS14444.1	X	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731543	0.48939	.	.	ENSG00000078596	ENST00000373298;ENST00000434584	T;T	0.17854	2.25;2.25	4.5	4.5	0.54988	.	0.132125	0.49305	D	0.000156	T	0.17238	0.0414	N	0.19112	0.55	0.37755	D	0.92611	B;D	0.56035	0.167;0.974	B;P	0.50231	0.042;0.635	T	0.07731	-1.0757	10	0.46703	T	0.11	-10.8221	13.1059	0.59247	0.0:1.0:0.0:0.0	.	198;242	B4E062;O43736	.;ITM2A_HUMAN	H	242;198	ENSP00000362395:D242H;ENSP00000415533:D198H	ENSP00000362395:D242H	D	-	1	0	ITM2A	78503310	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.158000	0.42329	1.817000	0.53016	0.513000	0.50165	GAT	ITM2A	-	NULL		0.368	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2A	HGNC	protein_coding	OTTHUMT00000057329.1	C	NM_004867		78616654	-1	no_errors	ENST00000373298	ensembl	human	known	70_37	missense	SNP	0.993	G
JUN	3725	genome.wustl.edu	37	1	59248525	59248525	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:59248525G>A	ENST00000371222.2	-	1	1260	c.218C>T	c.(217-219)tCg>tTg	p.S73L	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	73					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	CAGCTCGGGCGACGCCAGCTT	0.662			A		sarcoma																																			Dom	yes		1	1p32-p31	3725	jun oncogene		M	0													71.0	81.0	78.0					1																	59248525		2203	4299	6502	SO:0001583	missense	3725			AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.218C>T	1.37:g.59248525G>A	ENSP00000360266:p.Ser73Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FHM7|Q96G93	Missense_Mutation	SNP	pfam_JNK,pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.S73L	ENST00000371222.2	37	c.218	CCDS610.1	1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865256	0.91511	.	.	ENSG00000177606	ENST00000371222	T	0.45276	0.9	4.39	4.39	0.52855	Jun-like transcription factor (1);	0.000000	0.64402	U	0.000001	T	0.70395	0.3219	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78489	-0.2184	10	0.87932	D	0	-8.9291	17.1679	0.86821	0.0:0.0:1.0:0.0	.	73	P05412	JUN_HUMAN	L	73	ENSP00000360266:S73L	ENSP00000360266:S73L	S	-	2	0	JUN	59021113	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.204000	0.95041	2.255000	0.74692	0.561000	0.74099	TCG	JUN	-	pfam_JNK		0.662	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	HGNC	protein_coding	OTTHUMT00000023042.1	G	NM_002228		59248525	-1	no_errors	ENST00000371222	ensembl	human	known	70_37	missense	SNP	1.000	A
KCNA5	3741	genome.wustl.edu	37	12	5155077	5155077	+	Silent	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:5155077C>G	ENST00000252321.3	+	1	1993	c.1764C>G	c.(1762-1764)gtC>gtG	p.V588V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	588					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGTGTAACGTCAAGGCCAAGA	0.592																																																	0													39.0	40.0	40.0					12																	5155077		2203	4300	6503	SO:0001819	synonymous_variant	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1764C>G	12.37:g.5155077C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V588	ENST00000252321.3	37	c.1764	CCDS8536.1	12																																																																																			KCNA5	-	prints_K_chnl_volt-dep_Kv1.5		0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	C	NM_002234		5155077	+1	no_errors	ENST00000252321	ensembl	human	known	70_37	silent	SNP	1.000	G
KDM6A	7403	genome.wustl.edu	37	X	44938390	44938390	+	Splice_Site	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:44938390G>A	ENST00000377967.4	+	20	2979		c.e20-1		KDM6A_ENST00000543216.1_Splice_Site|KDM6A_ENST00000536777.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A						canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						TATTCATGAAGACCTGGGACT	0.328			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)											53.0	46.0	48.0					X																	44938390		2203	4300	6503	SO:0001630	splice_region_variant	7403			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.2939-1G>A	X.37:g.44938390G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LL9|Q5JVQ7	Splice_Site	SNP	-	e20-1	ENST00000377967.4	37	c.2960-1	CCDS14265.1	X	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246241	0.80024	.	.	ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000414389;ENST00000433797	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4214	0.90591	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM6A	44823334	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.476000	0.97823	2.290000	0.77057	0.594000	0.82650	.	KDM6A	-	-		0.328	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	G	NM_021140	Intron	44938390	+1	no_errors	ENST00000382899	ensembl	human	known	70_37	splice_site	SNP	1.000	A
KHDRBS3	10656	genome.wustl.edu	37	8	136659337	136659337	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:136659337C>T	ENST00000355849.5	+	0	1461				KHDRBS3_ENST00000520981.1_3'UTR	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3						regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			ATTGTACTGTCTGATGTTGTG	0.403																																																	0													115.0	105.0	108.0					8																	136659337		2203	4300	6503	SO:0001624	3_prime_UTR_variant	10656			AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.*10C>T	8.37:g.136659337C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NUL8|Q9UPA8	RNA	SNP	-	NULL	ENST00000355849.5	37	NULL	CCDS6374.1	8																																																																																			KHDRBS3	-	-		0.403	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS3	HGNC	protein_coding	OTTHUMT00000377529.1	C			136659337	+1	no_errors	ENST00000522433	ensembl	human	known	70_37	rna	SNP	1.000	T
CEMIP	57214	genome.wustl.edu	37	15	81221397	81221397	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:81221397G>A	ENST00000394685.3	+	21	2913	c.2494G>A	c.(2494-2496)Gag>Aag	p.E832K	KIAA1199_ENST00000356249.5_Missense_Mutation_p.E832K|KIAA1199_ENST00000220244.3_Missense_Mutation_p.E832K|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		832					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTCCAAGCAAGAGATAAAGAA	0.527																																																	0													139.0	130.0	133.0					15																	81221397		2203	4300	6503	SO:0001583	missense	57214																														ENST00000394685.3:c.2494G>A	15.37:g.81221397G>A	ENSP00000378177:p.Glu832Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.E832K	ENST00000394685.3	37	c.2494	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656202	0.67586	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.59224	0.28;0.28;0.28	4.87	4.87	0.63330	Pectin lyase fold/virulence factor (1);	0.132075	0.49916	D	0.000132	T	0.46737	0.1408	L	0.42686	1.345	0.41357	D	0.987402	P	0.42456	0.78	B	0.38106	0.265	T	0.40021	-0.9585	10	0.15499	T	0.54	-46.2994	13.8987	0.63790	0.0:0.1522:0.8478:0.0	.	832	Q8WUJ3	K1199_HUMAN	K	832	ENSP00000220244:E832K;ENSP00000378177:E832K;ENSP00000348583:E832K	ENSP00000220244:E832K	E	+	1	0	KIAA1199	79008452	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.572000	0.60886	2.518000	0.84900	0.655000	0.94253	GAG	KIAA1199	-	superfamily_Pectin_lyase_fold/virulence		0.527	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	G			81221397	+1	no_errors	ENST00000220244	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA1522	57648	genome.wustl.edu	37	1	33234342	33234342	+	Silent	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:33234342G>T	ENST00000373480.1	+	4	478	c.375G>T	c.(373-375)gcG>gcT	p.A125A	KIAA1522_ENST00000401073.2_Silent_p.A184A|KIAA1522_ENST00000373481.3_Silent_p.A136A|KIAA1522_ENST00000294521.3_Silent_p.A125A	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	125										breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CAGAGGACGCGCTCTCCATCC	0.582																																																	0													40.0	41.0	41.0					1																	33234342		2020	4201	6221	SO:0001819	synonymous_variant	57648			AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.375G>T	1.37:g.33234342G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Silent	SNP	NULL	p.A184	ENST00000373480.1	37	c.552	CCDS55588.1	1																																																																																			KIAA1522	-	NULL		0.582	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1522	HGNC	protein_coding	OTTHUMT00000022130.1	G			33234342	+1	no_errors	ENST00000401073	ensembl	human	known	70_37	silent	SNP	0.345	T
KIAA1683	80726	genome.wustl.edu	37	19	18380286	18380286	+	Start_Codon_SNP	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:18380286C>T	ENST00000600328.3	-	2	196	c.3G>A	c.(1-3)atG>atA	p.M1I	KIAA1683_ENST00000392413.4_Start_Codon_SNP_p.M1I|KIAA1683_ENST00000600359.3_5'UTR			Q9H0B3	K1683_HUMAN	KIAA1683	1						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTTGAAGGGTCATAGATTTGG	0.517																																																	0													119.0	95.0	103.0					19																	18380286		2203	4300	6503	SO:0001582	initiator_codon_variant	80726			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3G>A	19.37:g.18380286C>T	ENSP00000470780:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.M1I	ENST00000600328.3	37	c.3	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172819	0.38413	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000411671	T;T	0.03242	4.0;4.02	2.77	2.77	0.32553	.	.	.	.	.	T	0.04588	0.0125	.	.	.	0.80722	D	1	P;P	0.47034	0.889;0.889	B;B	0.41036	0.346;0.346	T	0.43475	-0.9389	8	0.87932	D	0	.	9.2775	0.37709	0.0:1.0:0.0:0.0	.	1;1	E9PDE0;Q9H0B3	.;K1683_HUMAN	I	1	ENSP00000376213:M1I;ENSP00000352774:M1I	ENSP00000352774:M1I	M	-	3	0	KIAA1683	18241286	0.744000	0.28250	1.000000	0.80357	0.948000	0.59901	0.407000	0.21049	1.878000	0.54408	0.456000	0.33151	ATG	KIAA1683	-	NULL		0.517	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3	C		Missense_Mutation	18380286	-1	no_errors	ENST00000392413	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA1958	158405	genome.wustl.edu	37	9	115421911	115421911	+	Silent	SNP	G	G	A	rs150043037		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:115421911G>A	ENST00000337530.6	+	4	2009	c.1713G>A	c.(1711-1713)acG>acA	p.T571T	KIAA1958_ENST00000536272.1_Silent_p.T599T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	571										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						ACATGCGGACGCTGCAGGAGC	0.577																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	83.0	79.0	80.0		1713	-11.3	0.4	9	dbSNP_134	80	0,8600		0,0,4300	no	coding-synonymous	KIAA1958	NM_133465.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		571/717	115421911	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	158405			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1713G>A	9.37:g.115421911G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.T599	ENST00000337530.6	37	c.1797	CCDS35108.1	9																																																																																			KIAA1958	-	pfam_DUF3504		0.577	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1	G	NM_133465		115421911	+1	no_errors	ENST00000536272	ensembl	human	known	70_37	silent	SNP	0.408	A
KIF21A	55605	genome.wustl.edu	37	12	39716488	39716488	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:39716488G>T	ENST00000361418.5	-	27	3668	c.3653C>A	c.(3652-3654)cCt>cAt	p.P1218H	KIF21A_ENST00000395670.3_Missense_Mutation_p.P1218H|KIF21A_ENST00000361961.3_Missense_Mutation_p.P1205H|KIF21A_ENST00000544797.2_Missense_Mutation_p.P1198H|KIF21A_ENST00000541463.2_Missense_Mutation_p.P1182H|KIF21A_ENST00000547745.1_5'Flank			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1218					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TATCTTAGAAGGTAAGCCAGG	0.413																																																	0													118.0	109.0	112.0					12																	39716488		2203	4300	6503	SO:0001583	missense	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.3653C>A	12.37:g.39716488G>T	ENSP00000354878:p.Pro1218His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.P1218H	ENST00000361418.5	37	c.3653	CCDS53776.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.334769|4.334769	0.81801|0.81801	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000552961|ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463	.|T;T;T;T;T;T	.|0.70282	.|-0.47;-0.42;0.34;-0.44;-0.36;-0.42	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.000000	.|0.53938	.|D	.|0.000057	D|D	0.83622|0.83622	0.5294|0.5294	M|M	0.72894|0.72894	2.215|2.215	0.53005|0.53005	D|D	0.99996|0.99996	.|D;P;B;D;B;B	.|0.89917	.|0.996;0.785;0.382;1.0;0.166;0.016	.|P;P;B;D;B;B	.|0.87578	.|0.855;0.639;0.091;0.998;0.158;0.022	D|D	0.83964|0.83964	0.0323|0.0323	5|10	.|0.46703	.|T	.|0.11	.|.	18.5275|18.5275	0.90978|0.90978	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1198;1182;1218;1205;1218;265	.|F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8	.|.;.;KI21A_HUMAN;.;.;.	I|H	566|1205;1218;1218;265;259;1198;1218;1182	.|ENSP00000354851:P1205H;ENSP00000379029:P1218H;ENSP00000448792:P259H;ENSP00000445606:P1198H;ENSP00000354878:P1218H;ENSP00000438075:P1182H	.|ENSP00000344501:P1218H	L|P	-|-	1|2	0|0	KIF21A|KIF21A	38002755|38002755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.172000|9.172000	0.94808|0.94808	2.358000|2.358000	0.79984|0.79984	0.655000|0.655000	0.94253|0.94253	CTT|CCT	KIF21A	-	NULL		0.413	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	G	NM_017641		39716488	-1	no_errors	ENST00000395670	ensembl	human	known	70_37	missense	SNP	1.000	T
KIF26A	26153	genome.wustl.edu	37	14	104641823	104641823	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr14:104641823C>G	ENST00000423312.2	+	12	2698	c.2698C>G	c.(2698-2700)Cga>Gga	p.R900G	KIF26A_ENST00000315264.7_Missense_Mutation_p.R761G	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	900					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CAGCACCCCTCGAGGCAGTTC	0.692																																																	0													10.0	14.0	13.0					14																	104641823		1967	4114	6081	SO:0001583	missense	26153			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2698C>G	14.37:g.104641823C>G	ENSP00000388241:p.Arg900Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R900G	ENST00000423312.2	37	c.2698	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750978	0.31046	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.79454	-1.26;-1.27	3.97	3.05	0.35203	.	.	.	.	.	T	0.64000	0.2559	L	0.34521	1.04	0.09310	N	1	B	0.34372	0.451	B	0.31337	0.128	T	0.51004	-0.8760	9	0.22706	T	0.39	.	9.5496	0.39301	0.0:0.8987:0.0:0.1013	.	900	Q9ULI4	KI26A_HUMAN	G	900;761	ENSP00000388241:R900G;ENSP00000325452:R761G	ENSP00000325452:R761G	R	+	1	2	KIF26A	103711576	0.000000	0.05858	0.025000	0.17156	0.147000	0.21601	-0.096000	0.11059	1.925000	0.55765	0.462000	0.41574	CGA	KIF26A	-	NULL		0.692	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	C			104641823	+1	no_errors	ENST00000423312	ensembl	human	known	70_37	missense	SNP	0.062	G
TICRR	90381	genome.wustl.edu	37	15	90152031	90152031	+	Intron	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:90152031C>T	ENST00000268138.7	+	15	2827				TICRR_ENST00000560985.1_Intron|KIF7_ENST00000558928.1_5'UTR			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator						cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										TTGATGCTTTCAGAAGTGACC	0.378																																																	0													56.0	54.0	55.0					15																	90152031		1800	4080	5880	SO:0001627	intron_variant	374654			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2723-3C>T	15.37:g.90152031C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	RNA	SNP	-	NULL	ENST00000268138.7	37	NULL	CCDS10352.2	15																																																																																			KIF7	-	-		0.378	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000312856.1	C	NM_152259		90152031	-1	no_errors	ENST00000558928	ensembl	human	known	70_37	rna	SNP	1.000	T
KNTC1	9735	genome.wustl.edu	37	12	123019305	123019305	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:123019305G>C	ENST00000333479.7	+	3	401	c.224G>C	c.(223-225)aGa>aCa	p.R75T	KNTC1_ENST00000450485.2_Missense_Mutation_p.R75T	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	75					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGTATTTGTAGATCACTTCAA	0.373																																																	0													148.0	134.0	138.0					12																	123019305		1885	4111	5996	SO:0001583	missense	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.224G>C	12.37:g.123019305G>C	ENSP00000328236:p.Arg75Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.R75T	ENST00000333479.7	37	c.224	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916346	0.33815	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.36878	1.23;1.23	5.76	3.93	0.45458	.	0.121663	0.56097	D	0.000024	T	0.17450	0.0419	N	0.14661	0.345	0.80722	D	1	B;B	0.32245	0.361;0.201	B;B	0.26969	0.075;0.037	T	0.06391	-1.0829	10	0.38643	T	0.18	-15.6049	5.6871	0.17809	0.3594:0.0:0.6406:0.0	.	75;75	E7ES84;P50748	.;KNTC1_HUMAN	T	75	ENSP00000397992:R75T;ENSP00000328236:R75T	ENSP00000328236:R75T	R	+	2	0	KNTC1	121585258	0.989000	0.36119	0.997000	0.53966	0.994000	0.84299	1.714000	0.37961	1.438000	0.47492	0.655000	0.94253	AGA	KNTC1	-	superfamily_WD40_repeat_dom		0.373	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	G			123019305	+1	no_errors	ENST00000333479	ensembl	human	known	70_37	missense	SNP	1.000	C
KNTC1	9735	genome.wustl.edu	37	12	123089427	123089427	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:123089427G>A	ENST00000333479.7	+	50	5356	c.5179G>A	c.(5179-5181)Gaa>Aaa	p.E1727K	KNTC1_ENST00000537348.1_Missense_Mutation_p.E152K|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1727					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTAAAAGGACGAAAAACGTGA	0.448																																																	0													26.0	24.0	24.0					12																	123089427		1847	4109	5956	SO:0001583	missense	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.5179G>A	12.37:g.123089427G>A	ENSP00000328236:p.Glu1727Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.E1727K	ENST00000333479.7	37	c.5179	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624557	0.87560	.	.	ENSG00000184445	ENST00000333479;ENST00000537348	T;T	0.31247	1.5;1.5	5.71	5.71	0.89125	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.324624	0.37178	N	0.002219	T	0.48642	0.1511	L	0.57536	1.79	0.49213	D	0.99976	D	0.60575	0.988	P	0.56163	0.793	T	0.35151	-0.9800	10	0.48119	T	0.1	-12.7588	19.8633	0.96793	0.0:0.0:1.0:0.0	.	1727	P50748	KNTC1_HUMAN	K	1727;152	ENSP00000328236:E1727K;ENSP00000443622:E152K	ENSP00000328236:E1727K	E	+	1	0	KNTC1	121655380	1.000000	0.71417	0.918000	0.36340	0.827000	0.46813	4.104000	0.57790	2.697000	0.92050	0.591000	0.81541	GAA	KNTC1	-	pfam_RZZ-complex_KNTC1/ROD_C		0.448	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	G			123089427	+1	no_errors	ENST00000333479	ensembl	human	known	70_37	missense	SNP	1.000	A
L1CAM	3897	genome.wustl.edu	37	X	153136342	153136342	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:153136342G>A	ENST00000370060.1	-	7	786	c.597C>T	c.(595-597)ctC>ctT	p.L199L	L1CAM_ENST00000370057.3_Silent_p.L199L|L1CAM_ENST00000361981.3_Silent_p.L194L|L1CAM_ENST00000370055.1_Silent_p.L194L|L1CAM_ENST00000538883.1_Silent_p.L201L|L1CAM_ENST00000361699.4_Silent_p.L199L|L1CAM_ENST00000543994.1_Silent_p.L201L	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	199	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTCGGAGGTGAGCACATTGG	0.582																																																	0													291.0	192.0	225.0					X																	153136342		2203	4300	6503	SO:0001819	synonymous_variant	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.597C>T	X.37:g.153136342G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L201	ENST00000370060.1	37	c.603	CCDS14733.1	X																																																																																			L1CAM	-	smart_Ig_sub,pfscan_Ig-like		0.582	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	G	NM_024003		153136342	-1	no_errors	ENST00000543994	ensembl	human	known	70_37	silent	SNP	0.003	A
LAMA2	3908	genome.wustl.edu	37	6	129636636	129636636	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:129636636G>T	ENST00000421865.2	+	25	3620	c.3571G>T	c.(3571-3573)Gag>Tag	p.E1191*		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1191	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCTGAAGGCTGAGCAGACCAT	0.463																																																	0													94.0	90.0	91.0					6																	129636636		2203	4300	6503	SO:0001587	stop_gained	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.3571G>T	6.37:g.129636636G>T	ENSP00000400365:p.Glu1191*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14736|Q5VUM2|Q93022	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E1191*	ENST00000421865.2	37	c.3571	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	42	9.739430	0.99252	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	.	.	.	5.87	2.06	0.26882	.	0.314304	0.33631	N	0.004717	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	8.9079	0.35535	0.1226:0.2301:0.6473:0.0	.	.	.	.	X	1191	.	ENSP00000346769:E1191X	E	+	1	0	LAMA2	129678329	1.000000	0.71417	0.185000	0.23176	0.961000	0.63080	4.547000	0.60712	0.162000	0.19483	0.655000	0.94253	GAG	LAMA2	-	pfscan_Laminin_B_type_IV		0.463	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	G			129636636	+1	no_errors	ENST00000421865	ensembl	human	known	70_37	nonsense	SNP	0.978	T
LAMA3	3909	genome.wustl.edu	37	18	21390425	21390425	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:21390425G>C	ENST00000313654.9	+	13	1940	c.1699G>C	c.(1699-1701)Gac>Cac	p.D567H	LAMA3_ENST00000399516.3_Missense_Mutation_p.D567H	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	567	Domain V.|Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ACAGCGGTGTGACAGGTGTCT	0.557																																																	0													102.0	112.0	109.0					18																	21390425		2034	4204	6238	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1699G>C	18.37:g.21390425G>C	ENSP00000324532:p.Asp567His	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.D567H	ENST00000313654.9	37	c.1699	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630898	0.87660	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.66995	-0.24;-0.24	5.02	5.02	0.67125	EGF-like, laminin (4);	.	.	.	.	D	0.86276	0.5894	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89531	0.3785	9	0.87932	D	0	.	18.1237	0.89579	0.0:0.0:1.0:0.0	.	567;567	Q6VU67;Q16787	.;LAMA3_HUMAN	H	567;567;565	ENSP00000324532:D567H;ENSP00000382432:D567H	ENSP00000324532:D567H	D	+	1	0	LAMA3	19644423	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.746000	0.91604	2.634000	0.89283	0.561000	0.74099	GAC	LAMA3	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin		0.557	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129		21390425	+1	no_errors	ENST00000313654	ensembl	human	known	70_37	missense	SNP	1.000	C
LARP6	55323	genome.wustl.edu	37	15	71128664	71128664	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:71128664C>T	ENST00000299213.8	-	2	451	c.381G>A	c.(379-381)gtG>gtA	p.V127V		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	127	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GCTTAACGCTCACATATCCCA	0.413																																																	0													116.0	113.0	114.0					15																	71128664		2199	4297	6496	SO:0001819	synonymous_variant	55323			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.381G>A	15.37:g.71128664C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La	p.V127	ENST00000299213.8	37	c.381	CCDS32281.1	15																																																																																			LARP6	-	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La		0.413	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	C	NM_018357		71128664	-1	no_errors	ENST00000299213	ensembl	human	known	70_37	silent	SNP	1.000	T
LARP6	55323	genome.wustl.edu	37	15	71128729	71128729	+	Missense_Mutation	SNP	C	C	G	rs140759060	byFrequency	TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:71128729C>G	ENST00000299213.8	-	2	386	c.316G>C	c.(316-318)Gat>Cat	p.D106H		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	106	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						AGGTTTTCATCAGAAAAGTAG	0.488																																																	0													122.0	122.0	122.0					15																	71128729		2199	4297	6496	SO:0001583	missense	55323			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.316G>C	15.37:g.71128729C>G	ENSP00000299213:p.Asp106His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La	p.D106H	ENST00000299213.8	37	c.316	CCDS32281.1	15	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642184	0.87859	.	.	ENSG00000166173	ENST00000299213	T	0.54479	0.57	5.58	5.58	0.84498	Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	0.000000	0.85682	D	0.000000	D	0.83220	0.5207	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89307	0.3630	10	0.87932	D	0	-27.6892	17.0704	0.86572	0.0:1.0:0.0:0.0	.	106	Q9BRS8	LARP6_HUMAN	H	106	ENSP00000299213:D106H	ENSP00000299213:D106H	D	-	1	0	LARP6	68915783	1.000000	0.71417	0.580000	0.28601	0.922000	0.55478	5.622000	0.67750	2.627000	0.88993	0.655000	0.94253	GAT	LARP6	-	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La		0.488	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	C	NM_018357		71128729	-1	no_errors	ENST00000299213	ensembl	human	known	70_37	missense	SNP	0.999	G
LARP6	55323	genome.wustl.edu	37	15	71128822	71128822	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:71128822C>T	ENST00000299213.8	-	2	293	c.223G>A	c.(223-225)Gag>Aag	p.E75K		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	75					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CGCTCGTTCTCACCTCCACTT	0.507																																																	0													73.0	75.0	74.0					15																	71128822		2199	4297	6496	SO:0001583	missense	55323			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.223G>A	15.37:g.71128822C>T	ENSP00000299213:p.Glu75Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La	p.E75K	ENST00000299213.8	37	c.223	CCDS32281.1	15	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764431	0.69878	.	.	ENSG00000166173	ENST00000299213	T	0.48836	0.8	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	P	0.60415	0.874	T	0.39603	-0.9606	10	0.20046	T	0.44	-33.4779	17.0704	0.86572	0.0:1.0:0.0:0.0	.	75	Q9BRS8	LARP6_HUMAN	K	75	ENSP00000299213:E75K	ENSP00000299213:E75K	E	-	1	0	LARP6	68915876	1.000000	0.71417	0.924000	0.36721	0.401000	0.30781	6.867000	0.75511	2.627000	0.88993	0.655000	0.94253	GAG	LARP6	-	NULL		0.507	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	C	NM_018357		71128822	-1	no_errors	ENST00000299213	ensembl	human	known	70_37	missense	SNP	0.999	T
LILRA3	11026	genome.wustl.edu	37	19	54803724	54803724	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:54803724C>T	ENST00000251390.3	-	3	191	c.100G>A	c.(100-102)Gag>Aag	p.E34K	LILRA3_ENST00000391744.3_Missense_Mutation_p.E34K|LILRA3_ENST00000391745.1_Missense_Mutation_p.E51K	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	34	Ig-like C2-type 1.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGCCTGGCTCAGCCCAGAGG	0.552																																																	0													57.0	55.0	56.0					19																	54803724		2195	4180	6375	SO:0001583	missense	11026			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.100G>A	19.37:g.54803724C>T	ENSP00000251390:p.Glu34Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.E34K	ENST00000251390.3	37	c.100	CCDS12887.1	19	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224326	0.58668	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.14022	2.54;2.54;2.54	2.39	2.39	0.29439	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.119717	0.37530	N	0.002058	T	0.29389	0.0732	M	0.82193	2.58	0.09310	N	1	P;P	0.42556	0.783;0.671	P;P	0.53102	0.718;0.495	T	0.03534	-1.1027	10	0.87932	D	0	.	8.3255	0.32153	0.0:1.0:0.0:0.0	.	34;34	E7EU74;Q8N6C8	.;LIRA3_HUMAN	K	34;34;51	ENSP00000251390:E34K;ENSP00000375624:E34K;ENSP00000375625:E51K	ENSP00000251390:E34K	E	-	1	0	LILRA3	59495536	0.175000	0.23083	0.329000	0.25429	0.323000	0.28346	0.315000	0.19451	1.375000	0.46248	0.485000	0.47835	GAG	LILRA3	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like		0.552	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA3	HGNC	protein_coding	OTTHUMT00000140236.1	C			54803724	-1	no_errors	ENST00000251390	ensembl	human	known	70_37	missense	SNP	0.288	T
AP001372.2	0	genome.wustl.edu	37	11	74208839	74208839	+	lincRNA	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:74208839G>A	ENST00000526036.1	+	0	1754																											taatgataatgaagatgatgt	0.348																																																	0													84.0	76.0	78.0					11																	74208839		692	1589	2281			100287896																															11.37:g.74208839G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526036.1	37	NULL		11																																																																																			AP001372.2	-	-		0.348	AP001372.2-001	KNOWN	basic	lincRNA	LOC100287896	Clone_based_vega_gene	lincRNA	OTTHUMT00000317865.2	G			74208839	+1	no_errors	ENST00000526036	ensembl	human	known	70_37	rna	SNP	0.424	A
LINC00969	440993	genome.wustl.edu	37	3	195398061	195398061	+	lincRNA	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:195398061C>T	ENST00000445430.1	+	0	978									long intergenic non-protein coding RNA 969																		GAGGCATTCTCATTAACAGTC	0.498																																																	0																																												440993			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195398061C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			AC069513.3	-	-		0.498	LINC00969-038	KNOWN	basic	lincRNA	LOC440993	Clone_based_vega_gene	lincRNA	OTTHUMT00000341951.1	C			195398061	+1	no_errors	ENST00000414625	ensembl	human	known	70_37	rna	SNP	1.000	T
NPIPB11	728888	genome.wustl.edu	37	16	29393632	29393632	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:29393632G>C	ENST00000524087.1	-	8	2695	c.2621C>G	c.(2620-2622)tCa>tGa	p.S874*	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	874	Pro-rich.					integral component of membrane (GO:0016021)											CAGGTGTCTTGATATTATCAT	0.577																																																	0																																										SO:0001587	stop_gained	728888					16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.2621C>G	16.37:g.29393632G>C	ENSP00000430853:p.Ser874*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_NPIP	p.S874*	ENST00000524087.1	37	c.2621		16	.	.	.	.	.	.	.	.	.	.	g	20.2	3.943123	0.73672	.	.	ENSG00000254206	ENST00000524087	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.49483	D	0.999795	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	.	.	.	.	.	.	.	X	874	.	ENSP00000430853:S874X	S	-	2	0	RP11-231C14.2	29301133	.	.	.	.	.	.	.	.	.	.	.	.	TCA	61E3.4	-	NULL		0.577	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	LOC728888	Uniprot_genename	protein_coding	OTTHUMT00000374094.1	G	XM_002343430		29393632	-1	no_errors	ENST00000524087	ensembl	human	putative	70_37	nonsense	SNP	0.000	C
LRRIQ1	84125	genome.wustl.edu	37	12	85547849	85547849	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:85547849C>T	ENST00000393217.2	+	23	4758	c.4697C>T	c.(4696-4698)tCg>tTg	p.S1566L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1566										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAAATGAAATCGAAGAAACTA	0.269																																																	0													29.0	28.0	28.0					12																	85547849		1779	4038	5817	SO:0001583	missense	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4697C>T	12.37:g.85547849C>T	ENSP00000376910:p.Ser1566Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.S1566L	ENST00000393217.2	37	c.4697	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984820	0.53934	.	.	ENSG00000133640	ENST00000393217	T	0.59364	0.27	5.36	4.47	0.54385	.	.	.	.	.	T	0.40956	0.1138	N	0.19112	0.55	0.27346	N	0.956368	P	0.51240	0.943	B	0.35727	0.209	T	0.33214	-0.9877	9	0.72032	D	0.01	.	14.5435	0.68013	0.0:0.929:0.0:0.071	.	1566	Q96JM4	LRIQ1_HUMAN	L	1566	ENSP00000376910:S1566L	ENSP00000376910:S1566L	S	+	2	0	LRRIQ1	84071980	0.997000	0.39634	0.998000	0.56505	0.917000	0.54804	3.182000	0.50910	1.373000	0.46208	0.650000	0.86243	TCG	LRRIQ1	-	NULL		0.269	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	C	NM_032165		85547849	+1	no_errors	ENST00000393217	ensembl	human	known	70_37	missense	SNP	0.991	T
MASP1	5648	genome.wustl.edu	37	3	186940918	186940918	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:186940918C>T	ENST00000337774.5	-	14	2195	c.1806G>A	c.(1804-1806)atG>atA	p.M602I		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	602	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ACTTCACCTCCATCAGGGTCT	0.522																																																	0													105.0	94.0	98.0					3																	186940918		2203	4300	6503	SO:0001583	missense	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1806G>A	3.37:g.186940918C>T	ENSP00000336792:p.Met602Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.M602I	ENST00000337774.5	37	c.1806	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284339	0.80803	.	.	ENSG00000127241	ENST00000337774	D	0.92805	-3.11	5.47	5.47	0.80525	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92433	0.7598	M	0.66560	2.04	0.80722	D	1	P	0.40909	0.732	P	0.44811	0.461	D	0.92872	0.6315	9	0.66056	D	0.02	.	15.1887	0.73025	0.0:1.0:0.0:0.0	.	602	P48740	MASP1_HUMAN	I	602	ENSP00000336792:M602I	ENSP00000336792:M602I	M	-	3	0	MASP1	188423612	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.030000	0.64128	2.727000	0.93392	0.655000	0.94253	ATG	MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.522	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	C	NM_001879		186940918	-1	no_errors	ENST00000337774	ensembl	human	known	70_37	missense	SNP	1.000	T
MAST3	23031	genome.wustl.edu	37	19	18248147	18248147	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:18248147G>A	ENST00000262811.6	+	18	1984	c.1984G>A	c.(1984-1986)Gag>Aag	p.E662K		NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	662	AGC-kinase C-terminal.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GCTCGAAGCTGAGGATGATAC	0.632																																																	0													77.0	81.0	79.0					19																	18248147		1971	4144	6115	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.1984G>A	19.37:g.18248147G>A	ENSP00000262811:p.Glu662Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E662K	ENST00000262811.6	37	c.1984	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115376	0.77323	.	.	ENSG00000099308	ENST00000262811	T	0.24723	1.84	4.17	4.17	0.49024	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.33644	0.0870	M	0.83774	2.66	0.80722	D	1	B	0.31893	0.345	B	0.25987	0.065	T	0.44221	-0.9342	10	0.87932	D	0	-25.899	15.4848	0.75557	0.0:0.0:1.0:0.0	.	662	O60307	MAST3_HUMAN	K	662	ENSP00000262811:E662K	ENSP00000262811:E662K	E	+	1	0	MAST3	18109147	1.000000	0.71417	0.932000	0.37286	0.936000	0.57629	9.798000	0.99111	1.897000	0.54924	0.491000	0.48974	GAG	MAST3	-	superfamily_Kinase-like_dom		0.632	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	G	XM_038150		18248147	+1	no_errors	ENST00000262811	ensembl	human	known	70_37	missense	SNP	1.000	A
MED25	81857	genome.wustl.edu	37	19	50339648	50339648	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:50339648C>T	ENST00000312865.6	+	17	2184	c.2131C>T	c.(2131-2133)Cgg>Tgg	p.R711W	PTOV1-AS1_ENST00000600742.1_RNA|PTOV1-AS1_ENST00000596521.1_RNA|MED25_ENST00000538643.1_Missense_Mutation_p.R498W	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	711	Pro-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		ACTTCCCCCTCGGGCTCCACT	0.701																																					GBM(51;894 1657 37868)												0													7.0	7.0	7.0					19																	50339648		2134	4239	6373	SO:0001583	missense	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.2131C>T	19.37:g.50339648C>T	ENSP00000326767:p.Arg711Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.R711W	ENST00000312865.6	37	c.2131	CCDS33075.1	19	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436234	0.43224	.	.	ENSG00000104973	ENST00000355584;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070;ENST00000542221	T;T	0.80480	-1.35;-1.38	5.03	-8.75	0.00834	Mediator complex, subunit Med25, NR box (1);	.	.	.	.	T	0.62146	0.2404	N	0.24115	0.695	0.22811	N	0.998706	B;B;B	0.26195	0.056;0.144;0.056	B;B;B	0.17722	0.011;0.019;0.011	T	0.54180	-0.8332	9	0.87932	D	0	.	8.9486	0.35773	0.3215:0.549:0.0:0.1295	.	498;711;711	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	W	711;711;690;498;446;361	ENSP00000326767:R711W;ENSP00000437496:R498W	ENSP00000326767:R711W	R	+	1	2	MED25	55031460	0.002000	0.14202	0.002000	0.10522	0.399000	0.30720	-0.411000	0.07142	-1.342000	0.02222	0.563000	0.77884	CGG	MED25	-	pfam_Mediator_Med25_NR-box		0.701	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	C	NM_030973		50339648	+1	no_errors	ENST00000312865	ensembl	human	known	70_37	missense	SNP	0.001	T
MGAT4A	11320	genome.wustl.edu	37	2	99260398	99260398	+	Silent	SNP	A	A	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:99260398A>G	ENST00000264968.3	-	9	1371	c.1008T>C	c.(1006-1008)ccT>ccC	p.P336P	MGAT4A_ENST00000414521.2_Silent_p.P208P|MGAT4A_ENST00000409391.1_Silent_p.P336P|MGAT4A_ENST00000393487.1_Silent_p.P336P			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	336					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						CATCTTTTTCAGGGTTGCAGA	0.378																																																	0													71.0	72.0	71.0					2																	99260398		2203	4300	6503	SO:0001819	synonymous_variant	11320			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.1008T>C	2.37:g.99260398A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Silent	SNP	pfam_Glyco_transf_54	p.P336	ENST00000264968.3	37	c.1008	CCDS2036.1	2																																																																																			MGAT4A	-	pfam_Glyco_transf_54		0.378	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	HGNC	protein_coding	OTTHUMT00000252988.2	A	NM_012214		99260398	-1	no_errors	ENST00000264968	ensembl	human	known	70_37	silent	SNP	0.991	G
KMT2C	58508	genome.wustl.edu	37	7	151873963	151873963	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:151873963G>A	ENST00000262189.6	-	38	8793	c.8575C>T	c.(8575-8577)Cac>Tac	p.H2859Y	KMT2C_ENST00000355193.2_Missense_Mutation_p.H2859Y	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2859					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGTCTGAGTGAGCAGAAGCC	0.398																																																	0													132.0	128.0	130.0					7																	151873963		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8575C>T	7.37:g.151873963G>A	ENSP00000262189:p.His2859Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.H2859Y	ENST00000262189.6	37	c.8575	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.476|0.476	-0.881983|-0.881983	0.02530|0.02530	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000360104	D;D|.	0.83250|.	-1.7;-1.7|.	5.4|5.4	3.44|3.44	0.39384|0.39384	.|.	0.514489|.	0.15932|.	N|.	0.237612|.	T|T	0.23451|0.23451	0.0567|0.0567	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	0.999998|0.999998	B;B;B|.	0.28971|.	0.229;0.194;0.086|.	B;B;B|.	0.25759|.	0.063;0.058;0.058|.	T|T	0.17440|0.17440	-1.0369|-1.0369	10|5	0.59425|.	D|.	0.04|.	.|.	6.7013|6.7013	0.23227|0.23227	0.0:0.2887:0.5534:0.1579|0.0:0.2887:0.5534:0.1579	.|.	2859;1920;2859|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	Y|L	2859|364	ENSP00000262189:H2859Y;ENSP00000347325:H2859Y|.	ENSP00000262189:H2859Y|.	H|S	-|-	1|2	0|0	MLL3|MLL3	151504896|151504896	0.035000|0.035000	0.19736|0.19736	0.034000|0.034000	0.17996|0.17996	0.290000|0.290000	0.27261|0.27261	1.600000|1.600000	0.36762|0.36762	1.187000|1.187000	0.43000|0.43000	0.650000|0.650000	0.86243|0.86243	CAC|TCA	MLL3	-	NULL		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	G			151873963	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	missense	SNP	0.001	A
MNS1	55329	genome.wustl.edu	37	15	56735844	56735844	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:56735844G>A	ENST00000260453.3	-	6	1059	c.895C>T	c.(895-897)Cag>Tag	p.Q299*	TEX9_ENST00000352903.2_Intron|TEX9_ENST00000537232.1_Intron	NM_018365.2	NP_060835.1	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	299	Glu-rich.				cilium organization (GO:0044782)|left/right axis specification (GO:0070986)|meiotic nuclear division (GO:0007126)	axoneme (GO:0005930)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)|sperm flagellum (GO:0036126)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	20				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		ACCGCATTCTGAAGCTGTAGC	0.303																																																	0													149.0	145.0	146.0					15																	56735844		2192	4292	6484	SO:0001587	stop_gained	55329			AK002084	CCDS10158.1	15q21.3	2013-01-16			ENSG00000138587	ENSG00000138587			29636	protein-coding gene	gene with protein product	"""spermatogenesis associated 40"""	610766				7625268, 8032679	Standard	NM_018365		Approved	FLJ11222, SPATA40	uc002adr.2	Q8NEH6	OTTHUMG00000132034	ENST00000260453.3:c.895C>T	15.37:g.56735844G>A	ENSP00000260453:p.Gln299*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IYT6|Q9NUP4	Nonsense_Mutation	SNP	NULL	p.Q299*	ENST00000260453.3	37	c.895	CCDS10158.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.251728	0.95336	.	.	ENSG00000138587	ENST00000260453	.	.	.	5.44	2.04	0.26737	.	0.449072	0.25968	N	0.027155	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-3.7891	14.8279	0.70128	0.0:0.0:0.6167:0.3833	.	.	.	.	X	299	.	ENSP00000260453:Q299X	Q	-	1	0	MNS1	54523136	1.000000	0.71417	0.990000	0.47175	0.827000	0.46813	4.442000	0.59988	0.599000	0.29845	0.637000	0.83480	CAG	MNS1	-	NULL		0.303	MNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNS1	HGNC	protein_coding	OTTHUMT00000255047.2	G	NM_018365		56735844	-1	no_errors	ENST00000260453	ensembl	human	known	70_37	nonsense	SNP	0.843	A
MRPL53	116540	genome.wustl.edu	37	2	74699582	74699582	+	Silent	SNP	C	C	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:74699582C>A	ENST00000258105.7	-	2	769	c.108G>T	c.(106-108)acG>acT	p.T36T	MRPL53_ENST00000409710.1_Intron	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	36						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						CACTGCTCACCGTCTGCAGGA	0.602																																																	0													55.0	47.0	49.0					2																	74699582		2203	4300	6503	SO:0001819	synonymous_variant	116540			BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.108G>T	2.37:g.74699582C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ribosomal_L53_mit,superfamily_Thioredoxin-like_fold	p.T36	ENST00000258105.7	37	c.108	CCDS1944.1	2																																																																																			MRPL53	-	pfam_Ribosomal_L53_mit,superfamily_Thioredoxin-like_fold		0.602	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL53	HGNC	protein_coding	OTTHUMT00000252225.2	C	NM_053050		74699582	-1	no_errors	ENST00000258105	ensembl	human	known	70_37	silent	SNP	0.855	A
MUC4	4585	genome.wustl.edu	37	3	195507162	195507162	+	Silent	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:195507162G>C	ENST00000463781.3	-	2	11748	c.11289C>G	c.(11287-11289)gtC>gtG	p.V3763V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.V3763V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGCGTCGGTGACAAGAAGAG	0.602																																																	0													20.0	18.0	19.0					3																	195507162		676	1583	2259	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11289C>G	3.37:g.195507162G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V3763	ENST00000463781.3	37	c.11289	CCDS54700.1	3																																																																																			MUC4	-	NULL		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195507162	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	silent	SNP	0.050	C
MUC4	4585	genome.wustl.edu	37	3	195509260	195509260	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:195509260G>A	ENST00000463781.3	-	2	9650	c.9191C>T	c.(9190-9192)tCa>tTa	p.S3064L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3064L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGGATGCTGAGGAAGGGCT	0.612																																																	0													17.0	10.0	12.0					3																	195509260		635	1552	2187	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9191C>T	3.37:g.195509260G>A	ENSP00000417498:p.Ser3064Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3064L	ENST00000463781.3	37	c.9191	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	8.846	0.943367	0.18281	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.44;1.43	.	.	.	.	.	.	.	.	T	0.12902	0.0313	N	0.19112	0.55	0.09310	N	0.999999	P	0.42584	0.784	B	0.28638	0.092	T	0.13072	-1.0523	7	.	.	.	.	5.4195	0.16392	0.0:0.0:1.0:0.0	.	2936	E7ESK3	.	L	3064	ENSP00000417498:S3064L;ENSP00000420243:S3064L	.	S	-	2	0	MUC4	196994039	0.001000	0.12720	0.021000	0.16686	0.000000	0.00434	0.020000	0.13466	0.497000	0.27926	0.000000	0.15137	TCA	MUC4	-	NULL		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195509260	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.500	A
MUC4	4585	genome.wustl.edu	37	3	195512236	195512236	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:195512236G>A	ENST00000463781.3	-	2	6674	c.6215C>T	c.(6214-6216)tCa>tTa	p.S2072L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2072L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGGGTT	0.562																																																	0													23.0	22.0	22.0					3																	195512236		688	1569	2257	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6215C>T	3.37:g.195512236G>A	ENSP00000417498:p.Ser2072Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2072L	ENST00000463781.3	37	c.6215	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	6.166	0.398799	0.11696	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.3;1.31	.	.	.	.	.	.	.	.	T	0.23806	0.0576	N	0.19112	0.55	0.09310	N	1	P	0.34662	0.462	B	0.39706	0.307	T	0.24512	-1.0158	6	.	.	.	.	.	.	.	.	2072	E7ESK3	.	L	2072	ENSP00000417498:S2072L;ENSP00000420243:S2072L	.	S	-	2	0	MUC4	196996631	0.005000	0.15991	0.018000	0.16275	0.023000	0.10783	0.692000	0.25482	0.488000	0.27723	0.064000	0.15345	TCA	MUC4	-	NULL		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512236	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.121	A
MUC4	4585	genome.wustl.edu	37	3	195513359	195513359	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:195513359G>A	ENST00000463781.3	-	2	5551	c.5092C>T	c.(5092-5094)Cct>Tct	p.P1698S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1698S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCGGTGACAGGAAGACGGGTG	0.592																																																	0													39.0	42.0	41.0					3																	195513359		689	1581	2270	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5092C>T	3.37:g.195513359G>A	ENSP00000417498:p.Pro1698Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P1698S	ENST00000463781.3	37	c.5092	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	5.869	0.344538	0.11126	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.24723	1.84;1.86	.	.	.	.	.	.	.	.	T	0.24928	0.0605	N	0.19112	0.55	0.09310	N	1	D	0.57571	0.98	P	0.59424	0.857	T	0.16041	-1.0416	7	.	.	.	.	5.8679	0.18786	8.0E-4:0.0:0.9992:0.0	.	1698	E7ESK3	.	S	1698	ENSP00000417498:P1698S;ENSP00000420243:P1698S	.	P	-	1	0	MUC4	196997754	0.000000	0.05858	0.034000	0.17996	0.034000	0.12701	0.214000	0.17541	0.088000	0.17205	0.089000	0.15464	CCT	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513359	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.002	A
MYBL1	4603	genome.wustl.edu	37	8	67492379	67492379	+	Missense_Mutation	SNP	G	G	T	rs372059344		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:67492379G>T	ENST00000522677.3	-	9	1500	c.1090C>A	c.(1090-1092)Ctt>Att	p.L364I	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Missense_Mutation_p.L364I	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	364	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GATTCAATAAGTTCTAGAGTC	0.383																																																	0													46.0	44.0	44.0					8																	67492379		1840	4091	5931	SO:0001583	missense	4603			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1090C>A	8.37:g.67492379G>T	ENSP00000429633:p.Leu364Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EW29|Q495F9	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L364I	ENST00000522677.3	37	c.1090	CCDS47867.1	8	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672481	0.88348	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	T;T	0.22743	2.4;1.94	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	L	0.55743	1.74	0.80722	D	1	D;D;D	0.89917	0.999;0.993;1.0	D;P;D	0.76071	0.979;0.708;0.987	T	0.06552	-1.0820	10	0.29301	T	0.29	-13.0196	19.036	0.92978	0.0:0.0:1.0:0.0	.	364;363;364	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	I	364	ENSP00000429633:L364I;ENSP00000428011:L364I	ENSP00000429633:L364I	L	-	1	0	MYBL1	67654933	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.035000	0.93752	2.481000	0.83766	0.655000	0.94253	CTT	MYBL1	-	NULL		0.383	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	G	XM_034274		67492379	-1	no_errors	ENST00000522677	ensembl	human	known	70_37	missense	SNP	1.000	T
MYBPC2	4606	genome.wustl.edu	37	19	50961965	50961965	+	Silent	SNP	C	C	T	rs376193301		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:50961965C>T	ENST00000357701.5	+	21	2511	c.2460C>T	c.(2458-2460)agC>agT	p.S820S		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	820	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.			S -> T (in Ref. 1; CAA51544). {ECO:0000305}.	cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CGGGGCGCAGCGAGCCGGCCA	0.672																																																	0										0,4100		0,0,2050	26.0	34.0	31.0		2460	-2.3	0.9	19		31	1,8373		0,1,4186	no	coding-synonymous	MYBPC2	NM_004533.3		0,1,6236	TT,TC,CC		0.0119,0.0,0.0080		820/1142	50961965	1,12473	2050	4187	6237	SO:0001819	synonymous_variant	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2460C>T	19.37:g.50961965C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S820	ENST00000357701.5	37	c.2460	CCDS46152.1	19																																																																																			MYBPC2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.672	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	C	NM_004533		50961965	+1	no_errors	ENST00000357701	ensembl	human	known	70_37	silent	SNP	0.942	T
MYO7A	4647	genome.wustl.edu	37	11	76919742	76919742	+	Splice_Site	SNP	G	G	A	rs111033250		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:76919742G>A	ENST00000409709.3	+	44	6217	c.5945G>A	c.(5944-5946)gGa>gAa	p.G1982E	MYO7A_ENST00000409619.2_Splice_Site_p.G1933E|MYO7A_ENST00000458637.2_Splice_Site_p.G1944E|MYO7A_ENST00000605744.1_3'UTR	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1982	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGTGCTGCAGGAATTGTGCCC	0.607																																																	0													51.0	58.0	56.0					11																	76919742		2086	4211	6297	SO:0001630	splice_region_variant	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5945-1G>A	11.37:g.76919742G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.G1982E	ENST00000409709.3	37	c.5945	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565783	0.86439	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	D;D;D;D	0.88277	-2.36;-2.34;-2.35;-2.24	4.9	4.9	0.64082	Band 4.1 domain (1);FERM domain (1);	0.110929	0.64402	D	0.000010	D	0.93180	0.7828	M	0.77486	2.375	0.80722	D	1	D;P	0.58268	0.982;0.716	P;P	0.57324	0.818;0.466	D	0.93267	0.6648	9	.	.	.	.	18.0695	0.89402	0.0:0.0:1.0:0.0	.	1944;1982	F8VUN5;Q13402	.;MYO7A_HUMAN	E	1982;1944;1933;1155;1981;1951;1858;1124;597	ENSP00000386331:G1982E;ENSP00000392185:G1944E;ENSP00000386635:G1933E;ENSP00000417017:G1124E	.	G	+	2	0	MYO7A	76597390	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.405000	0.97313	2.282000	0.76494	0.305000	0.20034	GGA	MYO7A	-	smart_Band_41_domain,pfscan_FERM_domain		0.607	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	G	NM_000260	Missense_Mutation	76919742	+1	no_errors	ENST00000409709	ensembl	human	known	70_37	missense	SNP	1.000	A
NAB2	4665	genome.wustl.edu	37	12	57483008	57483008	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:57483008G>C	ENST00000300131.3	+	0	332				TMEM194A_ENST00000553654.1_5'Flank|NAB2_ENST00000357680.4_5'UTR|NAB2_ENST00000342556.6_5'UTR|NAB2_ENST00000554718.1_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)						cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGCAGGCGCCGAGCGCCGGGC	0.726																																																	0													6.0	7.0	6.0					12																	57483008		2042	4028	6070	SO:0001623	5_prime_UTR_variant	4665			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.-47G>C	12.37:g.57483008G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAK3|O76006|Q14797	RNA	SNP	-	NULL	ENST00000300131.3	37	NULL	CCDS8930.1	12																																																																																			NAB2	-	-		0.726	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAB2	HGNC	protein_coding	OTTHUMT00000412222.1	G	NM_005967		57483008	+1	no_errors	ENST00000554718	ensembl	human	putative	70_37	rna	SNP	0.309	C
NDN	4692	genome.wustl.edu	37	15	23932065	23932065	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:23932065C>T	ENST00000331837.4	-	1	385	c.300G>A	c.(298-300)caG>caA	p.Q100Q		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	100	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q100Q(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CGTGCGCCTTCTGCACCAGCT	0.662									Prader-Willi syndrome																																								1	Substitution - coding silent(1)	lung(1)											50.0	47.0	48.0					15																	23932065		2203	4300	6503	SO:0001819	synonymous_variant	4692	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.300G>A	15.37:g.23932065C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6Z5	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.Q100	ENST00000331837.4	37	c.300	CCDS10014.1	15																																																																																			NDN	-	pfscan_MAGE		0.662	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	C	NM_002487		23932065	-1	no_errors	ENST00000331837	ensembl	human	known	70_37	silent	SNP	1.000	T
ICE2	79664	genome.wustl.edu	37	15	60760317	60760317	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:60760317C>G	ENST00000261520.4	-	4	585	c.351G>C	c.(349-351)aaG>aaC	p.K117N	NARG2_ENST00000558654.1_5'UTR|NARG2_ENST00000439632.1_5'UTR|NARG2_ENST00000561114.1_Missense_Mutation_p.K117N	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TTGCAGGAATCTTTGCGTATT	0.358																																																	0													96.0	89.0	91.0					15																	60760317		2203	4300	6503	SO:0001583	missense	79664																														ENST00000261520.4:c.351G>C	15.37:g.60760317C>G	ENSP00000261520:p.Lys117Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_NARG2_C	p.K117N	ENST00000261520.4	37	c.351	CCDS10176.1	15	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569743	0.28003	.	.	ENSG00000128915	ENST00000261520	.	.	.	5.98	1.19	0.21007	.	0.298915	0.33875	N	0.004467	T	0.32346	0.0826	L	0.29908	0.895	0.51767	D	0.999935	B	0.20052	0.041	B	0.17433	0.018	T	0.07139	-1.0788	9	0.39692	T	0.17	-9.9545	2.7717	0.05336	0.2291:0.3186:0.0:0.4523	.	117	Q659A1	NARG2_HUMAN	N	117	.	ENSP00000261520:K117N	K	-	3	2	NARG2	58547609	0.344000	0.24827	0.870000	0.34147	0.750000	0.42670	0.478000	0.22212	0.308000	0.22923	0.655000	0.94253	AAG	NARG2	-	NULL		0.358	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	HGNC	protein_coding	OTTHUMT00000256136.1	C			60760317	-1	no_errors	ENST00000261520	ensembl	human	known	70_37	missense	SNP	0.464	G
NDUFB1	4707	genome.wustl.edu	37	14	92587952	92587952	+	Intron	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr14:92587952C>T	ENST00000553514.1	-	1	83				NDUFB1_ENST00000555441.1_5'Flank|NDUFB1_ENST00000556555.1_5'UTR|NDUFB1_ENST00000605997.1_Intron|CPSF2_ENST00000298875.4_5'Flank|NDUFB1_ENST00000329559.3_Intron			O75438	NDUB1_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			large_intestine(1)|lung(1)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.205)		CCGTGATCCTCGTCGCGGCGG	0.697																																																	0													18.0	23.0	21.0					14																	92587952		2161	4231	6392	SO:0001627	intron_variant	4707			BC104672	CCDS9901.1	14q31.3	2011-07-04	2002-08-29		ENSG00000183648	ENSG00000183648		"""Mitochondrial respiratory chain complex / Complex I"""	7695	protein-coding gene	gene with protein product	"""complex I MNLL subunit"""	603837	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1 (7kD, MNLL)"""			9763677	Standard	NM_004545		Approved	MNLL, CI-MNLL	uc001yaf.3	O75438		ENST00000553514.1:c.122+33G>A	14.37:g.92587952C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV68	RNA	SNP	-	NULL	ENST00000553514.1	37	NULL		14																																																																																			NDUFB1	-	-		0.697	NDUFB1-004	KNOWN	basic|appris_principal	protein_coding	NDUFB1	HGNC	protein_coding	OTTHUMT00000412116.2	C	NM_004545		92587952	-1	no_errors	ENST00000556555	ensembl	human	putative	70_37	rna	SNP	0.000	T
NEK1	4750	genome.wustl.edu	37	4	170510647	170510647	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:170510647C>T	ENST00000439128.2	-	6	1055	c.415G>A	c.(415-417)Gat>Aat	p.D139N	NEK1_ENST00000507142.1_Missense_Mutation_p.D139N|NEK1_ENST00000512193.1_Missense_Mutation_p.D139N|NEK1_ENST00000511633.1_Missense_Mutation_p.D139N|NEK1_ENST00000510533.1_Missense_Mutation_p.D139N	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	139	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ACTGTTCCATCTTTAGTTAAA	0.274																																																	0													37.0	33.0	34.0					4																	170510647		1678	3861	5539	SO:0001583	missense	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.415G>A	4.37:g.170510647C>T	ENSP00000408020:p.Asp139Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D139N	ENST00000439128.2	37	c.415	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226947	0.58668	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.20455	0.0492	N	0.20328	0.56	0.39574	D	0.969324	B;B;B;B;B;B	0.25719	0.003;0.108;0.043;0.108;0.043;0.132	B;B;B;B;B;B	0.34931	0.005;0.094;0.056;0.192;0.045;0.191	T	0.12941	-1.0528	10	0.17832	T	0.49	.	14.4671	0.67492	0.0:0.9301:0.0:0.0699	.	139;139;139;139;139;139	Q96PY6-5;Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;.;NEK1_HUMAN	N	139	ENSP00000408020:D139N;ENSP00000423332:D139N;ENSP00000427653:D139N;ENSP00000424757:D139N;ENSP00000424938:D139N	ENSP00000408020:D139N	D	-	1	0	NEK1	170747222	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.706000	0.54830	2.801000	0.96364	0.650000	0.86243	GAT	NEK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.274	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3	C			170510647	-1	no_errors	ENST00000507142	ensembl	human	known	70_37	missense	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29557345	29557345	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:29557345G>A	ENST00000358273.4	+	23	3441	c.3058G>A	c.(3058-3060)Gaa>Aaa	p.E1020K	NF1_ENST00000356175.3_Missense_Mutation_p.E1020K	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1020					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCAATTAGTTGAAGTAATGAT	0.333			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)											59.0	57.0	58.0					17																	29557345		2203	4299	6502	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3058G>A	17.37:g.29557345G>A	ENSP00000351015:p.Glu1020Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.E1020K	ENST00000358273.4	37	c.3058	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	.	16.35	3.099714	0.56183	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.11604	2.93;3.07;2.76	5.46	4.43	0.53597	Armadillo-type fold (1);	0.052520	0.85682	D	0.000000	T	0.15565	0.0375	M	0.81497	2.545	0.80722	D	1	B;B;B;B	0.24426	0.011;0.103;0.0;0.0	B;B;B;B	0.20384	0.006;0.029;0.002;0.004	T	0.02059	-1.1221	10	0.27785	T	0.31	.	12.2468	0.54574	0.0736:0.1327:0.7937:0.0	.	1020;70;1020;1020	E1P657;Q59FX3;P21359-2;P21359	.;.;.;NF1_HUMAN	K	1020;1020;686	ENSP00000351015:E1020K;ENSP00000348498:E1020K;ENSP00000389907:E686K	ENSP00000348498:E1020K	E	+	1	0	NF1	26581471	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	6.312000	0.72840	2.550000	0.86006	0.455000	0.32223	GAA	NF1	-	superfamily_ARM-type_fold		0.333	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	G	NM_000267		29557345	+1	no_errors	ENST00000358273	ensembl	human	known	70_37	missense	SNP	0.998	A
NIPSNAP1	8508	genome.wustl.edu	37	22	29957821	29957821	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr22:29957821G>C	ENST00000216121.7	-	5	652	c.398C>G	c.(397-399)cCa>cGa	p.P133R		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	133					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						CATGAGGGCTGGGTAGCCACC	0.552																																																	1	Unknown(1)	lung(1)											126.0	122.0	124.0					22																	29957821		2203	4300	6503	SO:0001583	missense	8508			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.398C>G	22.37:g.29957821G>C	ENSP00000216121:p.Pro133Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAY3|O43800	Missense_Mutation	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.P133R	ENST00000216121.7	37	c.398	CCDS13860.1	22	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750988	0.89753	.	.	ENSG00000184117	ENST00000216121	T	0.42131	0.98	4.72	4.72	0.59763	Dimeric alpha-beta barrel (1);	0.000000	0.85682	D	0.000000	T	0.68256	0.2981	M	0.86178	2.8	0.80722	D	1	D;D	0.76494	0.999;0.984	D;P	0.73380	0.98;0.808	T	0.72151	-0.4377	10	0.49607	T	0.09	-4.9986	17.8034	0.88595	0.0:0.0:1.0:0.0	.	113;133	B4DQI7;Q9BPW8	.;NIPS1_HUMAN	R	133	ENSP00000216121:P133R	ENSP00000216121:P133R	P	-	2	0	NIPSNAP1	28287821	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.115000	0.94336	2.605000	0.88082	0.561000	0.74099	CCA	NIPSNAP1	-	superfamily_Dimeric_a/b-barrel		0.552	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP1	HGNC	protein_coding	OTTHUMT00000322117.1	G			29957821	-1	no_errors	ENST00000216121	ensembl	human	known	70_37	missense	SNP	1.000	C
NPY2R	4887	genome.wustl.edu	37	4	156136145	156136145	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:156136145G>A	ENST00000329476.3	+	2	1543	c.1054G>A	c.(1054-1056)Gag>Aag	p.E352K	NPY2R_ENST00000506608.1_Missense_Mutation_p.E352K	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	352					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	CATTCACTCTGAGGTGTCCGT	0.502																																																	0													94.0	94.0	94.0					4																	156136145		2203	4300	6503	SO:0001583	missense	4887			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.1054G>A	4.37:g.156136145G>A	ENSP00000332591:p.Glu352Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.E352K	ENST00000329476.3	37	c.1054	CCDS3791.1	4	.	.	.	.	.	.	.	.	.	.	G	19.41	3.823151	0.71143	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.53857	0.6;0.6	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	L	0.44542	1.39	0.50467	D	0.999875	B	0.29909	0.261	B	0.21546	0.035	T	0.31613	-0.9937	10	0.27785	T	0.31	.	18.9076	0.92469	0.0:0.0:1.0:0.0	.	352	P49146	NPY2R_HUMAN	K	352	ENSP00000332591:E352K;ENSP00000426366:E352K	ENSP00000332591:E352K	E	+	1	0	NPY2R	156355595	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	5.751000	0.68720	2.711000	0.92665	0.643000	0.83706	GAG	NPY2R	-	prints_NPY2_rcpt		0.502	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1	G	NM_000910		156136145	+1	no_errors	ENST00000329476	ensembl	human	known	70_37	missense	SNP	1.000	A
NUP160	23279	genome.wustl.edu	37	11	47823452	47823452	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:47823452C>T	ENST00000378460.2	-	23	2852	c.2806G>A	c.(2806-2808)Gaa>Aaa	p.E936K	NUP160_ENST00000528071.1_Missense_Mutation_p.E822K|RNA5SP340_ENST00000517132.1_RNA|NUP160_ENST00000530326.1_Missense_Mutation_p.E822K	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	936					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TTGCCTACTTCAGATGCTGCC	0.428																																																	0													98.0	85.0	89.0					11																	47823452		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2806G>A	11.37:g.47823452C>T	ENSP00000367721:p.Glu936Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.E936K	ENST00000378460.2	37	c.2806	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669782	0.88348	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.43688	1.52;0.95;0.94	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.40347	0.1113	L	0.60455	1.87	0.80722	D	1	P	0.44690	0.841	B	0.38616	0.277	T	0.26224	-1.0109	10	0.27785	T	0.31	.	16.449	0.83973	0.0:1.0:0.0:0.0	.	936	Q12769	NU160_HUMAN	K	936;822;822	ENSP00000367721:E936K;ENSP00000433590:E822K;ENSP00000432367:E822K	ENSP00000367721:E936K	E	-	1	0	NUP160	47780028	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.651000	0.74372	2.561000	0.86390	0.555000	0.69702	GAA	NUP160	-	NULL		0.428	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	C	NM_015231		47823452	-1	no_errors	ENST00000378460	ensembl	human	known	70_37	missense	SNP	1.000	T
NUPR1	26471	genome.wustl.edu	37	16	28549402	28549402	+	Missense_Mutation	SNP	C	C	G	rs371618392		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:28549402C>G	ENST00000324873.6	-	2	453	c.187G>C	c.(187-189)Gag>Cag	p.E63Q	NUPR1_ENST00000395641.2_Missense_Mutation_p.E81Q	NM_001042483.1|NM_012385.2	NP_001035948.1|NP_036517.1	O60356	NUPR1_HUMAN	nuclear protein, transcriptional regulator, 1	63					acute inflammatory response (GO:0002526)|cell growth (GO:0016049)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male gonad development (GO:0008584)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein modification process (GO:0031401)|protein acetylation (GO:0006473)|protein complex assembly (GO:0006461)|regulation of female gonad development (GO:2000194)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E63K(1)		breast(1)|large_intestine(1)|lung(1)	3						AGTTTCCTCTCGTGCCCGCCA	0.622																																																	1	Substitution - Missense(1)	large_intestine(1)											124.0	141.0	135.0					16																	28549402		2197	4300	6497	SO:0001583	missense	26471			AF069073	CCDS10634.1, CCDS42137.1	16p11.2	2012-07-04	2012-07-04		ENSG00000176046	ENSG00000176046			29990	protein-coding gene	gene with protein product	"""candidate of metastasis 1"""	614812				9405444, 10493524, 10092851	Standard	NM_012385		Approved	COM1, p8	uc002dqd.1	O60356	OTTHUMG00000131764	ENST00000324873.6:c.187G>C	16.37:g.28549402C>G	ENSP00000315559:p.Glu63Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5C4|O60357|Q6FGG3	Missense_Mutation	SNP	pfam_Nuclear_phosphoprot_p8_DNA-bd	p.E63Q	ENST00000324873.6	37	c.187	CCDS10634.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.112137	0.94339	.	.	ENSG00000176046	ENST00000324873;ENST00000395641	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.79287	0.4420	.	.	.	0.49483	D	0.999792	D	0.89917	1.0	D	0.91635	0.999	T	0.80647	-0.1289	8	0.62326	D	0.03	-24.4866	15.2482	0.73523	0.0:1.0:0.0:0.0	.	63	O60356	NUPR1_HUMAN	Q	63;81	.	ENSP00000315559:E63Q	E	-	1	0	NUPR1	28456903	0.998000	0.40836	0.998000	0.56505	0.989000	0.77384	4.683000	0.61679	2.748000	0.94277	0.655000	0.94253	GAG	NUPR1	-	pfam_Nuclear_phosphoprot_p8_DNA-bd		0.622	NUPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPR1	HGNC	protein_coding	OTTHUMT00000254692.2	C	NM_012385		28549402	-1	no_errors	ENST00000324873	ensembl	human	known	70_37	missense	SNP	1.000	G
NUPR1	26471	genome.wustl.edu	37	16	28550171	28550171	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:28550171C>T	ENST00000324873.6	-	1	324	c.58G>A	c.(58-60)Gag>Aag	p.E20K	NUPR1_ENST00000395641.2_Missense_Mutation_p.E20K	NM_001042483.1|NM_012385.2	NP_001035948.1|NP_036517.1	O60356	NUPR1_HUMAN	nuclear protein, transcriptional regulator, 1	20					acute inflammatory response (GO:0002526)|cell growth (GO:0016049)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male gonad development (GO:0008584)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein modification process (GO:0031401)|protein acetylation (GO:0006473)|protein complex assembly (GO:0006461)|regulation of female gonad development (GO:2000194)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(1)	3						CTGGAGTCCTCGTCCTCCGGG	0.627																																																	0													83.0	75.0	78.0					16																	28550171		2197	4300	6497	SO:0001583	missense	26471			AF069073	CCDS10634.1, CCDS42137.1	16p11.2	2012-07-04	2012-07-04		ENSG00000176046	ENSG00000176046			29990	protein-coding gene	gene with protein product	"""candidate of metastasis 1"""	614812				9405444, 10493524, 10092851	Standard	NM_012385		Approved	COM1, p8	uc002dqd.1	O60356	OTTHUMG00000131764	ENST00000324873.6:c.58G>A	16.37:g.28550171C>T	ENSP00000315559:p.Glu20Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5C4|O60357|Q6FGG3	Missense_Mutation	SNP	pfam_Nuclear_phosphoprot_p8_DNA-bd	p.E20K	ENST00000324873.6	37	c.58	CCDS10634.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.877753	0.97055	.	.	ENSG00000176046	ENST00000324873;ENST00000395641	.	.	.	5.44	4.49	0.54785	.	0.107856	0.41938	D	0.000793	T	0.54727	0.1876	.	.	.	0.34361	D	0.690954	D	0.55385	0.971	P	0.48795	0.59	T	0.70528	-0.4847	8	0.87932	D	0	-4.8039	10.267	0.43460	0.0:0.9087:0.0:0.0913	.	20	O60356	NUPR1_HUMAN	K	20	.	ENSP00000315559:E20K	E	-	1	0	NUPR1	28457672	0.871000	0.30034	0.656000	0.29637	0.704000	0.40688	1.928000	0.40104	1.434000	0.47414	0.643000	0.83706	GAG	NUPR1	-	pfam_Nuclear_phosphoprot_p8_DNA-bd		0.627	NUPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPR1	HGNC	protein_coding	OTTHUMT00000254692.2	C	NM_012385		28550171	-1	no_errors	ENST00000324873	ensembl	human	known	70_37	missense	SNP	0.929	T
NYAP1	222950	genome.wustl.edu	37	7	100088718	100088718	+	Splice_Site	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:100088718G>A	ENST00000300179.2	+	6	2427	c.2268G>A	c.(2266-2268)caG>caA	p.Q756Q	NYAP1_ENST00000496985.1_3'UTR|NYAP1_ENST00000423930.1_Splice_Site_p.Q757Q|NYAP1_ENST00000454988.1_Splice_Site_p.Q700Q	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	756					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCCTGAGCCAGGTGAGGCTTG	0.612																																																	0													17.0	19.0	18.0					7																	100088718		2158	4223	6381	SO:0001630	splice_region_variant	222950			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.2268+1G>A	7.37:g.100088718G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6U9Y3|Q8N1V0	Silent	SNP	NULL	p.Q757	ENST00000300179.2	37	c.2271	CCDS5696.1	7																																																																																			NYAP1	-	NULL		0.612	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2	G	NM_173564	Silent	100088718	+1	no_errors	ENST00000423930	ensembl	human	known	70_37	silent	SNP	1.000	A
OCA2	4948	genome.wustl.edu	37	15	28116342	28116342	+	Silent	SNP	C	C	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:28116342C>A	ENST00000354638.3	-	21	2357	c.2202G>T	c.(2200-2202)ctG>ctT	p.L734L	OCA2_ENST00000353809.5_Silent_p.L710L	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	734					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.L734L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GGGACGACGCCAGGGCTGAGA	0.577									Oculocutaneous Albinism																																								1	Substitution - coding silent(1)	lung(1)											157.0	122.0	134.0					15																	28116342		2203	4300	6503	SO:0001819	synonymous_variant	4948	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2202G>T	15.37:g.28116342C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15211|Q15212|Q96EN1|Q9UMI5	Silent	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.L734	ENST00000354638.3	37	c.2202	CCDS10020.1	15																																																																																			OCA2	-	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB		0.577	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	HGNC	protein_coding	OTTHUMT00000250823.1	C	NM_000275		28116342	-1	no_errors	ENST00000354638	ensembl	human	known	70_37	silent	SNP	1.000	A
OLFM4	10562	genome.wustl.edu	37	13	53624523	53624523	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr13:53624523G>A	ENST00000219022.2	+	5	1228	c.1150G>A	c.(1150-1152)Gac>Aac	p.D384N		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	384	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GCAAGATATTGACTTTGCTGT	0.413																																																	0													211.0	208.0	209.0					13																	53624523		2203	4300	6503	SO:0001583	missense	10562			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1150G>A	13.37:g.53624523G>A	ENSP00000219022:p.Asp384Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.D384N	ENST00000219022.2	37	c.1150	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.583622	0.96578	.	.	ENSG00000102837	ENST00000219022	D	0.94280	-3.39	5.92	5.92	0.95590	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97833	1.0264	10	0.87932	D	0	.	20.3172	0.98658	0.0:0.0:1.0:0.0	.	384	Q6UX06	OLFM4_HUMAN	N	384	ENSP00000219022:D384N	ENSP00000219022:D384N	D	+	1	0	OLFM4	52522524	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.801000	0.96364	0.650000	0.86243	GAC	OLFM4	-	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like		0.413	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	G	NM_006418		53624523	+1	no_errors	ENST00000219022	ensembl	human	known	70_37	missense	SNP	1.000	A
OR4X1	390113	genome.wustl.edu	37	11	48286033	48286033	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:48286033C>T	ENST00000320048.1	+	1	621	c.621C>T	c.(619-621)gtC>gtT	p.V207V		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						TCTCCGTAGTCAGTTTCTTCG	0.557																																																	0													130.0	103.0	112.0					11																	48286033		2201	4298	6499	SO:0001819	synonymous_variant	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.621C>T	11.37:g.48286033C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF74	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V207	ENST00000320048.1	37	c.621	CCDS31487.1	11																																																																																			OR4X1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.557	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X1	HGNC	protein_coding	OTTHUMT00000383373.1	C	NM_001004726		48286033	+1	no_errors	ENST00000320048	ensembl	human	known	70_37	silent	SNP	0.935	T
ORC1	4998	genome.wustl.edu	37	1	52854276	52854276	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:52854276C>T	ENST00000371568.3	-	8	1439	c.1221G>A	c.(1219-1221)gaG>gaA	p.E407E	ORC1_ENST00000371566.1_Silent_p.E407E	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	407					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GAATCTCTTTCTCTTCTTGGT	0.428																																																	0													170.0	161.0	164.0					1																	52854276		2203	4300	6503	SO:0001819	synonymous_variant	4998				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.1221G>A	1.37:g.52854276C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ34|Q13471|Q5T0F5	Silent	SNP	pfam_BAH_dom,pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,pfam_DUF2075,smart_BAH_dom,smart_AAA+_ATPase,pfscan_BAH_dom	p.E407	ENST00000371568.3	37	c.1221	CCDS566.1	1																																																																																			ORC1	-	NULL		0.428	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC1	HGNC	protein_coding	OTTHUMT00000022202.1	C	NM_004153		52854276	-1	no_errors	ENST00000371566	ensembl	human	known	70_37	silent	SNP	0.662	T
PARP14	54625	genome.wustl.edu	37	3	122432403	122432403	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:122432403C>T	ENST00000474629.2	+	10	4018	c.3752C>T	c.(3751-3753)tCa>tTa	p.S1251L		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1251	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ACATCAAACTCATTCAATCTC	0.383																																																	0													87.0	82.0	83.0					3																	122432403		1878	4110	5988	SO:0001583	missense	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3752C>T	3.37:g.122432403C>T	ENSP00000418194:p.Ser1251Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	pfam_A1pp,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_A1pp,pfscan_A1pp,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S1251L	ENST00000474629.2	37	c.3752	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037561	0.35989	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000398157	T	0.22743	1.94	5.24	5.24	0.73138	Appr-1-p processing (3);	0.526506	0.19029	N	0.124607	T	0.34571	0.0902	M	0.66439	2.03	0.41240	D	0.98663	B;B	0.29270	0.228;0.24	B;B	0.39771	0.083;0.309	T	0.14420	-1.0473	10	0.56958	D	0.05	.	17.5692	0.87930	0.0:1.0:0.0:0.0	.	1251;1251	Q460N5-4;Q460N5	.;PAR14_HUMAN	L	1251;1170;247	ENSP00000418194:S1251L	ENSP00000381224:S247L	S	+	2	0	PARP14	123915093	0.000000	0.05858	0.733000	0.30861	0.068000	0.16541	1.156000	0.31712	2.745000	0.94114	0.650000	0.86243	TCA	PARP14	-	pfam_A1pp,smart_A1pp,pfscan_A1pp		0.383	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	C	NM_017554		122432403	+1	no_errors	ENST00000474629	ensembl	human	known	70_37	missense	SNP	0.980	T
PCDHA1	56147	genome.wustl.edu	37	5	140167975	140167975	+	Silent	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:140167975G>C	ENST00000504120.2	+	1	2100	c.2100G>C	c.(2098-2100)ctG>ctC	p.L700L	PCDHA1_ENST00000378133.3_Silent_p.L700L|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	700					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGTGTACCTGATCATCGCCA	0.667																																																	0													59.0	57.0	58.0					5																	140167975		2203	4297	6500	SO:0001819	synonymous_variant	56147			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2100G>C	5.37:g.140167975G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L700	ENST00000504120.2	37	c.2100	CCDS54913.1	5																																																																																			PCDHA1	-	NULL		0.667	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	G	NM_018900		140167975	+1	no_errors	ENST00000504120	ensembl	human	known	70_37	silent	SNP	1.000	C
PCDHB12	56124	genome.wustl.edu	37	5	140589898	140589898	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:140589898C>T	ENST00000239450.2	+	1	1608	c.1419C>T	c.(1417-1419)atC>atT	p.I473I	PCDHB12_ENST00000541609.1_Silent_p.I136I	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	473	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGGCAGCATCAGCGCCACAG	0.647																																																	0													90.0	88.0	89.0					5																	140589898		2203	4298	6501	SO:0001819	synonymous_variant	56124			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1419C>T	5.37:g.140589898C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I473	ENST00000239450.2	37	c.1419	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.647	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	C	NM_018932		140589898	+1	no_errors	ENST00000239450	ensembl	human	known	70_37	silent	SNP	0.243	T
PCDHGA2	56113	genome.wustl.edu	37	5	140720582	140720582	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:140720582G>A	ENST00000394576.2	+	1	2044	c.2044G>A	c.(2044-2046)Gcc>Acc	p.A682T	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	682	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGCCCTCCGCCATACCCAA	0.682																																																	0													95.0	103.0	100.0					5																	140720582		2203	4299	6502	SO:0001583	missense	56113			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2044G>A	5.37:g.140720582G>A	ENSP00000378077:p.Ala682Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A682T	ENST00000394576.2	37	c.2044	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	9.432	1.085832	0.20390	.	.	ENSG00000081853	ENST00000394576	T	0.50001	0.76	5.05	-3.3	0.05003	Cadherin (1);	0.398311	0.17607	U	0.168221	T	0.24005	0.0581	N	0.22421	0.69	0.09310	N	1	B;B	0.20988	0.01;0.05	B;B	0.12837	0.008;0.006	T	0.23547	-1.0185	10	0.14252	T	0.57	.	7.5144	0.27592	0.3332:0.4806:0.1863:0.0	.	682;682	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	T	682	ENSP00000378077:A682T	ENSP00000378077:A682T	A	+	1	0	PCDHGA2	140700766	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.683000	0.00394	-0.531000	0.06340	-0.350000	0.07774	GCC	PCDHGA2	-	pfscan_Cadherin		0.682	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	G	NM_018915		140720582	+1	no_errors	ENST00000394576	ensembl	human	known	70_37	missense	SNP	0.000	A
PCDH12	51294	genome.wustl.edu	37	5	141334932	141334932	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:141334932G>C	ENST00000231484.3	-	1	3695	c.2485C>G	c.(2485-2487)Caa>Gaa	p.Q829E	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	829					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTTGCCTTGATTACGCAGC	0.617																																																	0													67.0	62.0	64.0					5																	141334932		2203	4300	6503	SO:0001583	missense	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2485C>G	5.37:g.141334932G>C	ENSP00000231484:p.Gln829Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q829E	ENST00000231484.3	37	c.2485	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465705	0.43839	.	.	ENSG00000113555	ENST00000231484	T	0.53206	0.63	5.07	5.07	0.68467	.	0.133684	0.52532	D	0.000073	T	0.50137	0.1598	M	0.66939	2.045	0.41859	D	0.990219	P	0.46656	0.882	B	0.43701	0.428	T	0.55042	-0.8202	10	0.49607	T	0.09	.	13.8159	0.63292	0.0:0.0:1.0:0.0	.	829	Q9NPG4	PCD12_HUMAN	E	829	ENSP00000231484:Q829E	ENSP00000231484:Q829E	Q	-	1	0	PCDH12	141315116	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	3.260000	0.51523	2.653000	0.90120	0.561000	0.74099	CAA	PCDH12	-	NULL		0.617	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	G	NM_016580		141334932	-1	no_errors	ENST00000231484	ensembl	human	known	70_37	missense	SNP	1.000	C
PCYT2	5833	genome.wustl.edu	37	17	79868881	79868881	+	Intron	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:79868881C>T	ENST00000538936.2	-	1	198				PCYT2_ENST00000571105.1_Intron|PCYT2_ENST00000570388.1_Intron|PCYT2_ENST00000538721.2_Intron|PCYT2_ENST00000331285.3_5'UTR|PCYT2_ENST00000570391.1_5'UTR	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	CTCCAGATCTCAGCGCGGTGG	0.736																																																	0																																										SO:0001627	intron_variant	5833			D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.89+261G>A	17.37:g.79868881C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	NULL	p.E34K	ENST00000538936.2	37	c.100	CCDS11791.1	17																																																																																			PCYT2	-	NULL		0.736	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT2	HGNC	protein_coding	OTTHUMT00000439939.1	C	NM_002861		79868881	-1	no_errors	ENST00000573401	ensembl	human	known	70_37	missense	SNP	0.015	T
PDHB	5162	genome.wustl.edu	37	3	58415943	58415943	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:58415943C>G	ENST00000302746.6	-	7	654	c.612G>C	c.(610-612)ttG>ttC	p.L204F	PDHB_ENST00000485460.1_Missense_Mutation_p.L186F|PDHB_ENST00000474765.1_Missense_Mutation_p.L186F|RP11-802O23.3_ENST00000607214.1_RNA	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	204					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	CCCCATACATCAATTCATTCT	0.328																																																	0													81.0	83.0	82.0					3																	58415943		2203	4300	6503	SO:0001583	missense	5162				CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.612G>C	3.37:g.58415943C>G	ENSP00000307241:p.Leu204Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.L204F	ENST00000302746.6	37	c.612	CCDS2890.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360127	0.82353	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460;ENST00000474765	D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89	6.17	6.17	0.99709	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.95227	0.8452	M	0.86953	2.85	0.80722	D	1	B;B;B;D	0.54207	0.06;0.214;0.014;0.965	B;B;B;P	0.52823	0.036;0.093;0.021;0.71	D	0.95407	0.8495	10	0.87932	D	0	-8.4108	15.8933	0.79318	0.0:0.9342:0.0:0.0658	.	186;186;186;204	B4DDD7;C9J634;P11177-2;P11177	.;.;.;ODPB_HUMAN	F	204;186;186;186	ENSP00000307241:L204F;ENSP00000373220:L186F;ENSP00000417267:L186F;ENSP00000418448:L186F	ENSP00000307241:L204F	L	-	3	2	PDHB	58390983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.284000	0.33249	2.941000	0.99782	0.655000	0.94253	TTG	PDHB	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd		0.328	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHB	HGNC	protein_coding	OTTHUMT00000353558.1	C			58415943	-1	no_errors	ENST00000302746	ensembl	human	known	70_37	missense	SNP	1.000	G
PIEZO2	63895	genome.wustl.edu	37	18	10705483	10705483	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:10705483G>A	ENST00000503781.3	-	37	5510	c.5511C>T	c.(5509-5511)ttC>ttT	p.F1837F	RP11-856M7.2_ENST00000584167.1_RNA|PIEZO2_ENST00000580640.1_Silent_p.F1862F|PIEZO2_ENST00000302079.6_Silent_p.F1837F	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	1837					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										ACAGATGCTCGAAGCTCACAG	0.632																																																	0													61.0	69.0	66.0					18																	10705483		692	1591	2283	SO:0001819	synonymous_variant	63895			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.5511C>T	18.37:g.10705483G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	pfam_DUF3595	p.F1862	ENST00000503781.3	37	c.5586		18																																																																																			PIEZO2	-	NULL		0.632	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	G	NM_022068		10705483	-1	no_errors	ENST00000580640	ensembl	human	novel	70_37	silent	SNP	0.034	A
PIEZO2	63895	genome.wustl.edu	37	18	10857131	10857131	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:10857131C>T	ENST00000503781.3	-	6	570	c.571G>A	c.(571-573)Gag>Aag	p.E191K	PIEZO2_ENST00000580640.1_Missense_Mutation_p.E191K|PIEZO2_ENST00000302079.6_Missense_Mutation_p.E191K	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	191					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TCTTCCAACTCGCCTTCAACA	0.438																																																	0													182.0	152.0	161.0					18																	10857131		692	1591	2283	SO:0001583	missense	63895			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.571G>A	18.37:g.10857131C>T	ENSP00000421377:p.Glu191Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	NULL	p.E191K	ENST00000503781.3	37	c.571		18	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648347	0.67358	.	.	ENSG00000154864	ENST00000302079	T	0.73152	-0.72	5.26	5.26	0.73747	.	0.466367	0.25169	N	0.032618	T	0.69459	0.3113	L	0.29908	0.895	0.80722	D	1	.	.	.	.	.	.	T	0.63363	-0.6654	8	0.19590	T	0.45	-15.2501	19.2202	0.93793	0.0:1.0:0.0:0.0	.	.	.	.	K	191	ENSP00000303316:E191K	ENSP00000303316:E191K	E	-	1	0	FAM38B	10847131	1.000000	0.71417	0.978000	0.43139	0.990000	0.78478	5.168000	0.64978	2.621000	0.88768	0.591000	0.81541	GAG	PIEZO2	-	NULL		0.438	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	C	NM_022068		10857131	-1	no_errors	ENST00000582913	ensembl	human	known	70_37	missense	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936082	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209218783	209218783	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:209218783C>G	ENST00000264380.4	+	40	6164	c.6006C>G	c.(6004-6006)atC>atG	p.I2002M		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	2002	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GAACCTCGATCCATAGTGACT	0.418																																																	0													178.0	175.0	176.0					2																	209218783		2203	4300	6503	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.6006C>G	2.37:g.209218783C>G	ENSP00000264380:p.Ile2002Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.I2002M	ENST00000264380.4	37	c.6006	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442162	0.63067	.	.	ENSG00000115020	ENST00000264380	T	0.35048	1.33	6.17	5.3	0.74995	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	M	0.76433	2.335	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.61845	-0.6979	10	0.87932	D	0	-16.9687	9.6181	0.39704	0.2295:0.7021:0.0:0.0684	.	2002	Q9Y2I7	FYV1_HUMAN	M	2002	ENSP00000264380:I2002M	ENSP00000264380:I2002M	I	+	3	3	PIKFYVE	208927028	1.000000	0.71417	0.994000	0.49952	0.899000	0.52679	1.121000	0.31283	1.627000	0.50400	0.655000	0.94253	ATC	PIKFYVE	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub		0.418	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	C	NM_015040		209218783	+1	no_errors	ENST00000264380	ensembl	human	known	70_37	missense	SNP	1.000	G
PKD2L2	27039	genome.wustl.edu	37	5	137235254	137235254	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:137235254C>G	ENST00000508883.1	+	5	600	c.574C>G	c.(574-576)Ctt>Gtt	p.L192V	PKD2L2_ENST00000290431.5_Missense_Mutation_p.L192V|PKD2L2_ENST00000502810.1_Missense_Mutation_p.L192V|PKD2L2_ENST00000508638.1_Missense_Mutation_p.L192V|PKD2L2_ENST00000350250.4_Missense_Mutation_p.L158V			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	192					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTGGGGATTTCTTGGTGTTTA	0.388																																																	0													126.0	115.0	118.0					5																	137235254		1828	4086	5914	SO:0001583	missense	27039			AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.574C>G	5.37:g.137235254C>G	ENSP00000424725:p.Leu192Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	p.L192V	ENST00000508883.1	37	c.574		5	.	.	.	.	.	.	.	.	.	.	C	6.483	0.457356	0.12342	.	.	ENSG00000078795	ENST00000503015;ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	5.37	-2.17	0.07059	Polycystin cation channel, PKD1/PKD2 (1);	0.218066	0.31709	N	0.007193	T	0.39655	0.1086	N	0.03917	-0.325	0.09310	N	1	B;B;B	0.15141	0.001;0.012;0.0	B;B;B	0.14578	0.006;0.011;0.001	T	0.18304	-1.0341	10	0.23302	T	0.38	-1.2474	1.9424	0.03349	0.3792:0.2223:0.2918:0.1067	.	192;192;192	Q9NZM6;E9PC91;Q9NZM6-5	PK2L2_HUMAN;.;.	V	102;158;192;192;192;192	ENSP00000424885:L102V;ENSP00000344177:L158V;ENSP00000423382:L192V;ENSP00000425513:L192V;ENSP00000424725:L192V;ENSP00000290431:L192V	ENSP00000290431:L192V	L	+	1	0	PKD2L2	137263153	0.000000	0.05858	0.722000	0.30670	0.990000	0.78478	-0.596000	0.05720	-0.435000	0.07264	-0.165000	0.13383	CTT	PKD2L2	-	pfam_PKD1_2_channel		0.388	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	HGNC	protein_coding	OTTHUMT00000372521.1	C	NM_014386		137235254	+1	no_errors	ENST00000508883	ensembl	human	known	70_37	missense	SNP	0.009	G
PLEC	5339	genome.wustl.edu	37	8	144994213	144994213	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:144994213G>C	ENST00000322810.4	-	32	10356	c.10187C>G	c.(10186-10188)tCt>tGt	p.S3396C	PLEC_ENST00000354958.2_Missense_Mutation_p.S3237C|PLEC_ENST00000354589.3_Missense_Mutation_p.S3259C|PLEC_ENST00000436759.2_Missense_Mutation_p.S3286C|PLEC_ENST00000357649.2_Missense_Mutation_p.S3263C|PLEC_ENST00000527096.1_Missense_Mutation_p.S3282C|PLEC_ENST00000356346.3_Missense_Mutation_p.S3245C|PLEC_ENST00000398774.2_Missense_Mutation_p.S3227C|PLEC_ENST00000345136.3_Missense_Mutation_p.S3259C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3396	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GAAGTACTCAGAGCTGATGAG	0.592																																																	0													56.0	63.0	60.0					8																	144994213		2162	4249	6411	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10187C>G	8.37:g.144994213G>C	ENSP00000323856:p.Ser3396Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.S3396C	ENST00000322810.4	37	c.10187	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	G	8.856	0.945673	0.18356	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.91740	-2.88;-2.88;-2.9;-2.9;-2.86;-2.87;-2.87;-2.86;-2.87	4.76	3.89	0.44902	.	0.000000	0.64402	U	0.000006	D	0.95367	0.8496	M	0.83483	2.645	0.49299	D	0.999778	D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.998;0.999;0.999;0.999;0.999	D;D;D;P;D;D;D;D	0.63192	0.912;0.912;0.912;0.818;0.912;0.912;0.912;0.912	D	0.95550	0.8620	10	0.87932	D	0	.	13.0928	0.59174	0.08:0.0:0.92:0.0	.	3286;3245;3237;3396;3227;3259;3263;3259	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	3259;3263;3259;3227;3396;3237;3245;3286;3282	ENSP00000344848:S3259C;ENSP00000350277:S3263C;ENSP00000346602:S3259C;ENSP00000381756:S3227C;ENSP00000323856:S3396C;ENSP00000347044:S3237C;ENSP00000348702:S3245C;ENSP00000388180:S3286C;ENSP00000434583:S3282C	ENSP00000323856:S3396C	S	-	2	0	PLEC	145066201	1.000000	0.71417	0.195000	0.23364	0.757000	0.42996	7.746000	0.85057	1.103000	0.41568	0.448000	0.29417	TCT	PLEC	-	NULL		0.592	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	G	NM_000445		144994213	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	missense	SNP	0.999	C
PLEC	5339	genome.wustl.edu	37	8	144995001	144995001	+	Silent	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:144995001G>C	ENST00000322810.4	-	32	9568	c.9399C>G	c.(9397-9399)ctC>ctG	p.L3133L	PLEC_ENST00000354958.2_Silent_p.L2974L|PLEC_ENST00000354589.3_Silent_p.L2996L|PLEC_ENST00000436759.2_Silent_p.L3023L|PLEC_ENST00000357649.2_Silent_p.L3000L|PLEC_ENST00000527096.1_Silent_p.L3019L|PLEC_ENST00000356346.3_Silent_p.L2982L|PLEC_ENST00000398774.2_Silent_p.L2964L|PLEC_ENST00000345136.3_Silent_p.L2996L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3133	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCTGGTAGAGCTCGCGGT	0.672																																																	0													17.0	21.0	19.0					8																	144995001		2040	4121	6161	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9399C>G	8.37:g.144995001G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L3133	ENST00000322810.4	37	c.9399	CCDS43772.1	8																																																																																			PLEC	-	smart_Plectin_repeat		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	G	NM_000445		144995001	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	silent	SNP	0.554	C
PMS1	5378	genome.wustl.edu	37	2	190682823	190682823	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:190682823G>A	ENST00000441310.2	+	5	732	c.499G>A	c.(499-501)Gat>Aat	p.D167N	PMS1_ENST00000432292.3_De_novo_Start_OutOfFrame|PMS1_ENST00000418224.3_De_novo_Start_OutOfFrame|PMS1_ENST00000447232.2_Missense_Mutation_p.D167N|PMS1_ENST00000409823.3_Missense_Mutation_p.D167N|PMS1_ENST00000421722.1_3'UTR	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	167					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AAAATGTAAAGATGAAATAAA	0.318			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													41.0	42.0	42.0					2																	190682823		2202	4297	6499	SO:0001583	missense	5378				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.499G>A	2.37:g.190682823G>A	ENSP00000406490:p.Asp167Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.D167N	ENST00000441310.2	37	c.499	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.105759	0.94292	.	.	ENSG00000064933	ENST00000441310;ENST00000409823;ENST00000424766;ENST00000447232;ENST00000424307	T;T;T;T;D	0.89810	-0.74;-0.74;-0.74;-0.74;-2.57	5.36	5.36	0.76844	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.095595	0.64402	D	0.000001	D	0.91888	0.7432	M	0.69823	2.125	0.80722	D	1	B;P;B;P;B;B;B	0.39044	0.255;0.454;0.235;0.656;0.255;0.409;0.255	B;B;B;P;B;B;B	0.47162	0.155;0.186;0.115;0.54;0.109;0.184;0.155	D	0.92191	0.5759	10	0.66056	D	0.02	-21.2146	19.4502	0.94863	0.0:0.0:1.0:0.0	.	167;167;167;167;167;167;167	Q4VAL4;B4DMF4;Q5FBZ4;Q5FBZ9;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	N	167;167;167;167;106	ENSP00000406490:D167N;ENSP00000387125:D167N;ENSP00000410082:D167N;ENSP00000401064:D167N;ENSP00000389938:D106N	ENSP00000387125:D167N	D	+	1	0	PMS1	190391068	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.972000	0.93424	2.681000	0.91329	0.585000	0.79938	GAT	PMS1	-	superfamily_ATPase-like_ATP-bd,tigrfam_DNA_mismatch_repair_N		0.318	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	G			190682823	+1	no_errors	ENST00000441310	ensembl	human	known	70_37	missense	SNP	1.000	A
PNOC	5368	genome.wustl.edu	37	8	28186791	28186791	+	Silent	SNP	C	C	T	rs368188580		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:28186791C>T	ENST00000301908.3	+	2	325	c.117C>T	c.(115-117)ttC>ttT	p.F39F	RP11-380I10.4_ENST00000521731.1_RNA	NM_006228.3	NP_006219.1	Q13519	PNOC_HUMAN	prepronociceptin	39					neuropeptide signaling pathway (GO:0007218)|sensory perception (GO:0007600)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)		TGGACAGCTTCGACCTGGAGG	0.582																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	111.0	92.0	98.0		117	3.7	0.9	8		98	0,8600		0,0,4300	no	coding-synonymous	PNOC	NM_006228.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		39/177	28186791	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5368				CCDS6066.1, CCDS64862.1	8p21	2013-02-26			ENSG00000168081	ENSG00000168081		"""Endogenous ligands"""	9163	protein-coding gene	gene with protein product	"""nocistatin"""	601459				8710928, 10101606	Standard	XM_005273532		Approved	PPNOC	uc003xgp.3	Q13519	OTTHUMG00000102125	ENST00000301908.3:c.117C>T	8.37:g.28186791C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z749|Q6FH16	Silent	SNP	pfam_Opioid_neupept,prints_Nociceptin,prints_Opioid_neupept	p.F39	ENST00000301908.3	37	c.117	CCDS6066.1	8																																																																																			PNOC	-	pfam_Opioid_neupept,prints_Nociceptin		0.582	PNOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNOC	HGNC	protein_coding	OTTHUMT00000219964.2	C	NM_006228		28186791	+1	no_errors	ENST00000301908	ensembl	human	known	70_37	silent	SNP	0.893	T
PPARGC1B	133522	genome.wustl.edu	37	5	149212372	149212372	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:149212372G>A	ENST00000309241.5	+	5	768	c.736G>A	c.(736-738)Gag>Aag	p.E246K	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.E246K|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.E182K|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.E207K	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	246					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCCTGCCAAGGAGGACAAGGA	0.672																																																	0													40.0	48.0	45.0					5																	149212372		2203	4299	6502	SO:0001583	missense	133522			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.736G>A	5.37:g.149212372G>A	ENSP00000312649:p.Glu246Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E246K	ENST00000309241.5	37	c.736	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	G	18.12	3.551960	0.65311	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.09817	3.01;2.94;2.96;3.01	5.76	5.76	0.90799	.	0.258172	0.35349	N	0.003267	T	0.16257	0.0391	L	0.59436	1.845	0.49582	D	0.999808	B;B;B;B;B	0.24368	0.021;0.096;0.021;0.012;0.102	B;B;B;B;B	0.27380	0.021;0.062;0.021;0.009;0.079	T	0.04737	-1.0930	10	0.25106	T	0.35	-28.4919	19.9759	0.97304	0.0:0.0:1.0:0.0	.	225;225;207;246;246	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	K	207;246;246;182	ENSP00000353638:E207K;ENSP00000377855:E246K;ENSP00000312649:E246K;ENSP00000384403:E182K	ENSP00000312649:E246K	E	+	1	0	PPARGC1B	149192565	1.000000	0.71417	0.999000	0.59377	0.640000	0.38277	3.458000	0.53014	2.713000	0.92767	0.655000	0.94253	GAG	PPARGC1B	-	NULL		0.672	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	G	NM_133263		149212372	+1	no_errors	ENST00000309241	ensembl	human	known	70_37	missense	SNP	1.000	A
PPM1B	5495	genome.wustl.edu	37	2	44428556	44428556	+	Missense_Mutation	SNP	C	C	T	rs202053989		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:44428556C>T	ENST00000282412.4	+	2	630	c.218C>T	c.(217-219)aCa>aTa	p.T73I	PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000409895.4_Missense_Mutation_p.T73I|PPM1B_ENST00000378551.2_Missense_Mutation_p.T73I|PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000409432.3_Missense_Mutation_p.T73I	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	73					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TACTGCTCAACACATTTATTA	0.423																																																	0													163.0	147.0	153.0					2																	44428556		2203	4300	6503	SO:0001583	missense	5495			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.218C>T	2.37:g.44428556C>T	ENSP00000282412:p.Thr73Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.T73I	ENST00000282412.4	37	c.218	CCDS1817.1	2	.	.	.	.	.	.	.	.	.	.	C	14.30	2.495477	0.44352	.	.	ENSG00000138032	ENST00000419807;ENST00000409895;ENST00000409432;ENST00000282412;ENST00000378551;ENST00000409473	T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94;2.94	5.82	5.82	0.92795	Protein phosphatase 2C-like (5);	0.536331	0.22835	N	0.055054	T	0.13543	0.0328	L	0.31926	0.97	0.37087	D	0.899257	B;B;B;B;B	0.29612	0.251;0.001;0.116;0.017;0.058	B;B;B;B;B	0.37346	0.247;0.013;0.077;0.077;0.077	T	0.10730	-1.0617	10	0.52906	T	0.07	-4.509	15.665	0.77221	0.1377:0.8623:0.0:0.0	.	73;73;73;73;73	Q4J6C0;O75688-2;Q4J6C1;O75688;Q4J6C2	.;.;.;PPM1B_HUMAN;.	I	73	ENSP00000390087:T73I;ENSP00000387341:T73I;ENSP00000387287:T73I;ENSP00000282412:T73I;ENSP00000367813:T73I;ENSP00000386982:T73I	ENSP00000282412:T73I	T	+	2	0	PPM1B	44282060	0.287000	0.24315	0.991000	0.47740	0.976000	0.68499	4.024000	0.57218	2.752000	0.94435	0.655000	0.94253	ACA	PPM1B	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like		0.423	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	C	NM_002706		44428556	+1	no_errors	ENST00000282412	ensembl	human	known	70_37	missense	SNP	0.954	T
PRKCDBP	112464	genome.wustl.edu	37	11	6340598	6340598	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:6340598G>C	ENST00000303927.3	-	2	751	c.581C>G	c.(580-582)tCg>tGg	p.S194W	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.S226W	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	194					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)		p.S194L(1)		large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TTTCCGGCCCGAAAGGGCCCT	0.716																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											23.0	31.0	28.0					11																	6340598		2197	4294	6491	SO:0001583	missense	112464			AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.581C>G	11.37:g.6340598G>C	ENSP00000307292:p.Ser194Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S194W	ENST00000303927.3	37	c.581	CCDS7762.1	11	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965055	0.74131	.	.	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.72725	-0.68;-0.68	5.08	5.08	0.68730	.	0.067853	0.64402	D	0.000010	T	0.73737	0.3625	N	0.19112	0.55	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.77755	-0.2469	10	0.87932	D	0	-16.1931	13.9712	0.64242	0.0:0.0:1.0:0.0	.	194	Q969G5	PRDBP_HUMAN	W	194;226	ENSP00000307292:S194W;ENSP00000432047:S226W	ENSP00000307292:S194W	S	-	2	0	PRKCDBP	6297174	1.000000	0.71417	0.173000	0.22940	0.988000	0.76386	3.722000	0.54948	2.368000	0.80403	0.561000	0.74099	TCG	PRKCDBP	-	NULL		0.716	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCDBP	HGNC	protein_coding	OTTHUMT00000257228.2	G	NM_145040		6340598	-1	no_errors	ENST00000303927	ensembl	human	known	70_37	missense	SNP	0.486	C
PRDM11	56981	genome.wustl.edu	37	11	45245934	45245934	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:45245934G>A	ENST00000530656.1	+	7	1011	c.1011G>A	c.(1009-1011)ctG>ctA	p.L337L	PRDM11_ENST00000263765.4_Silent_p.L337L|CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000424263.2_Silent_p.L303L|PRDM11_ENST00000528980.1_Intron			Q9NQV5	PRD11_HUMAN	PR domain containing 11	337							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						AAATTGACCTGATTTTCAAGG	0.512																																					NSCLC(118;1511 1736 6472 36603 43224)												0													144.0	150.0	148.0					11																	45245934		2203	4299	6502	SO:0001819	synonymous_variant	56981			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1011G>A	11.37:g.45245934G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N9F1	Silent	SNP	pfscan_SET_dom	p.L337	ENST00000530656.1	37	c.1011		11																																																																																			PRDM11	-	NULL		0.512	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	G	NM_020229		45245934	+1	no_errors	ENST00000263765	ensembl	human	known	70_37	silent	SNP	1.000	A
PPP1CA	5499	genome.wustl.edu	37	11	67168188	67168188	+	Silent	SNP	G	G	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:67168188G>T	ENST00000376745.4	-	3	538	c.390C>A	c.(388-390)atC>atA	p.I130I	PPP1CA_ENST00000532446.1_5'UTR|PPP1CA_ENST00000358239.4_Silent_p.I86I|PPP1CA_ENST00000312989.7_Silent_p.I141I	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	130					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			AGATGCGGTTGATGCTGGCAC	0.562																																																	0													105.0	95.0	99.0					11																	67168188		2200	4295	6495	SO:0001819	synonymous_variant	5499				CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.390C>A	11.37:g.67168188G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Silent	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.I141	ENST00000376745.4	37	c.423	CCDS8160.1	11																																																																																			PPP1CA	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase		0.562	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CA	HGNC	protein_coding	OTTHUMT00000395487.1	G	NM_002708		67168188	-1	no_errors	ENST00000312989	ensembl	human	known	70_37	silent	SNP	1.000	T
PRR23B	389151	genome.wustl.edu	37	3	138738973	138738973	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:138738973C>T	ENST00000329447.5	-	1	795	c.531G>A	c.(529-531)ggG>ggA	p.G177G	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	177										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGGGGTAGAGCCCAGCGGCTG	0.652																																																	0													32.0	40.0	38.0					3																	138738973		2201	4300	6501	SO:0001819	synonymous_variant	389151			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.531G>A	3.37:g.138738973C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNV9	Silent	SNP	pfam_UPF0572	p.G177	ENST00000329447.5	37	c.531	CCDS33868.1	3																																																																																			PRR23B	-	pfam_UPF0572		0.652	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23B	HGNC	protein_coding	OTTHUMT00000361501.1	C	NM_001013650		138738973	-1	no_errors	ENST00000329447	ensembl	human	known	70_37	silent	SNP	0.002	T
PUM2	23369	genome.wustl.edu	37	2	20453700	20453700	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:20453700C>G	ENST00000361078.2	-	19	2974	c.2952G>C	c.(2950-2952)caG>caC	p.Q984H	PUM2_ENST00000403432.1_Missense_Mutation_p.Q982H|PUM2_ENST00000536417.1_Missense_Mutation_p.Q926H|PUM2_ENST00000338086.5_Missense_Mutation_p.Q982H|PUM2_ENST00000319801.5_Missense_Mutation_p.Q905H			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	984	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACCATCATTCTGGCAGCAAA	0.418																																																	0													188.0	163.0	172.0					2																	20453700		2203	4300	6503	SO:0001583	missense	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.2952G>C	2.37:g.20453700C>G	ENSP00000354370:p.Gln984His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.Q984H	ENST00000361078.2	37	c.2952		2	.	.	.	.	.	.	.	.	.	.	C	10.27	1.302620	0.23736	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.07638	0.0192	N	0.16708	0.43	0.80722	D	1	B;P;B;P	0.46327	0.006;0.687;0.396;0.876	B;B;B;B	0.31016	0.002;0.021;0.021;0.123	T	0.39840	-0.9594	10	0.14656	T	0.56	-2.9054	19.1508	0.93487	0.0:1.0:0.0:0.0	.	926;903;982;984	B4E2B6;B7ZL34;Q8TB72-3;Q8TB72	.;.;.;PUM2_HUMAN	H	982;984;905;794;982;926	ENSP00000338173:Q982H;ENSP00000354370:Q984H;ENSP00000326746:Q905H;ENSP00000409905:Q794H;ENSP00000385992:Q982H;ENSP00000440093:Q926H	ENSP00000326746:Q905H	Q	-	3	2	PUM2	20317181	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	6.052000	0.71080	2.519000	0.84933	0.655000	0.94253	CAG	PUM2	-	superfamily_ARM-type_fold,pfscan_Pumilio_RNA-bd_rpt		0.418	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	HGNC	protein_coding		C	NM_015317		20453700	-1	no_errors	ENST00000361078	ensembl	human	known	70_37	missense	SNP	1.000	G
PVRL1	5818	genome.wustl.edu	37	11	119494210	119494210	+	RNA	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:119494210G>A	ENST00000532153.1	+	0	117																											AGGGAACCGAGATATAGGATG	0.617																																																	0													57.0	62.0	60.0					11																	119494210		692	1591	2283			5818																															11.37:g.119494210G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000532153.1	37	NULL		11																																																																																			PVRL1	-	-		0.617	RP11-196E1.3-001	KNOWN	basic	antisense	PVRL1	HGNC	antisense	OTTHUMT00000388380.1	G			119494210	-1	no_errors	ENST00000531468	ensembl	human	putative	70_37	rna	SNP	0.001	A
R3HCC1	203069	genome.wustl.edu	37	8	23153596	23153596	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:23153596C>T	ENST00000411463.1	+	9	1429	c.1429C>T	c.(1429-1431)Ccg>Tcg	p.P477S	R3HCC1_ENST00000265806.6_Missense_Mutation_p.P250S|R3HCC1_ENST00000522012.1_3'UTR|R3HCC1_ENST00000518454.1_Missense_Mutation_p.P250S			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	477							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						TGTCCGGGGTCCGCTGCCGCC	0.662											OREG0018634	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													10.0	17.0	15.0					8																	23153596		692	1591	2283	SO:0001583	missense	203069				CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.1429C>T	8.37:g.23153596C>T	ENSP00000397555:p.Pro477Ser	Somatic	761	WXS	Illumina HiSeq	Phase_IV	B7ZLI1	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.P477S	ENST00000411463.1	37	c.1429		8	.	.	.	.	.	.	.	.	.	.	C	5.277	0.236606	0.10023	.	.	ENSG00000104679	ENST00000518454;ENST00000265806;ENST00000411463	T;T;T	0.23552	1.9;1.9;2.51	5.01	1.93	0.25924	.	3.947380	0.00496	N	0.000148	T	0.22551	0.0544	N	0.22421	0.69	0.09310	N	1	B	0.19331	0.035	B	0.14578	0.011	T	0.31308	-0.9948	10	0.37606	T	0.19	10.0839	12.5537	0.56242	0.0:0.5034:0.4966:0.0	.	477	Q9Y3T6	R3HC1_HUMAN	S	250;250;477	ENSP00000430607:P250S;ENSP00000265806:P250S;ENSP00000397555:P477S	ENSP00000265806:P250S	P	+	1	0	R3HCC1	23209541	0.001000	0.12720	0.005000	0.12908	0.057000	0.15508	0.144000	0.16135	0.737000	0.32582	-0.176000	0.13171	CCG	R3HCC1	-	NULL		0.662	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	R3HCC1	HGNC	protein_coding		C	NM_001136108		23153596	+1	no_errors	ENST00000411463	ensembl	human	known	70_37	missense	SNP	0.002	T
RBL2	5934	genome.wustl.edu	37	16	53504396	53504396	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:53504396C>T	ENST00000262133.6	+	16	2484	c.2347C>T	c.(2347-2349)Cag>Tag	p.Q783*	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	783	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCTCAGTGCTCAGGCCCTGGC	0.532																																																	0													56.0	55.0	55.0					16																	53504396		2198	4300	6498	SO:0001587	stop_gained	5934			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2347C>T	16.37:g.53504396C>T	ENSP00000262133:p.Gln783*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Nonsense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,smart_Cyclin-like	p.Q783*	ENST00000262133.6	37	c.2347	CCDS10748.1	16	.	.	.	.	.	.	.	.	.	.	C	39	7.807599	0.98501	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-11.8634	19.8354	0.96655	0.0:1.0:0.0:0.0	.	.	.	.	X	783;493	.	ENSP00000262133:Q783X	Q	+	1	0	RBL2	52061897	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.061000	0.76699	2.686000	0.91538	0.555000	0.69702	CAG	RBL2	-	NULL		0.532	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	HGNC	protein_coding	OTTHUMT00000256908.3	C	NM_005611		53504396	+1	no_errors	ENST00000262133	ensembl	human	known	70_37	nonsense	SNP	1.000	T
GBA2	57704	genome.wustl.edu	37	9	35749263	35749263	+	5'Flank	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:35749263G>A	ENST00000378103.3	-	0	0				RGP1_ENST00000456972.2_Missense_Mutation_p.E21K|GBA2_ENST00000378094.4_5'Flank|RGP1_ENST00000378078.4_5'Flank|GBA2_ENST00000545786.1_Intron	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGACTCCGCGGAGGGTGGGGG	0.766																																																	0													6.0	9.0	8.0					9																	35749263		1728	3903	5631	SO:0001631	upstream_gene_variant	9827			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35749263G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Rgp1	p.E21K	ENST00000378103.3	37	c.61	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764617	0.89932	.	.	ENSG00000107185	ENST00000456972	.	.	.	5.23	0.963	0.19649	.	.	.	.	.	T	0.29126	0.0724	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31696	-0.9934	5	0.59425	D	0.04	.	2.1596	0.03821	0.189:0.1541:0.499:0.1579	.	.	.	.	K	21	.	ENSP00000409466:E21K	E	+	1	0	RGP1	35739263	0.000000	0.05858	0.000000	0.03702	0.674000	0.39518	0.205000	0.17356	0.564000	0.29238	0.491000	0.48974	GAG	RGP1	-	NULL		0.766	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	G	NM_020944		35749263	+1	no_errors	ENST00000456972	ensembl	human	known	70_37	missense	SNP	0.000	A
GBA2	57704	genome.wustl.edu	37	9	35749382	35749382	+	5'Flank	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:35749382G>A	ENST00000378103.3	-	0	0				RGP1_ENST00000456972.2_Silent_p.P26P|GBA2_ENST00000378094.4_5'Flank|RGP1_ENST00000378078.4_5'UTR|GBA2_ENST00000545786.1_Intron	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TAGGGGTGCCGATCCCTAGTG	0.682																																																	0													48.0	59.0	55.0					9																	35749382		1927	4113	6040	SO:0001631	upstream_gene_variant	9827			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35749382G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Silent	SNP	pfam_Rgp1	p.P26	ENST00000378103.3	37	c.78	CCDS6589.1	9																																																																																			RGP1	-	NULL		0.682	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000055456.1	G	NM_020944		35749382	+1	no_errors	ENST00000456972	ensembl	human	known	70_37	silent	SNP	0.000	A
RGS4	5999	genome.wustl.edu	37	1	163042594	163042594	+	Splice_Site	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:163042594G>C	ENST00000367909.6	+	3	489		c.e3-1		RGS4_ENST00000527809.1_Splice_Site|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000421743.2_Splice_Site|RGS4_ENST00000367908.4_Splice_Site|RGS4_ENST00000367906.3_Splice_Site|RGS4_ENST00000531057.1_Splice_Site	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4						inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						ATTTTTTCTAGAGTGAGCCAA	0.383																																					Ovarian(76;1257 1738 3039 6086)												0													62.0	60.0	61.0					1																	163042594		2203	4300	6503	SO:0001630	splice_region_variant	5999			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.150-1G>C	1.37:g.163042594G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Splice_Site	SNP	-	e4-1	ENST00000367909.6	37	c.441-1	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	G	7.029	0.560316	0.13498	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000527809;ENST00000367908;ENST00000367906;ENST00000528938	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1682	0.65490	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGS4	161309218	1.000000	0.71417	0.944000	0.38274	0.071000	0.16799	5.551000	0.67274	2.162000	0.67917	0.655000	0.94253	.	RGS4	-	-		0.383	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	G	NM_005613	Intron	163042594	+1	no_errors	ENST00000421743	ensembl	human	known	70_37	splice_site	SNP	1.000	C
RICTOR	253260	genome.wustl.edu	37	5	38957799	38957799	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:38957799C>T	ENST00000357387.3	-	25	2484	c.2454G>A	c.(2452-2454)ctG>ctA	p.L818L	RICTOR_ENST00000503698.1_5'UTR|RICTOR_ENST00000296782.5_Silent_p.L818L	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CTCTTTCATTCAGATAGGAAA	0.308																																																	0													94.0	100.0	98.0					5																	38957799		2202	4297	6499	SO:0001819	synonymous_variant	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2454G>A	5.37:g.38957799C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	superfamily_ARM-type_fold	p.L818	ENST00000357387.3	37	c.2454	CCDS34148.1	5																																																																																			RICTOR	-	superfamily_ARM-type_fold		0.308	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	C	NM_152756		38957799	-1	no_errors	ENST00000296782	ensembl	human	known	70_37	silent	SNP	1.000	T
SAMD4B	55095	genome.wustl.edu	37	19	39871358	39871358	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:39871358C>T	ENST00000314471.6	+	13	2816	c.1781C>T	c.(1780-1782)tCg>tTg	p.S594L	SAMD4B_ENST00000596368.1_Intron|SAMD4B_ENST00000598913.1_Missense_Mutation_p.S594L	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	594					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CTGAGCCCCTCGGGCATTGGG	0.716																																																	0													11.0	13.0	12.0					19																	39871358		2186	4272	6458	SO:0001583	missense	55095				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1781C>T	19.37:g.39871358C>T	ENSP00000317224:p.Ser594Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5Z0M6|Q6P194	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.S594L	ENST00000314471.6	37	c.1781	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480609	0.63849	.	.	ENSG00000179134	ENST00000314471;ENST00000429637	.	.	.	4.74	4.74	0.60224	.	0.230034	0.32703	N	0.005749	T	0.47893	0.1470	L	0.42245	1.32	0.37888	D	0.930603	B;B	0.24132	0.098;0.098	B;B	0.15052	0.012;0.012	T	0.54702	-0.8254	9	0.66056	D	0.02	.	11.0125	0.47671	0.0:0.8116:0.1884:0.0	.	594;594	Q5PRF9;A5Z0M6	SMAG2_HUMAN;.	L	594	.	ENSP00000317224:S594L	S	+	2	0	SAMD4B	44563198	0.109000	0.22037	0.955000	0.39395	0.963000	0.63663	0.523000	0.22925	2.463000	0.83235	0.455000	0.32223	TCG	SAMD4B	-	NULL		0.716	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	HGNC	protein_coding	OTTHUMT00000464467.1	C	NM_018028		39871358	+1	no_errors	ENST00000314471	ensembl	human	known	70_37	missense	SNP	0.982	T
SLAMF1	6504	genome.wustl.edu	37	1	160582348	160582348	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:160582348G>C	ENST00000302035.6	-	6	1236	c.887C>G	c.(886-888)tCc>tGc	p.S296C	SLAMF1_ENST00000538290.1_3'UTR|SLAMF1_ENST00000235739.5_Missense_Mutation_p.S266C	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	296					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGCTGGGAAGGAGTCAAGTTT	0.507																																																	0													61.0	58.0	59.0					1																	160582348		2203	4300	6503	SO:0001583	missense	6504			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.887C>G	1.37:g.160582348G>C	ENSP00000306190:p.Ser296Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W172|Q9HBE8	Missense_Mutation	SNP	pfam_Sig_lymph_act_molc_N,pfscan_Ig-like	p.S296C	ENST00000302035.6	37	c.887	CCDS1207.1	1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089554	0.55968	.	.	ENSG00000117090	ENST00000302035;ENST00000235739	T;T	0.41065	1.01;1.01	4.21	2.12	0.27331	.	0.976410	0.08408	N	0.950423	T	0.15349	0.0370	L	0.44542	1.39	0.09310	N	0.999999	P	0.39624	0.681	B	0.36289	0.221	T	0.21655	-1.0239	10	0.59425	D	0.04	-0.2082	4.8536	0.13549	0.1346:0.21:0.6554:0.0	.	296	Q13291	SLAF1_HUMAN	C	296;266	ENSP00000306190:S296C;ENSP00000235739:S266C	ENSP00000235739:S266C	S	-	2	0	SLAMF1	158848972	0.006000	0.16342	0.000000	0.03702	0.599000	0.36880	0.508000	0.22692	0.595000	0.29777	0.655000	0.94253	TCC	SLAMF1	-	NULL		0.507	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF1	HGNC	protein_coding	OTTHUMT00000060454.1	G			160582348	-1	no_errors	ENST00000302035	ensembl	human	known	70_37	missense	SNP	0.000	C
SLC41A1	254428	genome.wustl.edu	37	1	205767910	205767910	+	Missense_Mutation	SNP	C	C	T	rs373421823		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:205767910C>T	ENST00000367137.3	-	6	1745	c.731G>A	c.(730-732)cGc>cAc	p.R244H	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	244					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CCCAATCTTGCGAGAGCCAAT	0.547																																																	0								C	HIS/ARG	0,4406		0,0,2203	101.0	96.0	97.0		731	5.7	1.0	1		97	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC41A1	NM_173854.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	244/514	205767910	1,13005	2203	4300	6503	SO:0001583	missense	254428			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.731G>A	1.37:g.205767910C>T	ENSP00000356105:p.Arg244His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr	p.R244H	ENST00000367137.3	37	c.731	CCDS30988.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790887	0.90367	0.0	1.16E-4	ENSG00000133065	ENST00000367137	T	0.30714	1.52	5.71	5.71	0.89125	MgtE magnesium transporter, integral membrane (1);	0.044183	0.85682	D	0.000000	T	0.37404	0.1002	M	0.64567	1.98	0.58432	D	0.999999	P	0.34815	0.47	B	0.42163	0.378	T	0.07501	-1.0769	10	0.27785	T	0.31	0.8534	12.7691	0.57410	0.0:0.9241:0.0:0.0759	.	244	Q8IVJ1	S41A1_HUMAN	H	244	ENSP00000356105:R244H	ENSP00000356105:R244H	R	-	2	0	SLC41A1	204034533	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.672000	0.61597	2.704000	0.92352	0.655000	0.94253	CGC	SLC41A1	-	pfam_MgtE_Mg_transptr_membr		0.547	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	C			205767910	-1	no_errors	ENST00000367137	ensembl	human	known	70_37	missense	SNP	1.000	T
SLITRK6	84189	genome.wustl.edu	37	13	86368132	86368132	+	Missense_Mutation	SNP	C	C	G	rs368371577		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr13:86368132C>G	ENST00000400286.2	-	2	3110	c.2512G>C	c.(2512-2514)Gag>Cag	p.E838Q		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	838					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GTTTGCTGCTCCAGGACTTCT	0.393																																																	0													84.0	77.0	79.0					13																	86368132		1866	4103	5969	SO:0001583	missense	84189			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.2512G>C	13.37:g.86368132C>G	ENSP00000383143:p.Glu838Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E838Q	ENST00000400286.2	37	c.2512	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286036	0.80803	.	.	ENSG00000184564	ENST00000400286	T	0.73258	-0.73	6.0	6.0	0.97389	.	0.000000	0.64402	U	0.000002	D	0.82416	0.5032	L	0.55213	1.73	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.82657	-0.0349	10	0.87932	D	0	-2.769	19.0603	0.93090	0.0:1.0:0.0:0.0	.	838	Q9H5Y7	SLIK6_HUMAN	Q	838	ENSP00000383143:E838Q	ENSP00000383143:E838Q	E	-	1	0	SLITRK6	85266133	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.456000	0.80751	2.848000	0.98002	0.637000	0.83480	GAG	SLITRK6	-	NULL		0.393	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	HGNC	protein_coding	OTTHUMT00000045404.2	C	NM_032229		86368132	-1	no_errors	ENST00000400286	ensembl	human	known	70_37	missense	SNP	1.000	G
SNED1	25992	genome.wustl.edu	37	2	242003111	242003111	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:242003111G>C	ENST00000310397.8	+	18	2479	c.2479G>C	c.(2479-2481)Gag>Cag	p.E827Q	SNED1_ENST00000342631.6_Missense_Mutation_p.E827Q|SNED1_ENST00000401884.1_Missense_Mutation_p.E827Q|SNED1_ENST00000405547.3_Missense_Mutation_p.E827Q|AC005237.4_ENST00000458377.1_RNA	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	827	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		AGTCCACTGTGAGACAGGTAG	0.642																																																	0													29.0	33.0	31.0					2																	242003111		1893	4103	5996	SO:0001583	missense	25992			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.2479G>C	2.37:g.242003111G>C	ENSP00000308893:p.Glu827Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Fibronectin_type3,pfam_Nidogen_extracell_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_Fibronectin_type3,superfamily_Complement_control_module,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Fibronectin_type3,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Sushi_SCR_CCP	p.E827Q	ENST00000310397.8	37	c.2479	CCDS46562.1	2	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656825	0.67586	.	.	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61	4.44	4.44	0.53790	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000042	D	0.96485	0.8853	M	0.62723	1.935	0.40631	D	0.981851	P;D	0.89917	0.59;1.0	B;D	0.85130	0.323;0.997	D	0.96891	0.9653	10	0.49607	T	0.09	.	16.6618	0.85242	0.0:0.0:1.0:0.0	.	827;827	B5MEF5;Q8TER0	.;SNED1_HUMAN	Q	827	ENSP00000384871:E827Q;ENSP00000386007:E827Q;ENSP00000308893:E827Q;ENSP00000342992:E827Q	ENSP00000308893:E827Q	E	+	1	0	SNED1	241651784	1.000000	0.71417	0.999000	0.59377	0.879000	0.50718	4.792000	0.62467	2.019000	0.59389	0.467000	0.42956	GAG	SNED1	-	smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.642	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNED1	HGNC	protein_coding	OTTHUMT00000323935.2	G	XM_059482		242003111	+1	no_errors	ENST00000310397	ensembl	human	known	70_37	missense	SNP	1.000	C
SOCS3	9021	genome.wustl.edu	37	17	76354722	76354722	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:76354722G>A	ENST00000330871.2	-	2	870	c.455C>T	c.(454-456)tCt>tTt	p.S152F	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	152					branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			TGGCTGGGCAGACGGCTGCTC	0.662																																																	0													16.0	20.0	19.0					17																	76354722		2189	4276	6465	SO:0001583	missense	9021			AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.455C>T	17.37:g.76354722G>A	ENSP00000330341:p.Ser152Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O14509	Missense_Mutation	SNP	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.S152F	ENST00000330871.2	37	c.455	CCDS11756.1	17	.	.	.	.	.	.	.	.	.	.	G	5.287	0.238435	0.10023	.	.	ENSG00000184557	ENST00000330871	T	0.47528	0.84	3.73	2.66	0.31614	SH2 motif (1);	0.502040	0.18739	N	0.132508	T	0.26195	0.0639	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.11641	-1.0579	10	0.13470	T	0.59	-1.133	6.4521	0.21910	0.2142:0.0:0.7858:0.0	.	152	O14543	SOCS3_HUMAN	F	152	ENSP00000330341:S152F	ENSP00000330341:S152F	S	-	2	0	SOCS3	73866317	0.114000	0.22134	0.871000	0.34182	0.846000	0.48090	0.845000	0.27668	1.911000	0.55334	0.462000	0.41574	TCT	SOCS3	-	NULL		0.662	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS3	HGNC	protein_coding	OTTHUMT00000437300.1	G			76354722	-1	no_errors	ENST00000330871	ensembl	human	known	70_37	missense	SNP	0.020	A
MTCL1	23255	genome.wustl.edu	37	18	8831528	8831528	+	3'UTR	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:8831528G>A	ENST00000581670.1	+	0	1608				SOGA2_ENST00000359865.3_Intron|SOGA2_ENST00000517570.1_Intron|SOGA2_ENST00000306285.7_Intron|SOGA2_ENST00000400050.3_Intron|SOGA2_ENST00000518815.1_Intron																							AGTCTGTTGAGAAGTGTGTTT	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	23255																														ENST00000581670.1:c.*1605G>A	18.37:g.8831528G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000581670.1	37	NULL		18																																																																																			SOGA2	-	-		0.428	SOGA2-016	KNOWN	basic	processed_transcript	SOGA2	HGNC	protein_coding	OTTHUMT00000444467.1	G			8831528	+1	no_errors	ENST00000581670	ensembl	human	known	70_37	rna	SNP	0.005	A
SOX11	6664	genome.wustl.edu	37	2	5833654	5833654	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:5833654G>A	ENST00000322002.3	+	1	856	c.801G>A	c.(799-801)ctG>ctA	p.L267L	AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA|AC010729.1_ENST00000455579.2_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	267					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CGCAGCTGCTGAGACGCTACA	0.697																																																	0													8.0	7.0	8.0					2																	5833654		1978	4004	5982	SO:0001819	synonymous_variant	6664				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.801G>A	2.37:g.5833654G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZFV8	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pirsf_SOX-12/11/4a,pfscan_HMG_superfamily	p.L267	ENST00000322002.3	37	c.801	CCDS1654.1	2																																																																																			SOX11	-	pirsf_SOX-12/11/4a		0.697	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	G	NM_003108		5833654	+1	no_errors	ENST00000322002	ensembl	human	known	70_37	silent	SNP	1.000	A
SP140	11262	genome.wustl.edu	37	2	231134292	231134292	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:231134292C>T	ENST00000392045.3	+	13	1400	c.1286C>T	c.(1285-1287)tCa>tTa	p.S429L	SP140_ENST00000343805.6_Missense_Mutation_p.S369L|SP140_ENST00000350136.5_Missense_Mutation_p.S298L|SP140_ENST00000417495.3_Missense_Mutation_p.S315L|SP140_ENST00000420434.3_Missense_Mutation_p.S402L|SP140_ENST00000486687.2_Missense_Mutation_p.S353L	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	429					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GAAGGAGAATCAGAAGAGCTT	0.348																																																	0													122.0	119.0	119.0					2																	231134292		1838	4090	5928	SO:0001583	missense	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1286C>T	2.37:g.231134292C>T	ENSP00000375899:p.Ser429Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.S429L	ENST00000392045.3	37	c.1286	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267470	0.23136	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.58358	0.56;0.85;0.63;0.34;0.62	2.68	0.793	0.18632	.	.	.	.	.	T	0.48714	0.1515	N	0.19112	0.55	0.09310	N	1	D;B;B;B	0.57899	0.981;0.176;0.27;0.176	D;B;B;B	0.67231	0.95;0.026;0.059;0.026	T	0.32481	-0.9905	9	0.30854	T	0.27	.	4.3707	0.11246	0.0:0.6508:0.0:0.3492	.	402;315;369;429	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	L	353;298;429;315;369;402	ENSP00000440107:S353L;ENSP00000345846:S298L;ENSP00000375899:S429L;ENSP00000342096:S369L;ENSP00000398210:S402L	ENSP00000342096:S369L	S	+	2	0	SP140	230842536	0.000000	0.05858	0.001000	0.08648	0.040000	0.13550	-0.566000	0.05922	0.210000	0.20664	0.556000	0.70494	TCA	SP140	-	NULL		0.348	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	HGNC	protein_coding	OTTHUMT00000332015.1	C	NM_007237		231134292	+1	no_errors	ENST00000392045	ensembl	human	known	70_37	missense	SNP	0.002	T
SPATA31E1	286234	genome.wustl.edu	37	9	90500620	90500620	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:90500620C>G	ENST00000325643.5	+	4	1284	c.1218C>G	c.(1216-1218)ttC>ttG	p.F406L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	406					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TAAATCCCTTCTGGAACGTGT	0.557																																																	0													87.0	66.0	73.0					9																	90500620		2202	4299	6501	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1218C>G	9.37:g.90500620C>G	ENSP00000322640:p.Phe406Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.F406L	ENST00000325643.5	37	c.1218	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	c	13.27	2.186274	0.38609	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.04454	3.62	2.67	0.783	0.18572	.	0.485631	0.17508	N	0.171732	T	0.05823	0.0152	L	0.56124	1.755	0.09310	N	1	P;P	0.42375	0.778;0.518	P;B	0.45119	0.47;0.103	T	0.31752	-0.9932	10	0.17832	T	0.49	.	4.6362	0.12525	0.0:0.6828:0.0:0.3172	.	406;58	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	406;58	ENSP00000322640:F406L	ENSP00000322640:F406L	F	+	3	2	C9orf79	89690440	0.011000	0.17503	0.007000	0.13788	0.045000	0.14185	0.092000	0.15066	0.215000	0.20761	0.644000	0.83932	TTC	SPATA31E1	-	NULL		0.557	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	C	NM_178828		90500620	+1	no_errors	ENST00000325643	ensembl	human	known	70_37	missense	SNP	0.009	G
ST18	9705	genome.wustl.edu	37	8	53126766	53126766	+	Missense_Mutation	SNP	C	C	G	rs576240176		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr8:53126766C>G	ENST00000276480.7	-	7	735	c.52G>C	c.(52-54)Gag>Cag	p.E18Q		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	18					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AACTCACCCTCGGTTCCTTTA	0.468																																																	0													217.0	171.0	186.0					8																	53126766		2203	4300	6503	SO:0001583	missense	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.52G>C	8.37:g.53126766C>G	ENSP00000276480:p.Glu18Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.E18Q	ENST00000276480.7	37	c.52	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825702	0.32237	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.43294	0.95;0.95	5.49	2.1	0.27182	.	0.367731	0.28382	N	0.015559	T	0.27454	0.0674	L	0.36672	1.1	0.23555	N	0.997421	B	0.02656	0.0	B	0.06405	0.002	T	0.18587	-1.0332	10	0.51188	T	0.08	.	3.7441	0.08541	0.0:0.2302:0.1868:0.5829	.	18	O60284	ST18_HUMAN	Q	18	ENSP00000276480:E18Q;ENSP00000428521:E18Q	ENSP00000276480:E18Q	E	-	1	0	ST18	53289319	1.000000	0.71417	0.267000	0.24556	0.863000	0.49368	4.435000	0.59941	0.197000	0.20387	0.655000	0.94253	GAG	ST18	-	NULL		0.468	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	C			53126766	-1	no_errors	ENST00000276480	ensembl	human	known	70_37	missense	SNP	0.904	G
ST8SIA1	6489	genome.wustl.edu	37	12	22401946	22401946	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:22401946C>T	ENST00000396037.4	-	4	1059	c.578G>A	c.(577-579)cGg>cAg	p.R193Q	ST8SIA1_ENST00000539510.1_Missense_Mutation_p.R50Q	NM_003034.3	NP_003025.1	Q92185	SIA8A_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1	193					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|glycosphingolipid biosynthetic process (GO:0006688)|positive regulation of cell proliferation (GO:0008284)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25						TTACCTTTGCCGAATTATGCT	0.398																																																	0													170.0	140.0	150.0					12																	22401946		2203	4300	6503	SO:0001583	missense	6489			L32867	CCDS8697.1	12p12.1-p11.2	2013-03-01	2003-01-14	2005-02-07	ENSG00000111728	ENSG00000111728	2.4.99.8	"""Sialyltransferases"""	10869	protein-coding gene	gene with protein product	"""ST8Sia I"""	601123	"""sialyltransferase 8 (alpha-N-acetylneuraminate: alpha-2,8-sialytransferase, GD3 synthase) A"""	SIAT8, SIAT8A		7901202	Standard	NM_003034		Approved		uc001rfo.4	Q92185	OTTHUMG00000169098	ENST00000396037.4:c.578G>A	12.37:g.22401946C>T	ENSP00000379353:p.Arg193Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4H6|Q17RL0|Q6PZN5|Q93064	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R193Q	ENST00000396037.4	37	c.578	CCDS8697.1	12	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221438	0.39300	.	.	ENSG00000111728	ENST00000396037;ENST00000539510;ENST00000540824;ENST00000538256;ENST00000541868	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.62	5.62	0.85841	.	0.130754	0.52532	D	0.000066	T	0.11922	0.0290	N	0.04203	-0.255	0.32906	D	0.513904	B;B	0.20261	0.043;0.024	B;B	0.16289	0.003;0.015	T	0.21245	-1.0251	10	0.06891	T	0.86	-17.2675	8.6964	0.34298	0.0:0.872:0.0:0.128	.	50;193	G3V1U7;Q92185	.;SIA8A_HUMAN	Q	193;50;144;12;170	ENSP00000379353:R193Q;ENSP00000446363:R50Q;ENSP00000441707:R144Q;ENSP00000440292:R170Q	ENSP00000379353:R193Q	R	-	2	0	ST8SIA1	22293213	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.781000	0.55394	2.653000	0.90120	0.637000	0.83480	CGG	ST8SIA1	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.398	ST8SIA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA1	HGNC	protein_coding	OTTHUMT00000402245.2	C	NM_003034		22401946	-1	no_errors	ENST00000396037	ensembl	human	known	70_37	missense	SNP	1.000	T
STRN	6801	genome.wustl.edu	37	2	37082431	37082431	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:37082431G>A	ENST00000263918.4	-	15	1910	c.1902C>T	c.(1900-1902)ttC>ttT	p.F634F	STRN_ENST00000379213.2_Silent_p.F585F	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	634					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				ATCCCTTGCTGAATGATGCTA	0.378																																																	0													175.0	149.0	157.0					2																	37082431		2203	4300	6503	SO:0001819	synonymous_variant	6801			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.1902C>T	2.37:g.37082431G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KP65|Q53TQ8|Q9NP38	Silent	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F634	ENST00000263918.4	37	c.1902	CCDS1784.1	2																																																																																			STRN	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.378	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	G			37082431	-1	no_errors	ENST00000263918	ensembl	human	known	70_37	silent	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152443192	152443192	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:152443192C>T	ENST00000367255.5	-	0	27374				SYNE1_ENST00000423061.1_3'UTR|SYNE1_ENST00000356820.4_3'UTR|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000265368.4_3'UTR|SYNE1_ENST00000448038.1_3'UTR|SYNE1_ENST00000539504.1_3'UTR|SYNE1_ENST00000341594.5_3'UTR|ESR1_ENST00000427531.2_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTCATTTATCTGATGGTTGG	0.483										HNSCC(10;0.0054)																																							0																																										SO:0001624	3_prime_UTR_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.*379G>A	6.37:g.152443192C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	RNA	SNP	-	NULL	ENST00000367255.5	37	NULL	CCDS5236.2	6																																																																																			SYNE1	-	-		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152443192	-1	no_errors	ENST00000347037	ensembl	human	known	70_37	rna	SNP	0.000	T
SYNJ2BP	55333	genome.wustl.edu	37	14	70839334	70839334	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr14:70839334C>T	ENST00000256366.4	-	0	893				SYNJ2BP_ENST00000554216.1_5'UTR|SYNJ2BP-COX16_ENST00000555276.1_RNA	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein						intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)				central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		AAAGAAAAATCCTTTCTTCCT	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	55333			AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.*374G>A	14.37:g.70839334C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49SH3|Q96IA4	RNA	SNP	-	NULL	ENST00000256366.4	37	NULL	CCDS9803.1	14																																																																																			SYNJ2BP	-	-		0.383	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2BP	HGNC	protein_coding	OTTHUMT00000412472.1	C	NM_018373		70839334	-1	no_errors	ENST00000554216	ensembl	human	putative	70_37	rna	SNP	0.782	T
SYNM	23336	genome.wustl.edu	37	15	99671977	99671977	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:99671977G>C	ENST00000560674.1	+	4	3023	c.2554G>C	c.(2554-2556)Gag>Cag	p.E852Q	SYNM_ENST00000328642.7_Missense_Mutation_p.E1137Q|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000336292.6_Missense_Mutation_p.E1137Q			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1138	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CTGGAGGACTGAGCGAATGTC	0.602																																					Pancreas(125;1071 1762 21750 40003 40381)												0													44.0	47.0	46.0					15																	99671977		2095	4230	6325	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.2554G>C	15.37:g.99671977G>C	ENSP00000453040:p.Glu852Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.E1137Q	ENST00000560674.1	37	c.3409		15	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471066	0.63625	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.91407	-2.84;-2.31	5.4	5.4	0.78164	.	.	.	.	.	D	0.95351	0.8491	.	.	.	0.42026	D	0.991004	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.95929	0.8937	8	0.87932	D	0	.	16.3251	0.82977	0.0:0.0:1.0:0.0	.	1138;1137	O15061;C9JIE4	SYNEM_HUMAN;.	Q	1137	ENSP00000336775:E1137Q;ENSP00000330469:E1137Q	ENSP00000330469:E1137Q	E	+	1	0	SYNM	97489500	1.000000	0.71417	0.942000	0.38095	0.485000	0.33311	4.461000	0.60115	2.508000	0.84585	0.655000	0.94253	GAG	SYNM	-	NULL		0.602	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	G	NM_145728		99671977	+1	no_errors	ENST00000336292	ensembl	human	known	70_37	missense	SNP	0.996	C
SYNM	23336	genome.wustl.edu	37	15	99672256	99672256	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:99672256G>A	ENST00000336292.6	+	5	3808	c.3688G>A	c.(3688-3690)Gaa>Aaa	p.E1230K	SYNM_ENST00000328642.7_Intron|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000560674.1_Intron	NM_145728.2	NP_663780.2	O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1231	Interaction with TLN1 and VCL.|Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						ATTTCATGCTGAAAAGGAGAT	0.512																																					Pancreas(125;1071 1762 21750 40003 40381)												0													46.0	47.0	46.0					15																	99672256		1924	4130	6054	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000336292.6:c.3688G>A	15.37:g.99672256G>A	ENSP00000336775:p.Glu1230Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.E1230K	ENST00000336292.6	37	c.3688		15	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635745	0.29068	.	.	ENSG00000182253	ENST00000336292	D	0.83335	-1.71	5.26	-3.21	0.05140	.	.	.	.	.	T	0.70395	0.3219	.	.	.	0.19575	N	0.999964	B	0.09022	0.002	B	0.08055	0.003	T	0.55522	-0.8128	8	0.35671	T	0.21	.	10.0468	0.42192	0.1411:0.2318:0.6271:0.0	.	1231	O15061	SYNEM_HUMAN	K	1230	ENSP00000336775:E1230K	ENSP00000336775:E1230K	E	+	1	0	SYNM	97489779	0.000000	0.05858	0.000000	0.03702	0.928000	0.56348	-0.576000	0.05854	-0.268000	0.09312	0.655000	0.94253	GAA	SYNM	-	NULL		0.512	SYNM-202	KNOWN	basic|appris_candidate_longest	protein_coding	SYNM	HGNC	protein_coding		G	NM_145728		99672256	+1	no_errors	ENST00000336292	ensembl	human	known	70_37	missense	SNP	0.000	A
SYTL1	84958	genome.wustl.edu	37	1	27677685	27677685	+	Intron	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:27677685G>C	ENST00000543823.1	+	11	1626				SYTL1_ENST00000490170.1_3'UTR|SYTL1_ENST00000318074.5_Intron			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)			NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGTCTGCAGACCCCACCCT	0.711																																																	0																																										SO:0001627	intron_variant	84958			AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1165-64G>C	1.37:g.27677685G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	RNA	SNP	-	NULL	ENST00000543823.1	37	NULL	CCDS53286.1	1																																																																																			SYTL1	-	-		0.711	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL1	HGNC	protein_coding		G	NM_032872		27677685	+1	no_errors	ENST00000490170	ensembl	human	known	70_37	rna	SNP	0.000	C
TAF5L	27097	genome.wustl.edu	37	1	229730226	229730226	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:229730226T>C	ENST00000366676.1	-	4	1587	c.1588A>G	c.(1588-1590)Atg>Gtg	p.M530V	TAF5L_ENST00000258281.2_Missense_Mutation_p.M530V			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	530					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GAGTTGTCCATGGAGGCAGAG	0.582																																																	0													77.0	71.0	73.0					1																	229730226		2203	4300	6503	SO:0001583	missense	27097			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.1588A>G	1.37:g.229730226T>C	ENSP00000355636:p.Met530Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.M530V	ENST00000366676.1	37	c.1588	CCDS1581.1	1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.504355	0.44558	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	T;T	0.59906	0.23;0.23	5.97	5.97	0.96955	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.033205	0.85682	D	0.000000	T	0.46870	0.1415	L	0.31294	0.92	0.53005	D	0.999967	B	0.18610	0.029	B	0.21151	0.033	T	0.37619	-0.9698	10	0.17369	T	0.5	-38.4172	16.4473	0.83942	0.0:0.0:0.0:1.0	.	530	O75529	TAF5L_HUMAN	V	530	ENSP00000355636:M530V;ENSP00000258281:M530V	ENSP00000258281:M530V	M	-	1	0	TAF5L	227796849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.979000	0.56888	2.281000	0.76405	0.533000	0.62120	ATG	TAF5L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.582	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5L	HGNC	protein_coding	OTTHUMT00000095229.1	T	NM_014409		229730226	-1	no_errors	ENST00000258281	ensembl	human	known	70_37	missense	SNP	1.000	C
TCP10	6953	genome.wustl.edu	37	6	167789501	167789501	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:167789501G>A	ENST00000397829.4	-	6	808	c.641C>T	c.(640-642)tCc>tTc	p.S214F	TCP10_ENST00000366827.2_Missense_Mutation_p.S214F	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	241						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GGTGGCCTGGGAAGCCTGCAC	0.587																																																	0													29.0	33.0	32.0					6																	167789501		1976	4170	6146	SO:0001583	missense	6953			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.641C>T	6.37:g.167789501G>A	ENSP00000380929:p.Ser214Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.S214F	ENST00000397829.4	37	c.641	CCDS43527.1	6	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400714	0.42613	.	.	ENSG00000203690	ENST00000366827;ENST00000397829	T;T	0.17691	2.26;2.26	1.65	0.703	0.18116	.	.	.	.	.	T	0.08044	0.0201	L	0.39898	1.24	0.09310	N	1	D;D	0.62365	0.991;0.991	P;P	0.50231	0.635;0.635	T	0.14476	-1.0471	9	0.87932	D	0	.	5.0669	0.14587	0.0:0.0:0.6506:0.3494	.	241;241	Q12799;Q12799-2	TCP10_HUMAN;.	F	214	ENSP00000355792:S214F;ENSP00000380929:S214F	ENSP00000355792:S214F	S	-	2	0	TCP10	167709491	0.000000	0.05858	0.000000	0.03702	0.473000	0.32948	-0.251000	0.08818	0.232000	0.21100	0.306000	0.20318	TCC	TCP10	-	NULL		0.587	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	G	NM_004610		167789501	-1	no_errors	ENST00000397829	ensembl	human	known	70_37	missense	SNP	0.000	A
THBS1	7057	genome.wustl.edu	37	15	39874405	39874405	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:39874405G>C	ENST00000260356.5	+	3	244	c.79G>C	c.(79-81)Gac>Cac	p.D27H		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	27					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GTCTGGCGGAGACAACAGCGT	0.602																																																	0													36.0	40.0	39.0					15																	39874405		2200	4296	6496	SO:0001583	missense	7057				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.79G>C	15.37:g.39874405G>C	ENSP00000260356:p.Asp27His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D27H	ENST00000260356.5	37	c.79	CCDS32194.1	15	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641505	0.87859	.	.	ENSG00000137801	ENST00000260356;ENST00000397591	T;T	0.80304	-1.36;0.32	5.17	5.17	0.71159	Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.37955	N	0.001870	D	0.89139	0.6630	M	0.72118	2.19	0.53688	D	0.999977	D	0.76494	0.999	D	0.79108	0.992	D	0.90002	0.4115	10	0.87932	D	0	-32.0138	17.8338	0.88690	0.0:0.0:1.0:0.0	.	27	P07996	TSP1_HUMAN	H	27	ENSP00000260356:D27H;ENSP00000380720:D27H	ENSP00000260356:D27H	D	+	1	0	THBS1	37661697	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.371000	0.97162	2.684000	0.91462	0.563000	0.77884	GAC	THBS1	-	smart_Laminin_G		0.602	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	G	NM_003246		39874405	+1	no_errors	ENST00000260356	ensembl	human	known	70_37	missense	SNP	1.000	C
TICRR	90381	genome.wustl.edu	37	15	90150020	90150020	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:90150020C>T	ENST00000268138.7	+	14	2791	c.2686C>T	c.(2686-2688)Cag>Tag	p.Q896*	TICRR_ENST00000560985.1_Nonsense_Mutation_p.Q895*|KIF7_ENST00000558928.1_5'Flank			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	896					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CCCTGCTCCTCAGCAGCCTTC	0.348																																																	0													89.0	82.0	84.0					15																	90150020		1833	4095	5928	SO:0001587	stop_gained	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2686C>T	15.37:g.90150020C>T	ENSP00000268138:p.Gln896*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Nonsense_Mutation	SNP	NULL	p.Q896*	ENST00000268138.7	37	c.2686	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	C	36	5.813879	0.96975	.	.	ENSG00000140534	ENST00000268138	.	.	.	5.96	4.06	0.47325	.	0.619445	0.16746	N	0.201228	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-2.9061	10.8536	0.46784	0.1467:0.7126:0.1408:0.0	.	.	.	.	X	896	.	ENSP00000268138:Q896X	Q	+	1	0	C15orf42	87951024	0.999000	0.42202	0.749000	0.31150	0.190000	0.23558	1.927000	0.40094	0.836000	0.34901	0.655000	0.94253	CAG	TICRR	-	NULL		0.348	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	C	NM_152259		90150020	+1	no_errors	ENST00000268138	ensembl	human	known	70_37	nonsense	SNP	0.985	T
TMEM171	134285	genome.wustl.edu	37	5	72419680	72419680	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:72419680C>T	ENST00000454765.2	+	2	953	c.480C>T	c.(478-480)ttC>ttT	p.F160F	TMEM171_ENST00000287773.5_Silent_p.F160F			Q8WVE6	TM171_HUMAN	transmembrane protein 171	160						integral component of membrane (GO:0016021)				endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|stomach(1)	15		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.87e-54)|Lung(70;0.115)		TGTGTGGGTTCCTTTCTCTGC	0.562																																					NSCLC(112;638 2280 27369 30736)												0													144.0	147.0	146.0					5																	72419680		2203	4300	6503	SO:0001819	synonymous_variant	134285			BC018083	CCDS4017.1, CCDS54869.1	5q13.2	2008-02-05			ENSG00000157111	ENSG00000157111			27031	protein-coding gene	gene with protein product						12477932	Standard	NM_173490		Approved	PRP2	uc003kcm.2	Q8WVE6	OTTHUMG00000131269	ENST00000454765.2:c.480C>T	5.37:g.72419680C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N0S1|Q8TDT7	Silent	SNP	NULL	p.F160	ENST00000454765.2	37	c.480	CCDS4017.1	5																																																																																			TMEM171	-	NULL		0.562	TMEM171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM171	HGNC	protein_coding	OTTHUMT00000254037.2	C	NM_173490		72419680	+1	no_errors	ENST00000454765	ensembl	human	known	70_37	silent	SNP	0.997	T
TMEM161B	153396	genome.wustl.edu	37	5	87521625	87521625	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:87521625G>A	ENST00000296595.6	-	4	374	c.250C>T	c.(250-252)Cat>Tat	p.H84Y	TMEM161B_ENST00000506536.1_5'UTR|TMEM161B_ENST00000509387.1_5'UTR|TMEM161B_ENST00000514135.1_Missense_Mutation_p.H84Y|TMEM161B_ENST00000512429.1_Missense_Mutation_p.H73Y	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	84						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		GTTTCTAGATGAAGGTCAATA	0.303																																																	0													126.0	123.0	124.0					5																	87521625		2202	4299	6501	SO:0001583	missense	153396			BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.250C>T	5.37:g.87521625G>A	ENSP00000296595:p.His84Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.H84Y	ENST00000296595.6	37	c.250	CCDS4065.1	5	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399171	0.62177	.	.	ENSG00000164180	ENST00000514135;ENST00000296595;ENST00000512429;ENST00000443393	.	.	.	5.02	5.02	0.67125	.	0.050121	0.85682	D	0.000000	T	0.56217	0.1970	L	0.43923	1.385	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50783	-0.8787	9	0.25751	T	0.34	-3.0464	18.6917	0.91585	0.0:0.0:1.0:0.0	.	84	Q8NDZ6	T161B_HUMAN	Y	84;84;73;84	.	ENSP00000296595:H84Y	H	-	1	0	TMEM161B	87557381	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.307000	0.96226	2.504000	0.84457	0.467000	0.42956	CAT	TMEM161B	-	pfam_Transmembrane_161A/B		0.303	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161B	HGNC	protein_coding	OTTHUMT00000254094.1	G	NM_153354		87521625	-1	no_errors	ENST00000296595	ensembl	human	known	70_37	missense	SNP	1.000	A
TMEM35	59353	genome.wustl.edu	37	X	100334062	100334062	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:100334062G>C	ENST00000372930.4	+	1	354	c.71G>C	c.(70-72)gGg>gCg	p.G24A	TRMT2B-AS1_ENST00000443801.2_RNA	NM_021637.2	NP_067650.1	Q53FP2	TMM35_HUMAN	transmembrane protein 35	24						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|large_intestine(3)|liver(1)|skin(1)|urinary_tract(1)	7						GTTTTCATGGGGACTATCAAG	0.562																																																	0													118.0	87.0	97.0					X																	100334062		2203	4300	6503	SO:0001583	missense	59353			AK024146	CCDS14478.1	Xq22	2008-02-05			ENSG00000126950	ENSG00000126950			25864	protein-coding gene	gene with protein product							Standard	NM_021637		Approved	FLJ14084	uc004egw.3	Q53FP2	OTTHUMG00000022016	ENST00000372930.4:c.71G>C	X.37:g.100334062G>C	ENSP00000362021:p.Gly24Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H7Y3	Missense_Mutation	SNP	NULL	p.G24A	ENST00000372930.4	37	c.71	CCDS14478.1	X	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019643	0.75275	.	.	ENSG00000126950	ENST00000372930;ENST00000444892	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.77864	0.4194	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.79952	-0.1586	9	0.62326	D	0.03	-2.1379	16.9634	0.86279	0.0:0.0:1.0:0.0	.	24	Q53FP2	TMM35_HUMAN	A	24	.	ENSP00000362021:G24A	G	+	2	0	TMEM35	100220718	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.143000	0.94623	2.212000	0.71576	0.534000	0.68092	GGG	TMEM35	-	NULL		0.562	TMEM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM35	HGNC	protein_coding	OTTHUMT00000057508.1	G	NM_021637		100334062	+1	no_errors	ENST00000372930	ensembl	human	known	70_37	missense	SNP	1.000	C
TNFRSF6B	8771	genome.wustl.edu	37	20	62328438	62328438	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr20:62328438C>T	ENST00000369996.1	+	1	418	c.318C>T	c.(316-318)caC>caT	p.H106H	RTEL1-TNFRSF6B_ENST00000482936.1_3'UTR|ARFRP1_ENST00000485858.1_5'Flank	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	106					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			GGGCTTGCCACGCCACCCACA	0.662																																																	0													15.0	17.0	16.0					20																	62328438		2172	4271	6443	SO:0001819	synonymous_variant	8771			AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.318C>T	20.37:g.62328438C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	p.H106	ENST00000369996.1	37	c.318	CCDS13532.1	20																																																																																			TNFRSF6B	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg		0.662	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF6B	HGNC	protein_coding	OTTHUMT00000080182.1	C			62328438	+1	no_errors	ENST00000369996	ensembl	human	known	70_37	silent	SNP	0.001	T
TNXB	7148	genome.wustl.edu	37	6	32065757	32065757	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:32065757G>A	ENST00000479795.1	-	2	359	c.219C>T	c.(217-219)ttC>ttT	p.F73F	TNXB_ENST00000375244.3_Silent_p.F73F|TNXB_ENST00000375247.2_Silent_p.F73F			P22105	TENX_HUMAN	tenascin XB	73					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGCGGTGGGTGAATACCACCT	0.642																																																	0													28.0	31.0	30.0					6																	32065757		1927	4104	6031	SO:0001819	synonymous_variant	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.219C>T	6.37:g.32065757G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.F73	ENST00000479795.1	37	c.219		6																																																																																			TNXB	-	NULL		0.642	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000357059.1	G	NM_019105		32065757	-1	no_errors	ENST00000375247	ensembl	human	known	70_37	silent	SNP	1.000	A
TRANK1	9881	genome.wustl.edu	37	3	36875105	36875105	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:36875105G>A	ENST00000429976.2	-	21	6084	c.5837C>T	c.(5836-5838)tCa>tTa	p.S1946L	TRANK1_ENST00000428977.2_Missense_Mutation_p.S1396L|TRANK1_ENST00000301807.6_Missense_Mutation_p.S1396L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1946							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CAGCAGACATGAGGCCTGGAA	0.562																																																	0													35.0	36.0	36.0					3																	36875105		1957	4140	6097	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.5837C>T	3.37:g.36875105G>A	ENSP00000416168:p.Ser1946Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.S1946L	ENST00000429976.2	37	c.5837	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236981	0.39498	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.33654	1.4;1.82;1.4	5.02	3.22	0.36961	.	0.000000	0.48286	D	0.000194	T	0.23451	0.0567	L	0.32530	0.975	0.34239	D	0.677465	B	0.32071	0.355	B	0.24974	0.057	T	0.27502	-1.0072	10	0.38643	T	0.18	.	8.887	0.35409	0.2283:0.0:0.7717:0.0	.	1946	O15050	TRNK1_HUMAN	L	1396;1946;1396	ENSP00000416826:S1396L;ENSP00000416168:S1946L;ENSP00000301807:S1396L	ENSP00000301807:S1396L	S	-	2	0	TRANK1	36850109	0.995000	0.38212	0.917000	0.36280	0.993000	0.82548	2.403000	0.44530	0.645000	0.30675	0.561000	0.74099	TCA	TRANK1	-	NULL		0.562	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		G	NM_014831		36875105	-1	no_errors	ENST00000429976	ensembl	human	known	70_37	missense	SNP	0.852	A
TPRG1	285386	genome.wustl.edu	37	3	189038526	189038526	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:189038526G>C	ENST00000345063.3	+	6	912	c.745G>C	c.(745-747)Gag>Cag	p.E249Q	TPRG1_ENST00000433971.1_Missense_Mutation_p.E249Q	NM_198485.3	NP_940887.1	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	249						cytoplasm (GO:0005737)		p.E249Q(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|skin(2)|urinary_tract(1)	16	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CATTTTGATTGAGACCTACAC	0.438																																																	1	Substitution - Missense(1)	lung(1)											109.0	99.0	102.0					3																	189038526		2203	4300	6503	SO:0001583	missense	285386			AK125682	CCDS3292.1	3q28	2008-02-04	2008-01-16	2008-01-16	ENSG00000188001	ENSG00000188001			24759	protein-coding gene	gene with protein product			"""family with sequence similarity 79, member B"""	FAM79B			Standard	NM_198485		Approved	FLJ41238, FLJ43694	uc003frw.2	Q6ZUI0	OTTHUMG00000156321	ENST00000345063.3:c.745G>C	3.37:g.189038526G>C	ENSP00000341031:p.Glu249Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Inositol_phosphatase	p.E249Q	ENST00000345063.3	37	c.745	CCDS3292.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609934	0.87258	.	.	ENSG00000188001	ENST00000433971;ENST00000345063	.	.	.	5.69	4.82	0.62117	.	0.049177	0.85682	D	0.000000	T	0.57272	0.2042	M	0.76838	2.35	0.53688	D	0.99997	P	0.36086	0.536	B	0.34536	0.185	T	0.58814	-0.7570	8	.	.	.	-18.4775	12.5667	0.56314	0.0807:0.0:0.9192:0.0	.	249	Q6ZUI0	TPRG1_HUMAN	Q	249	.	.	E	+	1	0	TPRG1	190521220	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.197000	0.58413	1.416000	0.47057	0.563000	0.77884	GAG	TPRG1	-	NULL		0.438	TPRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRG1	HGNC	protein_coding	OTTHUMT00000343931.1	G	NM_198485		189038526	+1	no_errors	ENST00000345063	ensembl	human	known	70_37	missense	SNP	1.000	C
TRAPPC12	51112	genome.wustl.edu	37	2	3391549	3391549	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:3391549C>T	ENST00000324266.5	+	2	350	c.155C>T	c.(154-156)tCg>tTg	p.S52L	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.S52L	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	52					vesicle-mediated transport (GO:0016192)												GAGACCGCATCGGAAGGCTCG	0.612																																																	0													55.0	47.0	50.0					2																	3391549		2203	4300	6503	SO:0001583	missense	51112			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.155C>T	2.37:g.3391549C>T	ENSP00000324318:p.Ser52Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S52L	ENST00000324266.5	37	c.155	CCDS1652.1	2	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632568	0.47049	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	T;T	0.56941	0.43;0.43	5.0	5.0	0.66597	.	0.255560	0.34002	N	0.004360	T	0.67335	0.2882	L	0.52573	1.65	0.51482	D	0.999924	D;P;D	0.89917	1.0;0.935;1.0	D;B;D	0.91635	0.994;0.222;0.999	T	0.69397	-0.5156	10	0.72032	D	0.01	.	15.5858	0.76482	0.0:1.0:0.0:0.0	.	35;52;52	E7ENL7;Q8WVT3;Q53S18	.;TPC12_HUMAN;.	L	52;35;52	ENSP00000371544:S52L;ENSP00000324318:S52L	ENSP00000303612:S35L	S	+	2	0	TTC15	3370556	1.000000	0.71417	0.243000	0.24186	0.011000	0.07611	5.405000	0.66351	2.588000	0.87417	0.563000	0.77884	TCG	TRAPPC12	-	NULL		0.612	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAPPC12	HGNC	protein_coding	OTTHUMT00000206693.2	C	NM_016030		3391549	+1	no_errors	ENST00000324266	ensembl	human	known	70_37	missense	SNP	0.999	T
TROVE2	6738	genome.wustl.edu	37	1	193054347	193054347	+	3'UTR	DEL	A	A	-	rs567626813|rs56152513		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:193054347delA	ENST00000367446.3	+	0	2313				TROVE2_ENST00000432079.1_3'UTR|TROVE2_ENST00000367445.3_Intron|TROVE2_ENST00000367444.3_Intron|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000367443.1_Intron	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						CCAAGGGGGTAAAAAAAAAAA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	6738			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.*486A>-	1.37:g.193054347delA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	RNA	DEL	-	NULL	ENST00000367446.3	37	NULL	CCDS1379.1	1																																																																																			TROVE2	-	-		0.299	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1	A	NM_004600		193054347	+1	no_errors	ENST00000460715	ensembl	human	known	70_37	rna	DEL	0.000	-
TRRAP	8295	genome.wustl.edu	37	7	98497090	98497090	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:98497090G>A	ENST00000359863.4	+	9	888	c.679G>A	c.(679-681)Gaa>Aaa	p.E227K	TRRAP_ENST00000446306.3_Missense_Mutation_p.E227K|TRRAP_ENST00000355540.3_Missense_Mutation_p.E227K	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	227					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGTGTTGGCAGAATTGCCCAT	0.423																																																	0													186.0	179.0	181.0					7																	98497090		2203	4300	6503	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.679G>A	7.37:g.98497090G>A	ENSP00000352925:p.Glu227Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E227K	ENST00000359863.4	37	c.679	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752320	0.89753	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.15372	2.43;2.47	5.31	5.31	0.75309	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.54159	0.1841	M	0.93678	3.445	0.80722	D	1	D;P	0.56035	0.974;0.956	D;P	0.67725	0.953;0.899	T	0.66329	-0.5951	10	0.72032	D	0.01	.	19.3377	0.94326	0.0:0.0:1.0:0.0	.	227;227	Q9Y4A5-2;Q9Y4A5	.;TRRAP_HUMAN	K	227	ENSP00000352925:E227K;ENSP00000347733:E227K	ENSP00000347733:E227K	E	+	1	0	TRRAP	98335026	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.709000	0.98729	2.643000	0.89663	0.462000	0.41574	GAA	TRRAP	-	superfamily_ARM-type_fold		0.423	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	G	NM_003496		98497090	+1	no_errors	ENST00000359863	ensembl	human	known	70_37	missense	SNP	1.000	A
CFAP70	118491	genome.wustl.edu	37	10	75095277	75095277	+	Silent	SNP	G	G	A	rs375148315		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr10:75095277G>A	ENST00000310715.3	-	8	918	c.798C>T	c.(796-798)agC>agT	p.S266S	TTC18_ENST00000340329.3_Intron|TTC18_ENST00000401621.2_Silent_p.S266S|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000394865.1_Silent_p.S266S	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		266						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TCCTAAATTCGCTGTCCTGTA	0.393																																																	0								G		0,4406		0,0,2203	95.0	87.0	90.0		798	-4.6	0.9	10		90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TTC18	NM_145170.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		266/1122	75095277	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	118491																														ENST00000310715.3:c.798C>T	10.37:g.75095277G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S266	ENST00000310715.3	37	c.798	CCDS7324.3	10																																																																																			TTC18	-	NULL		0.393	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		G			75095277	-1	no_errors	ENST00000310715	ensembl	human	known	70_37	silent	SNP	0.662	A
TTN	7273	genome.wustl.edu	37	2	179445312	179445312	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:179445312G>A	ENST00000591111.1	-	267	62095	c.61871C>T	c.(61870-61872)gCg>gTg	p.A20624V	TTN_ENST00000460472.2_Missense_Mutation_p.A13200V|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A13325V|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A22265V|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A19697V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A13392V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20624					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTAAGTCCGCATCAAGTTC	0.398																																																	0													61.0	53.0	55.0					2																	179445312		1844	4082	5926	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61871C>T	2.37:g.179445312G>A	ENSP00000465570:p.Ala20624Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A19697V	ENST00000591111.1	37	c.59090		2	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994777	0.54041	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63913	-0.07;0.17;0.16;0.13	5.34	5.34	0.76211	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.78323	0.4265	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.80183	-0.1488	9	0.87932	D	0	.	19.0305	0.92955	0.0:0.0:1.0:0.0	.	13200;13325;13392;20624	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	19697;13200;13392;13325;13198	ENSP00000343764:A19697V;ENSP00000434586:A13200V;ENSP00000340554:A13392V;ENSP00000352154:A13325V	ENSP00000340554:A13392V	A	-	2	0	TTN	179153558	1.000000	0.71417	0.943000	0.38184	0.973000	0.67179	9.866000	0.99616	2.500000	0.84329	0.563000	0.77884	GCG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179445312	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179584091	179584091	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr2:179584091G>C	ENST00000591111.1	-	81	23299	c.23075C>G	c.(23074-23076)tCt>tGt	p.S7692C	TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S8009C|TTN_ENST00000342992.6_Missense_Mutation_p.S6765C|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13236	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCTGAGCCAGAGACTCGGCA	0.512																																																	0													97.0	99.0	98.0					2																	179584091		1905	4114	6019	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23075C>G	2.37:g.179584091G>C	ENSP00000465570:p.Ser7692Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.S6765C	ENST00000591111.1	37	c.20294		2	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169309	0.21621	.	.	ENSG00000155657	ENST00000342992	T	0.69306	-0.39	6.08	6.08	0.98989	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81744	0.4887	M	0.80616	2.505	0.80722	D	1	P	0.50066	0.931	P	0.57152	0.814	T	0.82491	-0.0431	9	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	7692	Q8WZ42	TITIN_HUMAN	C	6765	ENSP00000343764:S6765C	ENSP00000343764:S6765C	S	-	2	0	TTN	179292336	1.000000	0.71417	0.943000	0.38184	0.150000	0.21749	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	TCT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.512	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179584091	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	0.990	C
TYMP	1890	genome.wustl.edu	37	22	50966024	50966024	+	Silent	SNP	G	G	A	rs146557523		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr22:50966024G>A	ENST00000252029.3	-	5	801	c.639C>T	c.(637-639)ctC>ctT	p.L213L	CTA-384D8.36_ENST00000608319.1_RNA|TYMP_ENST00000395681.1_Silent_p.L213L|SCO2_ENST00000543927.1_5'Flank|SCO2_ENST00000395693.3_5'Flank|TYMP_ENST00000395680.1_Silent_p.L213L|TYMP_ENST00000395678.3_Silent_p.L213L|SCO2_ENST00000535425.1_5'Flank|SCO2_ENST00000252785.3_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	213					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CACCTGTGATGAGTGGCAGGC	0.577																																																	0								G	,,	3,4403	6.2+/-15.9	0,3,2200	105.0	89.0	95.0		639,639,639	0.4	0.8	22	dbSNP_134	95	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	TYMP	NM_001113755.1,NM_001113756.1,NM_001953.3	,,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,,	213/483,213/483,213/483	50966024	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	1890			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.639C>T	22.37:g.50966024G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MW15|H9KVA0|Q13390|Q8WVB7	Silent	SNP	pfam_Glycosyl_Trfase_fam3,pfam_Glycosyl_Trfase_fam3_N_dom,pfam_PYNP_C,superfamily_Glycosyl_Trfase_fam3,superfamily_PYNP_C,superfamily_Glycosyl_Trfase_fam3_N_dom,smart_PYNP_C,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk	p.L213	ENST00000252029.3	37	c.639	CCDS14096.1	22																																																																																			TYMP	-	pfam_Glycosyl_Trfase_fam3,superfamily_Glycosyl_Trfase_fam3,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk		0.577	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TYMP	HGNC	protein_coding	OTTHUMT00000317081.1	G	NM_001953		50966024	-1	no_errors	ENST00000252029	ensembl	human	known	70_37	silent	SNP	0.971	A
UGT2A1	10941	genome.wustl.edu	37	4	70465090	70465090	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr4:70465090C>G	ENST00000503640.1	-	2	793	c.738G>C	c.(736-738)gaG>gaC	p.E246D	UGT2A1_ENST00000502343.1_5'UTR|UGT2A2_ENST00000457664.2_Missense_Mutation_p.E255D|UGT2A1_ENST00000514019.1_Missense_Mutation_p.E456D|UGT2A1_ENST00000512704.1_Missense_Mutation_p.E246D|UGT2A1_ENST00000286604.4_Missense_Mutation_p.E290D	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	246					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						TCCCCATAGTCTCACATAACG	0.373																																																	0													75.0	71.0	73.0					4																	70465090		2203	4300	6503	SO:0001583	missense	10941			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.738G>C	4.37:g.70465090C>G	ENSP00000424478:p.Glu246Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.E255D	ENST00000503640.1	37	c.765	CCDS3529.1	4	.	.	.	.	.	.	.	.	.	.	C	5.022	0.189748	0.09547	.	.	ENSG00000173610	ENST00000457664;ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T;T	0.62639	0.13;0.13;0.01;0.01;0.14	4.63	-1.28	0.09318	.	0.116455	0.56097	D	0.000032	T	0.64549	0.2608	L	0.52573	1.65	.	.	.	B;P;D;D;D	0.76494	0.059;0.531;0.997;0.996;0.999	B;B;P;D;D	0.80764	0.037;0.381;0.89;0.987;0.994	T	0.65261	-0.6211	9	0.28530	T	0.3	.	5.4456	0.16533	0.0:0.31:0.1562:0.5338	.	456;456;246;255;246	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1-2;Q9Y4X1	.;.;.;.;UD2A1_HUMAN	D	255;246;246;456;290	ENSP00000387888:E255D;ENSP00000424478:E246D;ENSP00000421432:E246D;ENSP00000425497:E456D;ENSP00000286604:E290D	ENSP00000286604:E290D	E	-	3	2	UGT2A1	70499679	0.713000	0.27926	0.051000	0.19133	0.060000	0.15804	1.049000	0.30392	-0.196000	0.10366	-0.259000	0.10710	GAG	UGT2A1	-	pfam_UDP_glucos_trans		0.373	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A1	HGNC	protein_coding	OTTHUMT00000251554.3	C	NM_006798		70465090	-1	no_errors	ENST00000457664	ensembl	human	known	70_37	missense	SNP	0.233	G
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																																	1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	81622			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	UNC93B1	-	NULL		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		C	NM_030930		67759316	-1	no_errors	ENST00000227471	ensembl	human	known	70_37	missense	SNP	0.997	T
UQCRQ	27089	genome.wustl.edu	37	5	132203226	132203226	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr5:132203226C>T	ENST00000378670.3	+	3	342	c.201C>T	c.(199-201)ttC>ttT	p.F67F	UQCRQ_ENST00000378667.1_Silent_p.F67F|UQCRQ_ENST00000496429.1_3'UTR|GDF9_ENST00000464378.1_5'Flank|UQCRQ_ENST00000378665.1_Silent_p.F67F|GDF9_ENST00000296875.2_5'Flank|GDF9_ENST00000378673.2_5'Flank	NM_014402.4	NP_055217.2	O14949	QCR8_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa	67					cellular metabolic process (GO:0044237)|cerebellar Purkinje cell layer development (GO:0021680)|hippocampus development (GO:0021766)|hypothalamus development (GO:0021854)|midbrain development (GO:0030901)|pons development (GO:0021548)|pyramidal neuron development (GO:0021860)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|subthalamus development (GO:0021539)|thalamus development (GO:0021794)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain (GO:0070469)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			lung(3)	3		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGAAGAGTTCGAGAGATCCA	0.403																																																	0													83.0	82.0	82.0					5																	132203226		2203	4300	6503	SO:0001819	synonymous_variant	27089			BC001390	CCDS34237.1	5q31.1	2011-07-04			ENSG00000164405	ENSG00000164405	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	29594	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VII"", ""complex III subunit 8"""	612080				15544925, 12709789, 2164842	Standard	NM_014402		Approved	QP-C, QCR8, UQCR7	uc003kya.1	O14949	OTTHUMG00000059836	ENST00000378670.3:c.201C>T	5.37:g.132203226C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5FVE2|Q9BV88|Q9T2V7	Silent	SNP	pfam_Cyt_bc1_su8,superfamily_Cyt_bc1_su8	p.F67	ENST00000378670.3	37	c.201	CCDS34237.1	5																																																																																			UQCRQ	-	pfam_Cyt_bc1_su8,superfamily_Cyt_bc1_su8		0.403	UQCRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRQ	HGNC	protein_coding	OTTHUMT00000133040.1	C	NM_014402		132203226	+1	no_errors	ENST00000378665	ensembl	human	known	70_37	silent	SNP	0.991	T
USP43	124739	genome.wustl.edu	37	17	9596527	9596527	+	Silent	SNP	C	C	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr17:9596527C>A	ENST00000285199.7	+	9	1533	c.1437C>A	c.(1435-1437)ctC>ctA	p.L479L	USP43_ENST00000570475.1_Silent_p.L479L|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	479	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						GTCGGCCCCTCTGTCACTGGG	0.507																																																	0													48.0	45.0	46.0					17																	9596527		1921	4135	6056	SO:0001819	synonymous_variant	124739			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.1437C>A	17.37:g.9596527C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L479	ENST00000285199.7	37	c.1437	CCDS45610.1	17																																																																																			USP43	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.507	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	HGNC	protein_coding	OTTHUMT00000439855.3	C	NM_153210		9596527	+1	no_errors	ENST00000285199	ensembl	human	known	70_37	silent	SNP	0.811	A
UTP14A	10813	genome.wustl.edu	37	X	129047355	129047355	+	Intron	SNP	G	G	C	rs538026007		TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:129047355G>C	ENST00000394422.3	+	6	565				UTP14A_ENST00000371051.5_Intron|UTP14A_ENST00000371042.3_Missense_Mutation_p.R6T|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GGAGACTTTAGAAAAAAAAAA	0.363																																																	0																																										SO:0001627	intron_variant	10813			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.537+1458G>C	X.37:g.129047355G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.R6T	ENST00000394422.3	37	c.17	CCDS14615.1	X	.	.	.	.	.	.	.	.	.	.	G	9.069	0.996472	0.19043	.	.	ENSG00000156697	ENST00000427972;ENST00000371042	T;T	0.29142	1.58;1.6	3.55	3.55	0.40652	.	.	.	.	.	T	0.20007	0.0481	.	.	.	0.23003	N	0.998444	.	.	.	.	.	.	T	0.15896	-1.0421	6	0.14252	T	0.57	.	9.6888	0.40116	0.0:0.0:1.0:0.0	.	.	.	.	T	6	ENSP00000413187:R6T;ENSP00000360081:R6T	ENSP00000360081:R6T	R	+	2	0	UTP14A	128875036	0.996000	0.38824	0.823000	0.32752	0.612000	0.37316	3.217000	0.51184	2.031000	0.59945	0.529000	0.55759	AGA	UTP14A	-	NULL		0.363	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1	G	NM_006649		129047355	+1	no_errors	ENST00000371042	ensembl	human	known	70_37	missense	SNP	0.814	C
VEPH1	79674	genome.wustl.edu	37	3	157206875	157206875	+	Intron	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:157206875C>T	ENST00000362010.2	-	2	446				VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000468233.1_Intron|VEPH1_ENST00000494677.1_Intron|VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000537559.1_Intron|VEPH1_ENST00000543418.1_Intron	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1							plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			gtcagaacctctgcttcttct	0.418																																																	0																																										SO:0001627	intron_variant	79674			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.138+6125G>A	3.37:g.157206875C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	RNA	SNP	-	NULL	ENST00000362010.2	37	NULL	CCDS3179.1	3																																																																																			VEPH1	-	-		0.418	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	HGNC	protein_coding	OTTHUMT00000351845.3	C	NM_024621		157206875	-1	no_errors	ENST00000483440	ensembl	human	putative	70_37	rna	SNP	0.002	T
VEZT	55591	genome.wustl.edu	37	12	95688056	95688056	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:95688056G>C	ENST00000436874.1	+	10	1636	c.1531G>C	c.(1531-1533)Gaa>Caa	p.E511Q	VEZT_ENST00000261219.6_Missense_Mutation_p.E463Q|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	511					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						AGGCAAGCCTGAAATAGCATG	0.423																																																	0													63.0	56.0	59.0					12																	95688056		1868	4104	5972	SO:0001583	missense	55591			AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.1531G>C	12.37:g.95688056G>C	ENSP00000410083:p.Glu511Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	NULL	p.E511Q	ENST00000436874.1	37	c.1531	CCDS44954.1	12	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141337	0.57044	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000397792;ENST00000397796	T;T;T	0.18502	2.21;2.21;2.21	5.33	5.33	0.75918	.	0.219159	0.47455	D	0.000230	T	0.19765	0.0475	L	0.40543	1.245	0.37056	D	0.897841	P	0.45348	0.856	B	0.43623	0.425	T	0.03139	-1.1068	10	0.40728	T	0.16	-3.9021	17.5603	0.87905	0.0:0.0:1.0:0.0	.	511	Q9HBM0	VEZA_HUMAN	Q	511;463;467;511	ENSP00000410083:E511Q;ENSP00000261219:E463Q;ENSP00000380894:E467Q	ENSP00000261219:E463Q	E	+	1	0	VEZT	94212187	1.000000	0.71417	0.991000	0.47740	0.309000	0.27889	3.760000	0.55235	2.665000	0.90641	0.591000	0.81541	GAA	VEZT	-	NULL		0.423	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEZT	HGNC	protein_coding	OTTHUMT00000407804.2	G	NM_017599		95688056	+1	no_errors	ENST00000436874	ensembl	human	known	70_37	missense	SNP	1.000	C
VPS13A	23230	genome.wustl.edu	37	9	79931247	79931247	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr9:79931247G>A	ENST00000360280.3	+	39	5048	c.4788G>A	c.(4786-4788)atG>atA	p.M1596I	VPS13A_ENST00000376636.3_Missense_Mutation_p.M1557I|VPS13A_ENST00000376634.4_Missense_Mutation_p.M1596I|VPS13A_ENST00000357409.5_Missense_Mutation_p.M1596I|VPS13A_ENST00000423463.2_3'UTR	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1596					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATAGTACAATGACTGCTGCCA	0.378																																																	0													91.0	89.0	90.0					9																	79931247		2203	4300	6503	SO:0001583	missense	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.4788G>A	9.37:g.79931247G>A	ENSP00000353422:p.Met1596Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.M1596I	ENST00000360280.3	37	c.4788	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	11.58	1.679966	0.29783	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.09	2.95	0.34219	.	0.209202	0.41823	D	0.000805	T	0.27027	0.0662	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.11235	0.001;0.001;0.004;0.001	B;B;B;B	0.15870	0.005;0.001;0.014;0.014	T	0.05209	-1.0899	10	0.11794	T	0.64	.	9.8339	0.40958	0.0843:0.0:0.7725:0.1432	.	1557;1596;1596;1596	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	I	1596;1557;1596;1596	ENSP00000365821:M1596I;ENSP00000365823:M1557I;ENSP00000353422:M1596I;ENSP00000349985:M1596I	ENSP00000349985:M1596I	M	+	3	0	VPS13A	79121067	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.286000	0.43496	2.375000	0.81037	0.563000	0.77884	ATG	VPS13A	-	NULL		0.378	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	G	NM_015186		79931247	+1	no_errors	ENST00000360280	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48460336	48460336	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chrX:48460336C>T	ENST00000218056.5	+	6	1501	c.996C>T	c.(994-996)ctC>ctT	p.L332L	WDR13_ENST00000376729.5_Silent_p.L332L	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	332						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TCTCTTTCCTCTTTGATATGG	0.622																																																	0													57.0	50.0	52.0					X																	48460336		2203	4300	6503	SO:0001819	synonymous_variant	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.996C>T	X.37:g.48460336C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L332	ENST00000218056.5	37	c.996	CCDS14302.1	X																																																																																			WDR13	-	superfamily_WD40_repeat_dom		0.622	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	C			48460336	+1	no_errors	ENST00000218056	ensembl	human	known	70_37	silent	SNP	1.000	T
WDR3	10885	genome.wustl.edu	37	1	118486093	118486093	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr1:118486093T>C	ENST00000349139.5	+	11	1219	c.1172T>C	c.(1171-1173)tTg>tCg	p.L391S		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	391						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		CTGGTGGAATTGTATTCACTG	0.453																																																	0													136.0	110.0	119.0					1																	118486093		2203	4300	6503	SO:0001583	missense	10885			AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.1172T>C	1.37:g.118486093T>C	ENSP00000308179:p.Leu391Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L391S	ENST00000349139.5	37	c.1172	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	T	8.625	0.892385	0.17613	.	.	ENSG00000065183	ENST00000349139	T	0.54675	0.56	5.55	4.4	0.53042	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.361340	0.30492	N	0.009515	T	0.26846	0.0657	M	0.67397	2.05	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.24799	-1.0150	10	0.41790	T	0.15	-4.921	5.3934	0.16257	0.0:0.1566:0.1473:0.6961	.	391	Q9UNX4	WDR3_HUMAN	S	391	ENSP00000308179:L391S	ENSP00000308179:L391S	L	+	2	0	WDR3	118287616	0.175000	0.23083	0.001000	0.08648	0.290000	0.27261	1.954000	0.40362	1.013000	0.39391	0.533000	0.62120	TTG	WDR3	-	pfscan_WD40_repeat_dom		0.453	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	HGNC	protein_coding	OTTHUMT00000033720.2	T	NM_006784		118486093	+1	no_errors	ENST00000349139	ensembl	human	known	70_37	missense	SNP	0.001	C
WDR7	23335	genome.wustl.edu	37	18	54354104	54354104	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr18:54354104G>C	ENST00000254442.3	+	7	827	c.616G>C	c.(616-618)Gag>Cag	p.E206Q	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.E206Q	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	206					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GCCAATATTTGAGGAGGAATC	0.318																																																	0													76.0	68.0	71.0					18																	54354104		2203	4300	6503	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.616G>C	18.37:g.54354104G>C	ENSP00000254442:p.Glu206Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E206Q	ENST00000254442.3	37	c.616	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327881	0.81690	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.52754	0.65;0.65	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.76575	0.988;0.715	T	0.73697	-0.3901	10	0.56958	D	0.05	.	18.0761	0.89427	0.0:0.0:1.0:0.0	.	206;206	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	Q	206	ENSP00000254442:E206Q;ENSP00000350187:E206Q	ENSP00000254442:E206Q	E	+	1	0	WDR7	52505102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.368000	0.97152	2.417000	0.82017	0.650000	0.86243	GAG	WDR7	-	superfamily_Quinonprotein_ADH-like		0.318	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	G			54354104	+1	no_errors	ENST00000254442	ensembl	human	known	70_37	missense	SNP	1.000	C
WIPF3	644150	genome.wustl.edu	37	7	29923612	29923612	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr7:29923612C>T	ENST00000409290.1	+	4	502	c.502C>T	c.(502-504)Cgc>Tgc	p.R168C	WIPF3_ENST00000409123.1_Missense_Mutation_p.R168C|WIPF3_ENST00000242140.5_Missense_Mutation_p.R168C	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	168					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)				breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						AGccccgcctcgccccaacgt	0.687																																																	0													2.0	2.0	2.0					7																	29923612		1086	2779	3865	SO:0001583	missense	644150			AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.502C>T	7.37:g.29923612C>T	ENSP00000386878:p.Arg168Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZV2	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R168C	ENST00000409290.1	37	c.502	CCDS56472.1	7	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809076	0.31961	.	.	ENSG00000122574	ENST00000409123;ENST00000409290;ENST00000242140	T;T;T	0.52983	0.64;0.65;0.64	4.03	4.03	0.46877	.	0.484707	0.17119	N	0.186321	T	0.55000	0.1893	M	0.71036	2.16	0.42217	D	0.991838	D	0.76494	0.999	P	0.50082	0.63	T	0.61744	-0.7000	10	0.62326	D	0.03	.	11.8397	0.52346	0.0:1.0:0.0:0.0	.	168	A6NGB9	WIPF3_HUMAN	C	168	ENSP00000386790:R168C;ENSP00000386878:R168C;ENSP00000242140:R168C	ENSP00000242140:R168C	R	+	1	0	WIPF3	29890137	0.996000	0.38824	0.995000	0.50966	0.122000	0.20287	3.519000	0.53458	2.230000	0.72887	0.549000	0.68633	CGC	WIPF3	-	NULL		0.687	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	WIPF3	HGNC	protein_coding	OTTHUMT00000327705.1	C			29923612	+1	no_errors	ENST00000242140	ensembl	human	known	70_37	missense	SNP	1.000	T
WTIP	126374	genome.wustl.edu	37	19	34991087	34991087	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:34991087G>A	ENST00000590071.2	+	8	1543	c.1206G>A	c.(1204-1206)gcG>gcA	p.A402A	WTIP_ENST00000270288.6_Silent_p.A626A	NM_001080436.1	NP_001073905.1	A6NIX2	WTIP_HUMAN	Wilms tumor 1 interacting protein	402	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|negative regulation of hippo signaling (GO:0035331)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)	4	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			ATCCCCTGGCGGGCCACCTAC	0.657																																																	0													32.0	40.0	37.0					19																	34991087		2109	4217	6326	SO:0001819	synonymous_variant	126374			AK130059	CCDS59375.1	19q13.11	2012-03-16			ENSG00000142279	ENSG00000142279			20964	protein-coding gene	gene with protein product	"""WT1-interacting protein"""	614790				14736876	Standard	NM_001080436		Approved		uc002nvm.3	A6NIX2		ENST00000590071.2:c.1206G>A	19.37:g.34991087G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A626	ENST00000590071.2	37	c.1878	CCDS59375.1	19																																																																																			WTIP	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.657	WTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WTIP	HGNC	protein_coding	OTTHUMT00000459381.3	G	XM_059037		34991087	+1	no_errors	ENST00000270288	ensembl	human	known	70_37	silent	SNP	0.321	A
ZBTB2	57621	genome.wustl.edu	37	6	151687696	151687696	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr6:151687696C>T	ENST00000325144.4	-	3	645	c.505G>A	c.(505-507)Gag>Aag	p.E169K		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GGGACCTGCTCCTGGCTTATC	0.552																																																	0													86.0	89.0	88.0					6																	151687696		2203	4300	6503	SO:0001583	missense	57621			BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.505G>A	6.37:g.151687696C>T	ENSP00000323183:p.Glu169Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E169K	ENST00000325144.4	37	c.505	CCDS5231.1	6	.	.	.	.	.	.	.	.	.	.	C	6.650	0.488386	0.12641	.	.	ENSG00000181472	ENST00000325144	T	0.05025	3.51	5.26	5.26	0.73747	.	0.347447	0.33834	N	0.004508	T	0.02012	0.0063	L	0.27053	0.805	0.52501	D	0.999952	P	0.37781	0.608	B	0.24701	0.055	T	0.56811	-0.7917	10	0.18710	T	0.47	-29.7986	18.8721	0.92319	0.0:1.0:0.0:0.0	.	169	Q8N680	ZBTB2_HUMAN	K	169	ENSP00000323183:E169K	ENSP00000323183:E169K	E	-	1	0	ZBTB2	151729389	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	5.328000	0.65887	2.451000	0.82905	0.561000	0.74099	GAG	ZBTB2	-	NULL		0.552	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB2	HGNC	protein_coding	OTTHUMT00000042715.1	C	NM_020861		151687696	-1	no_errors	ENST00000325144	ensembl	human	known	70_37	missense	SNP	1.000	T
ZFYVE19	84936	genome.wustl.edu	37	15	41106171	41106171	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr15:41106171G>A	ENST00000355341.4	+	10	1741	c.1240G>A	c.(1240-1242)Gag>Aag	p.E414K	ZFYVE19_ENST00000570108.1_Missense_Mutation_p.E391K|ZFYVE19_ENST00000564258.1_Missense_Mutation_p.E239K|ZFYVE19_ENST00000299173.10_Missense_Mutation_p.E346K|ZFYVE19_ENST00000336455.5_Missense_Mutation_p.E404K	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	414	Poly-Glu.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GCCTGAGGCTGAGGAAGAGGA	0.617																																																	0													78.0	79.0	79.0					15																	41106171		2021	4203	6224	SO:0001583	missense	84936			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.1240G>A	15.37:g.41106171G>A	ENSP00000347498:p.Glu414Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E414K	ENST00000355341.4	37	c.1240	CCDS42025.1	15	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288952	0.80914	.	.	ENSG00000166140	ENST00000355341;ENST00000299173;ENST00000336455	T;T;T	0.16897	2.31;2.31;2.31	5.93	4.07	0.47477	.	0.400645	0.28778	N	0.014177	T	0.23330	0.0564	L	0.56769	1.78	0.35698	D	0.815386	B;P;B	0.50943	0.176;0.94;0.415	B;P;B	0.49799	0.037;0.622;0.093	T	0.22626	-1.0211	10	0.33940	T	0.23	-15.3776	9.5953	0.39569	0.1618:0.0:0.8382:0.0	.	404;346;414	Q96K21-2;Q96K21-3;Q96K21	.;.;ZFY19_HUMAN	K	414;346;404	ENSP00000347498:E414K;ENSP00000299173:E346K;ENSP00000337824:E404K	ENSP00000299173:E346K	E	+	1	0	ZFYVE19	38893463	1.000000	0.71417	0.808000	0.32385	0.973000	0.67179	4.159000	0.58157	1.526000	0.49068	0.561000	0.74099	GAG	ZFYVE19	-	superfamily_Znf_FYVE_PHD		0.617	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	G	NM_032850		41106171	+1	no_errors	ENST00000355341	ensembl	human	known	70_37	missense	SNP	0.982	A
ZIC4	84107	genome.wustl.edu	37	3	147106138	147106138	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr3:147106138C>T	ENST00000383075.3	-	0	2025				ZIC4_ENST00000425731.3_3'UTR|ZIC4_ENST00000525172.2_3'UTR|ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000472749.2_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						TTGATTAGACCTTTCTCCTTT	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	84107			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*508G>A	3.37:g.147106138C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-		0.488	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	C			147106138	-1	no_errors	ENST00000472749	ensembl	human	known	70_37	rna	SNP	1.000	T
ZNF492	57615	genome.wustl.edu	37	19	22846669	22846669	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:22846669G>A	ENST00000456783.2	+	4	442	c.198G>A	c.(196-198)gtG>gtA	p.V66V	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				TCCAAAAAGTGATACTGAGAA	0.303																																																	0													30.0	37.0	35.0					19																	22846669		1804	4104	5908	SO:0001819	synonymous_variant	57615			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.198G>A	19.37:g.22846669G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08EI7|Q08EI8	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V66	ENST00000456783.2	37	c.198	CCDS46032.1	19																																																																																			ZNF492	-	NULL		0.303	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	G	NM_020855		22846669	+1	no_errors	ENST00000456783	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF577	84765	genome.wustl.edu	37	19	52364164	52364164	+	3'UTR	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:52364164G>A	ENST00000412216.1	-	0	1699				ZNF577_ENST00000485702.1_5'UTR			Q9BSK1	ZN577_HUMAN	zinc finger protein 577						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TACCTGCAATGAGGTGTGATT	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	84765			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000412216.1:c.*15C>T	19.37:g.52364164G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0B4|A8K6Z7|C9JFB9	RNA	SNP	-	NULL	ENST00000412216.1	37	NULL		19																																																																																			ZNF577	-	-		0.338	ZNF577-005	PUTATIVE	basic	protein_coding	ZNF577	HGNC	protein_coding	OTTHUMT00000347247.1	G	NM_032679		52364164	-1	no_errors	ENST00000485702	ensembl	human	known	70_37	rna	SNP	0.070	A
ZNF534	147658	genome.wustl.edu	37	19	52942558	52942558	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:52942558C>T	ENST00000332323.6	+	4	1945	c.1884C>T	c.(1882-1884)ttC>ttT	p.F628F	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Silent_p.F615F|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	628					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						GCAAGGTCTTCAGTCGGAATT	0.408																																																	0													52.0	49.0	50.0					19																	52942558		692	1591	2283	SO:0001819	synonymous_variant	147658			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1884C>T	19.37:g.52942558C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q76KX9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F628	ENST00000332323.6	37	c.1884	CCDS46165.1	19																																																																																			ZNF534	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	C	NM_182512		52942558	+1	no_errors	ENST00000332323	ensembl	human	known	70_37	silent	SNP	0.009	T
ZNF597	146434	genome.wustl.edu	37	16	3487486	3487486	+	Missense_Mutation	SNP	T	T	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:3487486T>A	ENST00000301744.4	-	4	448	c.213A>T	c.(211-213)gaA>gaT	p.E71D		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	71	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						GCTCGTCAAGTTCCATAGACT	0.433																																																	0													77.0	78.0	78.0					16																	3487486		2197	4300	6497	SO:0001583	missense	146434			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.213A>T	16.37:g.3487486T>A	ENSP00000301744:p.Glu71Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E71D	ENST00000301744.4	37	c.213	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	T	6.098	0.386354	0.11524	.	.	ENSG00000167981	ENST00000301744	T	0.07444	3.19	4.91	1.48	0.22813	Krueppel-associated box (1);	0.294046	0.24762	N	0.035811	T	0.04588	0.0125	L	0.27944	0.81	0.21020	N	0.9998	P	0.37781	0.608	B	0.35413	0.202	T	0.42172	-0.9467	10	0.14656	T	0.56	-6.6669	6.4678	0.21991	0.0:0.2873:0.0:0.7127	.	71	Q96LX8	ZN597_HUMAN	D	71	ENSP00000301744:E71D	ENSP00000301744:E71D	E	-	3	2	ZNF597	3427487	0.000000	0.05858	0.186000	0.23195	0.810000	0.45777	-0.142000	0.10311	0.132000	0.18615	0.533000	0.62120	GAA	ZNF597	-	smart_Krueppel-associated_box		0.433	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	T	NM_152457		3487486	-1	no_errors	ENST00000301744	ensembl	human	known	70_37	missense	SNP	0.621	A
ZNF700	90592	genome.wustl.edu	37	19	12060821	12060821	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:12060821C>T	ENST00000254321.5	+	4	2125	c.1982C>T	c.(1981-1983)tCt>tTt	p.S661F	ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.S643F|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000591944.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	661					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TGTAAATTCTCTTCTTTTCAA	0.403																																																	0													60.0	58.0	59.0					19																	12060821		2203	4300	6503	SO:0001583	missense	90592			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1982C>T	19.37:g.12060821C>T	ENSP00000254321:p.Ser661Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S661F	ENST00000254321.5	37	c.1982	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	c	10.12	1.263005	0.23051	.	.	ENSG00000196757	ENST00000254321	T	0.37058	1.22	0.681	-0.901	0.10540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55273	0.1910	M	0.81942	2.565	0.09310	N	1	D	0.65815	0.995	D	0.72982	0.979	T	0.45145	-0.9281	9	0.72032	D	0.01	.	6.9412	0.24494	0.3003:0.6996:0.0:0.0	.	661	Q9H0M5	ZN700_HUMAN	F	661	ENSP00000254321:S661F	ENSP00000254321:S661F	S	+	2	0	ZNF700	11921821	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	-0.757000	0.04772	-0.337000	0.08426	0.313000	0.20887	TCT	ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	C	NM_144566		12060821	+1	no_errors	ENST00000254321	ensembl	human	known	70_37	missense	SNP	0.034	T
ZNF611	81856	genome.wustl.edu	37	19	53209325	53209325	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:53209325G>A	ENST00000319783.1	-	7	1299	c.983C>T	c.(982-984)tCa>tTa	p.S328L	ZNF611_ENST00000540744.1_Missense_Mutation_p.S328L|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000453741.2_Missense_Mutation_p.S259L|ZNF611_ENST00000602162.1_Missense_Mutation_p.S259L|ZNF611_ENST00000543227.1_Missense_Mutation_p.S328L|ZNF611_ENST00000595798.1_Missense_Mutation_p.S259L	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TAGAAGGGCTGAATTTTGACC	0.378																																																	0													108.0	103.0	105.0					19																	53209325		2203	4300	6503	SO:0001583	missense	81856			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.983C>T	19.37:g.53209325G>A	ENSP00000322427:p.Ser328Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRD5|Q69YG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S328L	ENST00000319783.1	37	c.983	CCDS12855.1	19	.	.	.	.	.	.	.	.	.	.	.	12.73	2.026190	0.35701	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	1.38	1.38	0.22167	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38161	0.1030	M	0.79343	2.45	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.06570	-1.0819	9	0.72032	D	0.01	.	7.2937	0.26380	0.0:0.2781:0.7219:0.0	.	328	Q8N823	ZN611_HUMAN	L	328;328;259;328	ENSP00000437616:S328L;ENSP00000439211:S328L;ENSP00000443505:S259L;ENSP00000322427:S328L	ENSP00000322427:S328L	S	-	2	0	ZNF611	57901137	0.000000	0.05858	0.003000	0.11579	0.037000	0.13140	-0.208000	0.09371	0.717000	0.32145	0.306000	0.20318	TCA	ZNF611	-	pfscan_Znf_C2H2		0.378	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF611	HGNC	protein_coding	OTTHUMT00000337612.1	G	NM_030972		53209325	-1	no_errors	ENST00000319783	ensembl	human	known	70_37	missense	SNP	0.005	A
ZNF740	283337	genome.wustl.edu	37	12	53579210	53579210	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr12:53579210G>C	ENST00000416904.3	+	4	644	c.199G>C	c.(199-201)Gat>Cat	p.D67H		NM_001004304.3	NP_001004304.1	Q8NDX6	ZN740_HUMAN	zinc finger protein 740	67					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)	3						GAGCCGCAAAGATGATGACAG	0.443																																																	0													78.0	78.0	78.0					12																	53579210		1885	4117	6002	SO:0001583	missense	283337			BC053557	CCDS44896.1	12q13.13	2013-01-08				ENSG00000139651		"""Zinc fingers, C2H2-type"""	27465	protein-coding gene	gene with protein product							Standard	NM_001004304		Approved	Zfp740	uc001scb.4	Q8NDX6		ENST00000416904.3:c.199G>C	12.37:g.53579210G>C	ENSP00000409463:p.Asp67His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9M9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D67H	ENST00000416904.3	37	c.199	CCDS44896.1	12	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622825	0.46840	.	.	ENSG00000139651	ENST00000416904	T	0.07908	3.15	4.85	4.85	0.62838	.	0.165226	0.40302	N	0.001129	T	0.04048	0.0113	N	0.08118	0	0.29272	N	0.870592	D	0.56746	0.977	B	0.38803	0.282	T	0.18808	-1.0325	10	0.59425	D	0.04	-3.9385	9.2898	0.37780	0.0964:0.0:0.9036:0.0	.	67	Q8NDX6	ZN740_HUMAN	H	67	ENSP00000409463:D67H	ENSP00000409463:D67H	D	+	1	0	ZNF740	51865477	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.632000	0.54287	2.686000	0.91538	0.462000	0.41574	GAT	ZNF740	-	NULL		0.443	ZNF740-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF740	HGNC	protein_coding	OTTHUMT00000406890.2	G	NM_001004304		53579210	+1	no_errors	ENST00000416904	ensembl	human	known	70_37	missense	SNP	1.000	C
ZP2	7783	genome.wustl.edu	37	16	21221009	21221009	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:21221009G>A	ENST00000574002.1	-	5	755	c.273C>T	c.(271-273)atC>atT	p.I91I	ZP2_ENST00000574091.1_Silent_p.I91I|ZP2_ENST00000219593.4_Silent_p.I91I			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	91					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		CTGGGTCCAGGATGTAAGTGC	0.493																																																	0													183.0	158.0	167.0					16																	21221009		2199	4300	6499	SO:0001819	synonymous_variant	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.273C>T	16.37:g.21221009G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Silent	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.I91	ENST00000574002.1	37	c.273	CCDS10596.1	16																																																																																			ZP2	-	NULL		0.493	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	G			21221009	-1	no_errors	ENST00000219593	ensembl	human	known	70_37	silent	SNP	0.002	A
ZNF778	197320	genome.wustl.edu	37	16	89294118	89294118	+	Silent	SNP	G	G	A			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr16:89294118G>A	ENST00000433976.2	+	6	1670	c.1338G>A	c.(1336-1338)gaG>gaA	p.E446E	ZNF778_ENST00000306502.6_Silent_p.E404E|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	446					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		ACACTGGAGAGAAACCATATG	0.488																																																	0													88.0	92.0	90.0					16																	89294118		2194	4299	6493	SO:0001819	synonymous_variant	197320			AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1338G>A	16.37:g.89294118G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AG0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E446	ENST00000433976.2	37	c.1338	CCDS45550.1	16																																																																																			ZNF778	-	pfscan_Znf_C2H2		0.488	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF778	HGNC	protein_coding	OTTHUMT00000430383.1	G	NM_182531		89294118	+1	no_errors	ENST00000433976	ensembl	human	known	70_37	silent	SNP	1.000	A
ZSWIM4	65249	genome.wustl.edu	37	19	13930181	13930181	+	Silent	SNP	C	C	T			TCGA-EK-A2RD-01A-12D-A20U-09	TCGA-EK-A2RD-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b429a4aa-1a29-4e26-8236-7dc5f7c87b23	aa41db66-99b8-4d24-ba78-67271a579215	g.chr19:13930181C>T	ENST00000254323.2	+	9	1773	c.1584C>T	c.(1582-1584)ttC>ttT	p.F528F	ZSWIM4_ENST00000440752.2_Silent_p.F362F	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	528							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GGGGTCCCTTCAGTGGCTTTG	0.637																																																	0													64.0	43.0	50.0					19																	13930181		2203	4300	6503	SO:0001819	synonymous_variant	65249			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1584C>T	19.37:g.13930181C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfscan_Znf_SWIM	p.F528	ENST00000254323.2	37	c.1584	CCDS32924.1	19																																																																																			ZSWIM4	-	NULL		0.637	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	C	XM_031342		13930181	+1	no_errors	ENST00000254323	ensembl	human	known	70_37	silent	SNP	1.000	T
