#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
A1CF	29974	genome.wustl.edu	37	10	52587925	52587925	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:52587925C>G	ENST00000373993.1	-	5	779	c.735G>C	c.(733-735)gaG>gaC	p.E245D	A1CF_ENST00000374001.2_Missense_Mutation_p.E245D|A1CF_ENST00000373997.3_Missense_Mutation_p.E245D|A1CF_ENST00000395489.2_Missense_Mutation_p.E238D|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000373995.3_Missense_Mutation_p.E253D|A1CF_ENST00000282641.2_Missense_Mutation_p.E245D|A1CF_ENST00000395495.1_Intron			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	245	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTTCAATCATCTCTTCAGAGG	0.368																																																	0													135.0	131.0	132.0					10																	52587925		2202	4300	6502	SO:0001583	missense	29974			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.735G>C	10.37:g.52587925C>G	ENSP00000363105:p.Glu245Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.E245D	ENST00000373993.1	37	c.735	CCDS7242.1	10	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721445	0.48728	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395488;ENST00000395489	T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96	5.48	2.6	0.31112	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.08714	0.0216	L	0.39566	1.225	0.58432	D	0.999996	B;B;P;B	0.40619	0.285;0.173;0.724;0.16	B;B;B;B	0.37091	0.091;0.241;0.183;0.091	T	0.27054	-1.0085	10	0.33141	T	0.24	.	9.6328	0.39789	0.0:0.7746:0.0:0.2254	.	238;245;245;253	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	D	245;245;245;253;245;228;238	ENSP00000363113:E245D;ENSP00000363105:E245D;ENSP00000363109:E245D;ENSP00000363107:E253D;ENSP00000282641:E245D;ENSP00000378868:E238D	ENSP00000282641:E245D	E	-	3	2	A1CF	52257931	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.837000	0.39201	0.271000	0.22005	-0.251000	0.11542	GAG	A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac		0.368	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	C	NM_014576		52587925	-1	no_errors	ENST00000282641	ensembl	human	known	70_37	missense	SNP	1.000	G
AAGAB	79719	genome.wustl.edu	37	15	67524189	67524189	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:67524189C>T	ENST00000261880.5	-	5	602	c.498G>A	c.(496-498)ctG>ctA	p.L166L	AAGAB_ENST00000542650.1_Silent_p.L57L|AAGAB_ENST00000561452.1_Silent_p.L57L	NM_001271885.1|NM_001271886.1|NM_024666.3	NP_001258814.1|NP_001258815.1|NP_078942.3	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin binding protein	166					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9						CATTGGCATTCAGGGCTTGGA	0.368																																																	0													256.0	248.0	250.0					15																	67524189		1928	4145	6073	SO:0001819	synonymous_variant	79719			AL136715	CCDS42050.1, CCDS61679.1	15q22.33-q23	2014-02-12	2009-07-20		ENSG00000103591	ENSG00000103591			25662	protein-coding gene	gene with protein product		614888				11230166, 10477754	Standard	NM_024666		Approved	FLJ11506, p34	uc002aqk.5	Q6PD74	OTTHUMG00000172246	ENST00000261880.5:c.498G>A	15.37:g.67524189C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DG44|Q6FI86|Q7Z5X9|Q9H0P1|Q9HAK0	Silent	SNP	pfam_Alpha/Gamma-adaptin-bd_p34	p.L166	ENST00000261880.5	37	c.498	CCDS42050.1	15																																																																																			AAGAB	-	pfam_Alpha/Gamma-adaptin-bd_p34		0.368	AAGAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAGAB	HGNC	protein_coding	OTTHUMT00000417472.1	C	NM_024666		67524189	-1	no_errors	ENST00000261880	ensembl	human	known	70_37	silent	SNP	0.995	T
ABCA1	19	genome.wustl.edu	37	9	107549160	107549160	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:107549160G>A	ENST00000374736.3	-	47	6696	c.6302C>T	c.(6301-6303)tCt>tTt	p.S2101F		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	2101	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GGACCTATGAGATGTAAGCAC	0.438																																																	0													109.0	100.0	103.0					9																	107549160		2203	4300	6503	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.6302C>T	9.37:g.107549160G>A	ENSP00000363868:p.Ser2101Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2101F	ENST00000374736.3	37	c.6302	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.310731	0.95629	.	.	ENSG00000165029	ENST00000374736	D	0.97976	-4.64	5.99	5.99	0.97316	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99372	0.9779	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.98408	1.0571	10	0.87932	D	0	.	20.5371	0.99232	0.0:0.0:1.0:0.0	.	2101	O95477	ABCA1_HUMAN	F	2101	ENSP00000363868:S2101F	ENSP00000363868:S2101F	S	-	2	0	ABCA1	106588981	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.824000	0.99380	2.857000	0.98124	0.650000	0.86243	TCT	ABCA1	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.438	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	G	NM_005502		107549160	-1	no_errors	ENST00000374736	ensembl	human	known	70_37	missense	SNP	1.000	A
ABCC11	85320	genome.wustl.edu	37	16	48244925	48244925	+	Silent	SNP	G	G	A	rs374088211		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:48244925G>A	ENST00000394747.1	-	10	1891	c.1542C>T	c.(1540-1542)ctC>ctT	p.L514L	ABCC11_ENST00000394748.1_Silent_p.L514L|ABCC11_ENST00000353782.5_Silent_p.L514L|ABCC11_ENST00000537808.1_Silent_p.L514L|ABCC11_ENST00000356608.2_Silent_p.L514L	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	514	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	CCTCTGGCCCGAGGGCATCTC	0.607																																																	0													101.0	85.0	90.0					16																	48244925		2201	4300	6501	SO:0001819	synonymous_variant	85320			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1542C>T	16.37:g.48244925G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L514	ENST00000394747.1	37	c.1542	CCDS10732.1	16																																																																																			ABCC11	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter-like		0.607	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	G	NM_032583		48244925	-1	no_errors	ENST00000356608	ensembl	human	known	70_37	silent	SNP	0.000	A
ACLY	47	genome.wustl.edu	37	17	40025361	40025361	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:40025361C>T	ENST00000352035.2	-	27	3199	c.3069G>A	c.(3067-3069)ctG>ctA	p.L1023L	ACLY_ENST00000393896.2_Silent_p.L1013L|ACLY_ENST00000590151.1_Silent_p.L1023L|ACLY_ENST00000537919.1_Silent_p.L752L|ACLY_ENST00000353196.1_Silent_p.L1013L|ACLY_ENST00000588779.1_5'UTR	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1023					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CATCTACATTCAGGATAAGAT	0.363																																					Colon(64;807 1396 15971 30971)												0													157.0	157.0	157.0					17																	40025361		2203	4300	6503	SO:0001819	synonymous_variant	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3069G>A	17.37:g.40025361C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.L1023	ENST00000352035.2	37	c.3069	CCDS11412.1	17																																																																																			ACLY	-	pfam_Citrate_synthase-like,superfamily_Citrate_synthase-like_core,pirsf_ATP-citrate_synthase		0.363	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	HGNC	protein_coding	OTTHUMT00000257465.1	C	NM_001096		40025361	-1	no_errors	ENST00000352035	ensembl	human	known	70_37	silent	SNP	1.000	T
ACSS1	84532	genome.wustl.edu	37	20	25038481	25038481	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:25038481G>A	ENST00000323482.4	-	1	337	c.258C>T	c.(256-258)ccC>ccT	p.P86P	ACSS1_ENST00000376726.3_Silent_p.P86P|ACSS1_ENST00000432802.2_Silent_p.P86P	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	86					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CGGTGTGGTAGGGGGTGTCCC	0.662																																																	0													43.0	48.0	46.0					20																	25038481		2203	4300	6503	SO:0001819	synonymous_variant	84532				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.258C>T	20.37:g.25038481G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Ac_CoA_lig	p.P86	ENST00000323482.4	37	c.258	CCDS13167.1	20																																																																																			ACSS1	-	pfam_Acyl-CoA_synth_DUF3448,tigrfam_Ac_CoA_lig		0.662	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	G	NM_032501		25038481	-1	no_errors	ENST00000323482	ensembl	human	known	70_37	silent	SNP	0.807	A
AHNAK2	113146	genome.wustl.edu	37	14	105421849	105421849	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:105421849G>A	ENST00000333244.5	-	5	556	c.437C>T	c.(436-438)tCa>tTa	p.S146L	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	146	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTTGGCGGCTGAGGAGTCCTT	0.587																																																	0													87.0	95.0	93.0					14																	105421849		2048	4208	6256	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.437C>T	14.37:g.105421849G>A	ENSP00000353114:p.Ser146Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S146L	ENST00000333244.5	37	c.437	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598773	0.66332	.	.	ENSG00000185567	ENST00000333244	T	0.37235	1.21	4.72	4.72	0.59763	PDZ/DHR/GLGF (3);	0.178326	0.37393	U	0.002119	T	0.52533	0.1740	L	0.46157	1.445	0.34254	D	0.679155	D	0.76494	0.999	D	0.68943	0.961	T	0.65220	-0.6221	10	0.72032	D	0.01	.	16.0752	0.80965	0.0:0.0:1.0:0.0	.	146	Q8IVF2	AHNK2_HUMAN	L	146	ENSP00000353114:S146L	ENSP00000353114:S146L	S	-	2	0	AHNAK2	104492894	1.000000	0.71417	0.777000	0.31699	0.521000	0.34408	7.468000	0.80943	2.460000	0.83146	0.650000	0.86243	TCA	AHNAK2	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.587	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	G	NM_138420		105421849	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	missense	SNP	0.991	A
AMBP	259	genome.wustl.edu	37	9	116823271	116823271	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:116823271G>A	ENST00000265132.3	-	9	1223	c.961C>T	c.(961-963)Cag>Tag	p.Q321*		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	321	BPTI/Kunitz inhibitor 2. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CCGTTGCCCTGGCAGCCCCCG	0.622																																																	0													80.0	81.0	81.0					9																	116823271		2203	4300	6503	SO:0001587	stop_gained	259			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.961C>T	9.37:g.116823271G>A	ENSP00000265132:p.Gln321*	Somatic		WXS	Illumina HiSeq	Phase_IV	P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Nonsense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_A1-microglobln,prints_PstgldnD_synth,prints_Prot_inh_Kunz-m,prints_Lipocalin	p.Q321*	ENST00000265132.3	37	c.961	CCDS6800.1	9	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815358	0.90790	.	.	ENSG00000106927	ENST00000265132	.	.	.	5.98	2.99	0.34606	.	0.459579	0.26899	N	0.021922	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	13.2286	0.59929	0.0:0.0:0.5464:0.4536	.	.	.	.	X	321	.	ENSP00000265132:Q321X	Q	-	1	0	AMBP	115863092	0.998000	0.40836	0.970000	0.41538	0.702000	0.40608	0.627000	0.24506	0.335000	0.23614	0.655000	0.94253	CAG	AMBP	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m		0.622	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	HGNC	protein_coding	OTTHUMT00000053758.2	G	NM_001633		116823271	-1	no_errors	ENST00000265132	ensembl	human	known	70_37	nonsense	SNP	0.989	A
AMFR	267	genome.wustl.edu	37	16	56396402	56396402	+	3'UTR	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:56396402G>A	ENST00000290649.5	-	0	2561					NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase						aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						ACCCCACGACGTGGGGGCGGG	0.597																																					Pancreas(2;144 323 39528)												0													102.0	99.0	100.0					16																	56396402		876	1991	2867	SO:0001624	3_prime_UTR_variant	267			L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.*419C>T	16.37:g.56396402G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P26442|Q8IZ70	RNA	SNP	-	NULL	ENST00000290649.5	37	NULL	CCDS10758.1	16	.	.	.	.	.	.	.	.	.	.	G	7.890	0.732054	0.15507	.	.	ENSG00000159461	ENST00000314566	.	.	.	5.02	-0.991	0.10235	.	.	.	.	.	T	0.29256	0.0728	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37244	-0.9714	5	0.87932	D	0	.	1.7791	0.03028	0.1774:0.3001:0.3686:0.1539	.	.	.	.	C	205	.	ENSP00000313137:R205C	R	-	1	0	AMFR	54953903	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.050000	0.11904	-0.021000	0.14009	-0.169000	0.13324	CGT	AMFR	-	-		0.597	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	HGNC	protein_coding	OTTHUMT00000256978.2	G			56396402	-1	no_errors	ENST00000492830	ensembl	human	known	70_37	rna	SNP	0.000	A
AMZ2P1	201283	genome.wustl.edu	37	17	62968902	62968902	+	RNA	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:62968902C>G	ENST00000430983.1	-	0	1433					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		TGTGTGTTCTCATTGACTCTA	0.363																																																	0																																												201283			AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968902C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000430983.1	37	NULL		17																																																																																			AMZ2P1	-	-		0.363	AMZ2P1-002	KNOWN	basic	processed_transcript	AMZ2P1	HGNC	pseudogene	OTTHUMT00000255102.1	C	NM_153032		62968902	-1	no_errors	ENST00000397713	ensembl	human	known	70_37	rna	SNP	0.218	G
ANP32D	23519	genome.wustl.edu	37	12	48866842	48866842	+	Splice_Site	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:48866842G>A	ENST00000266594.1	+	1	395	c.395G>A	c.(394-396)tGa>tAa	p.*132*		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	0						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						AACAACTACTGAGAAAAGATG	0.473																																																	0													78.0	77.0	77.0					12																	48866842		2203	4300	6503	SO:0001630	splice_region_variant	23519			U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.393+1G>A	12.37:g.48866842G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NTC4	Silent	SNP	NULL	p.*132	ENST00000266594.1	37	c.395	CCDS31788.1	12																																																																																			ANP32D	-	NULL		0.473	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32D	HGNC	protein_coding	OTTHUMT00000370058.1	G	NM_012404	Silent	48866842	+1	no_errors	ENST00000266594	ensembl	human	known	70_37	silent	SNP	1.000	A
AP1M2	10053	genome.wustl.edu	37	19	10692201	10692201	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:10692201C>T	ENST00000250244.6	-	5	590	c.508G>A	c.(508-510)Gag>Aag	p.E170K	AP1M2_ENST00000590923.1_Missense_Mutation_p.E170K	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	170	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ATGAAGACCTCGTTCTTCTTA	0.577											OREG0025241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													55.0	60.0	59.0					19																	10692201		2189	4291	6480	SO:0001583	missense	10053			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.508G>A	19.37:g.10692201C>T	ENSP00000250244:p.Glu170Lys	Somatic	666	WXS	Illumina HiSeq	Phase_IV	B2RDV5|Q9BSI8	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.E170K	ENST00000250244.6	37	c.508	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	c	29.0	4.971377	0.92919	.	.	ENSG00000129354	ENST00000250244	T	0.32515	1.45	4.86	3.83	0.44106	Clathrin adaptor, mu subunit, conserved site (1);Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.67040	0.2851	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.77672	-0.2500	10	0.87932	D	0	-39.681	12.1339	0.53959	0.0:0.915:0.0:0.085	.	170;170	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	K	170	ENSP00000250244:E170K	ENSP00000250244:E170K	E	-	1	0	AP1M2	10553201	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	7.606000	0.82863	1.279000	0.44446	0.478000	0.44815	GAG	AP1M2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu		0.577	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	HGNC	protein_coding	OTTHUMT00000452034.1	C			10692201	-1	no_errors	ENST00000590923	ensembl	human	known	70_37	missense	SNP	1.000	T
APBB1IP	54518	genome.wustl.edu	37	10	26802469	26802469	+	Splice_Site	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:26802469G>A	ENST00000376236.4	+	8	1148	c.693G>A	c.(691-693)gaG>gaA	p.E231E		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	231	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						TTTCATCAGAGAGGTTTTTTG	0.338																																																	0													66.0	70.0	68.0					10																	26802469		2203	4300	6503	SO:0001630	splice_region_variant	54518			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.692-1G>A	10.37:g.26802469G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Silent	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.E231	ENST00000376236.4	37	c.693	CCDS31167.1	10																																																																																			APBB1IP	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.338	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	G	NM_019043	Silent	26802469	+1	no_errors	ENST00000376236	ensembl	human	known	70_37	silent	SNP	1.000	A
AQP10	89872	genome.wustl.edu	37	1	154296432	154296432	+	Intron	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:154296432C>T	ENST00000324978.3	+	5	747				ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000355197.4_3'UTR|AQP10_ENST00000484864.1_3'UTR	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10						response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCCCCTTTCTCCCTTGCTTCC	0.458																																																	0																																										SO:0001627	intron_variant	89872			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.707+150C>T	1.37:g.154296432C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	RNA	SNP	-	NULL	ENST00000324978.3	37	NULL	CCDS1065.1	1																																																																																			AQP10	-	-		0.458	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP10	HGNC	protein_coding	OTTHUMT00000087661.1	C	NM_080429		154296432	+1	no_errors	ENST00000355197	ensembl	human	known	70_37	rna	SNP	0.000	T
ARHGEF4	50649	genome.wustl.edu	37	2	131798817	131798817	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:131798817G>A	ENST00000326016.5	+	9	1638	c.1119G>A	c.(1117-1119)caG>caA	p.Q373Q	ARHGEF4_ENST00000409303.1_Silent_p.Q313Q|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Silent_p.Q373Q|ARHGEF4_ENST00000392953.3_Silent_p.Q373Q|ARHGEF4_ENST00000439368.2_3'UTR|ARHGEF4_ENST00000355771.3_Silent_p.Q302Q	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	373	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CCGACTTCCAGATCTACTCGG	0.592																																																	0													97.0	93.0	94.0					2																	131798817		2203	4300	6503	SO:0001819	synonymous_variant	50649			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1119G>A	2.37:g.131798817G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HDC6|Q9UPP0	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q373	ENST00000326016.5	37	c.1119	CCDS2165.1	2																																																																																			ARHGEF4	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.592	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	G			131798817	+1	no_errors	ENST00000326016	ensembl	human	known	70_37	silent	SNP	1.000	A
ARHGEF6	9459	genome.wustl.edu	37	X	135763011	135763011	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:135763011A>G	ENST00000250617.6	-	15	2788	c.1583T>C	c.(1582-1584)gTc>gCc	p.V528A	ARHGEF6_ENST00000370622.1_Missense_Mutation_p.V374A|ARHGEF6_ENST00000370620.1_Missense_Mutation_p.V374A|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.V401A	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	528	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					GTTACAATGGACCACAATTCT	0.433																																																	0													210.0	157.0	175.0					X																	135763011		2203	4300	6503	SO:0001583	missense	9459			D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1583T>C	X.37:g.135763011A>G	ENSP00000250617:p.Val528Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_SM22_calponin	p.V528A	ENST00000250617.6	37	c.1583	CCDS14660.1	X	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238367	0.58886	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	4.9	4.9	0.64082	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.056111	0.64402	D	0.000001	T	0.63977	0.2557	M	0.61703	1.905	0.58432	D	0.999999	B;B	0.34200	0.101;0.441	B;P	0.56127	0.396;0.792	T	0.61441	-0.7062	10	0.31617	T	0.26	.	13.5522	0.61738	1.0:0.0:0.0:0.0	.	401;528	B7Z3C7;Q15052	.;ARHG6_HUMAN	A	528;374;374;374;401	ENSP00000250617:V528A;ENSP00000359654:V374A;ENSP00000359656:V374A;ENSP00000439483:V401A	ENSP00000250617:V528A	V	-	2	0	ARHGEF6	135590677	1.000000	0.71417	0.995000	0.50966	0.622000	0.37654	8.058000	0.89460	1.723000	0.51488	0.339000	0.21740	GTC	ARHGEF6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.433	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF6	HGNC	protein_coding	OTTHUMT00000058511.2	A	NM_004840		135763011	-1	no_errors	ENST00000250617	ensembl	human	known	70_37	missense	SNP	1.000	G
ASIC1	41	genome.wustl.edu	37	12	50474444	50474444	+	Intron	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:50474444G>C	ENST00000447966.2	+	9	1526				ASIC1_ENST00000552438.1_Intron|ASIC1_ENST00000228468.4_Missense_Mutation_p.G457R	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1						associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	TCCAAAAGCAGGGTGCTCACT	0.577																																																	0													72.0	59.0	64.0					12																	50474444		2203	4300	6503	SO:0001627	intron_variant	41			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.1297+72G>C	12.37:g.50474444G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.G457R	ENST00000447966.2	37	c.1369	CCDS44876.1	12	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279821	0.80692	.	.	ENSG00000110881	ENST00000228468	T	0.59083	0.29	5.18	3.33	0.38152	.	6.244980	0.00447	N	0.000085	T	0.45577	0.1349	.	.	.	0.09310	N	1	B	0.22276	0.067	B	0.20577	0.03	T	0.27971	-1.0058	9	0.34782	T	0.22	-3.2441	5.5989	0.17343	0.1693:0.0:0.6748:0.1559	.	457	P78348-1	.	R	457	ENSP00000228468:G457R	ENSP00000228468:G457R	G	+	1	0	ACCN2	48760711	0.000000	0.05858	0.001000	0.08648	0.922000	0.55478	0.455000	0.21843	0.673000	0.31224	-0.300000	0.09419	GGG	ASIC1	-	pfam_Na+channel_ASC		0.577	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC1	HGNC	protein_coding	OTTHUMT00000406004.2	G	NM_020039		50474444	+1	no_errors	ENST00000228468	ensembl	human	known	70_37	missense	SNP	0.001	C
ATAD2	29028	genome.wustl.edu	37	8	124384892	124384893	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:124384892_124384893insT	ENST00000287394.5	-	3	461_462	c.354_355insA	c.(352-357)aaagaafs	p.E119fs	ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	119					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E119fs*8(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTGTGCTCTTCTTTTTTTTTAT	0.267																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.355dupA	8.37:g.124384901_124384901dupT	ENSP00000287394:p.Glu119fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Frame_Shift_Ins	INS	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.E118fs	ENST00000287394.5	37	c.355_354	CCDS6343.1	8																																																																																			ATAD2	-	NULL		0.267	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	NM_014109		124384893	-1	no_errors	ENST00000287394	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:0.995	T
ATOH1	474	genome.wustl.edu	37	4	94750328	94750328	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:94750328C>T	ENST00000306011.3	+	1	287	c.251C>T	c.(250-252)tCc>tTc	p.S84F		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	84					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		TTGCTACATTCCCCGGAGCTG	0.701																																																	0													16.0	19.0	18.0					4																	94750328		2197	4292	6489	SO:0001583	missense	474			U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.251C>T	4.37:g.94750328C>T	ENSP00000302216:p.Ser84Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CT9	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.S84F	ENST00000306011.3	37	c.251	CCDS3638.1	4	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395131	0.62066	.	.	ENSG00000172238	ENST00000306011	D	0.98249	-4.82	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	D	0.95928	0.8674	N	0.24115	0.695	0.39400	D	0.966571	P	0.36733	0.567	B	0.42343	0.384	D	0.96975	0.9711	10	0.66056	D	0.02	-13.5908	14.0965	0.65027	0.0:1.0:0.0:0.0	.	84	Q92858	ATOH1_HUMAN	F	84	ENSP00000302216:S84F	ENSP00000302216:S84F	S	+	2	0	ATOH1	94969351	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.492000	0.60334	2.164000	0.68074	0.478000	0.44815	TCC	ATOH1	-	NULL		0.701	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH1	HGNC	protein_coding	OTTHUMT00000253585.1	C	NM_005172		94750328	+1	no_errors	ENST00000306011	ensembl	human	known	70_37	missense	SNP	1.000	T
ATP1A4	480	genome.wustl.edu	37	1	160156477	160156477	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:160156477G>A	ENST00000368081.4	+	22	3549	c.3078G>A	c.(3076-3078)gaG>gaA	p.E1026E	ATP1A4_ENST00000470705.1_Silent_p.E162E	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	1026					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGAAAGGGAGACGTACTACT	0.517																																																	0													87.0	72.0	77.0					1																	160156477		2203	4300	6503	SO:0001819	synonymous_variant	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.3078G>A	1.37:g.160156477G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.E1026	ENST00000368081.4	37	c.3078	CCDS1197.1	1																																																																																			ATP1A4	-	tigrfam_ATPase_P-typ_cation-ex_asu_euk		0.517	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	G	NM_144699		160156477	+1	no_errors	ENST00000368081	ensembl	human	known	70_37	silent	SNP	1.000	A
BANP	54971	genome.wustl.edu	37	16	88037938	88037938	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:88037938C>T	ENST00000393207.1	+	5	597	c.376C>T	c.(376-378)Cgg>Tgg	p.R126W	BANP_ENST00000479780.2_Intron|BANP_ENST00000286122.7_Missense_Mutation_p.R126W|BANP_ENST00000538234.1_Missense_Mutation_p.R134W|BANP_ENST00000393208.2_Intron|BANP_ENST00000355163.5_Intron|BANP_ENST00000355022.4_Intron	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	126					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		CAACAATGATCGGCAGAACGC	0.468																																																	0																																										SO:0001583	missense	54971			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.376C>T	16.37:g.88037938C>T	ENSP00000376902:p.Arg126Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	pfam_BEN_domain	p.R126W	ENST00000393207.1	37	c.376	CCDS54054.1	16	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578265	0.86645	.	.	ENSG00000172530	ENST00000286122;ENST00000538234;ENST00000393207	T;T;T	0.52754	0.65;0.65;0.65	5.93	5.93	0.95920	.	0.128183	0.49916	D	0.000134	T	0.55049	0.1896	N	0.24115	0.695	0.47862	D	0.999536	D;D	0.89917	1.0;1.0	D;D	0.76575	0.982;0.988	T	0.57631	-0.7778	10	0.72032	D	0.01	.	14.1896	0.65630	0.1493:0.8507:0.0:0.0	.	134;126	B4DE54;Q8N9N5	.;BANP_HUMAN	W	126;134;126	ENSP00000286122:R126W;ENSP00000444352:R134W;ENSP00000376902:R126W	ENSP00000286122:R126W	R	+	1	2	BANP	86595439	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.012000	0.49575	2.797000	0.96272	0.655000	0.94253	CGG	BANP	-	NULL		0.468	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	C	NM_017869		88037938	+1	no_errors	ENST00000286122	ensembl	human	known	70_37	missense	SNP	0.999	T
BDNF	627	genome.wustl.edu	37	11	27678712	27678712	+	3'UTR	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:27678712C>G	ENST00000525528.1	-	0	2493				BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000314915.6_3'UTR|BDNF_ENST00000395981.3_3'UTR|BDNF_ENST00000438929.1_3'UTR|BDNF_ENST00000356660.4_3'UTR|BDNF_ENST00000532997.1_3'UTR|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000395978.3_3'UTR|BDNF_ENST00000395980.2_3'UTR|BDNF_ENST00000533246.1_3'UTR|BDNF_ENST00000418212.1_3'UTR|BDNF_ENST00000395986.2_3'UTR|BDNF-AS_ENST00000499008.3_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000439476.2_3'UTR|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_3'UTR|BDNF_ENST00000533131.1_3'UTR|BDNF_ENST00000530861.1_3'UTR|BDNF_ENST00000420794.1_3'UTR|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395983.3_3'UTR|BDNF-AS_ENST00000501176.2_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						ACAAATGTATCTTTTATCAGC	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	627			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.*656G>C	11.37:g.27678712C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			BDNF	-	-		0.323	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1	C	NM_170735		27678712	-1	no_errors	ENST00000584049	ensembl	human	known	70_37	rna	SNP	0.990	G
BEGAIN	57596	genome.wustl.edu	37	14	101005410	101005410	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:101005410G>A	ENST00000355173.2	-	7	749	c.678C>T	c.(676-678)atC>atT	p.I226I	BEGAIN_ENST00000443071.2_Silent_p.I226I|CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_Silent_p.I162I	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	226						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				CACTGCAGTAGATGTCTCCCT	0.721																																					NSCLC(159;1889 2010 9965 27479 40101)												0													16.0	20.0	19.0					14																	101005410		2202	4299	6501	SO:0001819	synonymous_variant	57596			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.678C>T	14.37:g.101005410G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NPU3|Q9P282	Silent	SNP	superfamily_Prefoldin	p.I226	ENST00000355173.2	37	c.678	CCDS9962.1	14																																																																																			BEGAIN	-	NULL		0.721	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	HGNC	protein_coding	OTTHUMT00000414329.1	G	NM_020836		101005410	-1	no_errors	ENST00000355173	ensembl	human	known	70_37	silent	SNP	1.000	A
BLMH	642	genome.wustl.edu	37	17	28614948	28614948	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:28614948G>A	ENST00000261714.6	-	4	513	c.339C>T	c.(337-339)ttC>ttT	p.F113F	BLMH_ENST00000394819.3_Silent_p.F26F|RNU6-1267P_ENST00000410747.1_RNA|BLMH_ENST00000582669.1_5'Flank	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	113					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	CACTCAAGAAGAAATAACAGC	0.388																																					Pancreas(127;628 1772 12912 33293 36203)												0													81.0	79.0	79.0					17																	28614948		2203	4300	6503	SO:0001819	synonymous_variant	642			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.339C>T	17.37:g.28614948G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R796|Q53F86|Q9UER9	Silent	SNP	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	p.F113	ENST00000261714.6	37	c.339	CCDS32604.1	17																																																																																			BLMH	-	pfam_Peptidase_C1B,pirsf_Peptidase_C1B		0.388	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	HGNC	protein_coding	OTTHUMT00000447940.1	G	NM_000386		28614948	-1	no_errors	ENST00000261714	ensembl	human	known	70_37	silent	SNP	1.000	A
C17orf80	55028	genome.wustl.edu	37	17	71243444	71243444	+	Silent	SNP	G	G	A	rs368091108		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:71243444G>A	ENST00000535032.2	+	5	1907	c.1794G>A	c.(1792-1794)acG>acA	p.T598T	RP11-661C3.2_ENST00000579037.1_RNA|C17orf80_ENST00000582793.1_Silent_p.T67T|C17orf80_ENST00000268942.8_Silent_p.T562T|C17orf80_ENST00000577615.1_Silent_p.T562T|C17orf80_ENST00000359042.2_Silent_p.T598T			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	598						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			TGGCGAAGACGACTGGGGATT	0.483																																																	0								G	,	0,4406		0,0,2203	178.0	152.0	161.0		1686,1794	-4.4	0.0	17		161	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	C17orf80	NM_001100621.1,NM_017941.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	562/574,598/610	71243444	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55028			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.1794G>A	17.37:g.71243444G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Silent	SNP	NULL	p.T598	ENST00000535032.2	37	c.1794	CCDS11694.1	17																																																																																			C17orf80	-	NULL		0.483	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf80	HGNC	protein_coding	OTTHUMT00000441893.1	G	NM_017941		71243444	+1	no_errors	ENST00000359042	ensembl	human	known	70_37	silent	SNP	0.000	A
KDF1	126695	genome.wustl.edu	37	1	27278001	27278001	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:27278001G>A	ENST00000320567.5	-	2	959	c.871C>T	c.(871-873)Cag>Tag	p.Q291*		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		291					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TCAGCATCCTGCTCATCCAGG	0.582																																																	0													69.0	59.0	62.0					1																	27278001		2203	4300	6503	SO:0001587	stop_gained	126695																														ENST00000320567.5:c.871C>T	1.37:g.27278001G>A	ENSP00000319179:p.Gln291*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5QP32|Q8N0S7	Nonsense_Mutation	SNP	NULL	p.Q291*	ENST00000320567.5	37	c.871	CCDS293.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.429063	0.96131	.	.	ENSG00000175707	ENST00000320567	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.397	0.94611	0.0:0.0:1.0:0.0	.	.	.	.	X	291	.	ENSP00000319179:Q291X	Q	-	1	0	C1orf172	27150588	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.405000	0.97313	2.594000	0.87642	0.555000	0.69702	CAG	C1orf172	-	NULL		0.582	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	HGNC	protein_coding	OTTHUMT00000012340.1	G			27278001	-1	no_errors	ENST00000320567	ensembl	human	known	70_37	nonsense	SNP	1.000	A
KDF1	126695	genome.wustl.edu	37	1	27278443	27278443	+	Silent	SNP	G	G	C	rs535449942		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:27278443G>C	ENST00000320567.5	-	2	517	c.429C>G	c.(427-429)ccC>ccG	p.P143P		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		143					developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CCCGCCGGCTGGGGGGTGCAC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16347	0.0		0.001	False		,,,				2504	0.0																0													24.0	27.0	26.0					1																	27278443		2203	4300	6503	SO:0001819	synonymous_variant	126695																														ENST00000320567.5:c.429C>G	1.37:g.27278443G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5QP32|Q8N0S7	Silent	SNP	NULL	p.P143	ENST00000320567.5	37	c.429	CCDS293.1	1	.	.	.	.	.	.	.	.	.	.	G	7.080	0.570052	0.13560	.	.	ENSG00000175707	ENST00000374109	.	.	.	4.84	-1.75	0.08031	.	0.116963	0.64402	D	0.000014	T	0.18002	0.0432	.	.	.	0.52501	D	0.999952	.	.	.	.	.	.	T	0.22243	-1.0222	6	0.06236	T	0.91	.	2.4145	0.04432	0.4097:0.1141:0.3592:0.1169	.	.	.	.	R	104	.	ENSP00000363223:P104R	P	-	2	0	C1orf172	27151030	0.992000	0.36948	0.578000	0.28575	0.977000	0.68977	0.403000	0.20982	-0.559000	0.06110	0.650000	0.86243	CCA	C1orf172	-	NULL		0.632	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	HGNC	protein_coding	OTTHUMT00000012340.1	G			27278443	-1	no_errors	ENST00000320567	ensembl	human	known	70_37	silent	SNP	0.427	C
ZGRF1	55345	genome.wustl.edu	37	4	113538800	113538800	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:113538800C>G	ENST00000505019.1	-	6	2523	c.2398G>C	c.(2398-2400)Gag>Cag	p.E800Q	C4orf21_ENST00000309071.5_Missense_Mutation_p.E800Q|C4orf21_ENST00000445203.2_Missense_Mutation_p.E769Q	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		800						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		GTTTCAACCTCAACATGGTCA	0.388																																																	0													78.0	71.0	74.0					4																	113538800		2203	4300	6503	SO:0001583	missense	55345																														ENST00000505019.1:c.2398G>C	4.37:g.113538800C>G	ENSP00000424737:p.Glu800Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	pfam_DUF2439,pfam_Znf_GRF	p.E800Q	ENST00000505019.1	37	c.2398		4	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761735	0.31228	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.83250	-1.7;1.81;1.39	5.98	4.0	0.46444	.	0.471978	0.20005	N	0.101248	D	0.82300	0.5007	L	0.47716	1.5	0.09310	N	1	D;D	0.53619	0.961;0.96	P;P	0.52758	0.708;0.55	T	0.73946	-0.3822	10	0.66056	D	0.02	-7.5699	7.9738	0.30143	0.0:0.7296:0.0:0.2704	.	800;800	Q86YA3;G5EA02	CD021_HUMAN;.	Q	800;800;769	ENSP00000424737:E800Q;ENSP00000309095:E800Q;ENSP00000390505:E769Q	ENSP00000309095:E800Q	E	-	1	0	C4orf21	113758249	0.001000	0.12720	0.014000	0.15608	0.025000	0.11179	0.069000	0.14552	1.510000	0.48803	0.655000	0.94253	GAG	C4orf21	-	NULL		0.388	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	C			113538800	-1	no_errors	ENST00000505019	ensembl	human	known	70_37	missense	SNP	0.004	G
C4orf47	441054	genome.wustl.edu	37	4	186357251	186357251	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:186357251C>T	ENST00000378850.4	+	3	394	c.372C>T	c.(370-372)ttC>ttT	p.F124F		NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	124										breast(2)|endometrium(1)	3						TCCCATTTTTCAGCGCACAGT	0.368																																																	0													46.0	44.0	45.0					4																	186357251		692	1591	2283	SO:0001819	synonymous_variant	441054			AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.372C>T	4.37:g.186357251C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BLP7	Silent	SNP	NULL	p.F124	ENST00000378850.4	37	c.372	CCDS47169.1	4																																																																																			C4orf47	-	NULL		0.368	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf47	HGNC	protein_coding	OTTHUMT00000360667.1	C	NM_001114357		186357251	+1	no_errors	ENST00000378850	ensembl	human	known	70_37	silent	SNP	1.000	T
C7orf26	79034	genome.wustl.edu	37	7	6639837	6639837	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:6639837G>A	ENST00000344417.5	+	4	1225	c.958G>A	c.(958-960)Gac>Aac	p.D320N	C7orf26_ENST00000472693.1_3'UTR|C7orf26_ENST00000359073.5_Missense_Mutation_p.D223N	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	320										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		GATCCTCTTCGACCACATGGT	0.592																																																	0													58.0	51.0	54.0					7																	6639837		2203	4300	6503	SO:0001583	missense	79034			BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.958G>A	7.37:g.6639837G>A	ENSP00000340220:p.Asp320Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQ43	Missense_Mutation	SNP	NULL	p.D320N	ENST00000344417.5	37	c.958	CCDS5353.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.3|29.3	4.992955|4.992955	0.93167|0.93167	.|.	.|.	ENSG00000146576|ENSG00000146576	ENST00000344417;ENST00000359073|ENST00000445375	T;T|.	0.42900|.	0.96;0.96|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.082256|.	0.85682|.	D|.	0.000000|.	T|T	0.61337|0.61337	0.2339|0.2339	L|L	0.41236|0.41236	1.265|1.265	0.50171|0.50171	D|D	0.999851|0.999851	D;D|.	0.69078|.	0.994;0.997|.	P;P|.	0.60789|.	0.652;0.879|.	T|T	0.55309|0.55309	-0.8161|-0.8161	10|5	0.52906|.	T|.	0.07|.	-32.5857|-32.5857	17.036|17.036	0.86476|0.86476	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	223;320|.	Q96N11-2;Q96N11|.	.;CG026_HUMAN|.	N|Q	320;223|57	ENSP00000340220:D320N;ENSP00000351974:D223N|.	ENSP00000340220:D320N|.	D|R	+|+	1|2	0|0	C7orf26|C7orf26	6606362|6606362	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.814000|0.814000	0.46013|0.46013	9.062000|9.062000	0.93920|0.93920	2.811000|2.811000	0.96726|0.96726	0.555000|0.555000	0.69702|0.69702	GAC|CGA	C7orf26	-	NULL		0.592	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf26	HGNC	protein_coding	OTTHUMT00000246844.2	G	NM_024067		6639837	+1	no_errors	ENST00000344417	ensembl	human	known	70_37	missense	SNP	1.000	A
CCDC180	100499483	genome.wustl.edu	37	9	100080841	100080841	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:100080841G>A	ENST00000357054.1	+	24	2540	c.1605G>A	c.(1603-1605)cgG>cgA	p.R535R	CCDC180_ENST00000395220.1_Intron|CCDC180_ENST00000411667.2_Silent_p.R393R|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000529487.1_Silent_p.R396R|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Silent_p.R396R			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	535						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGCAAAGGCGGCTGAAGCATC	0.602																																																	0													78.0	63.0	68.0					9																	100080841		2203	4300	6503	SO:0001819	synonymous_variant	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1605G>A	9.37:g.100080841G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	NULL	p.R396	ENST00000357054.1	37	c.1188		9																																																																																			C9orf174	-	NULL		0.602	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		G	NM_020893		100080841	+1	no_errors	ENST00000375202	ensembl	human	known	70_37	silent	SNP	0.163	A
CCDC180	100499483	genome.wustl.edu	37	9	100086218	100086218	+	Intron	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:100086218G>C	ENST00000357054.1	+	27	2855				CCDC180_ENST00000395220.1_Silent_p.L611L|CCDC180_ENST00000411667.2_Intron|CCDC180_ENST00000460482.2_Intron|CCDC180_ENST00000529487.1_Intron|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Intron			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTGGGGAGCTGAGGTGGGGTT	0.607																																																	0													24.0	25.0	25.0					9																	100086218		2133	4175	6308	SO:0001627	intron_variant	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1920+33G>C	9.37:g.100086218G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	NULL	p.L611	ENST00000357054.1	37	c.1833		9																																																																																			C9orf174	-	NULL		0.607	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		G	NM_020893		100086218	+1	no_errors	ENST00000395220	ensembl	human	known	70_37	silent	SNP	0.000	C
CA13	377677	genome.wustl.edu	37	8	86158063	86158063	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:86158063G>A	ENST00000321764.3	+	1	308	c.6G>A	c.(4-6)tcG>tcA	p.S2S	CA13_ENST00000517298.1_Intron|RP11-219B4.5_ENST00000549291.1_5'Flank	NM_198584.2	NP_940986.1	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	2					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|myelin sheath (GO:0043209)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)	7					Zonisamide(DB00909)	GGACCATGTCGAGGCTCAGCT	0.662																																																	0													137.0	150.0	145.0					8																	86158063		2203	4300	6503	SO:0001819	synonymous_variant	377677			BC052602	CCDS6236.1	8q21	2004-05-10				ENSG00000185015		"""Carbonic anhydrases"""	14914	protein-coding gene	gene with protein product		611436				14600151	Standard	NM_198584		Approved	CAXIII, FLJ37995, MGC59868	uc003ydg.2	Q8N1Q1		ENST00000321764.3:c.6G>A	8.37:g.86158063G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.S2	ENST00000321764.3	37	c.6	CCDS6236.1	8																																																																																			CA13	-	NULL		0.662	CA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA13	HGNC	protein_coding	OTTHUMT00000381066.1	G	NM_198584		86158063	+1	no_errors	ENST00000321764	ensembl	human	known	70_37	silent	SNP	0.476	A
CA5BP1	340591	genome.wustl.edu	37	X	15706849	15706849	+	RNA	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:15706849C>T	ENST00000380334.2	+	0	93							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										CATCAACATTCGGTGGAGGGA	0.532																																																	0																																												340591			BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15706849C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEZ4	RNA	SNP	-	NULL	ENST00000380334.2	37	NULL		X																																																																																			CA5BP1	-	-		0.532	CA5BP1-005	KNOWN	basic	processed_transcript	CA5BP1	HGNC	pseudogene	OTTHUMT00000055884.3	C	NR_026551		15706849	+1	no_errors	ENST00000380331	ensembl	human	known	70_37	rna	SNP	0.963	T
CAST	831	genome.wustl.edu	37	5	96066545	96066545	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:96066545C>T	ENST00000341926.3	+	7	524	c.362C>T	c.(361-363)tCt>tTt	p.S121F	CAST_ENST00000348386.3_3'UTR|CAST_ENST00000325674.7_Missense_Mutation_p.S182F|CAST_ENST00000309190.5_Missense_Mutation_p.S99F|CAST_ENST00000508830.1_Missense_Mutation_p.S204F|CAST_ENST00000359176.4_Missense_Mutation_p.S185F|CAST_ENST00000511782.1_Missense_Mutation_p.S107F|CAST_ENST00000509903.1_Missense_Mutation_p.S99F|CAST_ENST00000504465.1_Intron|CAST_ENST00000338252.3_Missense_Mutation_p.S121F|CAST_ENST00000508608.1_Missense_Mutation_p.S167F|CAST_ENST00000511049.1_Missense_Mutation_p.S107F|CAST_ENST00000510756.1_Missense_Mutation_p.S182F|CAST_ENST00000395813.1_Missense_Mutation_p.S204F|CAST_ENST00000395812.2_Missense_Mutation_p.S163F			P20810	ICAL_HUMAN	calpastatin	121					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		ACTGCAATATCTGGCAAGCCG	0.453																																																	0													151.0	134.0	140.0					5																	96066545		2203	4300	6503	SO:0001583	missense	831			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.362C>T	5.37:g.96066545C>T	ENSP00000339914:p.Ser121Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	pfam_Prot_inh_calpain	p.S204F	ENST00000341926.3	37	c.611		5	.	.	.	.	.	.	.	.	.	.	c	14.80	2.642640	0.47153	.	.	ENSG00000153113	ENST00000505143;ENST00000338252;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000421689;ENST00000510756;ENST00000514845;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000509903;ENST00000511782	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.52057	0.68;2.07;2.09;2.01;2.09;2.07;2.07;2.09;0.79;2.1;2.09;2.09;2.09;2.1;2.09;2.07;2.09	5.02	3.22	0.36961	.	1.001760	0.08050	N	0.996445	T	0.64294	0.2585	M	0.61703	1.905	0.09310	N	1	P;D;D;D;D;D;P;D;D;P;D	0.71674	0.846;0.979;0.967;0.993;0.957;0.993;0.946;0.998;0.994;0.946;0.985	B;P;P;P;P;P;P;D;D;P;P	0.77004	0.365;0.89;0.851;0.858;0.854;0.858;0.704;0.929;0.989;0.771;0.898	T	0.44877	-0.9299	10	0.59425	D	0.04	0.1433	8.0548	0.30598	0.0:0.8132:0.0:0.1868	.	167;99;99;80;121;182;163;185;182;204;121	B7Z468;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2	.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.	F	199;121;204;182;204;185;182;163;185;182;148;167;121;107;99;121;99;107	ENSP00000422957:S199F;ENSP00000343421:S121F;ENSP00000425721:S204F;ENSP00000422951:S182F;ENSP00000379158:S204F;ENSP00000352098:S185F;ENSP00000320319:S182F;ENSP00000379157:S163F;ENSP00000396558:S185F;ENSP00000422176:S182F;ENSP00000422677:S167F;ENSP00000339914:S121F;ENSP00000421130:S107F;ENSP00000312523:S99F;ENSP00000422325:S121F;ENSP00000426946:S99F;ENSP00000423638:S107F	ENSP00000312523:S99F	S	+	2	0	CAST	96092301	0.002000	0.14202	0.001000	0.08648	0.003000	0.03518	1.326000	0.33735	0.797000	0.33971	0.651000	0.88453	TCT	CAST	-	NULL		0.453	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	C	NM_173062		96066545	+1	no_errors	ENST00000395813	ensembl	human	known	70_37	missense	SNP	0.001	T
CBWD2	150472	genome.wustl.edu	37	2	114210748	114210748	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:114210748G>C	ENST00000259199.4	+	5	641	c.463G>C	c.(463-465)Gaa>Caa	p.E155Q	CBWD2_ENST00000433343.2_Missense_Mutation_p.E119Q|CBWD2_ENST00000416503.2_Missense_Mutation_p.E155Q	NM_172003.3	NP_742000.1	Q8IUF1	CBWD2_HUMAN	COBW domain containing 2	155							ATP binding (GO:0005524)			endometrium(1)|lung(1)	2						GGTTGATGCTGAATTAGGGAG	0.284																																																	0													18.0	31.0	27.0					2																	114210748		1466	2650	4116	SO:0001583	missense	150472			AF452722	CCDS2116.1	2q14.1	2005-08-22			ENSG00000136682	ENSG00000136682			17907	protein-coding gene	gene with protein product		611079				12421752, 15233989	Standard	NM_172003		Approved		uc002tju.3	Q8IUF1	OTTHUMG00000131360	ENST00000259199.4:c.463G>C	2.37:g.114210748G>C	ENSP00000259199:p.Glu155Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VAN3	Missense_Mutation	SNP	pfam_CobW/HypB/UreG_dom,pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C	p.E155Q	ENST00000259199.4	37	c.463	CCDS2116.1	2	.	.	.	.	.	.	.	.	.	.	.	12.99	2.102390	0.37145	.	.	ENSG00000136682	ENST00000259199;ENST00000376448;ENST00000416503;ENST00000433343	T;T;T	0.46063	0.88;0.88;0.88	2.85	2.85	0.33270	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	M	0.62088	1.915	0.53005	D	0.999963	B;B;P	0.37663	0.061;0.063;0.604	B;B;P	0.46685	0.1;0.09;0.524	T	0.44467	-0.9326	10	0.33940	T	0.23	-15.652	11.5306	0.50607	0.0:0.0:1.0:0.0	.	119;119;155	B7Z8M0;F8WEG4;Q8IUF1	.;.;CBWD2_HUMAN	Q	155;155;155;119	ENSP00000259199:E155Q;ENSP00000411906:E155Q;ENSP00000401945:E119Q	ENSP00000259199:E155Q	E	+	1	0	CBWD2	113927218	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.617000	0.90927	1.617000	0.50277	0.398000	0.26397	GAA	CBWD2	-	pfam_CobW/HypB/UreG_dom		0.284	CBWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD2	HGNC	protein_coding	OTTHUMT00000254149.3	G	NM_172003		114210748	+1	no_errors	ENST00000259199	ensembl	human	known	70_37	missense	SNP	1.000	C
CCDC24	149473	genome.wustl.edu	37	1	44461379	44461379	+	Intron	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:44461379C>T	ENST00000372318.3	+	7	793				CCDC24_ENST00000479055.1_Intron|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372307.3_Intron	NM_152499.1	NP_689712.1	Q8N4L8	CCD24_HUMAN	coiled-coil domain containing 24											endometrium(3)|large_intestine(2)|lung(3)|stomach(1)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				CACCCAGCCTCCTGCTCCCAC	0.602																																																	0													35.0	38.0	37.0					1																	44461379		2203	4300	6503	SO:0001627	intron_variant	149473				CCDS507.1	1p34.1	2008-02-05			ENSG00000159214	ENSG00000159214			28688	protein-coding gene	gene with protein product						12477932	Standard	NM_152499		Approved	MGC45441	uc001clj.3	Q8N4L8	OTTHUMG00000008299	ENST00000372318.3:c.622+37C>T	1.37:g.44461379C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6RWT2	RNA	SNP	-	NULL	ENST00000372318.3	37	NULL	CCDS507.1	1																																																																																			CCDC24	-	-		0.602	CCDC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC24	HGNC	protein_coding	OTTHUMT00000022865.1	C	NM_152499		44461379	+1	no_errors	ENST00000463846	ensembl	human	known	70_37	rna	SNP	0.000	T
CD74	972	genome.wustl.edu	37	5	149784289	149784289	+	Missense_Mutation	SNP	C	C	G	rs375690781		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:149784289C>G	ENST00000009530.7	-	6	580	c.579G>C	c.(577-579)atG>atC	p.M193I	CD74_ENST00000353334.6_Missense_Mutation_p.M193I|CD74_ENST00000377795.3_Intron|CD74_ENST00000524315.1_Intron			P04233	HG2A_HUMAN	CD74 molecule, major histocompatibility complex, class II invariant chain	193					activation of MAPK activity (GO:0000187)|antigen processing and presentation of endogenous antigen (GO:0019883)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|chaperone mediated protein folding requiring cofactor (GO:0051085)|defense response (GO:0006952)|immunoglobulin mediated immune response (GO:0016064)|intracellular protein transport (GO:0006886)|macrophage migration inhibitory factor signaling pathway (GO:0035691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of peptide secretion (GO:0002792)|negative regulation of T cell differentiation (GO:0045581)|negative thymic T cell selection (GO:0045060)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type 2 immune response (GO:0002830)|positive thymic T cell selection (GO:0045059)|prostaglandin biosynthetic process (GO:0001516)|protein complex assembly (GO:0006461)|regulation of macrophage activation (GO:0043030)|signal transduction (GO:0007165)|T cell selection (GO:0045058)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|macrophage migration inhibitory factor receptor complex (GO:0035692)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|NOS2-CD74 complex (GO:0035693)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)|vacuole (GO:0005773)	beta-amyloid binding (GO:0001540)|cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|macrophage migration inhibitory factor binding (GO:0035718)|MHC class II protein binding (GO:0042289)|MHC class II protein binding, via antigen binding groove (GO:0042658)|MHC class II protein complex binding (GO:0023026)|protein binding involved in protein folding (GO:0044183)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	5		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTGCCTGCTCATTTCAAACA	0.577			T	ROS1	NSCLC																																			Dom	yes		5	5q32	972	"""CD74 molecule, major histocompatibility complex, class II invariant chain"""		E	0													49.0	51.0	51.0					5																	149784289		1970	4150	6120	SO:0001583	missense	972				CCDS34276.1, CCDS47308.1, CCDS47309.1	5q32	2012-09-20	2006-03-28		ENSG00000019582	ENSG00000019582		"""CD molecules"""	1697	protein-coding gene	gene with protein product	"""HLA-DR-gamma"", ""Ia-associated invariant chain"", ""gamma chain of class II antigens"", ""MHC HLA-DR gamma chain"""	142790	"""CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)"""	DHLAG		6324166, 3001652	Standard	NM_004355		Approved		uc003lsc.3	P04233	OTTHUMG00000163559	ENST00000009530.7:c.579G>C	5.37:g.149784289C>G	ENSP00000009530:p.Met193Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7R1|B4DNE8|D3DQG3|D3DQG4|Q14597|Q29832|Q5U0J8|Q8SNA0|Q8WLP6	Missense_Mutation	SNP	pfam_MHC_II-assoc_invar/CLIP_MHC-bd,pfam_MHC_II-assoc_invariant_trimer,pfam_Thyroglobulin_1,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,pfscan_Thyroglobulin_1,prints_MHC_II-assoc_invar_chain	p.M193I	ENST00000009530.7	37	c.579	CCDS47309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.578491|4.578491	0.86645|0.86645	.|.	.|.	ENSG00000019582|ENSG00000019582	ENST00000518797|ENST00000353334;ENST00000009530	.|T	.|0.62639	.|0.01	5.56|5.56	5.56|5.56	0.83823|0.83823	.|MHC class II-associated invariant chain, trimerisation (3);Thyroglobulin type-1 (1);	.|0.245131	.|0.52532	.|D	.|0.000061	T|T	0.78947|0.78947	0.4364|0.4364	M|M	0.74881|0.74881	2.28|2.28	0.50632|0.50632	D|D	0.999889|0.999889	.|D;P;D;D	.|0.63046	.|0.969;0.794;0.992;0.985	.|D;B;D;D	.|0.72338	.|0.968;0.406;0.91;0.977	T|T	0.80777|0.80777	-0.1231|-0.1231	5|10	.|0.72032	.|D	.|0.01	-18.8627|-18.8627	16.4355|16.4355	0.83873|0.83873	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|193;193;193;105	.|A9YLN4;P04233-2;P04233;B4DUJ2	.|.;.;HG2A_HUMAN;.	Q|I	188|193	.|ENSP00000009530:M193I	.|ENSP00000009530:M193I	E|M	-|-	1|3	0|0	CD74|CD74	149764482|149764482	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.867000|0.867000	0.49689|0.49689	5.014000|5.014000	0.64029|0.64029	2.619000|2.619000	0.88677|0.88677	0.491000|0.491000	0.48974|0.48974	GAG|ATG	CD74	-	pfam_MHC_II-assoc_invariant_trimer,superfamily_MHC_II-assoc_invariant_trimer,superfamily_Thyroglobulin_1,pirsf_MHC_II-assoc_invar_chain,prints_MHC_II-assoc_invar_chain		0.577	CD74-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD74	HGNC	protein_coding	OTTHUMT00000374178.1	C	NM_004355		149784289	-1	no_errors	ENST00000009530	ensembl	human	known	70_37	missense	SNP	1.000	G
CDAN1	146059	genome.wustl.edu	37	15	43028186	43028186	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:43028186G>A	ENST00000356231.3	-	3	683	c.660C>T	c.(658-660)atC>atT	p.I220I		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	220					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GGACACAGCTGATTGGGGGTG	0.612																																																	0													105.0	120.0	115.0					15																	43028186		2203	4299	6502	SO:0001819	synonymous_variant	146059			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.660C>T	15.37:g.43028186G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NYD0|Q7Z7L5|Q969N3	Silent	SNP	NULL	p.I220	ENST00000356231.3	37	c.660	CCDS32209.1	15																																																																																			CDAN1	-	NULL		0.612	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDAN1	HGNC	protein_coding	OTTHUMT00000431103.1	G	XM_085300		43028186	-1	no_errors	ENST00000356231	ensembl	human	known	70_37	silent	SNP	1.000	A
CDK7	1022	genome.wustl.edu	37	5	68530841	68530841	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:68530841G>A	ENST00000256443.3	+	1	142	c.39G>A	c.(37-39)gaG>gaA	p.E13E	CDK7_ENST00000502604.1_5'Flank|CDK7_ENST00000514676.1_Silent_p.E13E	NM_001799.3	NP_001790.1	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	13	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				7-methylguanosine mRNA capping (GO:0006370)|androgen receptor signaling pathway (GO:0030521)|ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA-dependent ATPase activity (GO:0008094)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription coactivator activity (GO:0003713)			endometrium(1)|lung(2)	3		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		AGCGTTATGAGAAGCTGGACT	0.622								Nucleotide excision repair (NER)																																									0													29.0	26.0	27.0					5																	68530841		2202	4299	6501	SO:0001819	synonymous_variant	1022				CCDS3999.1	5q12.1	2012-11-05	2007-11-21		ENSG00000134058	ENSG00000134058		"""Cyclin-dependent kinases"", ""General transcription factor IIH complex subunits"""	1778	protein-coding gene	gene with protein product		601955	"""cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase)"", ""cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)"""			8069918	Standard	NM_001799		Approved	CAK1, CDKN7, MO15, STK1, CAK	uc003jvs.4	P50613	OTTHUMG00000099358	ENST00000256443.3:c.39G>A	5.37:g.68530841G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BS60|Q9UE19	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E13	ENST00000256443.3	37	c.39	CCDS3999.1	5																																																																																			CDK7	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.622	CDK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK7	HGNC	protein_coding	OTTHUMT00000216802.3	G	NM_001799		68530841	+1	no_errors	ENST00000256443	ensembl	human	known	70_37	silent	SNP	1.000	A
CEP128	145508	genome.wustl.edu	37	14	80971268	80971268	+	Missense_Mutation	SNP	A	A	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:80971268A>C	ENST00000555265.1	-	24	3543	c.3168T>G	c.(3166-3168)ttT>ttG	p.F1056L	CEP128_ENST00000553717.1_5'UTR|CEP128_ENST00000281129.3_Missense_Mutation_p.F1056L			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	1056						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TCACGTATGAAAATCTTGGAC	0.398																																																	0													59.0	58.0	58.0					14																	80971268		2203	4300	6503	SO:0001583	missense	145508			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.3168T>G	14.37:g.80971268A>C	ENSP00000451162:p.Phe1056Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.F1056L	ENST00000555265.1	37	c.3168	CCDS32130.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.62|16.62	3.174793|3.174793	0.57692|0.57692	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265|ENST00000556061	T;T|.	0.22539|.	1.95;1.95|.	5.32|5.32	4.15|4.15	0.48705|0.48705	.|.	0.641169|0.641169	0.14346|0.14346	N|N	0.325421|0.325421	T|T	0.37517|0.37517	0.1006|0.1006	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	B|.	0.20052|.	0.041|.	B|.	0.20184|.	0.028|.	T|T	0.12016|0.12016	-1.0564|-1.0564	10|6	0.02654|.	T|.	1|.	.|.	7.9529|7.9529	0.30025|0.30025	0.9072:0.0:0.0928:0.0|0.9072:0.0:0.0928:0.0	.|.	1056|.	Q6ZU80|.	CE128_HUMAN|.	L|V	1056|122	ENSP00000281129:F1056L;ENSP00000451162:F1056L|.	ENSP00000281129:F1056L|.	F|F	-|-	3|1	2|0	CEP128|CEP128	80041021|80041021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.608000|0.608000	0.24223|0.24223	2.225000|2.225000	0.72522|0.72522	0.528000|0.528000	0.53228|0.53228	TTT|TTC	CEP128	-	NULL		0.398	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	A	NM_152446		80971268	-1	no_errors	ENST00000281129	ensembl	human	known	70_37	missense	SNP	1.000	C
CEP57	9702	genome.wustl.edu	37	11	95546186	95546186	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:95546186C>G	ENST00000325542.5	+	3	531	c.293C>G	c.(292-294)tCt>tGt	p.S98C	CEP57_ENST00000537677.1_Missense_Mutation_p.S71C|CEP57_ENST00000325486.5_Missense_Mutation_p.S98C|CEP57_ENST00000536587.1_3'UTR|CEP57_ENST00000541150.1_Missense_Mutation_p.S89C|CEP57_ENST00000538658.1_Missense_Mutation_p.S98C	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	98	centrosome localization domain (CLD). {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAAACCTTGTCTAGAGAAACA	0.363									Mosaic Variegated Aneuploidy Syndrome																																								0													71.0	72.0	72.0					11																	95546186		2201	4298	6499	SO:0001583	missense	9702	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.293C>G	11.37:g.95546186C>G	ENSP00000317902:p.Ser98Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.S98C	ENST00000325542.5	37	c.293	CCDS8304.1	11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955221	0.73902	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000544522;ENST00000541365;ENST00000538658;ENST00000541150	T;T;T;T;T;T;T	0.78246	0.59;0.59;0.59;-1.16;0.59;0.59;0.59	5.98	5.98	0.97165	.	0.152498	0.46442	D	0.000300	D	0.87505	0.6194	M	0.71036	2.16	0.42105	D	0.991357	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.964;0.983;0.989;0.98	D	0.88162	0.2858	10	0.87932	D	0	-0.339	16.8826	0.86067	0.0:0.8637:0.1362:0.0	.	89;98;98;98	F5H5F7;Q86XR8-2;Q86XR8;Q86XR8-3	.;.;CEP57_HUMAN;.	C	71;98;98;89;71;98;89	ENSP00000441392:S71C;ENSP00000317902:S98C;ENSP00000317487:S98C;ENSP00000438065:S89C;ENSP00000445821:S71C;ENSP00000445706:S98C;ENSP00000443436:S89C	ENSP00000317487:S98C	S	+	2	0	CEP57	95185834	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.088000	0.57678	2.838000	0.97847	0.591000	0.81541	TCT	CEP57	-	NULL		0.363	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP57	HGNC	protein_coding	OTTHUMT00000395983.1	C	NM_014679		95546186	+1	no_errors	ENST00000325542	ensembl	human	known	70_37	missense	SNP	1.000	G
CES3	23491	genome.wustl.edu	37	16	67006823	67006823	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:67006823C>G	ENST00000303334.4	+	13	1658	c.1587C>G	c.(1585-1587)atC>atG	p.I529M	CES3_ENST00000543856.1_Missense_Mutation_p.I168M|CES3_ENST00000394037.1_Missense_Mutation_p.I526M	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	529						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		ATCTGGAGATCAACCCAGTGC	0.572																																																	0													94.0	96.0	95.0					16																	67006823		2200	4300	6500	SO:0001583	missense	23491			AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1587C>G	16.37:g.67006823C>G	ENSP00000304782:p.Ile529Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.I529M	ENST00000303334.4	37	c.1587	CCDS10826.1	16	.	.	.	.	.	.	.	.	.	.	C	16.51	3.143992	0.57044	.	.	ENSG00000172828	ENST00000303334;ENST00000394037;ENST00000543856	T;T;T	0.11169	2.8;2.8;2.8	4.82	-2.41	0.06562	Carboxylesterase, type B (1);	0.486350	0.15330	N	0.268092	T	0.14830	0.0358	M	0.71296	2.17	0.09310	N	1	D;P	0.58268	0.982;0.607	P;P	0.51974	0.686;0.507	T	0.10567	-1.0624	10	0.87932	D	0	.	1.7429	0.02956	0.1357:0.2979:0.1334:0.4329	.	168;529	F5H242;Q6UWW8	.;EST3_HUMAN	M	529;526;168	ENSP00000304782:I529M;ENSP00000377602:I526M;ENSP00000445559:I168M	ENSP00000304782:I529M	I	+	3	3	CES3	65564324	0.003000	0.15002	0.081000	0.20488	0.237000	0.25408	-0.106000	0.10890	-0.119000	0.11830	0.579000	0.79373	ATC	CES3	-	pfam_CarbesteraseB		0.572	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CES3	HGNC	protein_coding	OTTHUMT00000268848.1	C	NM_024922		67006823	+1	no_errors	ENST00000303334	ensembl	human	known	70_37	missense	SNP	0.001	G
CMPK2	129607	genome.wustl.edu	37	2	6988805	6988805	+	3'UTR	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:6988805G>C	ENST00000256722.5	-	0	2525				CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000458098.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial						cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGAAATGGTAGATAGGATAAA	0.303																																																	0																																										SO:0001624	3_prime_UTR_variant	129607				CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.*1176C>G	2.37:g.6988805G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	RNA	SNP	-	NULL	ENST00000256722.5	37	NULL	CCDS42648.1	2																																																																																			CMPK2	-	-		0.303	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2	G	NM_207315		6988805	-1	no_errors	ENST00000478738	ensembl	human	known	70_37	rna	SNP	0.000	C
CLEC4F	165530	genome.wustl.edu	37	2	71046974	71046974	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:71046974G>A	ENST00000272367.2	-	2	187	c.111C>T	c.(109-111)ctC>ctT	p.L37L	CLEC4F_ENST00000426626.1_Silent_p.L37L	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	37					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TAGCCTGAACGAGCCTCGGTA	0.557																																					Colon(107;10 2157 6841 26035)												0													57.0	56.0	56.0					2																	71046974		2203	4300	6503	SO:0001819	synonymous_variant	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.111C>T	2.37:g.71046974G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPA5	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Prefoldin,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.L37	ENST00000272367.2	37	c.111	CCDS1910.1	2																																																																																			CLEC4F	-	NULL		0.557	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	HGNC	protein_coding	OTTHUMT00000251922.1	G	NM_173535		71046974	-1	no_errors	ENST00000272367	ensembl	human	known	70_37	silent	SNP	0.000	A
CLASP1	23332	genome.wustl.edu	37	2	122139867	122139867	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:122139867C>T	ENST00000263710.4	-	33	3797	c.3408G>A	c.(3406-3408)gcG>gcA	p.A1136A	CLASP1_ENST00000545861.1_Intron|CLASP1_ENST00000541859.1_Intron|CLASP1_ENST00000455322.2_Intron|CLASP1_ENST00000409078.3_Intron|CLASP1_ENST00000541377.1_Intron|CLASP1_ENST00000397587.3_Intron	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1136					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					GTGGGTGCTTCGCTAACCCGT	0.542																																																	0													68.0	78.0	75.0					2																	122139867		1985	4140	6125	SO:0001819	synonymous_variant	23332			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3408G>A	2.37:g.122139867C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Silent	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A1136	ENST00000263710.4	37	c.3408		2																																																																																			CLASP1	-	superfamily_ARM-type_fold		0.542	CLASP1-201	KNOWN	basic	protein_coding	CLASP1	HGNC	protein_coding		C	NM_015282		122139867	-1	no_errors	ENST00000263710	ensembl	human	known	70_37	silent	SNP	1.000	T
COL27A1	85301	genome.wustl.edu	37	9	116930429	116930429	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:116930429C>G	ENST00000356083.3	+	3	985	c.594C>G	c.(592-594)ctC>ctG	p.L198L		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	198	Laminin G-like.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GCTCCTTCCTCTTTGGGAAGA	0.607																																																	0													41.0	41.0	41.0					9																	116930429		2202	4300	6502	SO:0001819	synonymous_variant	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.594C>G	9.37:g.116930429C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q66K43|Q96JF7	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.L198	ENST00000356083.3	37	c.594	CCDS6802.1	9																																																																																			COL27A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.607	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	C	NM_032888		116930429	+1	no_errors	ENST00000356083	ensembl	human	known	70_37	silent	SNP	0.997	G
CPNE4	131034	genome.wustl.edu	37	3	131756537	131756537	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:131756537G>C	ENST00000512055.1	-	0	1113				CPNE4_ENST00000512332.1_De_novo_Start_OutOfFrame|CPNE4_ENST00000429747.1_5'Flank|CPNE4_ENST00000502818.1_De_novo_Start_OutOfFrame|CPNE4_ENST00000511604.1_De_novo_Start_InFrame			Q96A23	CPNE4_HUMAN	copine IV							extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						GCTCTGGGTAGATTCACTCGC	0.478																																																	0																																												131034			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.-1014C>G	3.37:g.131756537G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNC5|Q8TEX1	RNA	SNP	-	NULL	ENST00000512055.1	37	NULL	CCDS3072.1	3																																																																																			CPNE4	-	-		0.478	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	G	NM_130808		131756537	-1	no_errors	ENST00000506687	ensembl	human	known	70_37	rna	SNP	0.004	C
CRYZ	1429	genome.wustl.edu	37	1	75175917	75175917	+	Silent	SNP	T	T	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:75175917T>A	ENST00000340866.5	-	6	582	c.495A>T	c.(493-495)gcA>gcT	p.A165A	CRYZ_ENST00000370872.3_Silent_p.A28A|CRYZ_ENST00000370871.3_Silent_p.A165A|CRYZ_ENST00000492102.1_5'Flank|CRYZ_ENST00000417775.1_Silent_p.A165A	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	165					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	CAATTTGGCATGCTGCTAATC	0.363																																																	0													68.0	68.0	68.0					1																	75175917		2203	4300	6503	SO:0001819	synonymous_variant	1429				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.495A>T	1.37:g.75175917T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Silent	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.A165	ENST00000340866.5	37	c.495	CCDS665.1	1																																																																																			CRYZ	-	pfam_ADH_C,smart_PKS_ER		0.363	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZ	HGNC	protein_coding	OTTHUMT00000026514.1	T			75175917	-1	no_errors	ENST00000340866	ensembl	human	known	70_37	silent	SNP	0.942	A
CSGALNACT2	55454	genome.wustl.edu	37	10	43654206	43654206	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:43654206C>G	ENST00000374466.3	+	3	1040	c.705C>G	c.(703-705)ctC>ctG	p.L235L	CSGALNACT2_ENST00000374464.1_Silent_p.L235L	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	235					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AGTATGAACTCTTTTTTAAGA	0.398																																																	0													108.0	103.0	105.0					10																	43654206		2203	4300	6503	SO:0001819	synonymous_variant	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.705C>G	10.37:g.43654206C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Silent	SNP	pfam_Chond_GalNAc	p.L235	ENST00000374466.3	37	c.705	CCDS7201.1	10																																																																																			CSGALNACT2	-	pfam_Chond_GalNAc		0.398	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSGALNACT2	HGNC	protein_coding	OTTHUMT00000047693.1	C	NM_018590		43654206	+1	no_errors	ENST00000374466	ensembl	human	known	70_37	silent	SNP	0.824	G
CSPG4P5	114817	genome.wustl.edu	37	15	84959378	84959378	+	RNA	SNP	C	C	T	rs201410532	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:84959378C>T	ENST00000558801.1	-	0	5351									DNM1 pseudogene 51																		CCCTCACAGGCAGAGTCCAGG	0.622																																																	0																																												114817					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84959378C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	1.604	-0.525771	0.04141	.	.	ENSG00000235370	ENST00000456932	.	.	.	.	.	.	.	0.594802	0.16639	N	0.205730	T	0.28433	0.0703	.	.	.	.	.	.	.	.	.	.	.	.	T	0.25152	-1.0140	4	0.26408	T	0.33	.	3.6294	0.08126	2.0E-4:0.5041:0.4955:2.0E-4	.	.	.	.	T	94	.	ENSP00000389645:A94T	A	-	1	0	CSPG4P5	82750382	0.000000	0.05858	0.255000	0.24374	0.257000	0.26127	-1.293000	0.02770	0.107000	0.17824	0.109000	0.15622	GCC	CSPG4P5	-	-		0.622	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	C			84959378	-1	no_errors	ENST00000456932	ensembl	human	known	70_37	rna	SNP	0.650	T
HYPM	25763	genome.wustl.edu	37	X	37850284	37850284	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:37850284C>T	ENST00000341016.3	+	1	215	c.192C>T	c.(190-192)atC>atT	p.I64I	TM4SF2_ENST00000465127.1_Intron	NM_012274.1	NP_036406.1	O75409	HYPM_HUMAN		64										central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)	8						CTGACTACATCATGGAGCGGG	0.532																																																	0													98.0	97.0	97.0					X																	37850284		2103	4203	6306	SO:0001819	synonymous_variant	25763																														ENST00000341016.3:c.192C>T	X.37:g.37850284C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4D3	Silent	SNP	superfamily_Histone-fold	p.I64	ENST00000341016.3	37	c.192	CCDS43929.1	X																																																																																			CXorf27	-	superfamily_Histone-fold		0.532	CXorf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf27	HGNC	protein_coding	OTTHUMT00000080888.1	C			37850284	+1	no_errors	ENST00000341016	ensembl	human	known	70_37	silent	SNP	0.987	T
CYP2A7	1549	genome.wustl.edu	37	19	41381746	41381746	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:41381746C>T	ENST00000301146.4	-	9	1878	c.1337G>A	c.(1336-1338)aGa>aAa	p.R446K	CYP2A7_ENST00000291764.3_Missense_Mutation_p.R395K|CTC-490E21.12_ENST00000601627.1_Intron	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	446						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAGCTCCATTCTGGCCAGGCC	0.587																																																	0													17.0	22.0	20.0					19																	41381746		2180	4257	6437	SO:0001583	missense	1549			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.1337G>A	19.37:g.41381746C>T	ENSP00000301146:p.Arg446Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13121	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2B-like	p.R446K	ENST00000301146.4	37	c.1337	CCDS12569.1	19	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811920	0.50527	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.69040	-0.37;-0.37	2.18	1.01	0.19927	.	0.000000	0.85682	U	0.000000	T	0.57110	0.2031	N	0.21448	0.665	0.19945	N	0.999941	B;B;B	0.30511	0.139;0.282;0.013	P;B;B	0.45829	0.494;0.329;0.194	T	0.54111	-0.8342	10	0.62326	D	0.03	.	4.6532	0.12605	0.2105:0.6503:0.0:0.1393	.	446;395;446	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	K	446;395	ENSP00000301146:R446K;ENSP00000291764:R395K	ENSP00000291764:R395K	R	-	2	0	CYP2A7	46073586	0.003000	0.15002	0.022000	0.16811	0.423000	0.31445	1.921000	0.40035	0.212000	0.20703	0.184000	0.17185	AGA	CYP2A7	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV		0.587	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A7	HGNC	protein_coding	OTTHUMT00000463269.2	C	NM_030589		41381746	-1	no_errors	ENST00000301146	ensembl	human	known	70_37	missense	SNP	0.554	T
CYSLTR1	10800	genome.wustl.edu	37	X	77528275	77528275	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:77528275C>T	ENST00000373304.3	-	3	1261	c.969G>A	c.(967-969)aaG>aaA	p.K323K		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	323					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AAGAGGCCTTCTTTCTGGGTA	0.368																																																	0													60.0	58.0	58.0					X																	77528275		2200	4298	6498	SO:0001819	synonymous_variant	10800			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.969G>A	X.37:g.77528275C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R954|D3DTE4|Q5JS94|Q8IV19	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_GPCR_Rhodpsn,prints_P2_purnocptor	p.K323	ENST00000373304.3	37	c.969	CCDS14439.1	X																																																																																			CYSLTR1	-	prints_CLT1_recept		0.368	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	C			77528275	-1	no_errors	ENST00000373304	ensembl	human	known	70_37	silent	SNP	0.973	T
DCAF13	25879	genome.wustl.edu	37	8	104452417	104452417	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:104452417C>G	ENST00000297579.5	+	9	1737	c.1460C>G	c.(1459-1461)tCt>tGt	p.S487C	DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	335					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						AAATGGACTTCTGACAGCAAG	0.348																																																	0													170.0	173.0	172.0					8																	104452417		2203	4300	6503	SO:0001583	missense	25879			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1460C>G	8.37:g.104452417C>G	ENSP00000297579:p.Ser487Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S487C	ENST00000297579.5	37	c.1460	CCDS34934.1	8	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775317	0.70107	.	.	ENSG00000164934	ENST00000297579	T	0.60920	0.15	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.333784	0.30800	N	0.008844	T	0.62085	0.2399	L	0.38175	1.15	0.80722	D	1	B	0.30482	0.281	P	0.45660	0.489	T	0.60177	-0.7314	10	0.38643	T	0.18	-13.8009	18.5005	0.90879	0.0:1.0:0.0:0.0	.	335	Q9NV06	DCA13_HUMAN	C	487	ENSP00000297579:S487C	ENSP00000297579:S487C	S	+	2	0	DCAF13	104521593	0.988000	0.35896	0.998000	0.56505	0.984000	0.73092	4.477000	0.60223	2.587000	0.87381	0.655000	0.94253	TCT	DCAF13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.348	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380797.2	C	NM_015420		104452417	+1	no_errors	ENST00000297579	ensembl	human	known	70_37	missense	SNP	0.952	G
DENND4C	55667	genome.wustl.edu	37	9	19346894	19346894	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:19346894C>T	ENST00000380432.2	+	18	3305	c.3272C>T	c.(3271-3273)tCa>tTa	p.S1091L	DENND4C_ENST00000434457.2_Missense_Mutation_p.S1376L|DENND4C_ENST00000602925.1_Missense_Mutation_p.S1327L			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1091					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						ACTTCTTTGTCAGCACTGGTG	0.463																																																	0													61.0	61.0	61.0					9																	19346894		2203	4300	6503	SO:0001583	missense	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.3272C>T	9.37:g.19346894C>T	ENSP00000369797:p.Ser1091Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S1091L	ENST00000380432.2	37	c.3272		9	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115206	0.56505	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427;ENST00000361024	T;T	0.52295	0.67;0.67	5.46	5.46	0.80206	.	4.612340	0.00857	N	0.001886	T	0.47563	0.1452	N	0.22421	0.69	0.50467	D	0.999874	B;B;B;B	0.28055	0.045;0.161;0.199;0.124	B;B;B;B	0.30572	0.029;0.079;0.117;0.05	T	0.08911	-1.0699	10	0.37606	T	0.19	-10.9675	19.2992	0.94136	0.0:1.0:0.0:0.0	.	421;1091;273;1091	B7Z660;Q5VZ89-5;Q5VZ89-3;Q5VZ89	.;.;.;DEN4C_HUMAN	L	1091;564;273;421;564;273;88	ENSP00000305795:S564L;ENSP00000443804:S421L	ENSP00000305795:S564L	S	+	2	0	DENND4C	19336894	1.000000	0.71417	0.970000	0.41538	0.540000	0.34992	5.778000	0.68940	2.564000	0.86499	0.585000	0.79938	TCA	DENND4C	-	NULL		0.463	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		C	NM_017925		19346894	+1	no_errors	ENST00000380437	ensembl	human	known	70_37	missense	SNP	1.000	T
DGKA	1606	genome.wustl.edu	37	12	56333286	56333286	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:56333286C>G	ENST00000331886.5	+	9	1136	c.682C>G	c.(682-684)Ctt>Gtt	p.L228V	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.L228V|DGKA_ENST00000394147.1_Missense_Mutation_p.L228V	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	228					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	AAGCATTGGTCTTGGCAAACA	0.547																																																	0													154.0	138.0	144.0					12																	56333286		2203	4300	6503	SO:0001583	missense	1606			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.682C>G	12.37:g.56333286C>G	ENSP00000328405:p.Leu228Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L228V	ENST00000331886.5	37	c.682	CCDS8896.1	12	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.664863	0.00765	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.13	2.12	0.27331	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.073656	0.56097	D	0.000037	T	0.69441	0.3111	N	0.20845	0.615	0.38550	D	0.949426	B;B;B;B	0.33841	0.251;0.004;0.428;0.036	B;B;B;B	0.37387	0.083;0.009;0.248;0.1	T	0.62666	-0.6806	10	0.06625	T	0.88	.	6.5665	0.22515	0.1337:0.6597:0.1301:0.0765	.	228;147;228;228	Q3ZE25;G3V4E1;B4E0C6;P23743	.;.;.;DGKA_HUMAN	V	228;147;228;228	ENSP00000328405:L228V;ENSP00000451743:L147V;ENSP00000377703:L228V;ENSP00000450359:L228V	ENSP00000328405:L228V	L	+	1	0	DGKA	54619553	0.980000	0.34600	0.996000	0.52242	0.120000	0.20174	1.303000	0.33470	0.857000	0.35407	-0.274000	0.10170	CTT	DGKA	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd		0.547	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKA	HGNC	protein_coding	OTTHUMT00000407291.1	C			56333286	+1	no_errors	ENST00000331886	ensembl	human	known	70_37	missense	SNP	0.993	G
DLGAP2	9228	genome.wustl.edu	37	8	1617924	1617924	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:1617924G>C	ENST00000421627.2	+	7	2070	c.1936G>C	c.(1936-1938)Gag>Cag	p.E646Q		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	725					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		tgaattcccagagcatcagcc	0.537																																																	0													129.0	145.0	140.0					8																	1617924		2019	4175	6194	SO:0001583	missense	9228			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1936G>C	8.37:g.1617924G>C	ENSP00000400258:p.Glu646Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.E646Q	ENST00000421627.2	37	c.1936	CCDS47760.1	8	.	.	.	.	.	.	.	.	.	.	G	9.962	1.223033	0.22457	.	.	ENSG00000198010	ENST00000421627	T	0.11821	2.74	3.62	3.62	0.41486	.	1.359160	0.04423	N	0.367963	T	0.09069	0.0224	N	0.04959	-0.14	0.23227	N	0.998087	B	0.06786	0.001	B	0.06405	0.002	T	0.07888	-1.0749	10	0.37606	T	0.19	-8.9481	11.1468	0.48434	0.0:0.0:1.0:0.0	.	725	Q9P1A6	DLGP2_HUMAN	Q	646	ENSP00000400258:E646Q	ENSP00000400258:E646Q	E	+	1	0	DLGAP2	1605331	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.251000	0.51453	2.322000	0.78497	0.556000	0.70494	GAG	DLGAP2	-	pfam_GKAP		0.537	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	G	NM_004745		1617924	+1	no_errors	ENST00000421627	ensembl	human	known	70_37	missense	SNP	1.000	C
DNAH1	25981	genome.wustl.edu	37	3	52404646	52404646	+	Missense_Mutation	SNP	G	G	A	rs375829118	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:52404646G>A	ENST00000420323.2	+	40	6673	c.6412G>A	c.(6412-6414)Gaa>Aaa	p.E2138K		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2138					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GATGGAGAACGAACAGGTGAG	0.627													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17983	0.0		0.0	False		,,,				2504	0.0																0								G	LYS/GLU	4,3952		0,4,1974	29.0	31.0	31.0		6412	2.6	0.0	3		31	0,8296		0,0,4148	no	missense	DNAH1	NM_015512.4	56	0,4,6122	AA,AG,GG		0.0,0.1011,0.0326	benign	2138/4266	52404646	4,12248	1978	4148	6126	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6412G>A	3.37:g.52404646G>A	ENSP00000401514:p.Glu2138Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.E2138K	ENST00000420323.2	37	c.6412	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255431	0.22965	0.001011	0.0	ENSG00000114841	ENST00000420323	T	0.23754	1.89	4.47	2.63	0.31362	.	0.348517	0.24160	N	0.040997	T	0.14743	0.0356	L	0.33624	1.015	0.28887	N	0.8941	B	0.27316	0.175	B	0.15052	0.012	T	0.27640	-1.0068	10	0.09338	T	0.73	.	9.4935	0.38974	0.0:0.1542:0.6856:0.1601	.	2138	C9JXH6	.	K	2138	ENSP00000401514:E2138K	ENSP00000401514:E2138K	E	+	1	0	DNAH1	52379686	1.000000	0.71417	0.003000	0.11579	0.087000	0.18053	3.747000	0.55134	0.292000	0.22492	0.491000	0.48974	GAA	DNAH1	-	NULL		0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	G	NM_015512		52404646	+1	no_errors	ENST00000420323	ensembl	human	known	70_37	missense	SNP	0.241	A
DNAH10	196385	genome.wustl.edu	37	12	124265759	124265759	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:124265759C>G	ENST00000409039.3	+	6	596	c.571C>G	c.(571-573)Cac>Gac	p.H191D		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	191	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGTAGAATATCACAGTATTCA	0.428																																																	0													165.0	178.0	174.0					12																	124265759		2203	4300	6503	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.571C>G	12.37:g.124265759C>G	ENSP00000386770:p.His191Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.H191D	ENST00000409039.3	37	c.571	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	c	0.313	-0.966390	0.02232	.	.	ENSG00000197653	ENST00000409039	T	0.20738	2.05	5.3	4.39	0.52855	.	0.350085	0.24018	N	0.042319	T	0.10809	0.0264	N	0.14661	0.345	0.25806	N	0.984459	B	0.02656	0.0	B	0.01281	0.0	T	0.30937	-0.9961	10	0.11794	T	0.64	.	9.3135	0.37919	0.2898:0.5697:0.1405:0.0	.	191	Q8IVF4	DYH10_HUMAN	D	191	ENSP00000386770:H191D	ENSP00000386770:H191D	H	+	1	0	DNAH10	122831712	0.959000	0.32827	0.998000	0.56505	0.117000	0.20001	1.326000	0.33735	1.199000	0.43173	0.436000	0.28706	CAC	DNAH10	-	NULL		0.428	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	C			124265759	+1	no_errors	ENST00000409039	ensembl	human	known	70_37	missense	SNP	0.996	G
DNAH14	127602	genome.wustl.edu	37	1	225268222	225268222	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:225268222C>T	ENST00000445597.2	+	15	2710	c.2710C>T	c.(2710-2712)Caa>Taa	p.Q904*	DNAH14_ENST00000439375.2_Nonsense_Mutation_p.Q970*|DNAH14_ENST00000430092.1_Nonsense_Mutation_p.Q970*			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	904					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CAGTGATTCTCAATCTCATAT	0.368																																																	0													204.0	177.0	185.0					1																	225268222		692	1591	2283	SO:0001587	stop_gained	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2710C>T	1.37:g.225268222C>T	ENSP00000409472:p.Gln904*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.Q970*	ENST00000445597.2	37	c.2908		1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550793	0.86127	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	.	.	.	5.34	2.16	0.27623	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	4.2971	0.10906	0.1465:0.4855:0.2852:0.0828	.	.	.	.	X	904;970;970;48	.	ENSP00000332424:Q48X	Q	+	1	0	DNAH14	223334845	0.000000	0.05858	0.004000	0.12327	0.338000	0.28826	0.150000	0.16263	0.700000	0.31782	0.508000	0.49915	CAA	DNAH14	-	NULL		0.368	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	C	XM_059166		225268222	+1	no_errors	ENST00000430092	ensembl	human	known	70_37	nonsense	SNP	0.001	T
DNAH17	8632	genome.wustl.edu	37	17	76490199	76490199	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:76490199C>G	ENST00000585328.1	-	41	6436	c.6312G>C	c.(6310-6312)ctG>ctC	p.L2104L	DNAH17_ENST00000586052.1_5'Flank|RP11-559N14.5_ENST00000591373.1_RNA|DNAH17_ENST00000389840.5_Silent_p.L2095L|RP11-559N14.5_ENST00000585969.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2095	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCACCACCTTCAGCACGAAGC	0.607																																																	0													39.0	44.0	42.0					17																	76490199		2183	4282	6465	SO:0001819	synonymous_variant	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.6312G>C	17.37:g.76490199C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.L2095	ENST00000585328.1	37	c.6285		17																																																																																			DNAH17	-	NULL		0.607	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	C	NM_173628		76490199	-1	no_errors	ENST00000389840	ensembl	human	known	70_37	silent	SNP	1.000	G
DNHD1	144132	genome.wustl.edu	37	11	6530458	6530458	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:6530458C>T	ENST00000527990.2	+	4	1191	c.1191C>T	c.(1189-1191)ctC>ctT	p.L397L	DNHD1_ENST00000354685.3_Silent_p.L397L|DNHD1_ENST00000254579.6_Silent_p.L397L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	397					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ATCATCTGCTCTTGGCTGTGC	0.393																																																	0													105.0	110.0	108.0					11																	6530458		2201	4296	6497	SO:0001819	synonymous_variant	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.1191C>T	11.37:g.6530458C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_t-SNARE	p.L397	ENST00000527990.2	37	c.1191	CCDS44532.1	11																																																																																			DNHD1	-	NULL		0.393	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	C	NM_144666		6530458	+1	no_errors	ENST00000254579	ensembl	human	known	70_37	silent	SNP	0.395	T
DNM2	1785	genome.wustl.edu	37	19	10886383	10886383	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:10886383G>A	ENST00000355667.6	+	4	470	c.390G>A	c.(388-390)ttG>ttA	p.L130L	DNM2_ENST00000359692.6_Silent_p.L130L|DNM2_ENST00000591819.1_3'UTR|DNM2_ENST00000389253.4_Silent_p.L130L|DNM2_ENST00000408974.4_Silent_p.L130L|DNM2_ENST00000585892.1_Silent_p.L130L|DNM2_ENST00000314646.5_Silent_p.L130L	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	130	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TCCCAGTGTTGAACTTGACCC	0.577			"""F, N, Splice, Mis, O"""		ETP ALL																																			Rec	yes		19	19p13.2	1785	dynamin 2		L	0													204.0	209.0	207.0					19																	10886383		2203	4300	6503	SO:0001819	synonymous_variant	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.390G>A	19.37:g.10886383G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.L130	ENST00000355667.6	37	c.390	CCDS45968.1	19																																																																																			DNM2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin		0.577	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	HGNC	protein_coding	OTTHUMT00000452592.1	G	NM_004945		10886383	+1	no_errors	ENST00000314646	ensembl	human	known	70_37	silent	SNP	1.000	A
DSG4	147409	genome.wustl.edu	37	18	28956917	28956917	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr18:28956917C>G	ENST00000308128.4	+	1	178	c.43C>G	c.(43-45)Cta>Gta	p.L15V	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.L15V|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	15					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTGATCATTCTAATGGTAAG	0.413																																																	0													102.0	89.0	94.0					18																	28956917		2203	4300	6503	SO:0001583	missense	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.43C>G	18.37:g.28956917C>G	ENSP00000311859:p.Leu15Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.L15V	ENST00000308128.4	37	c.43	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	C	3.878	-0.026627	0.07589	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.60424	0.27;0.19	5.99	1.37	0.22104	.	0.870070	0.09131	N	0.844367	T	0.49423	0.1556	L	0.59436	1.845	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.13407	0.004;0.009	T	0.42361	-0.9456	10	0.42905	T	0.14	.	4.0294	0.09701	0.0:0.2609:0.1858:0.5533	.	15;15	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	V	15	ENSP00000311859:L15V;ENSP00000352785:L15V	ENSP00000311859:L15V	L	+	1	2	DSG4	27210915	1.000000	0.71417	0.005000	0.12908	0.035000	0.12851	0.627000	0.24506	0.012000	0.14892	-0.176000	0.13171	CTA	DSG4	-	NULL		0.413	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	C	NM_177986		28956917	+1	no_errors	ENST00000359747	ensembl	human	known	70_37	missense	SNP	0.108	G
ECHDC2	55268	genome.wustl.edu	37	1	53387259	53387259	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:53387259C>T	ENST00000371522.4	-	1	180	c.87G>A	c.(85-87)gaG>gaA	p.E29E	ECHDC2_ENST00000480312.2_5'Flank|ECHDC2_ENST00000358358.5_Silent_p.E29E|ECHDC2_ENST00000536120.1_5'UTR|ECHDC2_ENST00000541281.1_5'UTR	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	29					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						GCACTTGGATCTCTGAGCCCC	0.741																																																	0													8.0	10.0	10.0					1																	53387259		2177	4274	6451	SO:0001819	synonymous_variant	55268			AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.87G>A	1.37:g.53387259C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ36|Q9NV38	Silent	SNP	pfam_Crotonase_core	p.E29	ENST00000371522.4	37	c.87	CCDS55600.1	1																																																																																			ECHDC2	-	NULL		0.741	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC2	HGNC	protein_coding	OTTHUMT00000024712.3	C	NM_018281		53387259	-1	no_errors	ENST00000371522	ensembl	human	known	70_37	silent	SNP	0.997	T
EFEMP2	30008	genome.wustl.edu	37	11	65634130	65634130	+	3'UTR	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:65634130G>A	ENST00000307998.6	-	0	1821				MUS81_ENST00000525006.1_Intron|EFEMP2_ENST00000528176.1_Silent_p.V408V|EFEMP2_ENST00000532648.1_5'UTR	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2						blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		CTCTCGGGGTGACTGAAGCTC	0.617																																																	0																																										SO:0001624	3_prime_UTR_variant	30008			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.*259C>T	11.37:g.65634130G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	pfam_EGF-like_Ca-bd,superfamily_TIL_dom,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.V408	ENST00000307998.6	37	c.1224	CCDS8116.1	11																																																																																			EFEMP2	-	NULL		0.617	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP2	HGNC	protein_coding	OTTHUMT00000391047.4	G	NM_016938		65634130	-1	no_errors	ENST00000528176	ensembl	human	putative	70_37	silent	SNP	0.000	A
EIF2B3	8891	genome.wustl.edu	37	1	45347294	45347294	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:45347294C>T	ENST00000360403.2	-	7	900	c.774G>A	c.(772-774)ctG>ctA	p.L258L	EIF2B3_ENST00000372183.3_Silent_p.L258L	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	258					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					CTAAGGACTTCAGCTCCTTTT	0.473																																					Colon(26;357 658 2581 11857 12657)												0													253.0	236.0	242.0					1																	45347294		2203	4300	6503	SO:0001819	synonymous_variant	8891			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.774G>A	1.37:g.45347294C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	pfam_NTP_transferase	p.L258	ENST00000360403.2	37	c.774	CCDS517.1	1																																																																																			EIF2B3	-	NULL		0.473	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B3	HGNC	protein_coding	OTTHUMT00000023724.1	C	NM_020365		45347294	-1	no_errors	ENST00000360403	ensembl	human	known	70_37	silent	SNP	0.180	T
EIF5AL1	143244	genome.wustl.edu	37	10	81272687	81272687	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:81272687C>G	ENST00000520547.2	+	1	331	c.282C>G	c.(280-282)atC>atG	p.I94M	AL133481.1_ENST00000538322.1_5'Flank	NM_001099692.1	NP_001093162.1	Q6IS14	IF5AL_HUMAN	eukaryotic translation initiation factor 5A-like 1	94					mRNA transport (GO:0051028)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|protein transport (GO:0015031)|translational frameshifting (GO:0006452)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)	ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			endometrium(1)	1	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			TGATTGGCATCCAGGATGGGT	0.493																																																	0													63.0	63.0	63.0					10																	81272687		2202	4296	6498	SO:0001583	missense	143244				CCDS53546.1	10q22.3	2012-04-19			ENSG00000253626	ENSG00000253626			17419	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 5A pseudogene 1"""	EIF5AP1			Standard	NM_001099692		Approved	bA342M3.3	uc009xrx.3	Q6IS14	OTTHUMG00000018563	ENST00000520547.2:c.282C>G	10.37:g.81272687C>G	ENSP00000430706:p.Ile94Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Transl_elong_IF5A_C,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like,pirsf_Transl_elong_IF5A,tigrfam_Transl_elong_IF5A	p.I94M	ENST00000520547.2	37	c.282	CCDS53546.1	10	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349255	0.24426	.	.	ENSG00000253626	ENST00000520547	T	0.56275	0.47	1.02	-0.0575	0.13801	Nucleic acid-binding, OB-fold-like (1);Translation elongation factor, IF5A C-terminal (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.65554	0.2702	M	0.85462	2.755	0.30478	N	0.772667	P	0.52170	0.951	P	0.60789	0.879	T	0.62353	-0.6872	9	0.72032	D	0.01	.	3.3295	0.07079	0.0:0.4497:0.0:0.5503	.	94	Q6IS14	IF5AL_HUMAN	M	94	ENSP00000430706:I94M	ENSP00000430706:I94M	I	+	3	3	EIF5AL1	80942693	0.969000	0.33509	0.726000	0.30738	0.702000	0.40608	-0.271000	0.08572	0.542000	0.28846	0.372000	0.22366	ATC	EIF5AL1	-	pfam_Transl_elong_IF5A_C,superfamily_NA-bd_OB-fold-like,pirsf_Transl_elong_IF5A,tigrfam_Transl_elong_IF5A		0.493	EIF5AL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5AL1	HGNC	protein_coding	OTTHUMT00000048954.4	C	NM_001099692		81272687	+1	no_errors	ENST00000520547	ensembl	human	known	70_37	missense	SNP	0.996	G
ELMO1	9844	genome.wustl.edu	37	7	36917698	36917698	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:36917698G>A	ENST00000310758.4	-	19	2386	c.1739C>T	c.(1738-1740)tCg>tTg	p.S580L	ELMO1_ENST00000442504.1_Missense_Mutation_p.S580L|ELMO1_ENST00000448602.1_Missense_Mutation_p.S580L|ELMO1_ENST00000341056.3_Missense_Mutation_p.S282L|ELMO1_ENST00000396040.2_Missense_Mutation_p.S100L|ELMO1_ENST00000396045.3_Missense_Mutation_p.S100L	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	580	PH.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GTGATTTGGCGAAAGCCGACA	0.418																																																	0													71.0	66.0	68.0					7																	36917698		2203	4300	6503	SO:0001583	missense	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1739C>T	7.37:g.36917698G>A	ENSP00000312185:p.Ser580Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.S580L	ENST00000310758.4	37	c.1739	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.261631	0.95368	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56	5.81	5.81	0.92471	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.77143	0.4087	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.63033	0.91	T	0.80854	-0.1196	10	0.87932	D	0	.	20.0833	0.97789	0.0:0.0:1.0:0.0	.	580	Q92556	ELMO1_HUMAN	L	282;100;580;484;100;580;580	ENSP00000342142:S282L;ENSP00000379360:S100L;ENSP00000312185:S580L;ENSP00000379355:S100L;ENSP00000406952:S580L;ENSP00000394458:S580L	ENSP00000312185:S580L	S	-	2	0	ELMO1	36884223	1.000000	0.71417	0.990000	0.47175	0.860000	0.49131	9.359000	0.97115	2.756000	0.94617	0.655000	0.94253	TCG	ELMO1	-	NULL		0.418	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	G	NM_130442		36917698	-1	no_errors	ENST00000310758	ensembl	human	known	70_37	missense	SNP	1.000	A
ENAH	55740	genome.wustl.edu	37	1	225699552	225699552	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:225699552C>T	ENST00000366844.3	-	10	1883	c.1432G>A	c.(1432-1434)Gag>Aag	p.E478K	ENAH_ENST00000366843.2_Missense_Mutation_p.E478K|ENAH_ENST00000284563.6_Missense_Mutation_p.E725K	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	478	EVH2.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.E478*(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		GTTACAGGCTCTGAATCTTCC	0.313																																																	2	Substitution - Nonsense(2)	lung(2)											36.0	38.0	37.0					1																	225699552		2202	4297	6499	SO:0001583	missense	55740			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.1432G>A	1.37:g.225699552C>T	ENSP00000355809:p.Glu478Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	pfam_EVH1,pfam_VASP_tetra,smart_EVH1,pfscan_EVH1	p.E478K	ENST00000366844.3	37	c.1432	CCDS31041.1	1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987568	0.93106	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	T;T;T	0.47869	0.96;1.66;0.83	5.98	5.98	0.97165	.	0.361134	0.29293	N	0.012577	T	0.69975	0.3171	M	0.75447	2.3	0.50313	D	0.999861	D;D	0.76494	0.999;0.992	D;D	0.79784	0.993;0.941	T	0.68055	-0.5510	10	0.46703	T	0.11	-16.7021	18.6239	0.91331	0.0:1.0:0.0:0.0	.	478;478	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	K	478;478;725;440	ENSP00000355809:E478K;ENSP00000355808:E478K;ENSP00000284563:E725K	ENSP00000284563:E725K	E	-	1	0	ENAH	223766175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.038000	0.64177	2.838000	0.97847	0.655000	0.94253	GAG	ENAH	-	NULL		0.313	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	HGNC	protein_coding	OTTHUMT00000357426.2	C	NM_018212		225699552	-1	no_errors	ENST00000366844	ensembl	human	known	70_37	missense	SNP	1.000	T
ENO4	387712	genome.wustl.edu	37	10	118630744	118630744	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:118630744G>C	ENST00000409522.1	+	3	386	c.331G>C	c.(331-333)Gaa>Caa	p.E111Q	ENO4_ENST00000369207.2_Missense_Mutation_p.E151Q|ENO4_ENST00000341276.5_Missense_Mutation_p.E389Q			A6NNW6	ENO4_HUMAN	enolase family member 4	389					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						CCTGGGGCTAGAACTGGGAAC	0.448																																																	0																																										SO:0001583	missense	387712				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000409522.1:c.331G>C	10.37:g.118630744G>C	ENSP00000387194:p.Glu111Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.E389Q	ENST00000409522.1	37	c.1165		10	.	.	.	.	.	.	.	.	.	.	G	13.28	2.191462	0.38707	.	.	ENSG00000188316	ENST00000409522;ENST00000341276;ENST00000369207	T;T;T	0.66460	-0.21;0.65;0.65	5.98	5.98	0.97165	.	0.170346	0.49916	D	0.000130	T	0.74733	0.3755	L	0.54323	1.7	0.35005	D	0.756315	D	0.57257	0.979	P	0.52957	0.714	T	0.80072	-0.1535	10	0.62326	D	0.03	-14.5701	20.4581	0.99154	0.0:0.0:1.0:0.0	.	111	A6NNW6-2	.	Q	111;389;151	ENSP00000387194:E111Q;ENSP00000345555:E389Q;ENSP00000358208:E151Q	ENSP00000345555:E389Q	E	+	1	0	ENO4	118620734	1.000000	0.71417	0.735000	0.30896	0.923000	0.55619	3.512000	0.53407	2.835000	0.97688	0.650000	0.86243	GAA	ENO4	-	pfam_Enolase_C		0.448	ENO4-002	PUTATIVE	basic|exp_conf	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000331643.1	G	NM_001242699		118630744	+1	no_errors	ENST00000341276	ensembl	human	known	70_37	missense	SNP	0.964	C
ENO4	387712	genome.wustl.edu	37	10	118633637	118633637	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:118633637G>A	ENST00000369207.2	+	7	737	c.561G>A	c.(559-561)gaG>gaA	p.E187E	ENO4_ENST00000409522.1_Intron|ENO4_ENST00000341276.5_Silent_p.E425E			A6NNW6	ENO4_HUMAN	enolase family member 4	425					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						ATGCAGCGGAGATGGTTGACC	0.363																																																	0																																										SO:0001819	synonymous_variant	387712				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000369207.2:c.561G>A	10.37:g.118633637G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZN9	Silent	SNP	pfam_Enolase_C,pfam_Enolase_N	p.E425	ENST00000369207.2	37	c.1275		10																																																																																			ENO4	-	pfam_Enolase_C		0.363	ENO4-001	PUTATIVE	basic	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000050552.2	G	NM_001242699		118633637	+1	no_errors	ENST00000341276	ensembl	human	known	70_37	silent	SNP	1.000	A
ENO4	387712	genome.wustl.edu	37	10	118633639	118633639	+	Missense_Mutation	SNP	T	T	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:118633639T>A	ENST00000369207.2	+	7	739	c.563T>A	c.(562-564)aTg>aAg	p.M188K	ENO4_ENST00000409522.1_Intron|ENO4_ENST00000341276.5_Missense_Mutation_p.M426K			A6NNW6	ENO4_HUMAN	enolase family member 4	426					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						GCAGCGGAGATGGTTGACCTG	0.363																																																	0																																										SO:0001583	missense	387712				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000369207.2:c.563T>A	10.37:g.118633639T>A	ENSP00000358208:p.Met188Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.M426K	ENST00000369207.2	37	c.1277		10	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429409	0.83776	.	.	ENSG00000188316	ENST00000341276;ENST00000369207	T;T	0.53423	0.62;0.62	5.95	5.95	0.96441	.	0.045600	0.85682	D	0.000000	T	0.65165	0.2665	M	0.72894	2.215	0.43734	D	0.996224	.	.	.	.	.	.	T	0.68368	-0.5427	8	0.87932	D	0	-35.0488	16.4237	0.83790	0.0:0.0:0.0:1.0	.	.	.	.	K	426;188	ENSP00000345555:M426K;ENSP00000358208:M188K	ENSP00000345555:M426K	M	+	2	0	ENO4	118623629	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.022000	0.76431	2.279000	0.76181	0.533000	0.62120	ATG	ENO4	-	pfam_Enolase_C		0.363	ENO4-001	PUTATIVE	basic	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000050552.2	T	NM_001242699		118633639	+1	no_errors	ENST00000341276	ensembl	human	known	70_37	missense	SNP	1.000	A
PP13004	402481	genome.wustl.edu	37	7	36124283	36124284	+	Missense_Mutation	DNP	GG	GG	AC	rs374132559	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:36124283_36124284GG>AC	ENST00000381493.2	+	2	434_435	c.285_286GG>AC	c.(283-288)tcGGag>tcACag	p.E96Q																								AAGCAAGATCGGAGTTCACGTG	0.569																																																	0																																										SO:0001583	missense	0																														Exception_encountered	7.37:g.36124283_36124284delinsAC	ENSP00000370904:p.Glu96Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Silent|Missense_Mutation	SNP	NULL	p.S95|p.E96Q	ENST00000381493.2	37	c.285|c.286		7																																																																																			PP13004	-	NULL		0.569	PP13004-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	ENSG00000205745	Uniprot_genename	protein_coding	OTTHUMT00000338269.2	G			36124283|36124284	+1	no_errors	ENST00000381493	ensembl	human	novel	70_37	silent|missense	SNP	0.000|0.001	A|C
CTB-180A7.8	0	genome.wustl.edu	37	19	6400122	6400122	+	lincRNA	SNP	A	A	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:6400122A>G	ENST00000398173.3	+	0	207																											TTCCCAGGGCATCATCCCAGA	0.587																																																	0																																												0																															19.37:g.6400122A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000398173.3	37	NULL		19																																																																																			CTB-180A7.8	-	-		0.587	CTB-180A7.8-201	KNOWN	basic	lincRNA	ENSG00000214347	Clone_based_vega_gene	lincRNA		A			6400122	+1	no_errors	ENST00000398173	ensembl	human	known	70_37	rna	SNP	0.000	G
AC007952.5	0	genome.wustl.edu	37	17	18996549	18996549	+	Silent	SNP	G	G	A	rs78735049		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:18996549G>A	ENST00000428928.1	+	1	263	c.45G>A	c.(43-45)ttG>ttA	p.L15L	AC007952.5_ENST00000399093.1_5'UTR|AC007952.5_ENST00000443876.1_Silent_p.L15L|AC007952.5_ENST00000399091.1_5'UTR|RP11-160E2.19_ENST00000583141.1_lincRNA																							agacctgcttgttcatggctg	0.577																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000428928.1:c.45G>A	17.37:g.18996549G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.L15	ENST00000428928.1	37	c.45		17																																																																																			AC007952.5	-	NULL		0.577	AC007952.5-202	KNOWN	basic|appris_candidate_longest	protein_coding	ENSG00000228157	Clone_based_vega_gene	protein_coding		G			18996549	+1	no_errors	ENST00000428928	ensembl	human	known	70_37	silent	SNP	0.000	A
LOC101929268	101929268	genome.wustl.edu	37	8	49503099	49503099	+	lincRNA	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:49503099G>A	ENST00000430626.1	+	0	139				RP11-770E5.1_ENST00000522575.1_RNA																							AGCATTCAAGGAGCCAAGGAA	0.517																																																	0													128.0	116.0	120.0					8																	49503099		692	1591	2283			0																															8.37:g.49503099G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000430626.1	37	NULL		8																																																																																			AC026904.1	-	-		0.517	AC026904.1-001	KNOWN	basic	lincRNA	ENSG00000233858	Clone_based_vega_gene	lincRNA	OTTHUMT00000280498.1	G			49503099	+1	no_errors	ENST00000430626	ensembl	human	known	70_37	rna	SNP	0.000	A
KCNIP1	30820	genome.wustl.edu	37	5	170108309	170108309	+	Intron	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:170108309G>C	ENST00000411494.1	+	2	61				KCNIP1_ENST00000328939.4_Intron|CTC-265N9.1_ENST00000523591.1_RNA|KCNIP1_ENST00000434108.1_Intron|KCNIP1_ENST00000520740.1_Intron|KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000390656.4_Intron			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1						detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGCCGGGCTGAAACAGCGTG	0.582																																																	0																																										SO:0001627	intron_variant	0			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.62-31549G>C	5.37:g.170108309G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	RNA	SNP	-	NULL	ENST00000411494.1	37	NULL	CCDS34286.1	5																																																																																			CTC-265N9.1	-	-		0.582	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	ENSG00000253591	Clone_based_vega_gene	protein_coding	OTTHUMT00000371760.1	G			170108309	-1	no_errors	ENST00000523591	ensembl	human	known	70_37	rna	SNP	0.000	C
ATP5L	10632	genome.wustl.edu	37	11	118272366	118272366	+	5'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:118272366C>T	ENST00000300688.3	+	0	498				ATP5L_ENST00000529770.1_3'UTR|RP11-770J1.5_ENST00000534438.1_Missense_Mutation_p.R6K|ATP5L_ENST00000524422.1_5'UTR|RP11-770J1.5_ENST00000531742.1_5'Flank	NM_006476.4	NP_006467.4	O75964	ATP5L_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G						ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)		GCGACGGACTCTCCATTCCAG	0.657																																																	0													42.0	38.0	40.0					11																	118272366		2200	4296	6496	SO:0001623	5_prime_UTR_variant	0			AF092124	CCDS8397.1	11q23.3	2012-10-12	2010-06-11		ENSG00000167283	ENSG00000167283		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	14247	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G"""			11230166, 11042152	Standard	NR_033759		Approved	ATP5JG	uc001psx.3	O75964		ENST00000300688.3:c.-15C>T	11.37:g.118272366C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0K3|Q96BV6|Q9UBZ7	Missense_Mutation	SNP	NULL	p.R6K	ENST00000300688.3	37	c.17	CCDS8397.1	11	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054813	0.36277	.	.	ENSG00000254873	ENST00000534438	.	.	.	6.17	-12.3	0.00002	.	.	.	.	.	T	0.32376	0.0827	.	.	.	0.20307	N	0.999918	.	.	.	.	.	.	T	0.53954	-0.8365	5	0.87932	D	0	.	7.5298	0.27677	0.1483:0.4519:0.3008:0.099	.	.	.	.	K	6	.	ENSP00000433775:R6K	R	-	2	0	RP11-770J1.5	117777576	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.135000	0.03225	-2.972000	0.00286	-0.238000	0.12139	AGA	RP11-770J1.5	-	NULL		0.657	ATP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254873	Clone_based_vega_gene	protein_coding	OTTHUMT00000389220.1	C	NM_006476		118272366	-1	no_errors	ENST00000534438	ensembl	human	putative	70_37	missense	SNP	0.000	T
AP1G2	8906	genome.wustl.edu	37	14	24036583	24036583	+	5'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:24036583C>T	ENST00000308724.5	-	0	696				AP1G2_ENST00000397120.3_Intron|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_Intron	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CCTGGGCTTTCGGCCCAGGCC	0.587											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001623	5_prime_UTR_variant	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.-60G>A	14.37:g.24036583C>T		Somatic	768	WXS	Illumina HiSeq	Phase_IV	D3DS51|O75504	RNA	SNP	-	NULL	ENST00000308724.5	37	NULL	CCDS9602.1	14																																																																																			RP11-66N24.3	-	-		0.587	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258727	Clone_based_vega_gene	protein_coding	OTTHUMT00000071812.4	C	NM_003917		24036583	+1	no_errors	ENST00000555968	ensembl	human	known	70_37	rna	SNP	0.012	T
BEGAIN	57596	genome.wustl.edu	37	14	101006724	101006724	+	Intron	SNP	A	A	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:101006724A>T	ENST00000355173.2	-	6	507				BEGAIN_ENST00000443071.2_Intron|CTD-2062F14.3_ENST00000553301.1_lincRNA|BEGAIN_ENST00000556751.1_Intron	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated							cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GCTCAGGCTCAGCTGGCATCT	0.682																																					NSCLC(159;1889 2010 9965 27479 40101)												0																																										SO:0001627	intron_variant	0			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.435+108T>A	14.37:g.101006724A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NPU3|Q9P282	RNA	SNP	-	NULL	ENST00000355173.2	37	NULL	CCDS9962.1	14																																																																																			CTD-2062F14.3	-	-		0.682	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000259031	Clone_based_vega_gene	protein_coding	OTTHUMT00000414329.1	A	NM_020836		101006724	+1	no_errors	ENST00000553301	ensembl	human	known	70_37	rna	SNP	0.087	T
EPM2AIP1	9852	genome.wustl.edu	37	3	37034248	37034248	+	Silent	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:37034248G>T	ENST00000322716.5	-	1	547	c.321C>A	c.(319-321)ctC>ctA	p.L107L	MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000455445.2_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	107					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						TCAAGGCCAAGAGGCGGCAGA	0.647																																																	0													82.0	88.0	86.0					3																	37034248		1948	4157	6105	SO:0001819	synonymous_variant	9852			AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.321C>A	3.37:g.37034248G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O94866|Q9H3L3	Silent	SNP	NULL	p.L107	ENST00000322716.5	37	c.321	CCDS46790.1	3																																																																																			EPM2AIP1	-	NULL		0.647	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2AIP1	HGNC	protein_coding	OTTHUMT00000470593.1	G	NM_014805		37034248	-1	no_errors	ENST00000322716	ensembl	human	known	70_37	silent	SNP	0.389	T
EPHA3	2042	genome.wustl.edu	37	3	89391038	89391038	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:89391038G>A	ENST00000336596.2	+	5	1329	c.1104G>A	c.(1102-1104)tgG>tgA	p.W368*	EPHA3_ENST00000494014.1_Nonsense_Mutation_p.W368*|EPHA3_ENST00000452448.2_Nonsense_Mutation_p.W368*	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	368	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AATGTGGGTGGAATATAAAAC	0.493										TSP Lung(6;0.00050)																																							0													115.0	109.0	111.0					3																	89391038		2203	4300	6503	SO:0001587	stop_gained	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1104G>A	3.37:g.89391038G>A	ENSP00000337451:p.Trp368*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H2V3|Q9H2V4	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.W368*	ENST00000336596.2	37	c.1104	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.136771	0.94517	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	.	.	.	5.87	4.99	0.66335	.	0.220039	0.47455	D	0.000230	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3205	0.11015	0.21:0.1995:0.5905:0.0	.	.	.	.	X	368	.	.	W	+	3	0	EPHA3	89473728	0.991000	0.36638	1.000000	0.80357	0.989000	0.77384	1.111000	0.31159	2.941000	0.99782	0.655000	0.94253	TGG	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.493	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	G	NM_005233		89391038	+1	no_errors	ENST00000336596	ensembl	human	known	70_37	nonsense	SNP	0.978	A
ERBB2IP	55914	genome.wustl.edu	37	5	65338985	65338985	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:65338985G>C	ENST00000284037.5	+	16	1776	c.1387G>C	c.(1387-1389)Gaa>Caa	p.E463Q	ERBB2IP_ENST00000380936.1_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.E463Q|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.E463Q	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	463					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		AGTTGCATTTGAATGTGATGA	0.363																																																	0													91.0	87.0	88.0					5																	65338985		2203	4300	6503	SO:0001583	missense	55914				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.1387G>C	5.37:g.65338985G>C	ENSP00000284037:p.Glu463Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.E463Q	ENST00000284037.5	37	c.1387	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760676	0.89932	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.48	5.48	0.80851	.	0.044361	0.85682	D	0.000000	T	0.52533	0.1740	L	0.29908	0.895	0.80722	D	1	P;B;P;B;P;P;B	0.42409	0.688;0.008;0.779;0.266;0.693;0.558;0.223	P;B;P;B;B;P;B	0.51170	0.661;0.047;0.579;0.216;0.389;0.579;0.309	T	0.53129	-0.8482	10	0.62326	D	0.03	.	19.7083	0.96083	0.0:0.0:1.0:0.0	.	463;463;463;463;463;463;463	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	Q	463	ENSP00000284037:E463Q;ENSP00000370330:E463Q;ENSP00000370326:E463Q;ENSP00000370323:E463Q;ENSP00000370322:E463Q;ENSP00000370325:E463Q;ENSP00000422766:E463Q;ENSP00000426632:E463Q;ENSP00000422015:E463Q	ENSP00000284037:E463Q	E	+	1	0	ERBB2IP	65374741	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.388000	0.97237	2.745000	0.94114	0.555000	0.69702	GAA	ERBB2IP	-	NULL		0.363	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	G	NM_018695		65338985	+1	no_errors	ENST00000284037	ensembl	human	known	70_37	missense	SNP	1.000	C
ERMP1	79956	genome.wustl.edu	37	9	5787458	5787458	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:5787458G>C	ENST00000339450.5	-	14	2611	c.2522C>G	c.(2521-2523)tCt>tGt	p.S841C	ERMP1_ENST00000543230.1_3'UTR|ERMP1_ENST00000381506.3_3'UTR|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	841						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		CTGCCATGCAGAGGCCTGGAG	0.473																																																	0													132.0	127.0	129.0					9																	5787458		2203	4300	6503	SO:0001583	missense	79956			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.2522C>G	9.37:g.5787458G>C	ENSP00000340427:p.Ser841Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.S841C	ENST00000339450.5	37	c.2522	CCDS34983.1	9	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377698	0.24944	.	.	ENSG00000099219	ENST00000339450	T	0.48522	0.81	5.9	5.0	0.66597	.	0.263099	0.44688	D	0.000440	T	0.34629	0.0904	L	0.34521	1.04	0.23572	N	0.997384	B	0.29835	0.258	B	0.20955	0.032	T	0.27938	-1.0059	10	0.49607	T	0.09	-10.794	11.0482	0.47872	0.07:0.131:0.799:0.0	.	841	Q7Z2K6	ERMP1_HUMAN	C	841	ENSP00000340427:S841C	ENSP00000340427:S841C	S	-	2	0	ERMP1	5777458	0.997000	0.39634	0.738000	0.30950	0.002000	0.02628	3.868000	0.56055	1.484000	0.48361	-0.182000	0.12963	TCT	ERMP1	-	NULL		0.473	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMP1	HGNC	protein_coding	OTTHUMT00000354877.1	G	NM_024896		5787458	-1	no_errors	ENST00000339450	ensembl	human	known	70_37	missense	SNP	0.190	C
FAAH2	158584	genome.wustl.edu	37	X	57405214	57405214	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:57405214C>G	ENST00000374900.4	+	6	993	c.873C>G	c.(871-873)atC>atG	p.I291M		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	291						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						GACCTGGGATCAAAAGGTATG	0.448										HNSCC(52;0.14)																																							0													106.0	83.0	91.0					X																	57405214		2203	4300	6503	SO:0001583	missense	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.873C>G	X.37:g.57405214C>G	ENSP00000364035:p.Ile291Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VT2|Q96N98	Missense_Mutation	SNP	pfam_Amidase,superfamily_Amidase_dom	p.I291M	ENST00000374900.4	37	c.873	CCDS14375.1	X	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469817	0.26423	.	.	ENSG00000165591	ENST00000374900	T	0.53423	0.62	2.43	2.43	0.29744	Amidase signature domain (2);	0.277629	0.30101	U	0.010419	T	0.49525	0.1562	L	0.36672	1.1	0.21897	N	0.99948	P	0.46784	0.884	P	0.58077	0.832	T	0.28681	-1.0036	10	0.52906	T	0.07	.	8.1956	0.31394	0.0:1.0:0.0:0.0	.	291	Q6GMR7	FAAH2_HUMAN	M	291	ENSP00000364035:I291M	ENSP00000364035:I291M	I	+	3	3	FAAH2	57421939	0.126000	0.22350	0.982000	0.44146	0.512000	0.34134	0.147000	0.16202	0.941000	0.37499	0.544000	0.68410	ATC	FAAH2	-	pfam_Amidase,superfamily_Amidase_dom		0.448	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	C	NM_174912		57405214	+1	no_errors	ENST00000374900	ensembl	human	known	70_37	missense	SNP	0.992	G
FAM120B	84498	genome.wustl.edu	37	6	170627053	170627053	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:170627053C>A	ENST00000476287.1	+	2	683	c.575C>A	c.(574-576)tCa>tAa	p.S192*	FAM120B_ENST00000537664.1_Nonsense_Mutation_p.S215*|FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000540480.1_Nonsense_Mutation_p.S204*	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	192					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		CCCTACTTTTCAATTAGCGAG	0.512																																																	0													82.0	87.0	85.0					6																	170627053		2203	4300	6503	SO:0001587	stop_gained	84498			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.575C>A	6.37:g.170627053C>A	ENSP00000417970:p.Ser192*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DL34|Q86V68|Q96JI9	Nonsense_Mutation	SNP	NULL	p.S215*	ENST00000476287.1	37	c.644	CCDS5314.1	6	.	.	.	.	.	.	.	.	.	.	C	39	7.397238	0.98258	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9544	20.0589	0.97667	0.0:1.0:0.0:0.0	.	.	.	.	X	204;215;192	.	ENSP00000436640:S192X	S	+	2	0	FAM120B	170468978	1.000000	0.71417	0.903000	0.35520	0.945000	0.59286	7.281000	0.78621	2.732000	0.93576	0.650000	0.86243	TCA	FAM120B	-	NULL		0.512	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM120B	HGNC	protein_coding	OTTHUMT00000043259.2	C	NM_032448		170627053	+1	no_errors	ENST00000537664	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FAM131C	348487	genome.wustl.edu	37	1	16384941	16384941	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:16384941G>C	ENST00000375662.4	-	7	1017	c.834C>G	c.(832-834)ttC>ttG	p.F278L	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	278										large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CTCAGTTATAGAACACCTCGT	0.701																																																	0													2.0	2.0	2.0					1																	16384941		881	1859	2740	SO:0001583	missense	348487				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.834C>G	1.37:g.16384941G>C	ENSP00000364814:p.Phe278Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T5Q5|Q8N3X3|Q8N9P9	Missense_Mutation	SNP	superfamily_Chromodomain-like	p.F278L	ENST00000375662.4	37	c.834	CCDS41270.1	1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511844	0.64522	.	.	ENSG00000185519	ENST00000375662	T	0.19669	2.13	4.4	1.98	0.26296	.	0.000000	0.85682	D	0.000000	T	0.36468	0.0968	M	0.64997	1.995	0.38083	D	0.936723	D	0.67145	0.996	D	0.77557	0.99	T	0.16958	-1.0385	10	0.87932	D	0	-3.1166	5.7664	0.18229	0.3242:0.0:0.6758:0.0	.	278	Q96AQ9	F131C_HUMAN	L	278	ENSP00000364814:F278L	ENSP00000364814:F278L	F	-	3	2	FAM131C	16257528	0.998000	0.40836	0.998000	0.56505	0.652000	0.38707	0.192000	0.17096	0.112000	0.17975	0.298000	0.19748	TTC	FAM131C	-	NULL		0.701	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM131C	HGNC	protein_coding	OTTHUMT00000026319.1	G	NM_182623		16384941	-1	no_errors	ENST00000375662	ensembl	human	known	70_37	missense	SNP	1.000	C
FAM198A	729085	genome.wustl.edu	37	3	43074493	43074493	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:43074493G>A	ENST00000430121.2	+	2	833	c.738G>A	c.(736-738)acG>acA	p.T246T	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	246						extracellular region (GO:0005576)				endometrium(1)	1						ATGCTGAGACGCTGTTGAGCA	0.602																																																	0													24.0	29.0	27.0					3																	43074493		692	1591	2283	SO:0001819	synonymous_variant	729085			AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.738G>A	3.37:g.43074493G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KR48	Silent	SNP	NULL	p.T246	ENST00000430121.2	37	c.738	CCDS46808.1	3																																																																																			FAM198A	-	NULL		0.602	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	G	NM_001129908		43074493	+1	no_errors	ENST00000273146	ensembl	human	known	70_37	silent	SNP	0.006	A
FBXW5	54461	genome.wustl.edu	37	9	139835782	139835782	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:139835782G>C	ENST00000325285.3	-	8	1457	c.1378C>G	c.(1378-1380)Ctg>Gtg	p.L460V	FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	460					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TGCGCACGCAGAGCCCGCCTC	0.672																																																	0													44.0	38.0	40.0					9																	139835782		2202	4298	6500	SO:0001583	missense	54461			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1378C>G	9.37:g.139835782G>C	ENSP00000313034:p.Leu460Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L460V	ENST00000325285.3	37	c.1378	CCDS7014.1	9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022761	0.75275	.	.	ENSG00000159069	ENST00000325285	T	0.69926	-0.44	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);	0.000000	0.64402	D	0.000001	T	0.79913	0.4528	L	0.61387	1.9	0.80722	D	1	D;P	0.69078	0.997;0.671	D;B	0.78314	0.991;0.306	T	0.80908	-0.1172	10	0.49607	T	0.09	-0.2241	17.795	0.88567	0.0:0.0:1.0:0.0	.	325;460	Q59ET5;Q969U6	.;FBXW5_HUMAN	V	460	ENSP00000313034:L460V	ENSP00000313034:L460V	L	-	1	2	FBXW5	138955603	1.000000	0.71417	0.955000	0.39395	0.884000	0.51177	4.299000	0.59073	2.204000	0.70986	0.561000	0.74099	CTG	FBXW5	-	superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat		0.672	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	HGNC	protein_coding	OTTHUMT00000055227.1	G	NM_018998		139835782	-1	no_errors	ENST00000325285	ensembl	human	known	70_37	missense	SNP	1.000	C
FBXW5	54461	genome.wustl.edu	37	9	139836132	139836132	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:139836132G>C	ENST00000325285.3	-	7	1180	c.1101C>G	c.(1099-1101)atC>atG	p.I367M	FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	367					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGATCTGCTTGATGCCTGCAG	0.637																																																	0													51.0	41.0	44.0					9																	139836132		2166	4268	6434	SO:0001583	missense	54461			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1101C>G	9.37:g.139836132G>C	ENSP00000313034:p.Ile367Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_Quinoprot_gluc/sorb_DH,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I367M	ENST00000325285.3	37	c.1101	CCDS7014.1	9	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622127	0.46840	.	.	ENSG00000159069	ENST00000325285;ENST00000433269	T;T	0.77877	-1.13;1.33	4.91	2.01	0.26516	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);	0.105315	0.64402	D	0.000006	T	0.78947	0.4364	M	0.62723	1.935	0.50467	D	0.999878	D;D	0.61080	0.986;0.989	P;P	0.57057	0.757;0.812	T	0.74592	-0.3614	10	0.38643	T	0.18	-6.5612	5.6545	0.17635	0.3474:0.0:0.523:0.1296	.	232;367	Q59ET5;Q969U6	.;FBXW5_HUMAN	M	367;202	ENSP00000313034:I367M;ENSP00000409102:I202M	ENSP00000313034:I367M	I	-	3	3	FBXW5	138955953	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.191000	0.32138	0.597000	0.29811	-0.254000	0.11334	ATC	FBXW5	-	superfamily_Quinoprot_gluc/sorb_DH		0.637	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	HGNC	protein_coding	OTTHUMT00000055227.1	G	NM_018998		139836132	-1	no_errors	ENST00000325285	ensembl	human	known	70_37	missense	SNP	0.994	C
FER1L6	654463	genome.wustl.edu	37	8	125131950	125131950	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:125131950C>G	ENST00000522917.1	+	41	5699	c.5493C>G	c.(5491-5493)ctC>ctG	p.L1831L	FER1L6_ENST00000399018.1_Silent_p.L1831L|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1831						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ctttcattctcatcatcctca	0.478																																																	0													232.0	244.0	240.0					8																	125131950		2082	4207	6289	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.5493C>G	8.37:g.125131950C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L1831	ENST00000522917.1	37	c.5493	CCDS43767.1	8																																																																																			FER1L6	-	superfamily_ABC_transptrTM_dom_typ1		0.478	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	C	NM_001039112		125131950	+1	no_errors	ENST00000399018	ensembl	human	known	70_37	silent	SNP	0.851	G
FER1L6	654463	genome.wustl.edu	37	8	125131974	125131974	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:125131974C>T	ENST00000522917.1	+	41	5723	c.5517C>T	c.(5515-5517)gtC>gtT	p.V1839V	FER1L6_ENST00000399018.1_Silent_p.V1839V|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1839						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			tcttcctcgtccttttcatcT	0.458																																																	0													208.0	220.0	216.0					8																	125131974		2078	4207	6285	SO:0001819	synonymous_variant	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.5517C>T	8.37:g.125131974C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.V1839	ENST00000522917.1	37	c.5517	CCDS43767.1	8																																																																																			FER1L6	-	superfamily_ABC_transptrTM_dom_typ1		0.458	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	C	NM_001039112		125131974	+1	no_errors	ENST00000399018	ensembl	human	known	70_37	silent	SNP	0.999	T
TPRXL	348825	genome.wustl.edu	37	3	13976047	13976047	+	5'Flank	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:13976047G>C	ENST00000326972.8	+	0	0				FGD5P1_ENST00000502451.1_RNA			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like											endometrium(1)	1						AGAAGAGGAAGAGGAGCGTGA	0.642																																																	0																																										SO:0001631	upstream_gene_variant	100132526			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509		3.37:g.13976047G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAM5	RNA	SNP	-	NULL	ENST00000326972.8	37	NULL		3																																																																																			FGD5P1	-	-		0.642	TPRXL-001	KNOWN	basic|appris_principal	protein_coding	FGD5P1	HGNC	protein_coding	OTTHUMT00000340434.2	G	NR_002223		13976047	+1	no_errors	ENST00000502451	ensembl	human	known	70_37	rna	SNP	0.969	C
FKBP2	2286	genome.wustl.edu	37	11	64010730	64010730	+	Silent	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:64010730C>A	ENST00000394540.3	+	3	701	c.231C>A	c.(229-231)gtC>gtA	p.V77V	RP11-783K16.5_ENST00000544553.1_RNA|FKBP2_ENST00000309366.4_Silent_p.V77V|FKBP2_ENST00000449942.2_Silent_p.V77V	NM_057092.2	NP_476433.1	P26885	FKBP2_HUMAN	FK506 binding protein 2, 13kDa	77	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(2)|lung(3)	5						AGCCCTTTGTCTTCTCCCTTG	0.622																																																	0													53.0	54.0	54.0					11																	64010730		2201	4297	6498	SO:0001819	synonymous_variant	2286			M75099	CCDS8063.1	11q13.1-q13.3	2008-07-18	2002-08-29			ENSG00000173486			3718	protein-coding gene	gene with protein product	"""FK506 binding protein 2 (13kD)"", ""peptidyl-prolyl cis-trans isomerase"", ""rapamycin-binding protein"", ""proline isomerase"""	186946	"""FK506-binding protein 2 (13kD)"""			1713687	Standard	NM_004470		Approved	FKBP-13, PPIase	uc001nyy.3	P26885		ENST00000394540.3:c.231C>A	11.37:g.64010730C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BJH9|Q9BTS7	Silent	SNP	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	p.V77	ENST00000394540.3	37	c.231	CCDS8063.1	11																																																																																			FKBP2	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom		0.622	FKBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP2	HGNC	protein_coding	OTTHUMT00000396401.2	C	NM_004470		64010730	+1	no_errors	ENST00000309366	ensembl	human	known	70_37	silent	SNP	1.000	A
FKBP6	8468	genome.wustl.edu	37	7	72754676	72754676	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:72754676G>A	ENST00000252037.4	+	6	694	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	FKBP6_ENST00000431982.2_Missense_Mutation_p.E204K|FKBP6_ENST00000413573.2_Missense_Mutation_p.E179K|RNU6-1080P_ENST00000383982.1_RNA	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	209					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				AGCACCCCCTGAAGAGCAGCA	0.547																																																	0													60.0	65.0	63.0					7																	72754676		1965	4153	6118	SO:0001583	missense	8468			AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.625G>A	7.37:g.72754676G>A	ENSP00000252037:p.Glu209Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.E209K	ENST00000252037.4	37	c.625	CCDS43595.1	7	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787165	0.49997	.	.	ENSG00000077800	ENST00000431982;ENST00000442793;ENST00000413573;ENST00000252037	T;T;T;T	0.74002	-0.8;0.26;-0.8;-0.8	4.91	4.91	0.64330	Tetratricopeptide-like helical (1);	0.347447	0.31404	N	0.007717	T	0.69602	0.3129	L	0.50333	1.59	0.20821	N	0.999843	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.11329	0.006;0.001;0.002	T	0.61148	-0.7121	10	0.42905	T	0.14	-14.9873	15.2625	0.73634	0.0:0.0:1.0:0.0	.	204;209;179	O75344-2;O75344;Q7Z4T4	.;FKBP6_HUMAN;.	K	204;164;179;209	ENSP00000416277:E204K;ENSP00000402360:E164K;ENSP00000394952:E179K;ENSP00000252037:E209K	ENSP00000252037:E209K	E	+	1	0	FKBP6	72392612	0.268000	0.24133	0.037000	0.18230	0.003000	0.03518	3.574000	0.53863	2.284000	0.76573	0.563000	0.77884	GAA	FKBP6	-	NULL		0.547	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP6	HGNC	protein_coding	OTTHUMT00000318723.1	G	NM_003602		72754676	+1	no_errors	ENST00000252037	ensembl	human	known	70_37	missense	SNP	0.038	A
FKTN	2218	genome.wustl.edu	37	9	108358965	108358965	+	Intron	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:108358965C>T	ENST00000223528.2	+	3	289				FKTN_ENST00000357998.5_Intron|FKTN_ENST00000602661.1_Intron|FKTN_ENST00000448551.2_Intron|FKTN_ENST00000490134.1_3'UTR|FKTN_ENST00000540160.1_Intron	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin						muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						AGAAATTTCTCAATTATAATG	0.373																																																	0													60.0	62.0	61.0					9																	108358965		2203	4300	6503	SO:0001627	intron_variant	2218				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.165+27C>T	9.37:g.108358965C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	RNA	SNP	-	NULL	ENST00000223528.2	37	NULL	CCDS6766.1	9																																																																																			FKTN	-	-		0.373	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKTN	HGNC	protein_coding	OTTHUMT00000053505.1	C	NM_006731		108358965	+1	no_errors	ENST00000490134	ensembl	human	known	70_37	rna	SNP	0.000	T
FLT4	2324	genome.wustl.edu	37	5	180047610	180047610	+	Splice_Site	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:180047610C>T	ENST00000261937.6	-	16	2483	c.2405G>A	c.(2404-2406)aGg>aAg	p.R802K	FLT4_ENST00000393347.3_Splice_Site_p.R802K|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000502649.1_Splice_Site_p.R802K	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	802					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GACACTCACCCTCCTCATGTT	0.577																																					Colon(97;1075 1466 27033 27547 35871)												0													87.0	88.0	88.0					5																	180047610		2200	4298	6498	SO:0001630	splice_region_variant	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2406+1G>A	5.37:g.180047610C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.R802K	ENST00000261937.6	37	c.2405	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287174	0.80803	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.76448	-1.02;-1.02;-1.02	4.28	3.41	0.39046	.	.	.	.	.	T	0.68476	0.3005	L	0.39085	1.19	0.58432	D	0.999993	B;B;P	0.36378	0.34;0.224;0.55	B;B;B	0.37091	0.193;0.175;0.241	T	0.66184	-0.5987	9	0.34782	T	0.22	.	12.5687	0.56323	0.0:0.9182:0.0:0.0818	.	612;802;802	E9PFB0;E9PD35;P35916	.;.;VGFR3_HUMAN	K	802;802;802;612	ENSP00000261937:R802K;ENSP00000377016:R802K;ENSP00000426057:R802K	ENSP00000261937:R802K	R	-	2	0	FLT4	179980216	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.832000	0.62759	1.163000	0.42636	0.462000	0.41574	AGG	FLT4	-	NULL		0.577	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	C		Missense_Mutation	180047610	-1	no_errors	ENST00000261937	ensembl	human	known	70_37	missense	SNP	1.000	T
FRG1B	284802	genome.wustl.edu	37	20	29612387	29612387	+	Intron	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:29612387G>A	ENST00000278882.3	+	1	257				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATCTCTCCAGGCCTCTGCCTG	0.532																																																	0																																										SO:0001627	intron_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+274G>A	20.37:g.29612387G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-		0.532	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	G	NR_003579		29612387	+1	no_errors	ENST00000482423	ensembl	human	known	70_37	rna	SNP	0.013	A
FUT8	2530	genome.wustl.edu	37	14	66096237	66096237	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:66096237C>G	ENST00000360689.5	+	6	2237	c.510C>G	c.(508-510)ctC>ctG	p.L170L	FUT8_ENST00000394586.2_Silent_p.L170L|FUT8_ENST00000358307.2_Silent_p.L41L|FUT8_ENST00000557164.1_Silent_p.L7L|FUT8_ENST00000394585.1_Silent_p.L170L	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	170					cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		TATACTACCTCAGTCAGACAG	0.423																																																	0													136.0	130.0	132.0					14																	66096237		2203	4300	6503	SO:0001819	synonymous_variant	2530			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.510C>G	14.37:g.66096237C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Silent	SNP	superfamily_SH3_domain,smart_SH3_domain,pirsf_Alpha1_6FUT_euk	p.L170	ENST00000360689.5	37	c.510	CCDS9775.1	14																																																																																			FUT8	-	pirsf_Alpha1_6FUT_euk		0.423	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT8	HGNC	protein_coding	OTTHUMT00000286406.1	C	NM_004480		66096237	+1	no_errors	ENST00000360689	ensembl	human	known	70_37	silent	SNP	1.000	G
FUT9	10690	genome.wustl.edu	37	6	96651676	96651676	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:96651676C>G	ENST00000302103.5	+	3	971	c.645C>G	c.(643-645)atC>atG	p.I215M		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	215					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		GCATTGAAATCCATACCTACG	0.373																																					Melanoma(98;1369 1476 6592 22940 26587)												0													59.0	57.0	58.0					6																	96651676		2203	4300	6503	SO:0001583	missense	10690			AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.645C>G	6.37:g.96651676C>G	ENSP00000302599:p.Ile215Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0W4	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.I215M	ENST00000302103.5	37	c.645	CCDS5033.1	6	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320997	0.41096	.	.	ENSG00000172461	ENST00000302103	T	0.29655	1.56	5.75	2.6	0.31112	.	0.050600	0.85682	D	0.000000	T	0.45357	0.1338	M	0.82517	2.595	0.41448	D	0.987969	D	0.67145	0.996	D	0.77004	0.989	T	0.53795	-0.8388	10	0.87932	D	0	-15.1268	11.1477	0.48440	0.0:0.7648:0.0:0.2352	.	215	Q9Y231	FUT9_HUMAN	M	215	ENSP00000302599:I215M	ENSP00000302599:I215M	I	+	3	3	FUT9	96758397	0.968000	0.33430	1.000000	0.80357	0.988000	0.76386	0.132000	0.15891	0.792000	0.33850	0.655000	0.94253	ATC	FUT9	-	pfam_Glyco_trans_10		0.373	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT9	HGNC	protein_coding	OTTHUMT00000041554.2	C	NM_006581		96651676	+1	no_errors	ENST00000302103	ensembl	human	known	70_37	missense	SNP	1.000	G
FZD4	8322	genome.wustl.edu	37	11	86663136	86663136	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:86663136A>G	ENST00000531380.1	-	2	967	c.662T>C	c.(661-663)aTc>aCc	p.I221T	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	221					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGCCATCCAGATATCAGTGAA	0.517																																																	0													90.0	78.0	82.0					11																	86663136		2201	4299	6500	SO:0001583	missense	8322			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.662T>C	11.37:g.86663136A>G	ENSP00000434034:p.Ile221Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.I221T	ENST00000531380.1	37	c.662	CCDS8279.1	11	.	.	.	.	.	.	.	.	.	.	A	13.47	2.245339	0.39697	.	.	ENSG00000174804	ENST00000531380	D	0.81739	-1.53	5.74	4.62	0.57501	GPCR, family 2-like (1);	0.437153	0.26723	N	0.022840	D	0.83243	0.5212	L	0.59912	1.85	0.29524	N	0.853275	P	0.35575	0.51	P	0.48982	0.597	T	0.78602	-0.2140	9	.	.	.	.	11.6134	0.51074	0.9306:0.0:0.0694:0.0	.	221	Q9ULV1	FZD4_HUMAN	T	221	ENSP00000434034:I221T	.	I	-	2	0	FZD4	86340784	0.999000	0.42202	0.134000	0.22075	0.926000	0.56050	4.333000	0.59285	1.016000	0.39470	0.533000	0.62120	ATC	FZD4	-	pfam_Frizzled,pfscan_GPCR_2-like		0.517	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	FZD4	HGNC	protein_coding	OTTHUMT00000393818.2	A	NM_012193		86663136	-1	no_errors	ENST00000531380	ensembl	human	known	70_37	missense	SNP	0.381	G
GATM	2628	genome.wustl.edu	37	15	45656204	45656204	+	Silent	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:45656204G>T	ENST00000396659.3	-	8	1392	c.1053C>A	c.(1051-1053)ctC>ctA	p.L351L	GATM_ENST00000558336.1_Silent_p.L351L	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	351					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	ATGACATCCAGAGTGGATGAT	0.353																																																	0													143.0	126.0	132.0					15																	45656204		2198	4298	6496	SO:0001819	synonymous_variant	2628			S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.1053C>A	15.37:g.45656204G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DH99|B4DPI3|Q53EQ4	Silent	SNP	NULL	p.L351	ENST00000396659.3	37	c.1053	CCDS10122.1	15																																																																																			GATM	-	NULL		0.353	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATM	HGNC	protein_coding	OTTHUMT00000254220.2	G	NM_001482		45656204	-1	no_errors	ENST00000396659	ensembl	human	known	70_37	silent	SNP	1.000	T
GIPC2	54810	genome.wustl.edu	37	1	78560749	78560749	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:78560749G>A	ENST00000370759.3	+	3	733	c.540G>A	c.(538-540)aaG>aaA	p.K180K	RNA5SP22_ENST00000365393.1_RNA	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	180	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						ATGTTGCTAAGAAGTTAAAGG	0.383																																																	0													137.0	145.0	142.0					1																	78560749		2203	4300	6503	SO:0001819	synonymous_variant	54810			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.540G>A	1.37:g.78560749G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IYD3|Q9NXS7	Silent	SNP	pfam_PDZ,superfamily_PDZ,superfamily_Ig_E-set,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.K180	ENST00000370759.3	37	c.540	CCDS685.1	1																																																																																			GIPC2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ		0.383	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC2	HGNC	protein_coding	OTTHUMT00000098629.1	G	NM_017655		78560749	+1	no_errors	ENST00000370759	ensembl	human	known	70_37	silent	SNP	0.999	A
GCSAML	148823	genome.wustl.edu	37	1	247690334	247690334	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:247690334C>T	ENST00000366490.3	+	2	235	c.77C>T	c.(76-78)tCa>tTa	p.S26L	GCSAML_ENST00000366491.2_5'UTR|GCSAML_ENST00000366489.1_5'UTR|GCSAML-AS1_ENST00000420469.1_RNA|GCSAML_ENST00000531662.1_3'UTR|GCSAML_ENST00000527541.1_5'UTR|GCSAML_ENST00000527084.1_5'UTR|GCSAML_ENST00000463359.1_Intron			Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	0																	GTGTTTCTTTCAGTTCTTGGA	0.413																																																	0																																										SO:0001583	missense	148823			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366490.3:c.77C>T	1.37:g.247690334C>T	ENSP00000355446:p.Ser26Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	NULL	p.S26L	ENST00000366490.3	37	c.77		1	.	.	.	.	.	.	.	.	.	.	C	6.746	0.506430	0.12883	.	.	ENSG00000169224	ENST00000366490	.	.	.	0.721	0.721	0.18219	.	.	.	.	.	T	0.41190	0.1148	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39210	-0.9625	4	0.87932	D	0	.	.	.	.	.	.	.	.	L	26	.	ENSP00000355446:S26L	S	+	2	0	C1orf150	245756957	0.000000	0.05858	0.002000	0.10522	0.083000	0.17756	-0.915000	0.04033	0.690000	0.31570	0.205000	0.17691	TCA	GCSAML	-	NULL		0.413	GCSAML-201	KNOWN	basic	protein_coding	GCSAML	HGNC	protein_coding		C	NM_145278		247690334	+1	no_errors	ENST00000366490	ensembl	human	known	70_37	missense	SNP	0.002	T
GLI3	2737	genome.wustl.edu	37	7	42088256	42088256	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:42088256C>T	ENST00000395925.3	-	5	597	c.513G>A	c.(511-513)ctG>ctA	p.L171L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	171					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TAATGAAGGGCAGGTCCGGAT	0.512									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																																								0													99.0	101.0	100.0					7																	42088256		2203	4300	6503	SO:0001819	synonymous_variant	2737	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.513G>A	7.37:g.42088256C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L171	ENST00000395925.3	37	c.513	CCDS5465.1	7																																																																																			GLI3	-	NULL		0.512	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	C	NM_000168		42088256	-1	no_errors	ENST00000395925	ensembl	human	known	70_37	silent	SNP	1.000	T
GMCL1	64395	genome.wustl.edu	37	2	70088422	70088422	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:70088422C>T	ENST00000282570.3	+	10	1336	c.1085C>T	c.(1084-1086)tCt>tTt	p.S362F		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	362					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						TGGCTCTCTTCTGTGTATAAA	0.318																																																	0													46.0	51.0	49.0					2																	70088422		2203	4300	6503	SO:0001583	missense	64395			AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.1085C>T	2.37:g.70088422C>T	ENSP00000282570:p.Ser362Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S362F	ENST00000282570.3	37	c.1085	CCDS1895.1	2	.	.	.	.	.	.	.	.	.	.	C	16.43	3.120495	0.56613	.	.	ENSG00000087338	ENST00000282570	T	0.55413	0.52	5.29	3.43	0.39272	.	0.245803	0.42420	D	0.000704	T	0.52075	0.1712	L	0.53249	1.67	0.45354	D	0.998341	B	0.32543	0.375	B	0.38755	0.281	T	0.53500	-0.8430	10	0.52906	T	0.07	-6.3574	13.3308	0.60485	0.0:0.6681:0.3319:0.0	.	362	Q96IK5	GMCL1_HUMAN	F	362	ENSP00000282570:S362F	ENSP00000282570:S362F	S	+	2	0	GMCL1	69941926	0.658000	0.27402	0.997000	0.53966	0.988000	0.76386	2.213000	0.42844	0.747000	0.32809	0.555000	0.69702	TCT	GMCL1	-	NULL		0.318	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMCL1	HGNC	protein_coding	OTTHUMT00000251841.2	C	NM_178439		70088422	+1	no_errors	ENST00000282570	ensembl	human	known	70_37	missense	SNP	0.999	T
GOLGA8J	653073	genome.wustl.edu	37	15	30376977	30376977	+	Missense_Mutation	SNP	A	A	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:30376977A>C	ENST00000567927.1	+	2	52	c.52A>C	c.(52-54)Aaa>Caa	p.K18Q	GOLGA8J_ENST00000568123.1_3'UTR|GOLGA8J_ENST00000341650.6_5'UTR			A6NMD2	GOG8J_HUMAN	golgin A8 family, member J	18						Golgi apparatus (GO:0005794)											CCAACAGTTAAAAGAATATTG	0.438																																																	0																																										SO:0001583	missense	653073				CCDS61574.1	15q13.2	2012-10-05			ENSG00000179938	ENSG00000179938			38650	protein-coding gene	gene with protein product							Standard	NM_001282472		Approved			A6NMD2	OTTHUMG00000175635	ENST00000567927.1:c.52A>C	15.37:g.30376977A>C	ENSP00000456401:p.Lys18Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	H3BRU0	Missense_Mutation	SNP	NULL	p.K18Q	ENST00000567927.1	37	c.52		15																																																																																			GOLGA8J	-	NULL		0.438	GOLGA8J-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8J	HGNC	protein_coding	OTTHUMT00000430682.1	A	XM_001724382		30376977	+1	no_errors	ENST00000567927	ensembl	human	novel	70_37	missense	SNP	0.009	C
GOLGB1	2804	genome.wustl.edu	37	3	121409846	121409846	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:121409846G>C	ENST00000340645.5	-	14	8475	c.8350C>G	c.(8350-8352)Ctt>Gtt	p.L2784V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.L2789V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2784					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCAGAAAGAAGAGCATCTCTC	0.413																																																	0													129.0	119.0	122.0					3																	121409846		2203	4300	6503	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8350C>G	3.37:g.121409846G>C	ENSP00000341848:p.Leu2784Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.L2784V	ENST00000340645.5	37	c.8350	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	0.087	-1.172967	0.01646	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.19105	2.17;2.17	4.08	2.28	0.28536	.	0.424599	0.19381	N	0.115657	T	0.25158	0.0611	N	0.22421	0.69	0.28455	N	0.916176	D;D;P	0.71674	0.998;0.996;0.946	D;D;P	0.83275	0.996;0.986;0.54	T	0.07214	-1.0784	10	0.29301	T	0.29	.	5.9635	0.19313	0.2374:0.0:0.7626:0.0	.	2789;2789;2784	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	V	2784;2789	ENSP00000341848:L2784V;ENSP00000377275:L2789V	ENSP00000341848:L2784V	L	-	1	0	GOLGB1	122892536	0.011000	0.17503	0.374000	0.26016	0.023000	0.10783	0.889000	0.28282	0.393000	0.25203	-0.218000	0.12543	CTT	GOLGB1	-	NULL		0.413	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	G	NM_004487		121409846	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	missense	SNP	0.663	C
GOLGB1	2804	genome.wustl.edu	37	3	121409951	121409951	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:121409951G>C	ENST00000340645.5	-	14	8370	c.8245C>G	c.(8245-8247)Cat>Gat	p.H2749D	GOLGB1_ENST00000393667.3_Missense_Mutation_p.H2754D	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2749					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCATTGGCATGATCTCTACTA	0.393																																																	0													180.0	171.0	174.0					3																	121409951		2203	4300	6503	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8245C>G	3.37:g.121409951G>C	ENSP00000341848:p.His2749Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.H2749D	ENST00000340645.5	37	c.8245	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	7.633	0.679175	0.14907	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.14266	2.52;2.52	5.72	4.8	0.61643	.	0.501288	0.20093	N	0.099395	T	0.11922	0.0290	L	0.57536	1.79	0.32684	N	0.51514	B;B;B	0.31625	0.082;0.082;0.332	B;B;B	0.27076	0.058;0.058;0.076	T	0.13150	-1.0520	10	0.15952	T	0.53	.	6.7483	0.23474	0.0864:0.0:0.6928:0.2209	.	2754;2754;2749	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	D	2749;2754	ENSP00000341848:H2749D;ENSP00000377275:H2754D	ENSP00000341848:H2749D	H	-	1	0	GOLGB1	122892641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.265000	0.58865	1.242000	0.43836	0.655000	0.94253	CAT	GOLGB1	-	NULL		0.393	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	G	NM_004487		121409951	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	missense	SNP	1.000	C
GPR115	221393	genome.wustl.edu	37	6	47681717	47681717	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:47681717C>T	ENST00000283303.2	+	6	994	c.736C>T	c.(736-738)Cac>Tac	p.H246Y	GPR115_ENST00000371220.1_Missense_Mutation_p.H303Y|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000327753.3_Missense_Mutation_p.H246Y	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	246					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						AAAAGGGTTTCACATCAACCA	0.393																																					GBM(22;431 510 9010 26644 32828)												0													85.0	82.0	83.0					6																	47681717		2203	4300	6503	SO:0001583	missense	221393			AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.736C>T	6.37:g.47681717C>T	ENSP00000283303:p.His246Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.H303Y	ENST00000283303.2	37	c.907	CCDS4922.2	6	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.952385	0.00470	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.33654	1.62;1.4;1.4	5.19	4.2	0.49525	.	0.991144	0.08218	N	0.979579	T	0.11793	0.0287	L	0.40543	1.245	0.09310	N	1	B	0.24092	0.097	B	0.21546	0.035	T	0.22521	-1.0214	10	0.05525	T	0.97	-0.2592	12.6774	0.56901	0.2249:0.7751:0.0:0.0	.	246	Q8IZF3	GP115_HUMAN	Y	303;246;246	ENSP00000360264:H303Y;ENSP00000328319:H246Y;ENSP00000283303:H246Y	ENSP00000283303:H246Y	H	+	1	0	GPR115	47789676	0.002000	0.14202	0.823000	0.32752	0.492000	0.33523	1.702000	0.37836	2.578000	0.87016	0.655000	0.94253	CAC	GPR115	-	NULL		0.393	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR115	HGNC	protein_coding	OTTHUMT00000040819.2	C	NM_153838		47681717	+1	no_errors	ENST00000371220	ensembl	human	known	70_37	missense	SNP	0.132	T
GRAMD1B	57476	genome.wustl.edu	37	11	123476185	123476185	+	Splice_Site	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:123476185C>T	ENST00000529750.1	+	9	1220	c.893C>T	c.(892-894)tCg>tTg	p.S298L	GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000456860.2_Splice_Site_p.S305L|GRAMD1B_ENST00000322282.7_Splice_Site_p.S298L	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	298						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.S298*(2)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GCCCCCGTCTCGGTATGGGCA	0.562																																																	2	Substitution - Nonsense(2)	lung(2)											132.0	138.0	136.0					11																	123476185		2071	4191	6262	SO:0001630	splice_region_variant	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.894+1C>T	11.37:g.123476185C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UW85|Q9ULL9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.S298L	ENST00000529750.1	37	c.893	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635860	0.47049	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.33865	1.81;1.79;1.79;1.81;1.39	5.03	3.15	0.36227	.	0.311936	0.31577	N	0.007420	T	0.22399	0.0540	L	0.36672	1.1	0.58432	D	0.999992	B;B;B;B	0.33494	0.414;0.005;0.216;0.216	B;B;B;B	0.20184	0.028;0.001;0.012;0.012	T	0.04216	-1.0968	10	0.26408	T	0.33	.	9.3339	0.38038	0.0:0.8338:0.0:0.1662	.	258;305;298;305	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	L	305;305;298;298;258;294	ENSP00000402457:S305L;ENSP00000325628:S298L;ENSP00000436500:S298L;ENSP00000432987:S258L;ENSP00000434214:S294L	ENSP00000325628:S298L	S	+	2	0	GRAMD1B	122981395	1.000000	0.71417	0.993000	0.49108	0.858000	0.48976	4.944000	0.63561	0.528000	0.28580	0.305000	0.20034	TCG	GRAMD1B	-	NULL		0.562	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	C	XM_370660	Missense_Mutation	123476185	+1	no_errors	ENST00000322282	ensembl	human	known	70_37	missense	SNP	1.000	T
GSPT2	23708	genome.wustl.edu	37	X	51488203	51488203	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:51488203G>C	ENST00000340438.4	+	1	1723	c.1481G>C	c.(1480-1482)aGa>aCa	p.R494T		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	494					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					CTCAAAATCAGACTGAAGGGA	0.408																																																	0													76.0	66.0	69.0					X																	51488203		2203	4300	6503	SO:0001583	missense	23708			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.1481G>C	X.37:g.51488203G>C	ENSP00000341247:p.Arg494Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H909|Q9NVY0|Q9NY44	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_EF_GTP-bd_dom	p.R494T	ENST00000340438.4	37	c.1481	CCDS14336.1	X	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058576	0.55325	.	.	ENSG00000189369	ENST00000340438;ENST00000502175	T	0.62364	0.03	4.54	4.54	0.55810	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	M	0.66560	2.04	0.58432	D	0.999999	D	0.76494	0.999	D	0.72982	0.979	T	0.78497	-0.2181	10	0.72032	D	0.01	-0.3575	14.1724	0.65517	0.0:0.0:1.0:0.0	.	494	Q8IYD1	ERF3B_HUMAN	T	494;411	ENSP00000341247:R494T	ENSP00000341247:R494T	R	+	2	0	GSPT2	51504943	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.327000	0.79147	2.520000	0.84964	0.590000	0.80494	AGA	GSPT2	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel		0.408	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSPT2	HGNC	protein_coding	OTTHUMT00000056587.1	G			51488203	+1	no_errors	ENST00000340438	ensembl	human	known	70_37	missense	SNP	1.000	C
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72657941	72657941	+	RNA	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:72657941C>G	ENST00000425256.1	-	0	1970									GTF2I repeat domain containing 2 pseudogene 1																		gggtttccctctggatgacat	0.493																																																	0																																												401375			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72657941C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-		0.493	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	C	NR_002164		72657941	-1	no_errors	ENST00000425256	ensembl	human	known	70_37	rna	SNP	0.835	G
GTF2IRD2	84163	genome.wustl.edu	37	7	74211579	74211579	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:74211579C>T	ENST00000405086.2	-	16	2461	c.2272G>A	c.(2272-2274)Gac>Aac	p.D758N	GTF2IRD2_ENST00000451013.2_Missense_Mutation_p.D305N	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	758					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						atcgtcatgtcaaccaagaag	0.502																																					NSCLC(40;560 1096 7501 40315 49546)												0													5.0	5.0	5.0					7																	74211579		1708	3583	5291	SO:0001583	missense	84163			BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.2272G>A	7.37:g.74211579C>T	ENSP00000385491:p.Asp758Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,superfamily_RNaseH-like_dom,pfscan_GTF2I	p.D758N	ENST00000405086.2	37	c.2272	CCDS5576.1	7	.	.	.	.	.	.	.	.	.	.	c	15.28	2.786773	0.49997	.	.	ENSG00000196275	ENST00000405086;ENST00000451013	D;D	0.86865	-2.18;-2.18	1.74	1.74	0.24563	Ribonuclease H-like (1);	.	.	.	.	D	0.91560	0.7334	M	0.80422	2.495	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	D	0.90512	0.4482	9	0.87932	D	0	-24.639	7.1297	0.25493	0.0:1.0:0.0:0.0	.	758	Q86UP8	GTD2A_HUMAN	N	758;305	ENSP00000385491:D758N;ENSP00000406723:D305N	ENSP00000385491:D758N	D	-	1	0	GTF2IRD2	73849515	0.983000	0.35010	0.850000	0.33497	0.822000	0.46500	1.812000	0.38952	1.317000	0.45149	0.442000	0.29010	GAC	GTF2IRD2	-	superfamily_RNaseH-like_dom		0.502	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2	HGNC	protein_coding	OTTHUMT00000252712.3	C	NM_173537		74211579	-1	no_errors	ENST00000405086	ensembl	human	known	70_37	missense	SNP	0.913	T
HCAR2	338442	genome.wustl.edu	37	12	123187570	123187570	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:123187570A>T	ENST00000328880.5	-	1	320	c.261T>A	c.(259-261)taT>taA	p.Y87*	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	87					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	AACGCCTCACATAGTTGTCCA	0.542																																																	0													87.0	76.0	80.0					12																	123187570		2203	4300	6503	SO:0001587	stop_gained	338442			AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.261T>A	12.37:g.123187570A>T	ENSP00000375066:p.Tyr87*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJL5|A7LGG3	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2_purnocptor	p.Y87*	ENST00000328880.5	37	c.261	CCDS9235.1	12	.	.	.	.	.	.	.	.	.	.	A	8.189	0.795579	0.16327	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	.	.	.	5.65	-11.3	0.00108	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.813	15.8142	0.78586	0.6525:0.0:0.2811:0.0665	.	.	.	.	X	87	.	ENSP00000375066:Y87X	Y	-	3	2	HCAR2	121753523	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.837000	0.04377	-3.191000	0.00219	-1.811000	0.00612	TAT	HCAR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2_purnocptor		0.542	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR2	HGNC	protein_coding	OTTHUMT00000370202.1	A	NM_177551		123187570	-1	no_errors	ENST00000328880	ensembl	human	known	70_37	nonsense	SNP	0.000	T
HHLA2	11148	genome.wustl.edu	37	3	108074109	108074109	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:108074109C>G	ENST00000357759.5	+	5	980	c.566C>G	c.(565-567)tCt>tGt	p.S189C	HHLA2_ENST00000491820.1_Missense_Mutation_p.S189C|HHLA2_ENST00000489514.2_Missense_Mutation_p.S189C|HHLA2_ENST00000467761.1_Missense_Mutation_p.S189C|HHLA2_ENST00000467562.1_Missense_Mutation_p.S125C	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	189	Ig-like C1-type.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						GAAACAGGGTCTTTGGATTCT	0.358																																																	0													96.0	91.0	93.0					3																	108074109		1853	4091	5944	SO:0001583	missense	11148			AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.566C>G	3.37:g.108074109C>G	ENSP00000350402:p.Ser189Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S189C	ENST00000357759.5	37	c.566	CCDS46883.1	3	.	.	.	.	.	.	.	.	.	.	C	13.86	2.362676	0.41902	.	.	ENSG00000114455	ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514	T;T;T;T;T	0.03004	4.08;4.08;4.08;4.08;4.08	4.96	-0.608	0.11611	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	0.722768	0.11966	N	0.512235	T	0.07638	0.0192	L	0.32530	0.975	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.66847	0.947;0.947;0.947	T	0.34925	-0.9809	9	.	.	.	-21.2287	7.6215	0.28187	0.508:0.4091:0.0:0.0829	.	125;189;189	B4DKN2;C9J7D0;Q9UM44	.;.;HHLA2_HUMAN	C	189;125;189;189;189	ENSP00000418284:S189C;ENSP00000418345:S125C;ENSP00000350402:S189C;ENSP00000419207:S189C;ENSP00000417856:S189C	.	S	+	2	0	HHLA2	109556799	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.315000	0.08081	-0.347000	0.08299	0.655000	0.94253	TCT	HHLA2	-	pfam_Ig_C1-set,pfscan_Ig-like		0.358	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHLA2	HGNC	protein_coding	OTTHUMT00000353924.1	C	NM_007072		108074109	+1	no_errors	ENST00000357759	ensembl	human	known	70_37	missense	SNP	0.000	G
HEG1	57493	genome.wustl.edu	37	3	124731854	124731854	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:124731854G>A	ENST00000311127.4	-	6	2636	c.2569C>T	c.(2569-2571)Cct>Tct	p.P857S	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	857					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						AGGGTGCCAGGAGTGGTCATA	0.502																																																	0													194.0	193.0	193.0					3																	124731854		2050	4210	6260	SO:0001583	missense	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2569C>T	3.37:g.124731854G>A	ENSP00000311502:p.Pro857Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom	p.P857S	ENST00000311127.4	37	c.2569	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	G	5.814	0.334381	0.11013	.	.	ENSG00000173706	ENST00000311127	D	0.87491	-2.26	3.92	-0.659	0.11424	.	0.647951	0.12617	U	0.453381	T	0.79511	0.4458	M	0.66939	2.045	0.09310	N	1	B;B	0.20671	0.047;0.028	B;B	0.15484	0.013;0.006	T	0.60464	-0.7258	10	0.18710	T	0.47	.	1.3373	0.02148	0.236:0.1584:0.4436:0.162	.	857;857	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	S	857	ENSP00000311502:P857S	ENSP00000311502:P857S	P	-	1	0	HEG1	126214544	0.002000	0.14202	0.000000	0.03702	0.014000	0.08584	0.038000	0.13862	-0.133000	0.11537	0.561000	0.74099	CCT	HEG1	-	NULL		0.502	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	G	XM_087386		124731854	-1	no_errors	ENST00000311127	ensembl	human	known	70_37	missense	SNP	0.000	A
HIST1H2AB	8335	genome.wustl.edu	37	6	26033405	26033405	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:26033405C>T	ENST00000259791.2	-	1	391	c.392G>A	c.(391-393)tGa>tAa	p.*131*	HIST1H3B_ENST00000244661.2_5'Flank	NM_003513.2	NP_003504.2	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	0						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GTTAACTCTTCACTTTCCCTT	0.488																																																	0													51.0	52.0	52.0					6																	26033405		2203	4300	6503	SO:0001819	synonymous_variant	8335			X00089	CCDS4574.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000137259	ENSG00000278463		"""Histones / Replication-dependent"""	4734	protein-coding gene	gene with protein product		602795	"""H2A histone family, member M"", ""histone 1, H2ab"""	H2AFM		9439656, 9119399, 12408966	Standard	NM_003513		Approved	H2A/m	uc003nft.1	P04908	OTTHUMG00000014420	ENST00000259791.2:c.392G>A	6.37:g.26033405C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	P28001|Q76P63	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.*131	ENST00000259791.2	37	c.392	CCDS4574.1	6																																																																																			HIST1H2AB	-	NULL		0.488	HIST1H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AB	HGNC	protein_coding	OTTHUMT00000040082.1	C	NM_003513		26033405	-1	no_errors	ENST00000259791	ensembl	human	known	70_37	silent	SNP	0.936	T
HIST1H1B	3009	genome.wustl.edu	37	6	27835303	27835303	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:27835303G>A	ENST00000331442.3	-	1	56	c.5C>T	c.(4-6)tCg>tTg	p.S2L		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	2					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						AGCGGTTTCCGACATGGTGGC	0.577																																																	0													16.0	19.0	18.0					6																	27835303		2034	3971	6005	SO:0001583	missense	3009			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.5C>T	6.37:g.27835303G>A	ENSP00000330074:p.Ser2Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.S2L	ENST00000331442.3	37	c.5	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078044	0.76528	.	.	ENSG00000184357	ENST00000331442	T	0.05717	3.4	5.58	5.58	0.84498	.	0.337737	0.30840	N	0.008775	T	0.01905	0.0060	N	0.08118	0	0.58432	D	0.999999	D	0.53619	0.961	B	0.35114	0.196	T	0.55412	-0.8145	10	0.87932	D	0	-20.7658	18.954	0.92650	0.0:0.0:1.0:0.0	.	2	P16401	H15_HUMAN	L	2	ENSP00000330074:S2L	ENSP00000330074:S2L	S	-	2	0	HIST1H1B	27943282	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	6.033000	0.70925	2.793000	0.96121	0.655000	0.94253	TCG	HIST1H1B	-	NULL		0.577	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	G	NM_005322		27835303	-1	no_errors	ENST00000331442	ensembl	human	known	70_37	missense	SNP	1.000	A
HIST2H2BF	440689	genome.wustl.edu	37	1	149783771	149783771	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:149783771C>G	ENST00000369167.1	-	1	143	c.108G>C	c.(106-108)gaG>gaC	p.E36D	RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000469483.1_5'UTR|HIST2H2BF_ENST00000545683.1_Missense_Mutation_p.E36D|HIST2H2BF_ENST00000427880.2_Missense_Mutation_p.E36D	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	36					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					CGGAGTAGCTCTCCTTGCGGC	0.562																																																	0													198.0	178.0	185.0					1																	149783771		2203	4298	6501	SO:0001583	missense	440689			BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.108G>C	1.37:g.149783771C>G	ENSP00000358164:p.Glu36Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0U9|B4DLA9	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E36D	ENST00000369167.1	37	c.108	CCDS30846.1	1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013476	0.54468	.	.	ENSG00000203814	ENST00000545683;ENST00000427880;ENST00000369167	T;T;T	0.22539	1.95;1.95;1.95	3.52	0.386	0.16254	Histone-fold (2);Histone core (1);	0.000000	0.48767	D	0.000168	T	0.14313	0.0346	M	0.85299	2.745	0.29779	N	0.834149	B;B;B	0.29115	0.233;0.034;0.034	B;B;B	0.35550	0.205;0.068;0.031	T	0.09930	-1.0652	10	0.72032	D	0.01	.	8.1062	0.30887	0.0:0.6919:0.0:0.3081	.	36;36;36	B4DR52;B4DLA9;Q5QNW6	.;.;H2B2F_HUMAN	D	36	ENSP00000445831:E36D;ENSP00000407461:E36D;ENSP00000358164:E36D	ENSP00000358164:E36D	E	-	3	2	HIST2H2BF	148050395	0.994000	0.37717	0.999000	0.59377	0.924000	0.55760	0.385000	0.20685	0.096000	0.17463	0.184000	0.17185	GAG	HIST2H2BF	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B		0.562	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BF	HGNC	protein_coding	OTTHUMT00000033453.2	C	NM_001024599		149783771	-1	no_errors	ENST00000427880	ensembl	human	known	70_37	missense	SNP	1.000	G
HIST2H2BF	440689	genome.wustl.edu	37	1	149783795	149783795	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:149783795C>G	ENST00000369167.1	-	1	119	c.84G>C	c.(82-84)aaG>aaC	p.K28N	RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000469483.1_5'UTR|HIST2H2BF_ENST00000545683.1_Missense_Mutation_p.K28N|HIST2H2BF_ENST00000427880.2_Missense_Mutation_p.K28N	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	28					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					GCTTGCGCTTCTTGCCGTCCT	0.562																																																	0													167.0	156.0	160.0					1																	149783795		2203	4300	6503	SO:0001583	missense	440689			BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.84G>C	1.37:g.149783795C>G	ENSP00000358164:p.Lys28Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0U9|B4DLA9	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.K28N	ENST00000369167.1	37	c.84	CCDS30846.1	1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766741	0.69878	.	.	ENSG00000203814	ENST00000545683;ENST00000427880;ENST00000369167	T;T;T	0.25085	1.82;1.82;1.82	3.52	3.52	0.40303	Histone-fold (2);	0.000000	0.50627	D	0.000108	T	0.43656	0.1257	M	0.81942	2.565	0.49798	D	0.999821	D;P;P	0.67145	0.996;0.9;0.9	D;P;P	0.68943	0.961;0.859;0.544	T	0.51896	-0.8647	10	0.87932	D	0	.	14.9173	0.70807	0.0:1.0:0.0:0.0	.	28;28;28	B4DR52;B4DLA9;Q5QNW6	.;.;H2B2F_HUMAN	N	28	ENSP00000445831:K28N;ENSP00000407461:K28N;ENSP00000358164:K28N	ENSP00000358164:K28N	K	-	3	2	HIST2H2BF	148050419	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	1.662000	0.37418	2.283000	0.76528	0.184000	0.17185	AAG	HIST2H2BF	-	superfamily_Histone-fold,smart_Histone_H2B		0.562	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BF	HGNC	protein_coding	OTTHUMT00000033453.2	C	NM_001024599		149783795	-1	no_errors	ENST00000427880	ensembl	human	known	70_37	missense	SNP	1.000	G
HSF4	3299	genome.wustl.edu	37	16	67200499	67200499	+	Silent	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:67200499G>T	ENST00000521374.1	+	6	600	c.600G>T	c.(598-600)ccG>ccT	p.P200P	HSF4_ENST00000517867.1_3'UTR|HSF4_ENST00000264009.8_Silent_p.P200P|HSF4_ENST00000421453.1_Silent_p.P200P|HSF4_ENST00000584272.1_Silent_p.P200P			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	200	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		AGGCGGGGCCGAGCAATGCAG	0.562																																																	0													55.0	62.0	60.0					16																	67200499		1937	4148	6085	SO:0001819	synonymous_variant	3299			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.600G>T	16.37:g.67200499G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q99472|Q9ULV6	Nonsense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.E181*	ENST00000521374.1	37	c.541	CCDS42175.1	16	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267815	0.59540	.	.	ENSG00000102878	ENST00000517750	.	.	.	4.43	2.47	0.30058	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.4216	6.073	0.19899	0.0:0.65:0.1672:0.1827	.	.	.	.	X	47	.	.	E	+	1	0	HSF4	65758000	0.991000	0.36638	0.325000	0.25375	0.719000	0.41307	0.321000	0.19558	0.476000	0.27440	-0.344000	0.07964	GAG	HSF4	-	NULL		0.562	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF4	HGNC	protein_coding	OTTHUMT00000375080.1	G	NM_001538		67200499	+1	no_errors	ENST00000522295	ensembl	human	known	70_37	nonsense	SNP	1.000	T
HSBP1	3281	genome.wustl.edu	37	16	83842329	83842329	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:83842329G>C	ENST00000433866.2	+	2	324	c.90G>C	c.(88-90)atG>atC	p.M30I	RP11-483P21.2_ENST00000565064.1_RNA|RP11-483P21.2_ENST00000561599.1_RNA|HSBP1_ENST00000570259.1_Missense_Mutation_p.M30I	NM_001537.3	NP_001528.1	O75506	HSBP1_HUMAN	heat shock factor binding protein 1	30					muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)						all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)		TTCAGACCATGTCTGACCAGA	0.473																																																	0													119.0	110.0	113.0					16																	83842329		1908	4140	6048	SO:0001583	missense	3281			AF068754	CCDS45534.1	16q23.3	2008-02-05				ENSG00000230989			5203	protein-coding gene	gene with protein product		604553				9649501, 9493008	Standard	NM_001537		Approved		uc002fgy.2	O75506		ENST00000433866.2:c.90G>C	16.37:g.83842329G>C	ENSP00000392896:p.Met30Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XA8|Q7Z5Z3	Missense_Mutation	SNP	pfam_HS1-bd	p.M30I	ENST00000433866.2	37	c.90	CCDS45534.1	16	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259432	0.80246	.	.	ENSG00000230989	ENST00000433866	.	.	.	5.35	5.35	0.76521	Four-helical cytokine, core (1);	0.037784	0.85682	N	0.000000	T	0.64994	0.2649	.	.	.	0.80722	D	1	B	0.12630	0.006	B	0.26416	0.069	T	0.62548	-0.6831	8	0.62326	D	0.03	-12.9709	18.0389	0.89313	0.0:0.0:1.0:0.0	.	30	O75506	HSBP1_HUMAN	I	30	.	ENSP00000392896:M30I	M	+	3	0	HSBP1	82399830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.625000	0.90965	2.668000	0.90789	0.563000	0.77884	ATG	HSBP1	-	pfam_HS1-bd		0.473	HSBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSBP1	HGNC	protein_coding	OTTHUMT00000433004.1	G	NM_001537		83842329	+1	no_errors	ENST00000433866	ensembl	human	known	70_37	missense	SNP	1.000	C
HTT	3064	genome.wustl.edu	37	4	3213737	3213737	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:3213737G>A	ENST00000355072.5	+	48	6641	c.6496G>A	c.(6496-6498)Gaa>Aaa	p.E2166K		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2166					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TGCCCTTTTTGAAGCAGCCCG	0.562																																																	0													76.0	80.0	79.0					4																	3213737		1968	4170	6138	SO:0001583	missense	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.6496G>A	4.37:g.3213737G>A	ENSP00000347184:p.Glu2166Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.E2166K	ENST00000355072.5	37	c.6496	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325296	0.41197	.	.	ENSG00000197386	ENST00000355072	T	0.05081	3.5	5.73	4.89	0.63831	.	0.108238	0.64402	N	0.000007	T	0.04363	0.0120	N	0.24115	0.695	0.45150	D	0.998162	B	0.16166	0.016	B	0.13407	0.009	T	0.29212	-1.0019	10	0.07990	T	0.79	.	10.8113	0.46549	0.1439:0.0:0.8561:0.0	.	2166	P42858	HD_HUMAN	K	2166	ENSP00000347184:E2166K	ENSP00000347184:E2166K	E	+	1	0	HTT	3183535	1.000000	0.71417	0.553000	0.28255	0.729000	0.41735	6.244000	0.72391	1.421000	0.47157	0.655000	0.94253	GAA	HTT	-	NULL		0.562	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	G	NM_002111		3213737	+1	no_errors	ENST00000355072	ensembl	human	known	70_37	missense	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53589158	53589158	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:53589158C>A	ENST00000342160.3	-	53	7709	c.7252G>T	c.(7252-7254)Gaa>Taa	p.E2418*	HUWE1_ENST00000262854.6_Nonsense_Mutation_p.E2418*			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2418	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTGTCCTCTTCCTGAGTGTGC	0.502																																																	0													163.0	100.0	121.0					X																	53589158		2203	4300	6503	SO:0001587	stop_gained	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7252G>T	X.37:g.53589158C>A	ENSP00000340648:p.Glu2418*	Somatic		WXS	Illumina HiSeq	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Nonsense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.E2418*	ENST00000342160.3	37	c.7252	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	51|51	17.458541|17.458541	0.99887|0.99887	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	.|.	.|.	.|.	4.93|4.93	4.93|4.93	0.64822|0.64822	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.71451	.|0.3341	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74734	.|-0.3565	.|3	0.66056|.	D|.	0.02|.	.|.	16.1977|16.1977	0.82042|0.82042	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	2418|1451	.|.	ENSP00000262854:E2418X|.	E|G	-|-	1|2	0|0	HUWE1|HUWE1	53605883|53605883	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.680000|6.680000	0.74518|0.74518	2.164000|2.164000	0.68074|0.68074	0.513000|0.513000	0.50165|0.50165	GAA|GGA	HUWE1	-	NULL		0.502	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	C	XM_497119		53589158	-1	no_errors	ENST00000262854	ensembl	human	known	70_37	nonsense	SNP	1.000	A
IER2	9592	genome.wustl.edu	37	19	13264244	13264244	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:13264244G>C	ENST00000588173.1	+	1	1456	c.244G>C	c.(244-246)Gag>Cag	p.E82Q	CTC-250I14.6_ENST00000592882.1_RNA|IER2_ENST00000292433.3_Missense_Mutation_p.E82Q|IER2_ENST00000587885.1_Missense_Mutation_p.E82Q|CTC-250I14.6_ENST00000586483.1_RNA			Q9BTL4	IER2_HUMAN	immediate early response 2	82						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GTCCACGGCCGAGACAGCGAC	0.736											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													6.0	6.0	6.0					19																	13264244		2080	4105	6185	SO:0001583	missense	9592			M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.244G>C	19.37:g.13264244G>C	ENSP00000465617:p.Glu82Gln	Somatic	686	WXS	Illumina HiSeq	Phase_IV	Q03827|Q2TAZ2	Missense_Mutation	SNP	pfam_IER	p.E82Q	ENST00000588173.1	37	c.244	CCDS12295.1	19	.	.	.	.	.	.	.	.	.	.	G	6.097	0.386216	0.11524	.	.	ENSG00000160888	ENST00000292433	T	0.09723	2.95	4.38	2.19	0.27852	.	2.461570	0.02260	N	0.067478	T	0.13970	0.0338	L	0.54323	1.7	0.09310	N	1	B	0.19445	0.036	B	0.24974	0.057	T	0.37820	-0.9689	10	0.21014	T	0.42	-0.1883	7.3688	0.26790	0.102:0.1934:0.7046:0.0	.	82	Q9BTL4	IER2_HUMAN	Q	82	ENSP00000292433:E82Q	ENSP00000292433:E82Q	E	+	1	0	IER2	13125244	0.007000	0.16637	0.004000	0.12327	0.054000	0.15201	0.578000	0.23773	0.309000	0.22966	0.462000	0.41574	GAG	IER2	-	pfam_IER		0.736	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IER2	HGNC	protein_coding	OTTHUMT00000453033.1	G	NM_004907		13264244	+1	no_errors	ENST00000292433	ensembl	human	known	70_37	missense	SNP	0.052	C
IGF2R	3482	genome.wustl.edu	37	6	160431704	160431705	+	Intron	INS	-	-	T	rs8191741|rs3215571	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:160431704_160431705insT	ENST00000356956.1	+	4	562					NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor						insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TATAATTACTATTTTTTTTTAA	0.347													TTTTTTTTT|TTTTTTTTT|TTTTTTTTTT|insertion	74	0.0147764	0.0386	0.0029	5008	,	,		18894	0.0179		0.003	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	3482			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.415-14->T	6.37:g.160431713_160431713dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z7G9|Q96PT5	RNA	INS	-	NULL	ENST00000356956.1	37	NULL	CCDS5273.1	6																																																																																			IGF2R	-	-		0.347	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	NM_000876		160431705	+1	no_errors	ENST00000464636	ensembl	human	known	70_37	rna	INS	0.002:0.002	T
IMPG2	50939	genome.wustl.edu	37	3	100976541	100976541	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:100976541G>A	ENST00000193391.7	-	10	1172	c.985C>T	c.(985-987)Cac>Tac	p.H329Y		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	329	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TTGTTGGAGTGAAGGCTAATG	0.433																																																	0													139.0	131.0	134.0					3																	100976541		2203	4300	6503	SO:0001583	missense	50939			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.985C>T	3.37:g.100976541G>A	ENSP00000193391:p.His329Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.H329Y	ENST00000193391.7	37	c.985	CCDS2940.1	3	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259453	0.80246	.	.	ENSG00000081148	ENST00000193391	T	0.32023	1.47	5.38	5.38	0.77491	SEA (2);	0.085634	0.50627	D	0.000118	T	0.52885	0.1762	L	0.59436	1.845	0.41702	D	0.989404	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.977	T	0.54159	-0.8335	10	0.66056	D	0.02	-8.5083	17.3142	0.87218	0.0:0.0:1.0:0.0	.	329;329	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	Y	329	ENSP00000193391:H329Y	ENSP00000193391:H329Y	H	-	1	0	IMPG2	102459231	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.728000	0.62000	2.522000	0.85027	0.313000	0.20887	CAC	IMPG2	-	pfam_SEA,smart_SEA		0.433	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	G			100976541	-1	no_errors	ENST00000193391	ensembl	human	known	70_37	missense	SNP	1.000	A
INO80	54617	genome.wustl.edu	37	15	41371977	41371977	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:41371977C>G	ENST00000361937.3	-	9	1477	c.1053G>C	c.(1051-1053)gaG>gaC	p.E351D	INO80_ENST00000401393.3_Missense_Mutation_p.E351D			Q9ULG1	INO80_HUMAN	INO80 complex subunit	351	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.|DBINO. {ECO:0000255|PROSITE- ProRule:PRU00746}.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCTCTACTTTCTCATATTTCT	0.522																																																	0													198.0	206.0	203.0					15																	41371977		2203	4300	6503	SO:0001583	missense	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.1053G>C	15.37:g.41371977C>G	ENSP00000355205:p.Glu351Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X4|Q9NTG6	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E351D	ENST00000361937.3	37	c.1053	CCDS10071.1	15	.	.	.	.	.	.	.	.	.	.	C	7.305	0.613913	0.14066	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.92446	-3.04;-3.04	4.91	1.39	0.22231	DNA binding domain, INO80 (1);	0.056629	0.64402	D	0.000001	D	0.84306	0.5443	L	0.35414	1.06	0.43403	D	0.99553	B	0.11235	0.004	B	0.14023	0.01	T	0.73902	-0.3836	10	0.29301	T	0.29	.	7.2298	0.26036	0.0:0.5561:0.0:0.4439	.	351	Q9ULG1	INO80_HUMAN	D	351	ENSP00000355205:E351D;ENSP00000384686:E351D	ENSP00000355205:E351D	E	-	3	2	INO80	39159269	1.000000	0.71417	1.000000	0.80357	0.326000	0.28443	1.121000	0.31283	0.499000	0.27970	-0.444000	0.05651	GAG	INO80	-	NULL		0.522	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	HGNC	protein_coding	OTTHUMT00000252527.2	C	NM_017553		41371977	-1	no_errors	ENST00000361937	ensembl	human	known	70_37	missense	SNP	1.000	G
IQCG	84223	genome.wustl.edu	37	3	197639564	197639564	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:197639564G>A	ENST00000265239.6	-	9	1369	c.945C>T	c.(943-945)ttC>ttT	p.F315F	IQCG_ENST00000455191.1_Silent_p.F315F	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	315						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CCTTTCTAAGGAACATTTCAA	0.428																																																	0													176.0	190.0	186.0					3																	197639564		2203	4300	6503	SO:0001819	synonymous_variant	84223			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.945C>T	3.37:g.197639564G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BST2|Q9HAG8	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.F315	ENST00000265239.6	37	c.945	CCDS3331.1	3																																																																																			IQCG	-	NULL		0.428	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	G	NM_032263		197639564	-1	no_errors	ENST00000265239	ensembl	human	known	70_37	silent	SNP	1.000	A
IQGAP1	8826	genome.wustl.edu	37	15	91009278	91009278	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:91009278G>C	ENST00000268182.5	+	16	1946	c.1822G>C	c.(1822-1824)Ggt>Cgt	p.G608R	IQGAP1_ENST00000560738.1_Splice_Site	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	608					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGAAATTCAAGGTGGAATCTG	0.403																																																	0													157.0	154.0	155.0					15																	91009278		2198	4298	6496	SO:0001583	missense	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1822G>C	15.37:g.91009278G>C	ENSP00000268182:p.Gly608Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MBM3	Splice_Site	SNP	-	e3-1	ENST00000268182.5	37	c.107-1	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241484	0.79912	.	.	ENSG00000140575	ENST00000268182	T	0.07444	3.19	5.38	4.45	0.53987	.	0.117947	0.56097	D	0.000037	T	0.07638	0.0192	L	0.34521	1.04	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.27400	-1.0075	10	0.22109	T	0.4	-14.0425	13.6583	0.62352	0.0754:0.0:0.9246:0.0	.	608	P46940	IQGA1_HUMAN	R	608	ENSP00000268182:G608R	ENSP00000268182:G608R	G	+	1	0	IQGAP1	88810282	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.685000	0.84117	2.808000	0.96608	0.655000	0.94253	GGT	IQGAP1	-	-		0.403	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	G	NM_003870		91009278	+1	no_errors	ENST00000560738	ensembl	human	novel	70_37	splice_site	SNP	1.000	C
ISY1	57461	genome.wustl.edu	37	3	128852970	128852970	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:128852970C>T	ENST00000393295.3	-	9	927	c.610G>A	c.(610-612)Gag>Aag	p.E204K	ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.E204K|ISY1_ENST00000273541.8_Missense_Mutation_p.E226K|ISY1_ENST00000471497.1_Intron|ISY1_ENST00000393292.3_Missense_Mutation_p.R205K	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	204	Poly-Glu.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						tcctcctcctcttcctTTTCT	0.522																																																	0													116.0	119.0	118.0					3																	128852970		2020	4186	6206	SO:0001583	missense	57461				CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.610G>A	3.37:g.128852970C>T	ENSP00000376973:p.Glu204Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96IL2|Q9BT05	Missense_Mutation	SNP	pfam_Isy1	p.E226K	ENST00000393295.3	37	c.676	CCDS43149.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.33|18.33	3.600560|3.600560	0.66332|0.66332	.|.	.|.	ENSG00000240682|ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541|ENST00000393292	T|.	0.29917|.	1.55|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.171608|.	0.36519|.	N|.	0.002543|.	T|T	0.21145|0.21145	0.0509|0.0509	N|N	0.03608|0.03608	-0.345|-0.345	0.20489|0.20489	N|N	0.999891|0.999891	B;B;B|.	0.28933|.	0.228;0.009;0.005|.	B;B;B|.	0.27796|.	0.083;0.022;0.004|.	T|T	0.18241|0.18241	-1.0343|-1.0343	10|5	0.07030|.	T|.	0.85|.	.|.	15.1929|15.1929	0.73060|0.73060	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	226;204;204|.	Q9ULR0-2;Q9ULR0;Q9ULR0-1|.	.;ISY1_HUMAN;.|.	K|K	204;204;226|205	ENSP00000273541:E226K|.	ENSP00000273541:E226K|.	E|R	-|-	1|2	0|0	ISY1|ISY1	130335660|130335660	0.979000|0.979000	0.34478|0.34478	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.417000|2.417000	0.44653|0.44653	2.650000|2.650000	0.89964|0.89964	0.585000|0.585000	0.79938|0.79938	GAG|AGA	ISY1	-	pfam_Isy1		0.522	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISY1	HGNC	protein_coding	OTTHUMT00000267856.1	C	NM_020701		128852970	-1	no_errors	ENST00000273541	ensembl	human	known	70_37	missense	SNP	1.000	T
ITGB5	3693	genome.wustl.edu	37	3	124567329	124567329	+	Silent	SNP	G	G	C	rs145464711		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:124567329G>C	ENST00000296181.4	-	4	734	c.438C>G	c.(436-438)ctC>ctG	p.L146L		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	146	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TGGACAGGGAGAGGTCCATCA	0.562																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	117.0	101.0	106.0		438	4.6	1.0	3	dbSNP_134	106	0,8600		0,0,4300	no	coding-synonymous	ITGB5	NM_002213.3		0,1,6502	CC,CG,GG		0.0,0.0227,0.0077		146/800	124567329	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3693			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.438C>G	3.37:g.124567329G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B0LPF8|B2RD70	Silent	SNP	pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_VWF_A,pirsf_Integrin_bsu,prints_Integrin_bsu	p.L146	ENST00000296181.4	37	c.438	CCDS3030.1	3																																																																																			ITGB5	-	pfam_Integrin_bsu_N,smart_Integrin_bsu_N,smart_VWF_A,pirsf_Integrin_bsu,prints_Integrin_bsu		0.562	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3	G	NM_002213		124567329	-1	no_errors	ENST00000296181	ensembl	human	known	70_37	silent	SNP	1.000	C
ISY1	57461	genome.wustl.edu	37	3	128853782	128853782	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:128853782C>G	ENST00000393295.3	-	8	751	c.434G>C	c.(433-435)aGa>aCa	p.R145T	ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.R145T|ISY1_ENST00000273541.8_Missense_Mutation_p.R167T|ISY1_ENST00000471497.1_Intron|ISY1_ENST00000393292.3_Missense_Mutation_p.R145T	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	145					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						ACGTGTCTTTCTGGGAGGAGG	0.433																																																	0													99.0	97.0	98.0					3																	128853782		1971	4171	6142	SO:0001583	missense	57461				CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.434G>C	3.37:g.128853782C>G	ENSP00000376973:p.Arg145Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96IL2|Q9BT05	Missense_Mutation	SNP	pfam_Isy1	p.R167T	ENST00000393295.3	37	c.500	CCDS43149.1	3	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660695	0.88154	.	.	ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541;ENST00000496163;ENST00000393292	T	0.39787	1.06	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.70509	0.3232	M	0.90977	3.165	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.78314	0.986;0.988;0.991	T	0.77566	-0.2540	10	0.72032	D	0.01	.	14.1518	0.65389	0.0:1.0:0.0:0.0	.	167;145;145	Q9ULR0-2;Q9ULR0;Q9ULR0-1	.;ISY1_HUMAN;.	T	145;145;167;83;145	ENSP00000273541:R167T	ENSP00000273541:R167T	R	-	2	0	ISY1	130336472	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.816000	0.75247	2.466000	0.83321	0.467000	0.42956	AGA	ISY1	-	pfam_Isy1		0.433	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISY1	HGNC	protein_coding	OTTHUMT00000267856.1	C	NM_020701		128853782	-1	no_errors	ENST00000273541	ensembl	human	known	70_37	missense	SNP	1.000	G
ITPR3	3710	genome.wustl.edu	37	6	33632874	33632874	+	Silent	SNP	C	C	T	rs373612197		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:33632874C>T	ENST00000374316.5	+	14	2353	c.1293C>T	c.(1291-1293)atC>atT	p.I431I	ITPR3_ENST00000605930.1_Silent_p.I431I			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	431	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCTTTGCCATCGTGTCAGTGC	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17039	0.0		0.0	False		,,,				2504	0.001																0								C		1,4405	2.1+/-5.4	0,1,2202	86.0	82.0	84.0		1293	-5.8	0.9	6		84	0,8600		0,0,4300	no	coding-synonymous	ITPR3	NM_002224.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		431/2672	33632874	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1293C>T	6.37:g.33632874C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14649|Q5TAQ2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.I431	ENST00000374316.5	37	c.1293	CCDS4783.1	6																																																																																			ITPR3	-	pfam_MIR_motif,superfamily_MIR_motif,prints_InsP3_rcpt-bd		0.627	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	C	NM_002224		33632874	+1	no_errors	ENST00000374316	ensembl	human	known	70_37	silent	SNP	0.840	T
KAT6B	23522	genome.wustl.edu	37	10	76781645	76781645	+	Missense_Mutation	SNP	C	C	T	rs142309185		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:76781645C>T	ENST00000287239.4	+	16	3517	c.3028C>T	c.(3028-3030)Cgg>Tgg	p.R1010W	KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372711.1_Missense_Mutation_p.R827W|KAT6B_ENST00000372724.1_Missense_Mutation_p.R718W|KAT6B_ENST00000372714.1_Missense_Mutation_p.R718W|RP11-77G23.2_ENST00000413431.1_RNA|KAT6B_ENST00000372725.1_Missense_Mutation_p.R718W|RP11-77G23.5_ENST00000436608.1_RNA	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1010					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTAGGCTGAGCGGCTAATGGA	0.488											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0008	0.0	5008	,	,		20455	0.0		0.0	False		,,,				2504	0.0																0								C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	56.0	56.0	56.0		3028	5.1	1.0	10	dbSNP_134	56	0,8600		0,0,4300	no	missense	KAT6B	NM_012330.2	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	1010/2074	76781645	2,13004	2203	4300	6503	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3028C>T	10.37:g.76781645C>T	ENSP00000287239:p.Arg1010Trp	Somatic	1170	WXS	Illumina HiSeq	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R1010W	ENST00000287239.4	37	c.3028	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380741	0.42207	4.54E-4	0.0	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	T;T;T;T;T	0.78816	2.09;2.09;1.95;2.09;-1.21	5.98	5.06	0.68205	.	0.146450	0.31566	N	0.007425	D	0.83243	0.5212	L	0.42245	1.32	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.69479	0.964;0.855;0.952	D	0.84821	0.0796	10	0.66056	D	0.02	-10.3217	14.7477	0.69501	0.1448:0.8552:0.0:0.0	.	827;718;1010	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	W	718;718;1010;718;827	ENSP00000361810:R718W;ENSP00000361809:R718W;ENSP00000287239:R1010W;ENSP00000361799:R718W;ENSP00000361796:R827W	ENSP00000287239:R1010W	R	+	1	2	KAT6B	76451651	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.078000	0.64425	1.490000	0.48466	0.655000	0.94253	CGG	KAT6B	-	NULL		0.488	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	C	NM_012330		76781645	+1	no_errors	ENST00000287239	ensembl	human	known	70_37	missense	SNP	1.000	T
ITPRIP	85450	genome.wustl.edu	37	10	106075739	106075739	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:106075739G>A	ENST00000337478.1	-	2	242	c.71C>T	c.(70-72)cCg>cTg	p.P24L	ITPRIP_ENST00000358187.2_Missense_Mutation_p.P24L|RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.P24L	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	24						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						GTTCTCCCGCGGGAACAGCAG	0.622																																																	0													59.0	54.0	56.0					10																	106075739		2203	4300	6503	SO:0001583	missense	85450			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.71C>T	10.37:g.106075739G>A	ENSP00000337178:p.Pro24Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	NULL	p.P24L	ENST00000337478.1	37	c.71	CCDS7557.1	10	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206818	0.79127	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187;ENST00000458723	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.65	5.65	0.86999	.	0.059746	0.64402	D	0.000002	T	0.17874	0.0429	L	0.36672	1.1	0.80722	D	1	D	0.63046	0.992	P	0.50136	0.632	T	0.00199	-1.1928	10	0.87932	D	0	-12.3858	19.724	0.96154	0.0:0.0:1.0:0.0	.	24	Q8IWB1	IPRI_HUMAN	L	24	ENSP00000337178:P24L;ENSP00000278071:P24L;ENSP00000350915:P24L;ENSP00000414141:P24L	ENSP00000278071:P24L	P	-	2	0	ITPRIP	106065729	1.000000	0.71417	0.958000	0.39756	0.769000	0.43574	7.519000	0.81809	2.648000	0.89879	0.563000	0.77884	CCG	ITPRIP	-	NULL		0.622	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPRIP	HGNC	protein_coding	OTTHUMT00000050204.1	G	NM_033397		106075739	-1	no_errors	ENST00000278071	ensembl	human	known	70_37	missense	SNP	1.000	A
KDM2B	84678	genome.wustl.edu	37	12	121868153	121868153	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:121868153C>T	ENST00000377071.4	-	23	4021	c.3949G>A	c.(3949-3951)Gag>Aag	p.E1317K	RNF34_ENST00000392464.2_Silent_p.L460L|KDM2B_ENST00000536437.1_3'UTR|KDM2B_ENST00000542973.1_Missense_Mutation_p.E685K|KDM2B_ENST00000377069.4_Missense_Mutation_p.E1248K	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1317					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						ACAGACATCTCGGCTATGAAC	0.478																																																	0													144.0	138.0	140.0					12																	121868153		1950	4151	6101	SO:0001583	missense	84678			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3949G>A	12.37:g.121868153C>T	ENSP00000366271:p.Glu1317Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E1317K	ENST00000377071.4	37	c.3949	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	C	21.4	4.149306	0.78001	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043	T;T;T	0.23348	2.21;2.56;1.91	5.61	2.8	0.32819	.	0.000000	0.53938	D	0.000057	T	0.41558	0.1164	M	0.62723	1.935	0.80722	D	1	B;B;D;B	0.89917	0.112;0.036;1.0;0.112	B;B;D;B	0.75484	0.038;0.008;0.986;0.038	T	0.10847	-1.0612	10	0.24483	T	0.36	-11.3955	9.0499	0.36369	0.0:0.7441:0.1221:0.1337	.	757;1317;1248;760	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	K	1307;685;1248;1317;760	ENSP00000437821:E685K;ENSP00000366269:E1248K;ENSP00000366271:E1317K	ENSP00000366269:E1248K	E	-	1	0	KDM2B	120352536	1.000000	0.71417	0.925000	0.36789	0.943000	0.58893	7.770000	0.85390	0.320000	0.23234	-0.878000	0.02970	GAG	KDM2B	-	smart_Leu-rich_rpt_Cys-con_subtyp		0.478	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	C	NM_032590		121868153	-1	no_errors	ENST00000377071	ensembl	human	known	70_37	missense	SNP	0.993	T
CEMIP	57214	genome.wustl.edu	37	15	81234256	81234256	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:81234256C>G	ENST00000394685.3	+	26	3893	c.3474C>G	c.(3472-3474)ggC>ggG	p.G1158G	KIAA1199_ENST00000356249.5_Silent_p.G1158G|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.G1158G			Q8WUJ3	CEMIP_HUMAN		1158					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CCATGAAAGGCTGTGAGAGGA	0.502																																																	0													75.0	76.0	76.0					15																	81234256		2203	4300	6503	SO:0001819	synonymous_variant	57214																														ENST00000394685.3:c.3474C>G	15.37:g.81234256C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.G1158	ENST00000394685.3	37	c.3474	CCDS10315.1	15																																																																																			KIAA1199	-	NULL		0.502	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	C			81234256	+1	no_errors	ENST00000220244	ensembl	human	known	70_37	silent	SNP	1.000	G
KIAA1429	25962	genome.wustl.edu	37	8	95522724	95522724	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:95522724G>T	ENST00000297591.5	-	14	3622	c.3547C>A	c.(3547-3549)Caa>Aaa	p.Q1183K	KIAA1429_ENST00000523405.1_Intron|KIAA1429_ENST00000437199.1_Missense_Mutation_p.Q1183K	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1183				Q -> E (in Ref. 1; CAB55922). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TCACACAATTGAACACAAATA	0.408																																																	0													121.0	107.0	112.0					8																	95522724		2203	4300	6503	SO:0001583	missense	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.3547C>A	8.37:g.95522724G>T	ENSP00000297591:p.Gln1183Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q1183K	ENST00000297591.5	37	c.3547	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377154	0.82682	.	.	ENSG00000164944	ENST00000297591;ENST00000437199	T;T	0.65364	-0.15;-0.15	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.79399	0.4439	M	0.72118	2.19	0.80722	D	1	P	0.52577	0.954	D	0.67900	0.954	T	0.79436	-0.1804	10	0.62326	D	0.03	-13.9752	19.9405	0.97159	0.0:0.0:1.0:0.0	.	1183	Q69YN4	VIR_HUMAN	K	1183	ENSP00000297591:Q1183K;ENSP00000395600:Q1183K	ENSP00000297591:Q1183K	Q	-	1	0	KIAA1429	95591900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.167000	0.94773	2.716000	0.92895	0.650000	0.86243	CAA	KIAA1429	-	NULL		0.408	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	G	NM_015496		95522724	-1	no_errors	ENST00000297591	ensembl	human	known	70_37	missense	SNP	1.000	T
KIF26B	55083	genome.wustl.edu	37	1	245851198	245851198	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:245851198C>A	ENST00000407071.2	+	12	5353	c.4913C>A	c.(4912-4914)cCa>cAa	p.P1638Q	KIF26B_ENST00000366518.4_Missense_Mutation_p.P1257Q	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1638					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGGGCCTCCCAGACGAGCCT	0.677																																																	0													7.0	11.0	10.0					1																	245851198		1922	4117	6039	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4913C>A	1.37:g.245851198C>A	ENSP00000385545:p.Pro1638Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P1638Q	ENST00000407071.2	37	c.4913	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	5.548	0.285967	0.10513	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.76186	-1.0;-1.0	5.52	3.63	0.41609	.	.	.	.	.	T	0.68504	0.3008	M	0.63428	1.95	0.33503	D	0.590133	B;B	0.10296	0.003;0.003	B;B	0.09377	0.004;0.002	T	0.67019	-0.5776	9	0.23891	T	0.37	.	10.3788	0.44099	0.1352:0.7948:0.0:0.0699	.	1257;1638	B7WPD9;Q2KJY2	.;KI26B_HUMAN	Q	1638;1257;1254	ENSP00000385545:P1638Q;ENSP00000355475:P1257Q	ENSP00000355475:P1257Q	P	+	2	0	KIF26B	243917821	0.440000	0.25618	0.589000	0.28718	0.084000	0.17831	3.214000	0.51161	0.676000	0.31285	0.561000	0.74099	CCA	KIF26B	-	NULL		0.677	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	C	XM_371354		245851198	+1	no_errors	ENST00000407071	ensembl	human	known	70_37	missense	SNP	0.828	A
KIR3DL1	3811	genome.wustl.edu	37	19	55284986	55284986	+	Intron	SNP	C	C	T	rs687485	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:55284986C>T	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL3_ENST00000434419.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.T91M|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.T91M			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGTCGCATGACGCAAGACCTG	0.532																																																	0													280.0	243.0	256.0					19																	55284986		2172	4212	6384	SO:0001627	intron_variant	3802			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-44003C>T	19.37:g.55284986C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.T91M	ENST00000538269.1	37	c.272		19	.	.	.	.	.	.	.	.	.	.	C	0.414	-0.911548	0.02434	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.28666	1.6;1.6	1.24	0.116	0.14647	.	.	.	.	.	T	0.11153	0.0272	N	0.02973	-0.45	0.09310	N	1	P;P	0.42993	0.765;0.797	B;B	0.44163	0.322;0.443	T	0.10064	-1.0646	9	0.07813	T	0.8	.	3.815	0.08812	0.0:0.7435:0.0:0.2565	rs687485;rs17173097	91;91	Q6IST4;Q6H2H3	.;.	M	91	ENSP00000336769:T91M;ENSP00000291633:T91M	ENSP00000291633:T91M	T	+	2	0	KIR2DL1	59976798	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-1.126000	0.03254	0.106000	0.17784	-0.552000	0.04208	ACG	KIR2DL1	-	pfam_Immunoglobulin,smart_Ig_sub		0.532	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	HGNC	protein_coding		C	NM_013289		55284986	+1	no_errors	ENST00000336077	ensembl	human	known	70_37	missense	SNP	0.005	T
KLHDC8B	200942	genome.wustl.edu	37	3	49212502	49212502	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:49212502G>A	ENST00000332780.2	+	5	983	c.774G>A	c.(772-774)tgG>tgA	p.W258*	C3orf84_ENST00000443990.1_5'Flank	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	258						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CAGGGTCCTGGACCAAATTGC	0.597																																																	0													68.0	64.0	66.0					3																	49212502		2203	4300	6503	SO:0001587	stop_gained	200942				CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.774G>A	3.37:g.49212502G>A	ENSP00000327468:p.Trp258*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.W258*	ENST00000332780.2	37	c.774	CCDS2791.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.167200	0.97343	.	.	ENSG00000185909	ENST00000332780;ENST00000538729	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.5185	17.5839	0.87976	0.0:0.0:1.0:0.0	.	.	.	.	X	258;9	.	ENSP00000327468:W258X	W	+	3	0	KLHDC8B	49187506	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.455000	0.90355	2.837000	0.97791	0.655000	0.94253	TGG	KLHDC8B	-	pfam_Kelch_1,smart_Kelch_1		0.597	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC8B	HGNC	protein_coding	OTTHUMT00000345974.1	G	NM_173546		49212502	+1	no_errors	ENST00000332780	ensembl	human	known	70_37	nonsense	SNP	1.000	A
LANCL3	347404	genome.wustl.edu	37	X	37431657	37431657	+	Silent	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:37431657G>C	ENST00000378619.3	+	1	753	c.534G>C	c.(532-534)ctG>ctC	p.L178L	LANCL3_ENST00000378621.3_Silent_p.L178L|TM4SF2_ENST00000465127.1_Intron	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	178							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						CGGGTTACCTGTGTGCCGCGC	0.711																																																	0													4.0	5.0	5.0					X																	37431657		2097	4071	6168	SO:0001819	synonymous_variant	347404			AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.534G>C	X.37:g.37431657G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHE3	Silent	SNP	pfam_LANC-like,superfamily_6-hairpin_glycosidase-like,prints_LANC-like,prints_LanC-like_prot_euk	p.L178	ENST00000378619.3	37	c.534	CCDS55398.1	X																																																																																			LANCL3	-	pfam_LANC-like,prints_LANC-like		0.711	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LANCL3	HGNC	protein_coding	OTTHUMT00000080885.1	G	NM_198511		37431657	+1	no_errors	ENST00000378619	ensembl	human	known	70_37	silent	SNP	1.000	C
LEKR1	389170	genome.wustl.edu	37	3	156570671	156570671	+	5'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:156570671C>T	ENST00000470811.1	+	0	277				LEKR1_ENST00000498839.1_Nonsense_Mutation_p.Q55*|LEKR1_ENST00000356539.4_Nonsense_Mutation_p.Q55*|LEKR1_ENST00000483177.1_Nonsense_Mutation_p.Q55*|LEKR1_ENST00000477399.1_Nonsense_Mutation_p.Q55*|LEKR1_ENST00000489350.1_Intron|LEKR1_ENST00000491763.1_Nonsense_Mutation_p.Q55*			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1											breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GAAATTTTATCAAGGAAGTGT	0.333																																																	0													162.0	131.0	140.0					3																	156570671		692	1591	2283	SO:0001623	5_prime_UTR_variant	389170			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.-1059C>T	3.37:g.156570671C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	superfamily_Ribosomal_L29	p.Q55*	ENST00000470811.1	37	c.163		3	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874558	0.72180	.	.	ENSG00000197980;ENSG00000197980;ENSG00000197980;ENSG00000178110	ENST00000498839;ENST00000483177;ENST00000477399;ENST00000356539	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.8205	11.3823	0.49766	0.1254:0.6829:0.1917:0.0	.	.	.	.	X	55	.	.	Q	+	1	0	RP11-6F2.7;LEKR1	158053365	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.202000	0.51067	2.592000	0.87571	0.585000	0.79938	CAA	LEKR1	-	NULL		0.333	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	C	NM_001004316		156570671	+1	no_errors	ENST00000356539	ensembl	human	known	70_37	nonsense	SNP	1.000	T
LIG3	3980	genome.wustl.edu	37	17	33318723	33318723	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:33318723G>A	ENST00000378526.4	+	6	1208	c.1075G>A	c.(1075-1077)Gag>Aag	p.E359K	LIG3_ENST00000262327.5_Missense_Mutation_p.E359K	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	359					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	AGTCTTCTTTGAGCAGAGCAA	0.537								Other BER factors																																									0													101.0	90.0	94.0					17																	33318723		2203	4300	6503	SO:0001583	missense	3980				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1075G>A	17.37:g.33318723G>A	ENSP00000367787:p.Glu359Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.E359K	ENST00000378526.4	37	c.1075	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770802	0.69992	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.16196	2.36;2.36	5.5	5.5	0.81552	DNA ligase, ATP-dependent, N-terminal (3);	0.097921	0.64402	D	0.000001	T	0.16642	0.0400	L	0.42632	1.34	0.80722	D	1	B;B;B	0.33583	0.418;0.418;0.242	B;B;B	0.32393	0.145;0.145;0.145	T	0.04946	-1.0916	10	0.13853	T	0.58	-31.9864	18.5685	0.91126	0.0:0.0:1.0:0.0	.	359;359;359	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	K	359	ENSP00000367787:E359K;ENSP00000262327:E359K	ENSP00000262327:E359K	E	+	1	0	LIG3	30342836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.419000	0.97397	2.861000	0.98227	0.655000	0.94253	GAG	LIG3	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep		0.537	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	G	NM_013975		33318723	+1	no_errors	ENST00000378526	ensembl	human	known	70_37	missense	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76379796	76379796	+	Missense_Mutation	SNP	G	G	C	rs149414620		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr13:76379796G>C	ENST00000321797.8	+	7	1118	c.397G>C	c.(397-399)Gat>Cat	p.D133H	LMO7_ENST00000357063.3_Missense_Mutation_p.D418H|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000377534.3_Missense_Mutation_p.D418H|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.D133H			Q8WWI1	LMO7_HUMAN	LIM domain 7	418	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GAATGCTTTTGATCAGTTTCT	0.403																																																	0													312.0	286.0	294.0					13																	76379796		1568	3582	5150	SO:0001583	missense	4008			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.397G>C	13.37:g.76379796G>C	ENSP00000317802:p.Asp133His	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.D418H	ENST00000321797.8	37	c.1252		13	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226744	0.39399	.	.	ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526371	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.93	5.08	0.68730	.	0.113535	0.64402	D	0.000017	T	0.32224	0.0822	M	0.64997	1.995	0.45747	D	0.998649	P	0.38745	0.645	B	0.29440	0.102	T	0.25257	-1.0137	10	0.87932	D	0	-18.3322	11.2819	0.49199	0.0684:0.1277:0.8039:0.0	.	133	E9PLH4	.	H	418;418;133;133;133	ENSP00000349571:D418H;ENSP00000366757:D418H;ENSP00000317802:D133H;ENSP00000433352:D133H;ENSP00000432269:D133H	ENSP00000317802:D133H	D	+	1	0	LMO7	75277797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.995000	0.57001	1.506000	0.48736	0.563000	0.77884	GAT	LMO7	-	NULL		0.403	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045301.3	G	NM_005358		76379796	+1	no_errors	ENST00000357063	ensembl	human	known	70_37	missense	SNP	1.000	C
LRIG2	9860	genome.wustl.edu	37	1	113657443	113657443	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:113657443C>T	ENST00000361127.5	+	15	2673	c.2475C>T	c.(2473-2475)gtC>gtT	p.V825V	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	825					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGATCTGGGTCATTGTTATTT	0.433																																																	0													196.0	139.0	158.0					1																	113657443		2203	4300	6503	SO:0001819	synonymous_variant	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2475C>T	1.37:g.113657443C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NSN2	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V825	ENST00000361127.5	37	c.2475	CCDS30808.1	1																																																																																			LRIG2	-	NULL		0.433	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	C	NM_014813		113657443	+1	no_errors	ENST00000361127	ensembl	human	known	70_37	silent	SNP	1.000	T
LRRC27	80313	genome.wustl.edu	37	10	134188813	134188813	+	3'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:134188813C>T	ENST00000368614.3	+	0	1765				LRRC27_ENST00000368610.3_3'UTR|LRRC27_ENST00000368612.1_3'UTR|LRRC27_ENST00000392638.2_3'UTR|LRRC27_ENST00000368613.4_3'UTR|LRRC27_ENST00000475747.1_3'UTR	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27											breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		TCCCGGGCGTCGCCTCCTGTG	0.572																																																	0																																										SO:0001624	3_prime_UTR_variant	80313			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.*67C>T	10.37:g.134188813C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	RNA	SNP	-	NULL	ENST00000368614.3	37	NULL	CCDS31316.1	10																																																																																			LRRC27	-	-		0.572	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	C	XM_290462		134188813	+1	no_errors	ENST00000462656	ensembl	human	known	70_37	rna	SNP	0.000	T
LRRC4C	57689	genome.wustl.edu	37	11	40137708	40137708	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:40137708C>T	ENST00000278198.2	-	2	2098	c.135G>A	c.(133-135)caG>caA	p.Q45Q	LRRC4C_ENST00000528697.1_Silent_p.Q45Q|LRRC4C_ENST00000527150.1_Silent_p.Q45Q|LRRC4C_ENST00000530763.1_Silent_p.Q45Q			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	45	LRRNT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				AAGGGCAGGTCTGAGCCCGCA	0.542																																																	0													67.0	59.0	62.0					11																	40137708		2203	4300	6503	SO:0001819	synonymous_variant	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.135G>A	11.37:g.40137708C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0T1|Q7L0N3	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q45	ENST00000278198.2	37	c.135	CCDS31464.1	11																																																																																			LRRC4C	-	NULL		0.542	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	C	NM_020929		40137708	-1	no_errors	ENST00000527150	ensembl	human	known	70_37	silent	SNP	1.000	T
LRRK2	120892	genome.wustl.edu	37	12	40668470	40668470	+	Missense_Mutation	SNP	C	C	T	rs202191866		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:40668470C>T	ENST00000298910.7	+	15	1800	c.1742C>T	c.(1741-1743)tCc>tTc	p.S581F	LRRK2_ENST00000343742.2_Missense_Mutation_p.S581F	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	581					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GAGATGTTATCCCTGGAAGGT	0.348																																																	0													153.0	151.0	152.0					12																	40668470		2203	4300	6503	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1742C>T	12.37:g.40668470C>T	ENSP00000298910:p.Ser581Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.S581F	ENST00000298910.7	37	c.1742	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082051	0.55861	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.62639	0.01;0.01;0.01	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.237062	0.44483	D	0.000460	T	0.67277	0.2876	L	0.44542	1.39	0.20307	N	0.999911	P;D	0.56035	0.895;0.974	P;P	0.50617	0.548;0.646	T	0.62534	-0.6834	10	0.54805	T	0.06	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	581;581	E9PC85;Q5S007	.;LRRK2_HUMAN	F	329;581;581	ENSP00000398726:S329F;ENSP00000341930:S581F;ENSP00000298910:S581F	ENSP00000298910:S581F	S	+	2	0	LRRK2	38954737	0.992000	0.36948	0.808000	0.32385	0.541000	0.35023	3.547000	0.53663	2.833000	0.97629	0.585000	0.79938	TCC	LRRK2	-	superfamily_ARM-type_fold		0.348	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	C	XM_058513		40668470	+1	no_errors	ENST00000298910	ensembl	human	known	70_37	missense	SNP	0.334	T
MADCAM1	8174	genome.wustl.edu	37	19	501802	501802	+	Missense_Mutation	SNP	G	G	C	rs75905809		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:501802G>C	ENST00000215637.3	+	4	847	c.801G>C	c.(799-801)aaG>aaC	p.K267N	MADCAM1_ENST00000346144.4_Intron|MADCAM1_ENST00000587541.1_Missense_Mutation_p.K48N|MADCAM1_ENST00000382683.4_Intron|AC005775.2_ENST00000592413.1_RNA	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	267	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCCGACAAGACCTCCCCGG	0.721																																																	0													12.0	14.0	13.0					19																	501802		2117	4139	6256	SO:0001583	missense	8174			U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.801G>C	19.37:g.501802G>C	ENSP00000215637:p.Lys267Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	pfam_Adhes-Ig-like,smart_Ig_sub,pfscan_Ig-like	p.K267N	ENST00000215637.3	37	c.801	CCDS12028.1	19	.	.	.	.	.	.	.	.	.	.	g	1.225	-0.625782	0.03610	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.10573	2.86	3.12	-6.25	0.02039	.	2.146880	0.03414	N	0.205240	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34179	-0.9839	10	0.16896	T	0.51	.	3.4407	0.07462	0.2616:0.3054:0.3464:0.0866	.	267	Q13477	MADCA_HUMAN	N	291;283;275;267	ENSP00000215637:K267N	ENSP00000215637:K267N	K	+	3	2	MADCAM1	452802	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.864000	0.00347	-2.471000	0.00529	-1.635000	0.00777	AAG	MADCAM1	-	NULL		0.721	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MADCAM1	HGNC	protein_coding	OTTHUMT00000451884.1	G	NM_130760		501802	+1	no_errors	ENST00000215637	ensembl	human	known	70_37	missense	SNP	0.000	C
MAGEB16	139604	genome.wustl.edu	37	X	35820490	35820490	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:35820490G>C	ENST00000399989.1	+	2	456	c.177G>C	c.(175-177)gaG>gaC	p.E59D	MAGEB16_ENST00000399992.1_Missense_Mutation_p.E91D|MAGEB16_ENST00000399985.1_Missense_Mutation_p.E59D|MAGEB16_ENST00000399988.1_Missense_Mutation_p.E59D|MAGEB16_ENST00000399987.1_Missense_Mutation_p.E59D	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	59										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						CTAAGGCAGAGAGTCCTCTTG	0.532																																																	0													46.0	44.0	45.0					X																	35820490		1954	4118	6072	SO:0001583	missense	139604				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.177G>C	X.37:g.35820490G>C	ENSP00000382871:p.Glu59Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MU30	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E91D	ENST00000399989.1	37	c.273	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	G	6.921	0.539509	0.13250	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.04406	3.63;3.63;3.63;3.63;3.63	3.13	0.233	0.15386	Melanoma associated antigen, MAGE, N-terminal (1);	1.752200	0.03948	U	0.288037	T	0.03608	0.0103	N	0.14661	0.345	0.09310	N	1	B	0.25351	0.124	B	0.21360	0.034	T	0.42361	-0.9456	10	0.49607	T	0.09	.	5.2702	0.15620	0.0:0.3863:0.4731:0.1406	.	59	A2A368	MAGBG_HUMAN	D	59;91;59;59;59	ENSP00000382870:E59D;ENSP00000382874:E91D;ENSP00000382869:E59D;ENSP00000382871:E59D;ENSP00000382867:E59D	ENSP00000382867:E59D	E	+	3	2	MAGEB16	35730411	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.036000	0.13819	-0.054000	0.13266	0.521000	0.50471	GAG	MAGEB16	-	pfam_Melanoma_ass_antigen_N		0.532	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	HGNC	protein_coding	OTTHUMT00000251034.1	G			35820490	+1	no_errors	ENST00000399992	ensembl	human	known	70_37	missense	SNP	0.000	C
MAGI2	9863	genome.wustl.edu	37	7	77814979	77814979	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:77814979G>T	ENST00000354212.4	-	13	2531	c.2278C>A	c.(2278-2280)Cca>Aca	p.P760T	MAGI2_ENST00000522391.1_Missense_Mutation_p.P760T|MAGI2_ENST00000419488.1_Intron	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	760					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GTCCTGGGTGGCACTTGTTCT	0.368																																																	0													115.0	114.0	114.0					7																	77814979		2203	4300	6503	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2278C>A	7.37:g.77814979G>T	ENSP00000346151:p.Pro760Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.P760T	ENST00000354212.4	37	c.2278	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430529	0.62844	.	.	ENSG00000187391	ENST00000354212;ENST00000536298;ENST00000522391	T;T	0.38887	1.11;1.11	6.02	6.02	0.97574	PDZ/DHR/GLGF (1);	0.224065	0.22340	U	0.061348	T	0.38321	0.1036	L	0.43152	1.355	0.80722	D	1	B;P	0.36282	0.008;0.546	B;B	0.31614	0.003;0.133	T	0.10268	-1.0637	10	0.30078	T	0.28	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	760;760	B7Z4H4;Q86UL8	.;MAGI2_HUMAN	T	760	ENSP00000346151:P760T;ENSP00000428389:P760T	ENSP00000346151:P760T	P	-	1	0	MAGI2	77652915	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.159000	0.77483	2.850000	0.98022	0.650000	0.86243	CCA	MAGI2	-	superfamily_PDZ		0.368	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	G	NM_012301		77814979	-1	no_errors	ENST00000354212	ensembl	human	known	70_37	missense	SNP	1.000	T
MAML3	55534	genome.wustl.edu	37	4	140811335	140811335	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:140811335G>C	ENST00000509479.2	-	2	2111	c.1255C>G	c.(1255-1257)Caa>Gaa	p.Q419E	MAML3_ENST00000327122.5_Missense_Mutation_p.Q263E|MAML3_ENST00000398940.1_5'Flank	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TTTGGAGTTTGAGGGGACTGG	0.572																																																	0													124.0	121.0	122.0					4																	140811335		2110	4235	6345	SO:0001583	missense	55534			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1255C>G	4.37:g.140811335G>C	ENSP00000421180:p.Gln419Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q419E	ENST00000509479.2	37	c.1255	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834091	0.32421	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T	0.26223	1.75	5.65	5.65	0.86999	.	0.127518	0.53938	D	0.000059	T	0.20292	0.0488	L	0.36672	1.1	0.80722	D	1	P	0.38195	0.622	B	0.35182	0.197	T	0.03566	-1.1024	10	0.05436	T	0.98	.	19.7207	0.96142	0.0:0.0:1.0:0.0	.	419	Q96JK9	MAML3_HUMAN	E	419;263	ENSP00000421180:Q419E	ENSP00000313316:Q263E	Q	-	1	0	MAML3	141030785	1.000000	0.71417	0.451000	0.26982	0.829000	0.46940	7.225000	0.78051	2.647000	0.89833	0.650000	0.86243	CAA	MAML3	-	NULL		0.572	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	G			140811335	-1	no_errors	ENST00000509479	ensembl	human	known	70_37	missense	SNP	0.998	C
MAP3K15	389840	genome.wustl.edu	37	X	19418717	19418717	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:19418717C>G	ENST00000338883.4	-	14	1908	c.1909G>C	c.(1909-1911)Gag>Cag	p.E637Q	MAP3K15_ENST00000359173.3_Missense_Mutation_p.E72Q|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000469203.2_Missense_Mutation_p.E469Q	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	637							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					CCATCGGTCTCTCCCTCCAGC	0.438																																																	0													391.0	331.0	351.0					X																	19418717		2203	4300	6503	SO:0001583	missense	389840			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1909G>C	X.37:g.19418717C>G	ENSP00000345629:p.Glu637Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E637Q	ENST00000338883.4	37	c.1909		X	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334243	0.60853	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.73363	-0.71;-0.74;-0.69	5.28	4.42	0.53409	.	0.287438	0.39020	N	0.001497	T	0.80586	0.4651	M	0.71581	2.175	0.40013	D	0.975313	P;D	0.53462	0.952;0.96	P;P	0.53722	0.733;0.611	T	0.82436	-0.0458	10	0.59425	D	0.04	.	13.2733	0.60175	0.0:0.9214:0.0:0.0786	.	112;637	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	Q	637;72;469	ENSP00000345629:E637Q;ENSP00000352093:E72Q;ENSP00000428356:E469Q	ENSP00000345629:E637Q	E	-	1	0	MAP3K15	19328638	1.000000	0.71417	0.014000	0.15608	0.648000	0.38561	5.384000	0.66225	1.013000	0.39391	0.597000	0.82753	GAG	MAP3K15	-	NULL		0.438	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		C	NM_001001671		19418717	-1	no_errors	ENST00000338883	ensembl	human	known	70_37	missense	SNP	0.980	G
MAST3	23031	genome.wustl.edu	37	19	18257690	18257690	+	Splice_Site	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:18257690G>C	ENST00000262811.6	+	25	3075		c.e25-1		AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3								ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CCCTCCCGCAGAGCGGCAACA	0.652																																																	0													27.0	29.0	28.0					19																	18257690		2031	4116	6147	SO:0001630	splice_region_variant	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.3076-1G>C	19.37:g.18257690G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7LDZ8|Q9UPI0	Splice_Site	SNP	-	e25-1	ENST00000262811.6	37	c.3076-1	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	g	13.51	2.259757	0.39995	.	.	ENSG00000099308	ENST00000262811	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2117	0.73230	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAST3	18118690	1.000000	0.71417	0.969000	0.41365	0.262000	0.26303	9.726000	0.98782	1.811000	0.52892	0.306000	0.20318	.	MAST3	-	-		0.652	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	G	XM_038150	Intron	18257690	+1	no_errors	ENST00000262811	ensembl	human	known	70_37	splice_site	SNP	1.000	C
MCM10	55388	genome.wustl.edu	37	10	13234536	13234536	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:13234536G>C	ENST00000484800.2	+	13	1819	c.1716G>C	c.(1714-1716)atG>atC	p.M572I	MCM10_ENST00000378694.1_Missense_Mutation_p.M571I|MCM10_ENST00000378714.3_Missense_Mutation_p.M571I			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	572					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TGTTGGAGATGAGGAGAAGGA	0.498																																																	0													101.0	106.0	105.0					10																	13234536		2203	4300	6503	SO:0001583	missense	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1716G>C	10.37:g.13234536G>C	ENSP00000418268:p.Met572Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.M572I	ENST00000484800.2	37	c.1716	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	G	6.645	0.487453	0.12641	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.28666	1.6;1.6;1.6	5.36	1.38	0.22167	Replication factor Mcm10 (1);	0.563238	0.21415	N	0.074908	T	0.26048	0.0635	M	0.67953	2.075	0.24060	N	0.996015	B;B;B	0.12013	0.002;0.004;0.005	B;B;B	0.14023	0.007;0.006;0.01	T	0.22730	-1.0208	10	0.21540	T	0.41	-4.3112	6.2701	0.20949	0.4275:0.1316:0.441:0.0	.	571;571;572	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	I	571;572;572;571	ENSP00000367986:M571I;ENSP00000418268:M572I;ENSP00000367966:M571I	ENSP00000354945:M572I	M	+	3	0	MCM10	13274542	0.984000	0.35163	0.997000	0.53966	0.570000	0.35934	0.166000	0.16583	0.259000	0.21709	-0.158000	0.13435	ATG	MCM10	-	pfam_Rep_factor_Mcm10		0.498	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	G	NM_182751		13234536	+1	no_errors	ENST00000361282	ensembl	human	known	70_37	missense	SNP	0.576	C
MCMDC2	157777	genome.wustl.edu	37	8	67817467	67817467	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:67817467C>T	ENST00000422365.2	+	14	1947	c.1776C>T	c.(1774-1776)ttC>ttT	p.F592F	MCMDC2_ENST00000541540.1_Silent_p.F529F|MCMDC2_ENST00000313616.5_Silent_p.F592F	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	592	MCM.				DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						TTAGCGTTTTCCTATCTGAAG	0.318																																																	0													115.0	91.0	98.0					8																	67817467		692	1591	2283	SO:0001819	synonymous_variant	157777			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1776C>T	8.37:g.67817467C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	p.F592	ENST00000422365.2	37	c.1776	CCDS6197.2	8																																																																																			MCMDC2	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase		0.318	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	C	NM_173518		67817467	+1	no_errors	ENST00000422365	ensembl	human	known	70_37	silent	SNP	0.957	T
MDN1	23195	genome.wustl.edu	37	6	90453374	90453374	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:90453374G>C	ENST00000369393.3	-	30	4353	c.4238C>G	c.(4237-4239)tCt>tGt	p.S1413C	MDN1_ENST00000428876.1_Missense_Mutation_p.S1413C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1413					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCAGCTGACAGAGTATAATTT	0.463																																																	0													121.0	113.0	116.0					6																	90453374		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4238C>G	6.37:g.90453374G>C	ENSP00000358400:p.Ser1413Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.S1413C	ENST00000369393.3	37	c.4238	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440884	0.43326	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.54675	0.56;0.56	5.37	5.37	0.77165	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.137739	0.49916	D	0.000122	T	0.44265	0.1285	M	0.64630	1.985	0.50171	D	0.999859	B	0.26120	0.142	B	0.36030	0.216	T	0.45716	-0.9242	10	0.41790	T	0.15	.	14.6943	0.69110	0.0:0.1448:0.8552:0.0	.	1413	Q9NU22	MDN1_HUMAN	C	1413	ENSP00000358400:S1413C;ENSP00000413970:S1413C	ENSP00000358400:S1413C	S	-	2	0	MDN1	90510095	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.384000	0.73177	2.508000	0.84585	0.563000	0.77884	TCT	MDN1	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase,pirsf_Midasin		0.463	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	G			90453374	-1	no_errors	ENST00000369393	ensembl	human	known	70_37	missense	SNP	0.972	C
MEOX1	4222	genome.wustl.edu	37	17	41720864	41720864	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:41720864C>A	ENST00000318579.4	-	2	1053	c.634G>T	c.(634-636)Gag>Tag	p.E212*	MEOX1_ENST00000549132.1_Intron|MEOX1_ENST00000393661.2_Nonsense_Mutation_p.E97*|MEOX1_ENST00000329168.3_Intron	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	212					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		ACCTGGCGCTCAGAGAGGTCC	0.597																																																	0													47.0	43.0	45.0					17																	41720864		2203	4298	6501	SO:0001587	stop_gained	4222				CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.634G>T	17.37:g.41720864C>A	ENSP00000321684:p.Glu212*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K524|A8MWF9|Q15069	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.E212*	ENST00000318579.4	37	c.634	CCDS11466.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.296710	0.98192	.	.	ENSG00000005102	ENST00000318579;ENST00000393661	.	.	.	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.8327	16.0393	0.80651	0.0:1.0:0.0:0.0	.	.	.	.	X	212;97	.	ENSP00000321684:E212X	E	-	1	0	MEOX1	39076390	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	7.184000	0.77705	2.015000	0.59207	0.491000	0.48974	GAG	MEOX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa		0.597	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX1	HGNC	protein_coding	OTTHUMT00000409452.1	C			41720864	-1	no_errors	ENST00000318579	ensembl	human	known	70_37	nonsense	SNP	1.000	A
METTL7A	25840	genome.wustl.edu	37	12	51319179	51319179	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:51319179G>C	ENST00000548553.1	+	2	1339	c.358G>C	c.(358-360)Gag>Cag	p.E120Q	METTL7A_ENST00000332160.4_Missense_Mutation_p.E120Q			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	120						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						CCTGCAGTTTGAGCGCTTTGT	0.547																																																	0													91.0	82.0	85.0					12																	51319179		2203	4300	6503	SO:0001583	missense	25840				CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.358G>C	12.37:g.51319179G>C	ENSP00000448785:p.Glu120Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H7R3|Q9UHZ7|Q9Y422	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransferase-rel,pfam_SAM-MeTfrase_NodS-related	p.E120Q	ENST00000548553.1	37	c.358	CCDS8804.1	12	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156452	0.57259	.	.	ENSG00000185432	ENST00000548553;ENST00000550502;ENST00000332160	T;T;T	0.20463	2.07;3.81;2.07	5.02	5.02	0.67125	Methyltransferase type 11 (1);	0.152035	0.64402	D	0.000018	T	0.24851	0.0603	L	0.46885	1.475	0.41479	D	0.988152	P	0.34815	0.47	B	0.42692	0.395	T	0.01889	-1.1253	10	0.20519	T	0.43	0.0937	13.6065	0.62050	0.0:0.1553:0.8447:0.0	.	120	Q9H8H3	MET7A_HUMAN	Q	120	ENSP00000448785:E120Q;ENSP00000450239:E120Q;ENSP00000331787:E120Q	ENSP00000331787:E120Q	E	+	1	0	METTL7A	49605446	1.000000	0.71417	0.984000	0.44739	0.522000	0.34438	3.927000	0.56499	2.785000	0.95823	0.591000	0.81541	GAG	METTL7A	-	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_SAM-MeTfrase_NodS-related		0.547	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL7A	HGNC	protein_coding	OTTHUMT00000404294.2	G	NM_014033		51319179	+1	no_errors	ENST00000332160	ensembl	human	known	70_37	missense	SNP	1.000	C
MFSD10	10227	genome.wustl.edu	37	4	2934873	2934873	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:2934873G>A	ENST00000329687.4	-	3	866	c.332C>T	c.(331-333)tCt>tTt	p.S111F	NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000512712.2_RNA|MFSD10_ENST00000508221.1_Missense_Mutation_p.S111F|MFSD10_ENST00000355443.4_Missense_Mutation_p.S111F|MFSD10_ENST00000507555.1_Missense_Mutation_p.S111F|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000507999.1_RNA|MFSD10_ENST00000514800.1_Missense_Mutation_p.S111F	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	111					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CAAGCAGTCAGAGGTGGCCCC	0.632																																																	0													46.0	47.0	47.0					4																	2934873		2200	4300	6500	SO:0001583	missense	10227			L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.332C>T	4.37:g.2934873G>A	ENSP00000332646:p.Ser111Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q07706	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S111F	ENST00000329687.4	37	c.332	CCDS3365.1	4	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118768	0.56505	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08	4.19	4.19	0.49359	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.82522	0.5055	H	0.95539	3.685	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88410	0.3021	10	0.87932	D	0	-13.4298	15.4478	0.75243	0.0:0.0:1.0:0.0	.	111;111;111;111	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	F	111	ENSP00000426907:S111F;ENSP00000347619:S111F;ENSP00000332646:S111F;ENSP00000425757:S111F;ENSP00000423402:S111F	ENSP00000332646:S111F	S	-	2	0	MFSD10	2904671	1.000000	0.71417	0.290000	0.24890	0.168000	0.22595	8.622000	0.90953	2.175000	0.68902	0.561000	0.74099	TCT	MFSD10	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.632	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD10	HGNC	protein_coding	OTTHUMT00000358072.2	G	NM_001120		2934873	-1	no_errors	ENST00000329687	ensembl	human	known	70_37	missense	SNP	0.927	A
MIOS	54468	genome.wustl.edu	37	7	7622951	7622951	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:7622951G>C	ENST00000340080.4	+	6	2017	c.1596G>C	c.(1594-1596)ttG>ttC	p.L532F	MIOS_ENST00000461907.2_3'UTR|MIOS_ENST00000405785.1_Missense_Mutation_p.L532F	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	532						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGTTCAACTTGGATATTCGCC	0.408																																																	0													132.0	132.0	132.0					7																	7622951		1889	4115	6004	SO:0001583	missense	54468				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1596G>C	7.37:g.7622951G>C	ENSP00000339881:p.Leu532Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	smart_WD40_repeat	p.L532F	ENST00000340080.4	37	c.1596	CCDS43554.1	7	.	.	.	.	.	.	.	.	.	.	G	14.00	2.406303	0.42715	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.47869	0.83;0.83	5.38	4.5	0.54988	.	0.000000	0.64402	D	0.000001	T	0.38852	0.1056	L	0.51914	1.62	0.80722	D	1	B	0.18166	0.026	B	0.25291	0.059	T	0.14643	-1.0465	10	0.09590	T	0.72	-9.6968	10.3886	0.44156	0.1498:0.0:0.8502:0.0	.	532	Q9NXC5	MIO_HUMAN	F	532	ENSP00000339881:L532F;ENSP00000384088:L532F	ENSP00000339881:L532F	L	+	3	2	MIOS	7589476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.230000	0.58632	1.405000	0.46838	0.650000	0.86243	TTG	MIOS	-	NULL		0.408	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOS	HGNC	protein_coding	OTTHUMT00000326218.1	G	NM_019005		7622951	+1	no_errors	ENST00000340080	ensembl	human	known	70_37	missense	SNP	1.000	C
KMT2C	58508	genome.wustl.edu	37	7	151878287	151878287	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:151878287G>A	ENST00000262189.6	-	36	6876	c.6658C>T	c.(6658-6660)Cag>Tag	p.Q2220*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q2220*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2220	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCTGGTGGCTGAGAGTAAGGG	0.468																																																	0													84.0	80.0	81.0					7																	151878287		2203	4300	6503	SO:0001587	stop_gained	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.6658C>T	7.37:g.151878287G>A	ENSP00000262189:p.Gln2220*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q2220*	ENST00000262189.6	37	c.6658	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	49	15.064666	0.99821	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.37	5.37	0.77165	.	0.154508	0.29980	N	0.010707	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.4763	0.94991	0.0:0.0:1.0:0.0	.	.	.	.	X	2220	.	ENSP00000262189:Q2220X	Q	-	1	0	MLL3	151509220	1.000000	0.71417	0.995000	0.50966	0.923000	0.55619	7.531000	0.81973	2.677000	0.91161	0.655000	0.94253	CAG	MLL3	-	NULL		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	G			151878287	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MPPED1	758	genome.wustl.edu	37	22	43821097	43821097	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:43821097C>T	ENST00000417669.2	+	2	550	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	MPPED1_ENST00000439548.1_Intron|MPPED1_ENST00000538182.1_Missense_Mutation_p.R69W|MPPED1_ENST00000542779.1_Missense_Mutation_p.R36W|MPPED1_ENST00000414469.2_Intron|MPPED1_ENST00000443721.1_Missense_Mutation_p.R36W			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	36							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				GATGGCCGCTCGGCGGCACCA	0.662																																																	0													34.0	39.0	37.0					22																	43821097		2140	4273	6413	SO:0001583	missense	758			U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.106C>T	22.37:g.43821097C>T	ENSP00000388137:p.Arg36Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom	p.R69W	ENST00000417669.2	37	c.205	CCDS46723.1	22	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605041	0.87157	.	.	ENSG00000186732	ENST00000417669;ENST00000334209;ENST00000443721;ENST00000545165;ENST00000447567;ENST00000542779;ENST00000538182	T;T;T;T;T	0.58652	0.55;0.32;0.55;0.55;0.74	5.2	5.2	0.72013	.	0.532841	0.19415	N	0.114843	T	0.57562	0.2062	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;0.999	P;P	0.59424	0.857;0.857	T	0.61252	-0.7100	10	0.72032	D	0.01	-41.5059	11.6959	0.51542	0.2251:0.7749:0.0:0.0	.	69;36	B7Z2S9;O15442	.;MPPD1_HUMAN	W	36;36;36;14;36;36;69	ENSP00000388137:R36W;ENSP00000335568:R36W;ENSP00000400686:R36W;ENSP00000444532:R36W;ENSP00000438335:R69W	ENSP00000335568:R36W	R	+	1	2	MPPED1	42151041	0.997000	0.39634	0.941000	0.38009	0.956000	0.61745	3.745000	0.55119	2.430000	0.82344	0.655000	0.94253	CGG	MPPED1	-	NULL		0.662	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPED1	HGNC	protein_coding	OTTHUMT00000318938.2	C	NM_001044370		43821097	+1	no_errors	ENST00000538182	ensembl	human	known	70_37	missense	SNP	0.989	T
MRPL2	51069	genome.wustl.edu	37	6	43026954	43026954	+	Intron	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:43026954C>G	ENST00000388752.3	-	1	521				KLC4_ENST00000259708.3_5'Flank|KLC4_ENST00000453940.2_5'Flank|KLC4_ENST00000479388.1_5'Flank|MRPL2_ENST00000230413.5_Intron|KLC4_ENST00000394056.2_5'Flank|MRPL2_ENST00000487429.1_Missense_Mutation_p.E56Q|MRPL2_ENST00000468957.1_Intron|KLC4_ENST00000347162.5_5'Flank|MRPL2_ENST00000489623.1_Intron|KLC4_ENST00000458460.2_5'Flank|KLC4_ENST00000394058.1_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2						translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ACTCCCGCCTCGCATGCCCGC	0.592																																																	0																																										SO:0001627	intron_variant	51069			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.96+69G>C	6.37:g.43026954C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	NULL	p.E56Q	ENST00000388752.3	37	c.166	CCDS34454.1	6	.	.	.	.	.	.	.	.	.	.	C	9.625	1.134951	0.21123	.	.	ENSG00000112651	ENST00000487429	.	.	.	4.01	1.08	0.20341	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	0.999996	P	0.43231	0.801	B	0.42522	0.39	T	0.11817	-1.0572	7	0.87932	D	0	.	3.8257	0.08853	0.0:0.5653:0.2042:0.2305	.	56	C9J5E0	.	Q	56	.	ENSP00000417101:E56Q	E	-	1	0	MRPL2	43134932	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.524000	0.06222	0.092000	0.17331	0.491000	0.48974	GAG	MRPL2	-	NULL		0.592	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL2	HGNC	protein_coding	OTTHUMT00000040577.2	C			43026954	-1	no_errors	ENST00000487429	ensembl	human	putative	70_37	missense	SNP	0.000	G
MT-CO1	4512	genome.wustl.edu	37	M	6361	6361	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrM:6361C>T	ENST00000361624.2	+	1	458	c.458C>T	c.(457-459)gCa>gTa	p.A153V	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	153					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CTTACACCTAGCAGGTGTCTC	0.507																																																	0																																										SO:0001583	missense	4512					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.458C>T	M.37:g.6361C>T	ENSP00000354499:p.Ala153Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.A153V	ENST00000361624.2	37	c.458		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		C	YP_003024028		6361	+1	no_errors	ENST00000361624	ensembl	human	known	70_37	missense	SNP	NULL	T
MUC12	10071	genome.wustl.edu	37	7	100642138	100642138	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:100642138C>T	ENST00000379442.3	+	5	8723	c.8723C>T	c.(8722-8724)tCg>tTg	p.S2908L	MUC12_ENST00000536621.1_Missense_Mutation_p.S2765L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2908	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGCACCACCTCGGGCCTCACT	0.587																																																	0													40.0	42.0	41.0					7																	100642138		692	1578	2270	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.8723C>T	7.37:g.100642138C>T	ENSP00000368755:p.Ser2908Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.S2908L	ENST00000379442.3	37	c.8723		7	.	.	.	.	.	.	.	.	.	.	-	5.593	0.294196	0.10567	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12569	2.67;2.67	0.704	-0.435	0.12279	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43032	-0.9416	6	0.15066	T	0.55	.	.	.	.	.	.	.	.	L	2908;2765	ENSP00000368755:S2908L;ENSP00000441929:S2765L	ENSP00000368755:S2908L	S	+	2	0	MUC12	100428858	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.123000	0.10611	-0.624000	0.05611	-1.169000	0.01745	TCG	MUC12	-	NULL		0.587	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	C	XM_379904		100642138	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.000	T
MUC12	10071	genome.wustl.edu	37	7	100645303	100645303	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:100645303C>T	ENST00000379442.3	+	5	11888	c.11888C>T	c.(11887-11889)tCa>tTa	p.S3963L	MUC12_ENST00000536621.1_Missense_Mutation_p.S3820L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3963	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACCACAACCTCAGTTCGTCGT	0.577																																																	0													61.0	58.0	58.0					7																	100645303		230	887	1117	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.11888C>T	7.37:g.100645303C>T	ENSP00000368755:p.Ser3963Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.S3963L	ENST00000379442.3	37	c.11888		7	.	.	.	.	.	.	.	.	.	.	-	3.890	-0.024209	0.07634	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12569	2.67;2.67	0.609	0.609	0.17575	.	.	.	.	.	T	0.07143	0.0181	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.39272	-0.9622	7	0.39692	T	0.17	.	7.0748	0.25199	0.0:0.9999:0.0:1.0E-4	.	.	.	.	L	3963;3820	ENSP00000368755:S3963L;ENSP00000441929:S3820L	ENSP00000368755:S3963L	S	+	2	0	MUC12	100432023	0.003000	0.15002	0.001000	0.08648	0.011000	0.07611	1.602000	0.36783	0.610000	0.30035	0.162000	0.16502	TCA	MUC12	-	NULL		0.577	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	C	XM_379904		100645303	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.003	T
MUC17	140453	genome.wustl.edu	37	7	100682598	100682598	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:100682598C>T	ENST00000306151.4	+	3	7965	c.7901C>T	c.(7900-7902)tCa>tTa	p.S2634L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2634	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTAAGTACTTCATTAACAAGT	0.463																																																	0													241.0	244.0	243.0					7																	100682598		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7901C>T	7.37:g.100682598C>T	ENSP00000302716:p.Ser2634Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S2634L	ENST00000306151.4	37	c.7901	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	3.566	-0.088652	0.07097	.	.	ENSG00000169876	ENST00000306151	T	0.02050	4.48	0.522	0.522	0.17053	.	.	.	.	.	T	0.00967	0.0032	N	0.03608	-0.345	0.09310	N	1	P	0.38110	0.618	B	0.28638	0.092	T	0.51301	-0.8723	9	0.25751	T	0.34	.	6.9491	0.24536	0.0:0.9999:0.0:1.0E-4	.	2634	Q685J3	MUC17_HUMAN	L	2634	ENSP00000302716:S2634L	ENSP00000302716:S2634L	S	+	2	0	MUC17	100469318	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.166000	0.16583	0.562000	0.29204	0.134000	0.15878	TCA	MUC17	-	NULL		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100682598	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	missense	SNP	0.035	T
MUC4	4585	genome.wustl.edu	37	3	195507868	195507868	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195507868G>A	ENST00000463781.3	-	2	11042	c.10583C>T	c.(10582-10584)tCa>tTa	p.S3528L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3528L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGGATACTGAGGAAGTGTC	0.607																																																	0													41.0	35.0	37.0					3																	195507868		679	1587	2266	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10583C>T	3.37:g.195507868G>A	ENSP00000417498:p.Ser3528Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3528L	ENST00000463781.3	37	c.10583	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	7.217	0.596544	0.13875	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.55;1.36	0.743	0.743	0.18347	.	.	.	.	.	T	0.23806	0.0576	N	0.19112	0.55	0.09310	N	1	P	0.34662	0.462	B	0.39706	0.307	T	0.25984	-1.0116	8	.	.	.	.	6.9051	0.24305	1.0E-4:0.0:0.9999:0.0	.	3400	E7ESK3	.	L	3528	ENSP00000417498:S3528L;ENSP00000420243:S3528L	.	S	-	2	0	MUC4	196992647	0.001000	0.12720	0.031000	0.17742	0.031000	0.12232	0.869000	0.27996	0.088000	0.17205	0.089000	0.15464	TCA	MUC4	-	NULL		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195507868	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.008	A
MUC4	4585	genome.wustl.edu	37	3	195511846	195511846	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195511846G>A	ENST00000463781.3	-	2	7064	c.6605C>T	c.(6604-6606)tCc>tTc	p.S2202F	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2202F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	991					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGACCTGTGGATGCTGAGGA	0.592																																																	0													21.0	20.0	20.0					3																	195511846		686	1578	2264	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6605C>T	3.37:g.195511846G>A	ENSP00000417498:p.Ser2202Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2202F	ENST00000463781.3	37	c.6605	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	5.662	0.306803	0.10733	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.40756	1.16;1.02	.	.	.	.	.	.	.	.	T	0.42337	0.1198	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74348	0.983	T	0.23476	-1.0187	7	.	.	.	.	6.7067	0.23254	2.0E-4:0.0:0.9998:0.0	.	2202	E7ESK3	.	F	2202	ENSP00000417498:S2202F;ENSP00000420243:S2202F	.	S	-	2	0	MUC4	196996241	0.027000	0.19231	0.014000	0.15608	0.015000	0.08874	0.285000	0.18883	0.488000	0.27723	0.064000	0.15345	TCC	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195511846	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.114	A
MUC4	4585	genome.wustl.edu	37	3	195512066	195512066	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512066G>T	ENST00000463781.3	-	2	6844	c.6385C>A	c.(6385-6387)Ctt>Att	p.L2129I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2129I	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGTG	0.562																																																	0													58.0	51.0	53.0					3																	195512066		691	1590	2281	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6385C>A	3.37:g.195512066G>T	ENSP00000417498:p.Leu2129Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L2129I	ENST00000463781.3	37	c.6385	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	3.094	-0.186303	0.06340	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39997	1.28;1.05	.	.	.	.	.	.	.	.	T	0.18923	0.0454	N	0.19112	0.55	0.09310	N	1	B	0.28233	0.204	B	0.16289	0.015	T	0.14254	-1.0479	7	.	.	.	.	2.1452	0.03785	0.3253:0.3441:0.3305:0.0	.	2129	E7ESK3	.	I	2129	ENSP00000417498:L2129I;ENSP00000420243:L2129I	.	L	-	1	0	MUC4	196996461	0.005000	0.15991	0.026000	0.17262	0.053000	0.15095	0.592000	0.23984	-0.812000	0.04363	0.064000	0.15345	CTT	MUC4	-	NULL		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512066	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.097	T
MUC4	4585	genome.wustl.edu	37	3	195512140	195512140	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512140G>C	ENST00000463781.3	-	2	6770	c.6311C>G	c.(6310-6312)tCa>tGa	p.S2104*	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Nonsense_Mutation_p.S2104*	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATACTGAGGAAGCGTC	0.567																																																	0													52.0	44.0	46.0					3																	195512140		690	1589	2279	SO:0001587	stop_gained	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6311C>G	3.37:g.195512140G>C	ENSP00000417498:p.Ser2104*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2104*	ENST00000463781.3	37	c.6311	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	43	10.207998	0.99359	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7067	0.23254	2.0E-4:0.0:0.9998:0.0	.	.	.	.	X	2104	.	.	S	-	2	0	MUC4	196996535	0.000000	0.05858	0.009000	0.14445	0.080000	0.17528	0.362000	0.20284	0.488000	0.27723	0.064000	0.15345	TCA	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512140	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	nonsense	SNP	0.009	C
MUC4	4585	genome.wustl.edu	37	3	195512284	195512284	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512284G>C	ENST00000463781.3	-	2	6626	c.6167C>G	c.(6166-6168)tCa>tGa	p.S2056*	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Nonsense_Mutation_p.S2056*	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATACTGAGGAAAGGCT	0.567																																																	0													18.0	18.0	18.0					3																	195512284		685	1574	2259	SO:0001587	stop_gained	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6167C>G	3.37:g.195512284G>C	ENSP00000417498:p.Ser2056*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2056*	ENST00000463781.3	37	c.6167	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	43	10.054222	0.99326	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7067	0.23254	2.0E-4:0.0:0.9998:0.0	.	.	.	.	X	2056	.	.	S	-	2	0	MUC4	196996679	.	.	0.005000	0.12908	0.021000	0.10359	.	.	0.488000	0.27723	0.064000	0.15345	TCA	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512284	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	nonsense	SNP	0.008	C
MUC4	4585	genome.wustl.edu	37	3	195512318	195512318	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512318G>A	ENST00000463781.3	-	2	6592	c.6133C>T	c.(6133-6135)Cag>Tag	p.Q2045*	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Nonsense_Mutation_p.Q2045*	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGTCCTGACCTGTGGAT	0.582																																																	0													28.0	25.0	26.0					3																	195512318		687	1580	2267	SO:0001587	stop_gained	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6133C>T	3.37:g.195512318G>A	ENSP00000417498:p.Gln2045*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.Q2045*	ENST00000463781.3	37	c.6133	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.701346	0.99242	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	X	2045	.	.	Q	-	1	0	MUC4	196996713	0.000000	0.05858	0.006000	0.13384	0.058000	0.15608	-0.662000	0.05305	-0.833000	0.04245	0.064000	0.15345	CAG	MUC4	-	NULL		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512318	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	nonsense	SNP	0.007	A
MUC4	4585	genome.wustl.edu	37	3	195512351	195512351	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512351G>A	ENST00000463781.3	-	2	6559	c.6100C>T	c.(6100-6102)Cct>Tct	p.P2034S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2034S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCGGTGACAGGAAGCGGCGTG	0.572																																																	0													28.0	25.0	26.0					3																	195512351		687	1575	2262	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6100C>T	3.37:g.195512351G>A	ENSP00000417498:p.Pro2034Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P2034S	ENST00000463781.3	37	c.6100	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	5.053	0.195420	0.09599	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28895	1.59;1.67	.	.	.	.	.	.	.	.	T	0.12603	0.0306	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.08055	0.003	T	0.32693	-0.9897	6	.	.	.	.	.	.	.	.	2034	E7ESK3	.	S	2034	ENSP00000417498:P2034S;ENSP00000420243:P2034S	.	P	-	1	0	MUC4	196996746	0.735000	0.28153	0.012000	0.15200	0.018000	0.09664	0.899000	0.28417	0.064000	0.16427	0.064000	0.15345	CCT	MUC4	-	NULL		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512351	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.160	A
MUC4	4585	genome.wustl.edu	37	3	195512716	195512716	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195512716G>A	ENST00000463781.3	-	2	6194	c.5735C>T	c.(5734-5736)tCa>tTa	p.S1912L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1912L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATACTGAGGAAGCGTC	0.567																																																	0													50.0	42.0	44.0					3																	195512716		690	1591	2281	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5735C>T	3.37:g.195512716G>A	ENSP00000417498:p.Ser1912Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S1912L	ENST00000463781.3	37	c.5735	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	9.553	1.116314	0.20795	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.31;1.33	1.13	1.13	0.20643	.	.	.	.	.	T	0.18800	0.0451	N	0.19112	0.55	0.09310	N	1	P	0.47604	0.898	B	0.36885	0.235	T	0.09228	-1.0684	8	.	.	.	.	8.2156	0.31509	0.0:0.0:1.0:0.0	.	1912	E7ESK3	.	L	1912	ENSP00000417498:S1912L;ENSP00000420243:S1912L	.	S	-	2	0	MUC4	196997111	0.003000	0.15002	0.008000	0.14137	0.039000	0.13416	0.139000	0.16036	0.494000	0.27859	0.089000	0.15464	TCA	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512716	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.349	A
MUC4	4585	genome.wustl.edu	37	3	195513410	195513410	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195513410G>C	ENST00000463781.3	-	2	5500	c.5041C>G	c.(5041-5043)Ctt>Gtt	p.L1681V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L1681V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCG	0.612																																																	0													39.0	37.0	37.0					3																	195513410		690	1582	2272	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5041C>G	3.37:g.195513410G>C	ENSP00000417498:p.Leu1681Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L1681V	ENST00000463781.3	37	c.5041	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	3.003	-0.205683	0.06180	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.52754	0.65;0.75	.	.	.	.	.	.	.	.	T	0.20740	0.0499	N	0.19112	0.55	0.09310	N	1	P	0.42584	0.784	B	0.28638	0.092	T	0.10730	-1.0617	7	.	.	.	.	2.8509	0.05558	3.0E-4:2.0E-4:0.5024:0.497	.	1681	E7ESK3	.	V	1681	ENSP00000417498:L1681V;ENSP00000420243:L1681V	.	L	-	1	0	MUC4	196997805	0.000000	0.05858	0.127000	0.21898	0.038000	0.13279	-0.289000	0.08365	0.088000	0.17205	0.089000	0.15464	CTT	MUC4	-	NULL		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513410	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.173	C
MUC4	4585	genome.wustl.edu	37	3	195513580	195513580	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:195513580G>A	ENST00000463781.3	-	2	5330	c.4871C>T	c.(4870-4872)tCa>tTa	p.S1624L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1624L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGTGTC	0.567																																																	0													21.0	25.0	24.0					3																	195513580		688	1571	2259	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4871C>T	3.37:g.195513580G>A	ENSP00000417498:p.Ser1624Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S1624L	ENST00000463781.3	37	c.4871	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	6.040	0.375816	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.34;1.33	.	.	.	.	.	.	.	.	T	0.33847	0.0877	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	D	0.65443	0.935	T	0.14392	-1.0474	7	.	.	.	.	2.6645	0.05037	0.4931:0.0:0.5069:0.0	.	1624	E7ESK3	.	L	1624	ENSP00000417498:S1624L;ENSP00000420243:S1624L	.	S	-	2	0	MUC4	196997975	0.010000	0.17322	0.011000	0.14972	0.011000	0.07611	1.327000	0.33746	0.088000	0.17205	0.089000	0.15464	TCA	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513580	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.016	A
MUM1	84939	genome.wustl.edu	37	19	1366351	1366351	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:1366351C>G	ENST00000415183.3	+	7	1361	c.1335C>G	c.(1333-1335)atC>atG	p.I445M	MUM1_ENST00000311401.5_Missense_Mutation_p.I376M|MUM1_ENST00000344663.3_Missense_Mutation_p.I445M|MUM1_ENST00000591806.1_Missense_Mutation_p.I445M			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	444	PWWP.				chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTATACATCGAAGGACACA	0.478																																																	0													135.0	109.0	118.0					19																	1366351		2203	4300	6503	SO:0001583	missense	84939			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1335C>G	19.37:g.1366351C>G	ENSP00000394925:p.Ile445Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	pfam_PWWP	p.I445M	ENST00000415183.3	37	c.1335		19	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347701	0.24426	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.70282	-0.47;-0.47;-0.47	5.04	-9.6	0.00553	.	0.222950	0.45361	D	0.000371	T	0.75064	0.3799	L	0.54323	1.7	0.21861	N	0.999509	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.998;0.998	T	0.78239	-0.2281	10	0.87932	D	0	.	16.6053	0.84827	0.0:0.184:0.0:0.816	.	445;445;376;444	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	M	445;376;445	ENSP00000345789:I445M;ENSP00000309135:I376M;ENSP00000394925:I445M	ENSP00000309135:I376M	I	+	3	3	MUM1	1317351	0.031000	0.19500	0.018000	0.16275	0.011000	0.07611	-1.588000	0.02106	-1.754000	0.01321	-0.367000	0.07326	ATC	MUM1	-	NULL		0.478	MUM1-016	NOVEL	basic|exp_conf	protein_coding	MUM1	HGNC	protein_coding	OTTHUMT00000449510.1	C	NM_032853		1366351	+1	no_errors	ENST00000344663	ensembl	human	known	70_37	missense	SNP	0.103	G
MYH11	4629	genome.wustl.edu	37	16	15835413	15835413	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:15835413C>T	ENST00000300036.5	-	22	2875	c.2766G>A	c.(2764-2766)gaG>gaA	p.E922E	MYH11_ENST00000452625.2_Silent_p.E929E|MYH11_ENST00000396324.3_Silent_p.E929E|MYH11_ENST00000576790.2_Silent_p.E922E|AF001548.6_ENST00000577048.1_RNA	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	922					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CATGCAGTATCTCCTCCAGCT	0.597			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													104.0	107.0	106.0					16																	15835413		2197	4300	6497	SO:0001819	synonymous_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2766G>A	16.37:g.15835413C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E929	ENST00000300036.5	37	c.2787	CCDS10565.1	16																																																																																			MYH11	-	NULL		0.597	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	C	NM_001040113		15835413	-1	no_errors	ENST00000396324	ensembl	human	known	70_37	silent	SNP	1.000	T
MYO1F	4542	genome.wustl.edu	37	19	8595361	8595361	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:8595361C>T	ENST00000338257.8	-	20	2407	c.2140G>A	c.(2140-2142)Gag>Aag	p.E714K		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	714	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CGCATCTCCTCGTACTTCCGG	0.637																																																	0													124.0	134.0	131.0					19																	8595361		2059	4183	6242	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.2140G>A	19.37:g.8595361C>T	ENSP00000344871:p.Glu714Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.E714K	ENST00000338257.8	37	c.2140	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	C	10.02	1.234862	0.22626	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.94687	-3.49	5.26	4.21	0.49690	.	0.059913	0.64402	D	0.000004	D	0.90403	0.6996	L	0.53249	1.67	0.58432	D	0.999996	B	0.33238	0.403	B	0.17433	0.018	D	0.87747	0.2589	10	0.15499	T	0.54	.	14.9554	0.71110	0.0:0.8565:0.1435:0.0	.	714	O00160	MYO1F_HUMAN	K	759;714	ENSP00000344871:E714K	ENSP00000304899:E759K	E	-	1	0	MYO1F	8501361	0.579000	0.26725	0.870000	0.34147	0.869000	0.49853	3.289000	0.51747	1.207000	0.43291	0.555000	0.69702	GAG	MYO1F	-	pfscan_IQ_motif_EF-hand-BS		0.637	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	C			8595361	-1	no_errors	ENST00000338257	ensembl	human	known	70_37	missense	SNP	1.000	T
NAA15	80155	genome.wustl.edu	37	4	140309101	140309101	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:140309101G>A	ENST00000296543.5	+	20	2787	c.2464G>A	c.(2464-2466)Gaa>Aaa	p.E822K	NAA15_ENST00000398947.1_Missense_Mutation_p.E821K|NAA15_ENST00000515576.1_Intron	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	822	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						AGAAGCTGCTGAAATTTATAG	0.383																																																	0													152.0	133.0	139.0					4																	140309101		1827	4088	5915	SO:0001583	missense	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.2464G>A	4.37:g.140309101G>A	ENSP00000296543:p.Glu822Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E822K	ENST00000296543.5	37	c.2464	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109868	0.37242	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.46063	0.88;0.88	6.16	5.33	0.75918	.	0.231594	0.41823	D	0.000801	T	0.44644	0.1303	M	0.69358	2.11	0.80722	D	1	B	0.29085	0.232	B	0.30029	0.11	T	0.35500	-0.9786	10	0.36615	T	0.2	-0.0748	15.5553	0.76187	0.0656:0.0:0.9344:0.0	.	822	Q9BXJ9	NAA15_HUMAN	K	822;696;821	ENSP00000296543:E822K;ENSP00000381920:E821K	ENSP00000296543:E822K	E	+	1	0	NAA15	140528551	1.000000	0.71417	0.983000	0.44433	0.776000	0.43924	9.476000	0.97823	1.628000	0.50416	0.650000	0.86243	GAA	NAA15	-	NULL		0.383	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	G	NM_057175		140309101	+1	no_errors	ENST00000296543	ensembl	human	known	70_37	missense	SNP	1.000	A
NBEAL1	65065	genome.wustl.edu	37	2	204000415	204000415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:204000415C>T	ENST00000449802.1	+	27	4075	c.3742C>T	c.(3742-3744)Cag>Tag	p.Q1248*		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1248										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GCAAATTTTGCAGTTCCAGCC	0.294																																																	0													36.0	30.0	32.0					2																	204000415		692	1591	2283	SO:0001587	stop_gained	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3742C>T	2.37:g.204000415C>T	ENSP00000399903:p.Gln1248*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1248*	ENST00000449802.1	37	c.3742	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	C	42	9.227900	0.99106	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	.	.	.	5.33	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	13.7415	0.62852	0.2807:0.7193:0.0:0.0	.	.	.	.	X	1248	.	ENSP00000344985:Q1248X	Q	+	1	0	NBEAL1	203708660	0.999000	0.42202	0.993000	0.49108	0.278000	0.26855	3.272000	0.51616	0.572000	0.29383	0.563000	0.77884	CAG	NBEAL1	-	NULL		0.294	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	C			204000415	+1	no_errors	ENST00000449802	ensembl	human	known	70_37	nonsense	SNP	1.000	T
NBPF10	100132406	genome.wustl.edu	37	1	145299857	145299857	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:145299857G>A	ENST00000369338.1	+	2	283	c.93G>A	c.(91-93)aaG>aaA	p.K31K	NBPF10_ENST00000342960.5_Silent_p.K302K|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369339.3_Intron			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	302						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGCAGAGAAGAAACAGCAGT	0.468																																																	0													12.0	12.0	12.0					1																	145299857		690	1578	2268	SO:0001819	synonymous_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369338.1:c.93G>A	1.37:g.145299857G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5RHC0|Q9NWN6	Silent	SNP	pfam_NBPF_dom	p.K302	ENST00000369338.1	37	c.906		1																																																																																			NBPF10	-	NULL		0.468	NBPF10-003	KNOWN	not_best_in_genome_evidence|basic	protein_coding	NBPF10	HGNC	protein_coding	OTTHUMT00000038552.1	G	NM_001039703		145299857	+1	no_errors	ENST00000342960	ensembl	human	known	70_37	silent	SNP	0.000	A
NLGN1	22871	genome.wustl.edu	37	3	173322819	173322819	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:173322819C>T	ENST00000457714.1	+	3	860	c.431C>T	c.(430-432)tCa>tTa	p.S144L	NLGN1_ENST00000361589.4_Missense_Mutation_p.S144L|NLGN1_ENST00000401917.3_Missense_Mutation_p.S144L|NLGN1_ENST00000545397.1_Missense_Mutation_p.S144L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	144					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GTGGTTTCATCATATGTGCAA	0.398																																																	0													132.0	130.0	131.0					3																	173322819		2203	4300	6503	SO:0001583	missense	22871			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.431C>T	3.37:g.173322819C>T	ENSP00000392500:p.Ser144Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.S144L	ENST00000457714.1	37	c.431	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075175	0.55646	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.71461	0.41;0.41;-0.57;0.41;0.41	5.62	5.62	0.85841	.	0.086006	0.44688	D	0.000432	T	0.60715	0.2290	N	0.25094	0.71	0.52501	D	0.999952	B;B	0.16802	0.011;0.019	B;B	0.21360	0.034;0.013	T	0.53019	-0.8497	10	0.23302	T	0.38	.	20.0185	0.97487	0.0:1.0:0.0:0.0	.	144;144	D2X2H5;Q8N2Q7-2	.;.	L	144	ENSP00000392500:S144L;ENSP00000354541:S144L;ENSP00000410374:S144L;ENSP00000441108:S144L;ENSP00000385750:S144L	ENSP00000354541:S144L	S	+	2	0	NLGN1	174805513	1.000000	0.71417	0.775000	0.31657	0.965000	0.64279	7.445000	0.80570	2.809000	0.96659	0.467000	0.42956	TCA	NLGN1	-	pfam_CarbesteraseB		0.398	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	C	NM_014932		173322819	+1	no_errors	ENST00000401917	ensembl	human	known	70_37	missense	SNP	0.968	T
NOTCH4	4855	genome.wustl.edu	37	6	32170026	32170026	+	Silent	SNP	C	C	T	rs146699614	byFrequency	TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:32170026C>T	ENST00000375023.3	-	21	3720	c.3582G>A	c.(3580-3582)ccG>ccA	p.P1194P		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1194					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AGTTTCCTCCCGGGCCACTGC	0.677													T|||	2	0.000399361	0.0015	0.0	5008	,	,		18041	0.0		0.0	False		,,,				2504	0.0																0								T		3,3015		0,3,1506	37.0	41.0	39.0		3582	-6.6	0.4	6	dbSNP_134	39	0,5416		0,0,2708	no	coding-synonymous	NOTCH4	NM_004557.3		0,3,4214	TT,TC,CC		0.0,0.0994,0.0356		1194/2004	32170026	3,8431	1509	2708	4217	SO:0001819	synonymous_variant	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3582G>A	6.37:g.32170026C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.P1194	ENST00000375023.3	37	c.3582	CCDS34420.1	6																																																																																			NOTCH4	-	pfam_Notch_dom,superfamily_Notch_dom,smart_Notch_dom,pirsf_Notch,pfscan_Notch_dom,prints_Notch_dom		0.677	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	C			32170026	-1	no_errors	ENST00000375023	ensembl	human	known	70_37	silent	SNP	0.296	T
NOTCH4	4855	genome.wustl.edu	37	6	32183067	32183067	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:32183067C>T	ENST00000375023.3	-	12	2095	c.1957G>A	c.(1957-1959)Gat>Aat	p.D653N	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	653	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GGGCTTCCATCAGGACAGAGG	0.612																																																	0													105.0	63.0	78.0					6																	32183067		1511	2709	4220	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1957G>A	6.37:g.32183067C>T	ENSP00000364163:p.Asp653Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.D653N	ENST00000375023.3	37	c.1957	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086114	0.36855	.	.	ENSG00000204301	ENST00000375023	T	0.66995	-0.24	4.53	3.66	0.41972	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.45361	D	0.000370	T	0.56232	0.1971	L	0.41632	1.29	0.19945	N	0.99994	D	0.69078	0.997	D	0.77004	0.989	T	0.47005	-0.9150	10	0.21540	T	0.41	.	8.2902	0.31952	0.0:0.8917:0.0:0.1083	.	653	Q99466	NOTC4_HUMAN	N	653	ENSP00000364163:D653N	ENSP00000364163:D653N	D	-	1	0	NOTCH4	32291045	0.000000	0.05858	0.293000	0.24932	0.711000	0.40976	0.072000	0.14617	1.133000	0.42147	0.561000	0.74099	GAT	NOTCH4	-	smart_EG-like_dom,pirsf_Notch		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	C			32183067	-1	no_errors	ENST00000375023	ensembl	human	known	70_37	missense	SNP	0.186	T
NPAS3	64067	genome.wustl.edu	37	14	34270072	34270072	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:34270072C>T	ENST00000356141.4	+	12	2559	c.2559C>T	c.(2557-2559)ttC>ttT	p.F853F	NPAS3_ENST00000548645.1_Silent_p.F823F|NPAS3_ENST00000551492.1_Silent_p.F858F|NPAS3_ENST00000346562.2_Silent_p.F821F|NPAS3_ENST00000357798.5_Silent_p.F840F			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	853					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CTGTTAACTTCGTGGACGTTA	0.647																																																	0													42.0	30.0	34.0					14																	34270072		2203	4298	6501	SO:0001819	synonymous_variant	64067			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2559C>T	14.37:g.34270072C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,pfscan_PAS,pfscan_HLH_dom	p.F853	ENST00000356141.4	37	c.2559	CCDS53891.1	14																																																																																			NPAS3	-	NULL		0.647	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	C			34270072	+1	no_errors	ENST00000356141	ensembl	human	known	70_37	silent	SNP	1.000	T
NR4A1	3164	genome.wustl.edu	37	12	52435661	52435661	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:52435661G>A	ENST00000545748.1	+	2	1103	c.108G>A	c.(106-108)ctG>ctA	p.L36L	NR4A1_ENST00000550082.1_5'UTR|NR4A1_ENST00000360284.3_5'UTR			P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	0					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GCTGGGCCCTGAAGGCAGACG	0.597																																																	0													20.0	19.0	19.0					12																	52435661		875	1988	2863	SO:0001819	synonymous_variant	3164			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000545748.1:c.108G>A	12.37:g.52435661G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DML7|Q15627|Q53Y00|Q6IBU8	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Nuc_orp_HMR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.L36	ENST00000545748.1	37	c.108		12																																																																																			NR4A1	-	NULL		0.597	NR4A1-003	KNOWN	basic	protein_coding	NR4A1	HGNC	protein_coding	OTTHUMT00000404959.2	G			52435661	+1	no_errors	ENST00000545748	ensembl	human	known	70_37	silent	SNP	0.134	A
NT5DC2	64943	genome.wustl.edu	37	3	52563276	52563276	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:52563276C>T	ENST00000307076.4	-	2	596	c.196G>A	c.(196-198)Gac>Aac	p.D66N	NT5DC2_ENST00000490681.1_5'UTR|NT5DC2_ENST00000307092.4_Missense_Mutation_p.D32N|NT5DC2_ENST00000459839.1_Missense_Mutation_p.D103N|NT5DC2_ENST00000422318.2_Missense_Mutation_p.D103N	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	66							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		ACCTCAACGTCACGCAGGCTG	0.592																																																	0													241.0	192.0	208.0					3																	52563276		2203	4300	6503	SO:0001583	missense	64943			AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.196G>A	3.37:g.52563276C>T	ENSP00000302468:p.Asp66Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.D103N	ENST00000307076.4	37	c.307	CCDS2858.1	3	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591555	0.46214	.	.	ENSG00000168268	ENST00000307092;ENST00000307076;ENST00000422318;ENST00000459839	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.38	5.38	0.77491	HAD-like domain (1);	0.211748	0.48286	D	0.000186	T	0.25121	0.0610	L	0.38175	1.15	0.32745	N	0.507168	B;B;B	0.28258	0.205;0.025;0.045	B;B;B	0.29077	0.098;0.02;0.098	T	0.15607	-1.0431	10	0.31617	T	0.26	-22.0509	19.1256	0.93382	0.0:1.0:0.0:0.0	.	103;66;103	C9JTZ6;Q9H857;E9PAL9	.;NT5D2_HUMAN;.	N	32;66;103;103	ENSP00000306017:D32N;ENSP00000302468:D66N;ENSP00000406933:D103N;ENSP00000419547:D103N	ENSP00000302468:D66N	D	-	1	0	NT5DC2	52538316	1.000000	0.71417	0.123000	0.21794	0.532000	0.34746	5.770000	0.68873	2.512000	0.84698	0.555000	0.69702	GAC	NT5DC2	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl		0.592	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NT5DC2	HGNC	protein_coding	OTTHUMT00000351509.1	C	NM_022908		52563276	-1	no_errors	ENST00000422318	ensembl	human	known	70_37	missense	SNP	0.593	T
NUFIP2	57532	genome.wustl.edu	37	17	27614309	27614309	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:27614309C>G	ENST00000225388.4	-	2	761	c.703G>C	c.(703-705)Gaa>Caa	p.E235Q	NUFIP2_ENST00000579665.1_Intron	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	235						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TTAAGGTTTTCACAACCCTTG	0.403																																																	0													143.0	142.0	142.0					17																	27614309		2203	4300	6503	SO:0001583	missense	57532			AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.703G>C	17.37:g.27614309C>G	ENSP00000225388:p.Glu235Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3A6|Q9P2M5	Missense_Mutation	SNP	NULL	p.E235Q	ENST00000225388.4	37	c.703	CCDS32600.1	17	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303234	0.60195	.	.	ENSG00000108256	ENST00000225388	.	.	.	6.17	5.21	0.72293	.	0.065058	0.64402	D	0.000006	T	0.51652	0.1687	L	0.32530	0.975	0.80722	D	1	P	0.36535	0.557	B	0.39419	0.299	T	0.56353	-0.7993	9	0.66056	D	0.02	-12.7081	15.327	0.74172	0.0:0.9337:0.0:0.0663	.	235	Q7Z417	NUFP2_HUMAN	Q	235	.	ENSP00000225388:E235Q	E	-	1	0	NUFIP2	24638435	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.001000	0.76297	1.620000	0.50308	0.655000	0.94253	GAA	NUFIP2	-	NULL		0.403	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP2	HGNC	protein_coding	OTTHUMT00000447015.2	C	NM_020772		27614309	-1	no_errors	ENST00000225388	ensembl	human	known	70_37	missense	SNP	1.000	G
NYNRIN	57523	genome.wustl.edu	37	14	24877477	24877477	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:24877477G>C	ENST00000382554.3	+	3	919	c.601G>C	c.(601-603)Gac>Cac	p.D201H		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	201					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GGGCAAGGAAGACATCATCGA	0.637																																																	0													28.0	35.0	33.0					14																	24877477		2094	4222	6316	SO:0001583	missense	57523			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.601G>C	14.37:g.24877477G>C	ENSP00000371994:p.Asp201His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.D201H	ENST00000382554.3	37	c.601	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451190	0.63290	.	.	ENSG00000205978	ENST00000382554	T	0.10960	2.82	5.06	5.06	0.68205	.	0.770143	0.11771	N	0.531156	T	0.21550	0.0519	L	0.27053	0.805	0.29501	N	0.854946	D	0.89917	1.0	D	0.68765	0.96	T	0.05801	-1.0863	10	0.72032	D	0.01	.	13.798	0.63182	0.0:0.0:1.0:0.0	.	201	Q9P2P1	NYNRI_HUMAN	H	201	ENSP00000371994:D201H	ENSP00000371994:D201H	D	+	1	0	NYNRIN	23947317	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	2.848000	0.48278	2.619000	0.88677	0.655000	0.94253	GAC	NYNRIN	-	NULL		0.637	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	G			24877477	+1	no_errors	ENST00000382554	ensembl	human	known	70_37	missense	SNP	0.990	C
OR5H2	79310	genome.wustl.edu	37	3	98002360	98002360	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:98002360C>G	ENST00000355273.2	+	1	629	c.629C>G	c.(628-630)tCa>tGa	p.S210*	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						TTGTCTGGCTCAATTCAGGTA	0.318																																																	0													84.0	86.0	86.0					3																	98002360		2203	4299	6502	SO:0001587	stop_gained	79310				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.629C>G	3.37:g.98002360C>G	ENSP00000347418:p.Ser210*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF87	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S210*	ENST00000355273.2	37	c.629	CCDS33801.1	3	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498536	0.26861	.	.	ENSG00000197938	ENST00000355273	.	.	.	3.03	0.372	0.16173	.	0.000000	0.32736	U	0.005718	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	5.2214	0.15371	0.0:0.4483:0.0:0.5517	.	.	.	.	X	210	.	ENSP00000347418:S210X	S	+	2	0	OR5H2	99485050	0.003000	0.15002	0.003000	0.11579	0.015000	0.08874	1.586000	0.36611	0.146000	0.19002	0.411000	0.27672	TCA	OR5H2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.318	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	C			98002360	+1	no_errors	ENST00000355273	ensembl	human	known	70_37	nonsense	SNP	0.000	G
OSCP1	127700	genome.wustl.edu	37	1	36883706	36883706	+	3'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:36883706C>T	ENST00000356637.5	-	0	1267				SNORA63_ENST00000364578.1_RNA|OSCP1_ENST00000433045.2_3'UTR|OSCP1_ENST00000235532.5_3'UTR|OSCP1_ENST00000495222.1_5'UTR			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1						transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						CCAGCAGCCTCTCCCTGGGGG	0.537																																																	0													53.0	42.0	46.0					1																	36883706		2203	4300	6503	SO:0001624	3_prime_UTR_variant	127700				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.*34G>A	1.37:g.36883706C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	RNA	SNP	-	NULL	ENST00000356637.5	37	NULL		1																																																																																			OSCP1	-	-		0.537	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	OSCP1	HGNC	protein_coding	OTTHUMT00000389759.1	C	NM_145047		36883706	-1	no_errors	ENST00000471369	ensembl	human	known	70_37	rna	SNP	0.000	T
OR6K3	391114	genome.wustl.edu	37	1	158686965	158686965	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:158686965C>T	ENST00000368146.1	-	1	988	c.989G>A	c.(988-990)gGa>gAa	p.G330E	OR6K3_ENST00000368145.1_Missense_Mutation_p.G314E			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	330						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GTATTAACCTCCAGGCTTGTT	0.418																																																	0													111.0	115.0	113.0					1																	158686965		2203	4300	6503	SO:0001583	missense	391114			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.989G>A	1.37:g.158686965C>T	ENSP00000357128:p.Gly330Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G330E	ENST00000368146.1	37	c.989		1	.	.	.	.	.	.	.	.	.	.	C	8.085	0.773267	0.16051	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.00007	9.69;9.67	3.1	-2.84	0.05751	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.09310	N	1	B	0.21821	0.061	B	0.21708	0.036	T	0.24368	-1.0162	9	0.87932	D	0	.	3.9966	0.09561	0.0:0.2744:0.3576:0.3681	.	330	Q8NGY3	OR6K3_HUMAN	E	314;330	ENSP00000357127:G314E;ENSP00000357128:G330E	ENSP00000357127:G314E	G	-	2	0	OR6K3	156953589	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-3.699000	0.00390	-0.667000	0.05303	0.467000	0.42956	GGA	OR6K3	-	NULL		0.418	OR6K3-201	KNOWN	basic	protein_coding	OR6K3	HGNC	protein_coding		C			158686965	-1	no_errors	ENST00000368146	ensembl	human	known	70_37	missense	SNP	0.000	T
OTUB1	55611	genome.wustl.edu	37	11	63756108	63756108	+	Intron	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:63756108G>C	ENST00000538426.1	+	3	164				OTUB1_ENST00000543988.1_Intron|OTUB1_ENST00000543004.1_Missense_Mutation_p.D44H|OTUB1_ENST00000535715.1_Intron|OTUB1_ENST00000428192.2_Intron|OTUB1_ENST00000541478.1_Intron|OTUB1_ENST00000536443.1_Intron|OTUB1_ENST00000422031.2_Intron	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						GGACATGACAGATCCCTGCCT	0.542																																																	0													101.0	101.0	101.0					11																	63756108		2201	4297	6498	SO:0001627	intron_variant	55611			AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.121-18G>C	11.37:g.63756108G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.D44H	ENST00000538426.1	37	c.130	CCDS8055.1	11	.	.	.	.	.	.	.	.	.	.	G	10.09	1.253661	0.22965	.	.	ENSG00000167770	ENST00000543004	.	.	.	3.08	2.12	0.27331	.	.	.	.	.	T	0.21387	0.0515	.	.	.	0.18873	N	0.999981	.	.	.	.	.	.	T	0.24835	-1.0149	5	0.13853	T	0.58	.	7.9726	0.30136	0.0:0.254:0.746:0.0	.	.	.	.	H	44	.	ENSP00000437453:D44H	D	+	1	0	OTUB1	63512684	0.003000	0.15002	0.003000	0.11579	0.012000	0.07955	1.153000	0.31676	0.830000	0.34757	0.491000	0.48974	GAT	OTUB1	-	pirsf_Ubiquitin_thioesterase_Otubain		0.542	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB1	HGNC	protein_coding	OTTHUMT00000396277.1	G	NM_017670		63756108	+1	no_errors	ENST00000543004	ensembl	human	known	70_37	missense	SNP	0.005	C
PDE6B	5158	genome.wustl.edu	37	4	657657	657657	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:657657C>T	ENST00000496514.1	+	16	2040	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F	PDE6B_ENST00000255622.6_Silent_p.F673F|RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000429163.2_Silent_p.F394F			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	673					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CCCTGTACTTCAAGTGCGCGC	0.706																																					GBM(71;463 1194 9848 25922 46834)												0													36.0	36.0	36.0					4																	657657		2202	4300	6502	SO:0001819	synonymous_variant	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2019C>T	4.37:g.657657C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.F673	ENST00000496514.1	37	c.2019	CCDS33932.1	4																																																																																			PDE6B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom		0.706	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	HGNC	protein_coding	OTTHUMT00000358109.1	C	NM_000283		657657	+1	no_errors	ENST00000496514	ensembl	human	known	70_37	silent	SNP	1.000	T
PHF20	51230	genome.wustl.edu	37	20	34435287	34435287	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:34435287G>C	ENST00000374012.3	+	4	400	c.271G>C	c.(271-273)Gag>Cag	p.E91Q	PHF20_ENST00000439301.1_Missense_Mutation_p.E91Q|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	91	Tudor 2.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					TCAAATAAATGAGCAGGTCCT	0.358																																																	0													98.0	91.0	93.0					20																	34435287		2203	4300	6503	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.271G>C	20.37:g.34435287G>C	ENSP00000363124:p.Glu91Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_C2H2	p.E91Q	ENST00000374012.3	37	c.271	CCDS13268.1	20	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199439	0.58126	.	.	ENSG00000025293	ENST00000374012;ENST00000439301;ENST00000339089;ENST00000374000	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.45	4.48	0.54585	Tudor domain (1);	0.335476	0.32884	N	0.005525	T	0.38295	0.1035	L	0.46157	1.445	0.48975	D	0.999737	B	0.18013	0.025	B	0.17722	0.019	T	0.13150	-1.0520	10	0.30854	T	0.27	.	15.8416	0.78848	0.0:0.1409:0.8591:0.0	.	91	Q9BVI0	PHF20_HUMAN	Q	91	ENSP00000363124:E91Q;ENSP00000410373:E91Q;ENSP00000341900:E91Q;ENSP00000363112:E91Q	ENSP00000341900:E91Q	E	+	1	0	PHF20	33898701	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	6.195000	0.72088	1.251000	0.43983	0.467000	0.42956	GAG	PHF20	-	smart_Tudor		0.358	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	G	NM_016436		34435287	+1	no_errors	ENST00000374012	ensembl	human	known	70_37	missense	SNP	1.000	C
PHTF1	10745	genome.wustl.edu	37	1	114254566	114254566	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:114254566G>C	ENST00000369604.1	-	9	1436	c.953C>G	c.(952-954)tCt>tGt	p.S318C	PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369598.1_Missense_Mutation_p.S273C|PHTF1_ENST00000447664.2_3'UTR|PHTF1_ENST00000369600.1_Missense_Mutation_p.S265C|PHTF1_ENST00000369596.2_Missense_Mutation_p.S265C|PHTF1_ENST00000393357.2_Missense_Mutation_p.S318C|PHTF1_ENST00000357783.2_Missense_Mutation_p.S318C			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	318					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATTACCTGAGAGTTTAGGTG	0.333																																																	0													92.0	88.0	90.0					1																	114254566		2203	4300	6503	SO:0001583	missense	10745			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.953C>G	1.37:g.114254566G>C	ENSP00000358617:p.Ser318Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	pfam_TF_homeodomain_male	p.S318C	ENST00000369604.1	37	c.953	CCDS861.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.12|17.12	3.308318|3.308318	0.60305|0.60305	.|.	.|.	ENSG00000116793|ENSG00000116793	ENST00000412670|ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.|.	.|.	.|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.787886	.|0.12562	.|N	.|0.458055	T|T	0.37320|0.37320	0.0999|0.0999	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.49862	.|0.621;0.911;0.929	.|B;P;P	.|0.45829	.|0.219;0.494;0.471	T|T	0.41645|0.41645	-0.9497|-0.9497	5|9	.|0.72032	.|D	.|0.01	-4.9482|-4.9482	17.0498|17.0498	0.86515|0.86515	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|318;73;318	.|Q9UMS5;Q5TCR1;Q9UMS5-2	.|PHTF1_HUMAN;.;.	V|C	74|273;318;265;273;265;318;318	.|.	.|ENSP00000350428:S318C	L|S	-|-	1|2	0|0	PHTF1|PHTF1	114056089|114056089	1.000000|1.000000	0.71417|0.71417	0.939000|0.939000	0.37840|0.37840	0.521000|0.521000	0.34408|0.34408	4.190000|4.190000	0.58365|0.58365	2.703000|2.703000	0.92315|0.92315	0.460000|0.460000	0.39030|0.39030	CTC|TCT	PHTF1	-	NULL		0.333	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	HGNC	protein_coding	OTTHUMT00000032666.1	G	NM_006608		114254566	-1	no_errors	ENST00000369604	ensembl	human	known	70_37	missense	SNP	0.986	C
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PKD2	5311	genome.wustl.edu	37	4	88959628	88959628	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:88959628C>T	ENST00000237596.2	+	4	1135	c.1069C>T	c.(1069-1071)Ccc>Tcc	p.P357S		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		AGATAGGGCTCCCTTTGGGCC	0.458																																																	0													89.0	92.0	91.0					4																	88959628		2203	4300	6503	SO:0001583	missense	5311			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.1069C>T	4.37:g.88959628C>T	ENSP00000237596:p.Pro357Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_HAND_2,prints_PKD_2,prints_PKD_1	p.P357S	ENST00000237596.2	37	c.1069	CCDS3627.1	4	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667199	0.47677	.	.	ENSG00000118762	ENST00000237596	T	0.69685	-0.42	5.75	5.75	0.90469	Polycystin cation channel, PKD1/PKD2 (1);	0.108387	0.64402	D	0.000004	T	0.57562	0.2062	L	0.28504	0.86	0.80722	D	1	B	0.32968	0.392	B	0.30401	0.115	T	0.54036	-0.8353	10	0.31617	T	0.26	-15.1818	19.9598	0.97242	0.0:1.0:0.0:0.0	.	357	Q13563	PKD2_HUMAN	S	357	ENSP00000237596:P357S	ENSP00000237596:P357S	P	+	1	0	PKD2	89178652	1.000000	0.71417	0.992000	0.48379	0.970000	0.65996	3.831000	0.55776	2.716000	0.92895	0.655000	0.94253	CCC	PKD2	-	pfam_PKD1_2_channel		0.458	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4	C	NM_000297		88959628	+1	no_errors	ENST00000237596	ensembl	human	known	70_37	missense	SNP	0.999	T
PKD2	5311	genome.wustl.edu	37	4	88986631	88986631	+	Nonsense_Mutation	SNP	C	C	T	rs121918040		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:88986631C>T	ENST00000508588.1	+	6	873	c.478C>T	c.(478-480)Cga>Tga	p.R160*	PKD2_ENST00000502363.1_Nonsense_Mutation_p.R160*|PKD2_ENST00000511337.1_3'UTR|PKD2_ENST00000237596.2_Nonsense_Mutation_p.R742*			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.R742*(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGACGAACTTCGACAAGATCT	0.403																																																	1	Substitution - Nonsense(1)	endometrium(1)	GRCh37	CM961124	PKD2	M	rs121918040						86.0	82.0	83.0					4																	88986631		2203	4300	6503	SO:0001587	stop_gained	5311			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.478C>T	4.37:g.88986631C>T	ENSP00000427131:p.Arg160*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB08|Q9P0T6|Q9Y3X8	Nonsense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_HAND_2,prints_PKD_2,prints_PKD_1	p.R742*	ENST00000508588.1	37	c.2224		4	.	.	.	.	.	.	.	.	.	.	C	41	8.974909	0.99023	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	.	.	.	5.89	5.05	0.67936	.	0.062020	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2108	14.8891	0.70594	0.0:0.9315:0.0:0.0685	.	.	.	.	X	742;160;160	.	ENSP00000237596:R742X	R	+	1	2	PKD2	89205655	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.802000	0.69122	1.497000	0.48584	0.655000	0.94253	CGA	PKD2	-	NULL		0.403	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000363253.2	C	NM_000297		88986631	+1	no_errors	ENST00000237596	ensembl	human	known	70_37	nonsense	SNP	1.000	T
PLS1	5357	genome.wustl.edu	37	3	142423314	142423314	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:142423314G>C	ENST00000337777.3	+	14	1728	c.1515G>C	c.(1513-1515)ttG>ttC	p.L505F	PLS1_ENST00000457734.2_Missense_Mutation_p.L505F|PLS1_ENST00000497002.1_Missense_Mutation_p.L505F	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	505	Actin-binding 2.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GGTACACATTGAATGTGTTAT	0.294																																																	0													48.0	52.0	51.0					3																	142423314		2203	4295	6498	SO:0001583	missense	5357			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.1515G>C	3.37:g.142423314G>C	ENSP00000336831:p.Leu505Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF-hand,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.L505F	ENST00000337777.3	37	c.1515	CCDS3125.1	3	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010725	0.75046	.	.	ENSG00000120756	ENST00000457734;ENST00000337777;ENST00000497002	D;D;D	0.96011	-3.88;-3.88;-3.88	5.31	5.31	0.75309	Calponin homology domain (1);	0.066042	0.64402	D	0.000009	D	0.95262	0.8463	M	0.74881	2.28	0.80722	D	1	P	0.52316	0.952	P	0.46585	0.521	D	0.95335	0.8433	10	0.87932	D	0	-10.6793	12.6628	0.56824	0.0762:0.0:0.9238:0.0	.	505	Q14651	PLSI_HUMAN	F	505	ENSP00000387890:L505F;ENSP00000336831:L505F;ENSP00000418700:L505F	ENSP00000336831:L505F	L	+	3	2	PLS1	143906004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.006000	0.57083	2.644000	0.89710	0.655000	0.94253	TTG	PLS1	-	superfamily_CH-domain		0.294	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	G	NM_002670		142423314	+1	no_errors	ENST00000337777	ensembl	human	known	70_37	missense	SNP	1.000	C
PODXL	5420	genome.wustl.edu	37	7	131195681	131195681	+	Silent	SNP	C	C	T	rs553481012		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr7:131195681C>T	ENST00000378555.3	-	2	859	c.612G>A	c.(610-612)tcG>tcA	p.S204S	PODXL_ENST00000322985.9_Silent_p.S204S|PODXL_ENST00000465001.1_5'Flank|PODXL_ENST00000541194.1_Silent_p.S206S|PODXL_ENST00000537928.1_Silent_p.S204S			O00592	PODXL_HUMAN	podocalyxin-like	204	Thr-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.S204S(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					GGTCATGTCCCGAGCTTGTTG	0.542													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19425	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)											157.0	137.0	144.0					7																	131195681		2203	4300	6503	SO:0001819	synonymous_variant	5420				CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.612G>A	7.37:g.131195681C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1	p.S206	ENST00000378555.3	37	c.618	CCDS34755.1	7																																																																																			PODXL	-	pirsf_Podocalyxin-like_p1		0.542	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	HGNC	protein_coding	OTTHUMT00000337627.2	C	NM_001018111		131195681	-1	no_errors	ENST00000541194	ensembl	human	known	70_37	silent	SNP	0.000	T
POTEH	23784	genome.wustl.edu	37	22	16287382	16287382	+	Silent	SNP	C	C	T	rs376753969		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:16287382C>T	ENST00000343518.6	-	1	555	c.504G>A	c.(502-504)ccG>ccA	p.P168P		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	168										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CGTGGTACCTCGGCTCCATGA	0.592																																																	0								G		0,3986		0,0,1993	58.0	67.0	64.0		504	-2.8	0.0	22		64	2,7556		1,0,3778	no	coding-synonymous	POTEH	NM_001136213.1		1,0,5771	TT,TC,CC		0.0265,0.0,0.0173		168/546	16287382	2,11542	1993	3779	5772	SO:0001819	synonymous_variant	23784			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.504G>A	22.37:g.16287382C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P168	ENST00000343518.6	37	c.504	CCDS46658.1	22																																																																																			POTEH	-	NULL		0.592	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	C	NM_001136213		16287382	-1	no_errors	ENST00000343518	ensembl	human	known	70_37	silent	SNP	0.000	T
PPAN	56342	genome.wustl.edu	37	19	10220911	10220911	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:10220911C>T	ENST00000253107.7	+	8	917	c.811C>T	c.(811-813)Cgg>Tgg	p.R271W	PPAN_ENST00000393793.1_Missense_Mutation_p.R218W|SNORD105B_ENST00000458770.1_RNA|P2RY11_ENST00000321826.4_5'Flank|PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.R271W|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.R271W|SNORD105_ENST00000386910.1_RNA|PPAN_ENST00000556468.1_Missense_Mutation_p.R271W	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	271	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GAGTGCAGTGCGGCTCACCGA	0.697																																																	0													21.0	26.0	25.0					19																	10220911		2203	4293	6496	SO:0001583	missense	692312			BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.811C>T	19.37:g.10220911C>T	ENSP00000253107:p.Arg271Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	pfam_Brix,pfam_GPCR_Rhodpsn,superfamily_Anticodon-bd,smart_Brix,prints_P2_purnocptor,prints_GPCR_Rhodpsn,pfscan_Brix,pfscan_GPCR_Rhodpsn_7TM	p.R271W	ENST00000253107.7	37	c.811	CCDS12225.1	19	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521881	0.44866	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	4.82	2.63	0.31362	Brix domain (3);	.	.	.	.	T	0.53045	0.1772	M	0.86864	2.845	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.993;0.995;0.995	T	0.58177	-0.7682	9	0.87932	D	0	-29.8598	11.6869	0.51492	0.5112:0.4887:0.0:0.0	.	271;271;271	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	W	271;271;271;271;271;218;209	ENSP00000411918:R271W;ENSP00000377385:R271W;ENSP00000253107:R271W;ENSP00000450710:R271W;ENSP00000377382:R218W	ENSP00000253107:R271W	R	+	1	2	PPAN;PPAN-P2RY11	10081911	0.427000	0.25514	0.291000	0.24904	0.082000	0.17680	-0.034000	0.12225	0.384000	0.24942	0.561000	0.74099	CGG	PPAN-P2RY11	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix		0.697	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAN-P2RY11	HGNC	protein_coding	OTTHUMT00000316658.1	C	NM_020230		10220911	+1	no_errors	ENST00000393796	ensembl	human	known	70_37	missense	SNP	1.000	T
PPM1D	8493	genome.wustl.edu	37	17	58740432	58740432	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:58740432C>G	ENST00000305921.3	+	6	1569	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	446					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			AATGCCTTCTCAGAGAATTTT	0.433											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																																					0													102.0	101.0	102.0					17																	58740432		2203	4300	6503	SO:0001587	stop_gained	8493			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1337C>G	17.37:g.58740432C>G	ENSP00000306682:p.Ser446*	Somatic	1033	WXS	Illumina HiSeq	Phase_IV	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.S446*	ENST00000305921.3	37	c.1337	CCDS11625.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.477159	0.98309	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-12.6116	14.7773	0.69740	0.0:0.9316:0.0:0.0684	.	.	.	.	X	446	.	ENSP00000306682:S446X	S	+	2	0	PPM1D	56095214	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.356000	0.44116	2.894000	0.99253	0.591000	0.81541	TCA	PPM1D	-	NULL		0.433	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	C	NM_003620		58740432	+1	no_errors	ENST00000305921	ensembl	human	known	70_37	nonsense	SNP	1.000	G
PPOX	5498	genome.wustl.edu	37	1	161140467	161140467	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:161140467C>T	ENST00000367999.4	+	11	1422	c.1156C>T	c.(1156-1158)Cag>Tag	p.Q386*	PPOX_ENST00000352210.5_Nonsense_Mutation_p.Q386*|PPOX_ENST00000535223.1_Nonsense_Mutation_p.Q49*|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000544598.1_Nonsense_Mutation_p.Q94*|PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000432542.2_Nonsense_Mutation_p.Q131*	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	386					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGTCTTATCTCAGGAGCTGTT	0.522																																																	0													93.0	95.0	94.0					1																	161140467		2203	4300	6503	SO:0001587	stop_gained	5498			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1156C>T	1.37:g.161140467C>T	ENSP00000356978:p.Gln386*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVG0|Q5VTW8	Nonsense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.Q386*	ENST00000367999.4	37	c.1156	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.761729	0.96906	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000544598;ENST00000435935;ENST00000535223;ENST00000432542	.	.	.	5.96	2.98	0.34508	.	1.129100	0.06367	N	0.712745	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-13.6781	2.6517	0.05001	0.1543:0.5392:0.1489:0.1576	.	.	.	.	X	386;386;94;353;49;131	.	ENSP00000343943:Q386X	Q	+	1	0	PPOX	159407091	0.000000	0.05858	0.787000	0.31911	0.976000	0.68499	0.225000	0.17757	0.372000	0.24591	0.650000	0.86243	CAG	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase		0.522	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	C	NM_000309		161140467	+1	no_errors	ENST00000352210	ensembl	human	known	70_37	nonsense	SNP	0.230	T
PRDM9	56979	genome.wustl.edu	37	5	23509646	23509646	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:23509646G>A	ENST00000296682.3	+	3	319	c.137G>A	c.(136-138)tGg>tAg	p.W46*		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	46	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATGGGAGACTGGGAGAAAACT	0.423										HNSCC(3;0.000094)																																							0													209.0	193.0	198.0					5																	23509646		1877	4119	5996	SO:0001587	stop_gained	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.137G>A	5.37:g.23509646G>A	ENSP00000296682:p.Trp46*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX22|Q27Q50	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.W46*	ENST00000296682.3	37	c.137	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529438	0.85706	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	.	.	.	2.93	2.05	0.26809	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8737	5.9904	0.19458	0.1503:0.0:0.8497:0.0	.	.	.	.	X	46	.	ENSP00000296682:W46X	W	+	2	0	PRDM9	23545403	1.000000	0.71417	0.992000	0.48379	0.819000	0.46315	2.587000	0.46128	0.802000	0.34089	-0.192000	0.12808	TGG	PRDM9	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel		0.423	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	G	NM_020227		23509646	+1	no_errors	ENST00000296682	ensembl	human	known	70_37	nonsense	SNP	0.993	A
PPP2R2B	5521	genome.wustl.edu	37	5	145969475	145969475	+	3'UTR	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:145969475C>T	ENST00000394413.3	-	0	1937				PPP2R2B_ENST00000356826.3_3'UTR|PPP2R2B_ENST00000504198.1_3'UTR|PPP2R2B_ENST00000336640.6_3'UTR|PPP2R2B_ENST00000394414.1_3'UTR|PPP2R2B_ENST00000508545.2_3'UTR|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000453001.1_3'UTR|PPP2R2B_ENST00000394411.4_3'UTR|PPP2R2B_ENST00000394410.2_3'UTR			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACTAGTATTCAGTATGTGAG	0.308																																																	0													66.0	72.0	70.0					5																	145969475		2203	4300	6503	SO:0001624	3_prime_UTR_variant	5521			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.*35G>A	5.37:g.145969475C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	RNA	SNP	-	NULL	ENST00000394413.3	37	NULL	CCDS4284.1	5																																																																																			PPP2R2B	-	-		0.308	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	HGNC	protein_coding	OTTHUMT00000251893.2	C	NM_181678		145969475	-1	no_errors	ENST00000530902	ensembl	human	known	70_37	rna	SNP	1.000	T
PSG8	440533	genome.wustl.edu	37	19	43358124	43358124	+	Intron	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:43358124C>T	ENST00000401467.2	-	1	136				PSG10P_ENST00000597171.1_RNA			Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GGTGAAATTTCCAGTTACTCC	0.507																																																	0																																										SO:0001627	intron_variant	653492			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000401467.2:c.64+1583G>A	19.37:g.43358124C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	RNA	SNP	-	NULL	ENST00000401467.2	37	NULL		19																																																																																			PSG10P	-	-		0.507	PSG8-009	PUTATIVE	basic	protein_coding	PSG10P	HGNC	protein_coding	OTTHUMT00000464525.1	C			43358124	-1	no_errors	ENST00000597171	ensembl	human	known	70_37	rna	SNP	0.002	T
PSMB6	5694	genome.wustl.edu	37	17	4700801	4700801	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:4700801C>G	ENST00000270586.3	+	3	290	c.239C>G	c.(238-240)tCa>tGa	p.S80*		NM_001270481.1|NM_002798.2	NP_001257410.1|NP_002789.1	P28072	PSB6_HUMAN	proteasome (prosome, macropain) subunit, beta type, 6	80					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	endopeptidase activity (GO:0004175)|threonine-type endopeptidase activity (GO:0004298)			endometrium(3)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11						TGCTGTCGCTCAGGCTCAGCT	0.557																																																	0													110.0	95.0	100.0					17																	4700801		2203	4300	6503	SO:0001587	stop_gained	5694			BC000835	CCDS11056.1, CCDS73944.1	17p13	2004-02-18			ENSG00000142507	ENSG00000142507		"""Proteasome (prosome, macropain) subunits"""	9543	protein-coding gene	gene with protein product		600307				8066462, 1888762	Standard	NM_002798		Approved	Y, DELTA	uc002fzb.4	P28072	OTTHUMG00000090777	ENST00000270586.3:c.239C>G	17.37:g.4700801C>G	ENSP00000270586:p.Ser80*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96J55	Nonsense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.S80*	ENST00000270586.3	37	c.239	CCDS11056.1	17	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834582	0.50951	.	.	ENSG00000142507	ENST00000270586	.	.	.	5.65	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.9953	12.3576	0.55184	0.0:0.9198:0.0:0.0802	.	.	.	.	X	80	.	ENSP00000270586:S80X	S	+	2	0	PSMB6	4647759	1.000000	0.71417	0.993000	0.49108	0.231000	0.25187	6.371000	0.73119	1.636000	0.50526	-0.136000	0.14681	TCA	PSMB6	-	pfam_Proteasome_sua/b		0.557	PSMB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB6	HGNC	protein_coding	OTTHUMT00000207559.2	C	NM_002798		4700801	+1	no_errors	ENST00000270586	ensembl	human	known	70_37	nonsense	SNP	0.998	G
PTCHD2	57540	genome.wustl.edu	37	1	11579839	11579839	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:11579839C>T	ENST00000294484.6	+	9	2240	c.2102C>T	c.(2101-2103)tCc>tTc	p.S701F	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S701F	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	701					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CAGCCAGCCTCCAACACGGGC	0.652																																																	0													63.0	75.0	71.0					1																	11579839		2118	4235	6353	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2102C>T	1.37:g.11579839C>T	ENSP00000294484:p.Ser701Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.S701F	ENST00000294484.6	37	c.2102	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	C	6.462	0.453444	0.12283	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.89875	-2.58;-2.58	5.39	4.28	0.50868	.	0.439260	0.26275	N	0.025305	T	0.81508	0.4837	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.21546	0.035	T	0.73864	-0.3848	10	0.59425	D	0.04	-15.5395	12.9152	0.58203	0.0:0.8649:0.0:0.1351	.	701	Q9P2K9	PTHD2_HUMAN	F	701	ENSP00000294484:S701F;ENSP00000374226:S701F	ENSP00000294484:S701F	S	+	2	0	PTCHD2	11502426	0.001000	0.12720	0.010000	0.14722	0.017000	0.09413	1.364000	0.34171	2.498000	0.84270	0.561000	0.74099	TCC	PTCHD2	-	pfam_Patched		0.652	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	C	XM_052561		11579839	+1	no_errors	ENST00000294484	ensembl	human	known	70_37	missense	SNP	0.001	T
PZP	5858	genome.wustl.edu	37	12	9316798	9316798	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:9316798C>T	ENST00000261336.2	-	20	2573	c.2545G>A	c.(2545-2547)Gaa>Aaa	p.E849K	PZP_ENST00000381997.2_Intron|PZP_ENST00000539983.1_5'UTR	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	849					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TAGGATTCTTCTCCCTTTGTA	0.458																																					Melanoma(125;1402 1695 4685 34487 38571)												0													166.0	156.0	159.0					12																	9316798		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2545G>A	12.37:g.9316798C>T	ENSP00000261336:p.Glu849Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E849K	ENST00000261336.2	37	c.2545	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019528	0.35606	.	.	ENSG00000126838	ENST00000261336	T	0.16457	2.34	3.61	-4.51	0.03483	.	1.041780	0.07672	N	0.935614	T	0.16599	0.0399	L	0.60455	1.87	0.09310	N	1	B	0.17268	0.021	B	0.15484	0.013	T	0.36866	-0.9730	10	0.49607	T	0.09	.	9.9563	0.41668	0.0:0.7568:0.1244:0.1187	.	849	P20742	PZP_HUMAN	K	849	ENSP00000261336:E849K	ENSP00000261336:E849K	E	-	1	0	PZP	9208065	0.000000	0.05858	0.000000	0.03702	0.227000	0.25037	-1.537000	0.02206	-0.886000	0.03966	0.467000	0.42956	GAA	PZP	-	pfam_SV_autoAg		0.458	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	C	NM_002864		9316798	-1	no_errors	ENST00000261336	ensembl	human	known	70_37	missense	SNP	0.000	T
RAPGEFL1	51195	genome.wustl.edu	37	17	38340914	38340914	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:38340914G>A	ENST00000456989.2	+	4	410	c.364G>A	c.(364-366)Gag>Aag	p.E122K	RAPGEFL1_ENST00000436615.3_Missense_Mutation_p.E67K|RAPGEFL1_ENST00000544503.1_Missense_Mutation_p.E116K|RAPGEFL1_ENST00000540388.1_3'UTR|RAPGEFL1_ENST00000264644.6_Missense_Mutation_p.E67K			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	273					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						CCAGCTGGTGGAGACGGTGGA	0.582																																					Esophageal Squamous(28;274 750 6870 14218 42203)												0													21.0	19.0	20.0					17																	38340914		2203	4300	6503	SO:0001583	missense	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.364G>A	17.37:g.38340914G>A	ENSP00000394530:p.Glu122Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	p.E67K	ENST00000456989.2	37	c.199		17	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789496	0.70337	.	.	ENSG00000108352	ENST00000456989;ENST00000543876;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615;ENST00000538981	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.26	5.26	0.73747	Ras guanine nucleotide exchange factor, domain (1);	0.190715	0.32372	N	0.006181	T	0.40398	0.1115	N	0.24115	0.695	0.45946	D	0.998774	D	0.61697	0.99	P	0.57620	0.824	T	0.12604	-1.0541	10	0.05351	T	0.99	.	15.7937	0.78388	0.0:0.0:1.0:0.0	.	273	Q9UHV5	RPGFL_HUMAN	K	122;67;116;67;272;67;67	ENSP00000394530:E122K;ENSP00000440226:E67K;ENSP00000438631:E116K;ENSP00000408322:E67K;ENSP00000441059:E67K	ENSP00000264644:E272K	E	+	1	0	RAPGEFL1	35594440	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.585000	0.67497	2.460000	0.83146	0.655000	0.94253	GAG	RAPGEFL1	-	superfamily_Ras_GEF_dom		0.582	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	RAPGEFL1	HGNC	protein_coding	OTTHUMT00000397518.1	G	NM_016339		38340914	+1	no_errors	ENST00000264644	ensembl	human	known	70_37	missense	SNP	1.000	A
RBM24	221662	genome.wustl.edu	37	6	17292448	17292449	+	3'UTR	INS	-	-	AAA	rs376476676|rs552369365		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:17292448_17292449insAAA	ENST00000379052.5	+	0	1045_1046				RBM24_ENST00000318204.5_3'UTR|RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000425446.2_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24						cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TTAACAGCTTTAAAAAAAAAAA	0.342																																																	0																																										SO:0001624	3_prime_UTR_variant	221662			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.*99->AAA	6.37:g.17292455_17292457dupAAA		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	RNA	INS	-	NULL	ENST00000379052.5	37	NULL	CCDS47378.1	6																																																																																			RBM24	-	-		0.342	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2	-	NM_153020		17292449	+1	no_errors	ENST00000504055	ensembl	human	known	70_37	rna	INS	0.997:0.915	AAA
RCOR2	283248	genome.wustl.edu	37	11	63682379	63682379	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:63682379C>G	ENST00000301459.4	-	4	700	c.313G>C	c.(313-315)Gag>Cag	p.E105Q	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	105	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						CTCACCTGCTCAATGTTGTAG	0.632																																																	0													120.0	105.0	110.0					11																	63682379		2201	4297	6498	SO:0001583	missense	283248			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.313G>C	11.37:g.63682379C>G	ENSP00000301459:p.Glu105Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96FP3	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.E105Q	ENST00000301459.4	37	c.313	CCDS8052.1	11	.	.	.	.	.	.	.	.	.	.	c	28.7	4.943877	0.92593	.	.	ENSG00000167771	ENST00000301459	T	0.42900	0.96	4.65	4.65	0.58169	ELM2 domain (1);	0.126233	0.51477	D	0.000087	T	0.64136	0.2571	M	0.72894	2.215	0.58432	D	0.999998	D	0.71674	0.998	D	0.75484	0.986	T	0.68834	-0.5304	10	0.72032	D	0.01	.	16.6727	0.85271	0.0:1.0:0.0:0.0	.	105	Q8IZ40	RCOR2_HUMAN	Q	105	ENSP00000301459:E105Q	ENSP00000301459:E105Q	E	-	1	0	RCOR2	63438955	1.000000	0.71417	0.964000	0.40570	0.985000	0.73830	7.715000	0.84713	2.289000	0.77006	0.556000	0.70494	GAG	RCOR2	-	pfscan_ELM2_dom		0.632	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCOR2	HGNC	protein_coding	OTTHUMT00000318233.1	C	NM_173587		63682379	-1	no_errors	ENST00000301459	ensembl	human	known	70_37	missense	SNP	1.000	G
RFFL	117584	genome.wustl.edu	37	17	33353531	33353531	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:33353531C>G	ENST00000315249.7	-	2	264	c.42G>C	c.(40-42)caG>caC	p.Q14H	RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000394597.2_Missense_Mutation_p.Q14H|RFFL_ENST00000378516.2_Missense_Mutation_p.Q14H|RFFL_ENST00000584655.1_Missense_Mutation_p.Q14H|RFFL_ENST00000268850.7_Missense_Mutation_p.Q14H|RFFL_ENST00000447669.2_Missense_Mutation_p.Q14H|RFFL_ENST00000413582.2_Missense_Mutation_p.Q14H|RFFL_ENST00000415395.2_Missense_Mutation_p.Q14H					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCTCCTCAGGCTGTCCATCCA	0.562																																																	0													56.0	47.0	50.0					17																	33353531		2203	4300	6503	SO:0001583	missense	117584			AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.42G>C	17.37:g.33353531C>G	ENSP00000326170:p.Gln14His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_RING,pfscan_Znf_RING	p.Q14H	ENST00000315249.7	37	c.42	CCDS11286.1	17	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616797	0.28801	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850;ENST00000413582;ENST00000415395;ENST00000414419;ENST00000447669	T;T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.32	2.07	0.26955	Zinc finger, FYVE/PHD-type (1);	0.453537	0.24048	N	0.042030	T	0.57227	0.2039	N	0.22421	0.69	0.27636	N	0.947869	B;B;B;B	0.11235	0.004;0.002;0.004;0.002	B;B;B;B	0.09377	0.004;0.004;0.002;0.004	T	0.49041	-0.8980	10	0.56958	D	0.05	-16.4146	0.9865	0.01447	0.1588:0.3755:0.1375:0.3282	.	14;14;14;14	C9JN73;Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;.;RFFL_HUMAN;.	H	14	ENSP00000326170:Q14H;ENSP00000378096:Q14H;ENSP00000367777:Q14H;ENSP00000268850:Q14H;ENSP00000408513:Q14H;ENSP00000412322:Q14H;ENSP00000395090:Q14H;ENSP00000389832:Q14H	ENSP00000268850:Q14H	Q	-	3	2	RFFL	30377644	0.999000	0.42202	1.000000	0.80357	0.891000	0.51852	0.534000	0.23098	0.821000	0.34540	-0.142000	0.14014	CAG	RFFL	-	superfamily_Znf_FYVE_PHD		0.562	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFFL	HGNC	protein_coding	OTTHUMT00000256460.2	C	NM_057178		33353531	-1	no_errors	ENST00000315249	ensembl	human	known	70_37	missense	SNP	0.999	G
RFX4	5992	genome.wustl.edu	37	12	107126766	107126766	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:107126766G>A	ENST00000392842.1	+	15	1950	c.1536G>A	c.(1534-1536)tcG>tcA	p.S512S	RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000229387.5_Silent_p.S418S|RFX4_ENST00000357881.4_Silent_p.S521S|RP11-482D24.3_ENST00000552415.1_RNA	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	512					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						CAGTGCCATCGTTTTCTCCAG	0.502																																																	0													156.0	142.0	147.0					12																	107126766		2203	4300	6503	SO:0001819	synonymous_variant	5992			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.1536G>A	12.37:g.107126766G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Silent	SNP	pfam_DNA-bd_RFX	p.S521	ENST00000392842.1	37	c.1563	CCDS9106.1	12																																																																																			RFX4	-	NULL		0.502	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	G	NM_032491		107126766	+1	no_errors	ENST00000357881	ensembl	human	known	70_37	silent	SNP	0.036	A
RIMS2	9699	genome.wustl.edu	37	8	105010465	105010465	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:105010465C>T	ENST00000436393.2	+	16	2672	c.2431C>T	c.(2431-2433)Cac>Tac	p.H811Y	RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000507740.1_Missense_Mutation_p.H825Y|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1095	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TGACCATCATCACAGGGATGG	0.363										HNSCC(12;0.0054)																																							0													126.0	110.0	115.0					8																	105010465		1883	4105	5988	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2431C>T	8.37:g.105010465C>T	ENSP00000390665:p.His811Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.H811Y	ENST00000436393.2	37	c.2431		8	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780898	0.49891	.	.	ENSG00000176406	ENST00000329869;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T	0.18657	2.31;2.2;2.66	4.81	4.81	0.61882	.	.	.	.	.	T	0.06781	0.0173	N	0.00186	-1.895	0.80722	D	1	B;B	0.18310	0.0;0.027	B;B	0.19946	0.001;0.027	T	0.38693	-0.9649	9	0.51188	T	0.08	.	16.8103	0.85717	0.0:1.0:0.0:0.0	.	811;825	D6RA03;Q9UQ26-3	.;.	Y	1048;825;825;811	ENSP00000423559:H825Y;ENSP00000386228:H825Y;ENSP00000390665:H811Y	ENSP00000332184:H1048Y	H	+	1	0	RIMS2	105079641	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.127000	0.57944	2.496000	0.84212	0.650000	0.86243	CAC	RIMS2	-	NULL		0.363	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	C	NM_001100117		105010465	+1	no_errors	ENST00000436393	ensembl	human	novel	70_37	missense	SNP	1.000	T
RNF207	388591	genome.wustl.edu	37	1	6270935	6270935	+	Silent	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:6270935G>C	ENST00000377939.4	+	11	1075	c.948G>C	c.(946-948)ctG>ctC	p.L316L	RNF207_ENST00000377948.2_Intron	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	316						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CACAGGAGCTGATGGAGAGGC	0.677																																																	0													15.0	20.0	18.0					1																	6270935		2107	4214	6321	SO:0001819	synonymous_variant	388591			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.948G>C	1.37:g.6270935G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Silent	SNP	pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.L316	ENST00000377939.4	37	c.948	CCDS59.2	1																																																																																			RNF207	-	NULL		0.677	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF207	HGNC	protein_coding	OTTHUMT00000003669.2	G	NM_207396		6270935	+1	no_errors	ENST00000377939	ensembl	human	novel	70_37	silent	SNP	1.000	C
RNPEP	6051	genome.wustl.edu	37	1	201970518	201970518	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:201970518G>A	ENST00000295640.4	+	7	1262	c.1219G>A	c.(1219-1221)Gac>Aac	p.D407N	RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000419190.1_RNA|RP11-465N4.4_ENST00000415582.1_RNA|RNPEP_ENST00000367286.3_Missense_Mutation_p.D368N	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	407					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		TGACCCGGACGACACCTATAA	0.488																																					GBM(19;39 479 7473 13131 19462)												0													98.0	84.0	89.0					1																	201970518		2203	4300	6503	SO:0001583	missense	6051			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1219G>A	1.37:g.201970518G>A	ENSP00000295640:p.Asp407Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BVM9|Q9H1D4|Q9NPT7	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.D407N	ENST00000295640.4	37	c.1219	CCDS1418.1	1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727504	0.69074	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312;ENST00000449524	T;T;T;T	0.04809	4.18;4.18;4.18;3.55	5.71	5.71	0.89125	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.058683	0.64402	D	0.000005	T	0.14227	0.0344	M	0.77406	2.37	0.58432	D	0.999997	P;P	0.52842	0.956;0.956	P;P	0.47376	0.545;0.545	T	0.00326	-1.1815	10	0.54805	T	0.06	-39.9967	18.6362	0.91379	0.0:0.0:1.0:0.0	.	415;407	Q7RU04;Q9H4A4	.;AMPB_HUMAN	N	407;368;276;115	ENSP00000295640:D407N;ENSP00000356255:D368N;ENSP00000389602:D276N;ENSP00000407614:D115N	ENSP00000295640:D407N	D	+	1	0	RNPEP	200237141	0.999000	0.42202	0.432000	0.26747	0.167000	0.22549	3.782000	0.55401	2.684000	0.91462	0.561000	0.74099	GAC	RNPEP	-	pfam_Peptidase_M1_N		0.488	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNPEP	HGNC	protein_coding	OTTHUMT00000087345.1	G	NM_020216		201970518	+1	no_errors	ENST00000295640	ensembl	human	known	70_37	missense	SNP	0.931	A
RPS3A	6189	genome.wustl.edu	37	4	152022192	152022192	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:152022192G>A	ENST00000274065.4	+	3	312	c.232G>A	c.(232-234)Gaa>Aaa	p.E78K	SNORD73A_ENST00000386062.1_RNA|RPS3A_ENST00000512690.1_Missense_Mutation_p.E78K|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000514682.1_Missense_Mutation_p.E41K|RPS3A_ENST00000322686.6_Missense_Mutation_p.E65K|RPS3A_ENST00000509736.1_Intron|RPS3A_ENST00000506126.1_Missense_Mutation_p.E41K	NM_001006.4	NP_000997.1			ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					GCAGAATGATGAAGTTGCATT	0.373																																																	0													43.0	45.0	45.0					4																	152022192		2160	4271	6431	SO:0001583	missense	6189			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000274065.4:c.232G>A	4.37:g.152022192G>A	ENSP00000346050:p.Glu78Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_S3Ae	p.E78K	ENST00000274065.4	37	c.232	CCDS3775.1	4	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637649	0.87760	.	.	ENSG00000145425	ENST00000274065;ENST00000505243;ENST00000514682;ENST00000322686;ENST00000503002;ENST00000508783;ENST00000507327;ENST00000506126;ENST00000510993	.	.	.	5.54	4.69	0.59074	.	0.000000	0.34555	N	0.003871	T	0.72463	0.3463	M	0.86953	2.85	0.80722	D	1	P	0.40144	0.704	B	0.43701	0.428	T	0.77803	-0.2451	9	0.62326	D	0.03	.	15.8379	0.78814	0.0:0.0:0.8632:0.1368	.	78	P61247	RS3A_HUMAN	K	78;41;41;65;41;41;41;41;58	.	ENSP00000346050:E78K	E	+	1	0	RPS3A	152241642	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.857000	0.99534	1.331000	0.45412	0.555000	0.69702	GAA	RPS3A	-	pfam_Ribosomal_S3Ae		0.373	RPS3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS3A	HGNC	protein_coding	OTTHUMT00000364957.1	G			152022192	+1	no_errors	ENST00000274065	ensembl	human	known	70_37	missense	SNP	1.000	A
RTTN	25914	genome.wustl.edu	37	18	67718769	67718769	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr18:67718769G>C	ENST00000255674.6	-	39	5487	c.5201C>G	c.(5200-5202)tCa>tGa	p.S1734*	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1734					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				ATAAAAAGCTGATATTAACTC	0.378																																																	0													54.0	49.0	51.0					18																	67718769		1836	4096	5932	SO:0001587	stop_gained	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.5201C>G	18.37:g.67718769G>C	ENSP00000255674:p.Ser1734*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.S1734*	ENST00000255674.6	37	c.5201	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	G	46	12.550868	0.99677	.	.	ENSG00000176225	ENST00000255674	.	.	.	5.66	1.37	0.22104	.	1.164570	0.06030	N	0.652882	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	6.2902	0.21054	0.2499:0.0:0.6099:0.1402	.	.	.	.	X	1734	.	ENSP00000255674:S1734X	S	-	2	0	RTTN	65869749	0.000000	0.05858	0.001000	0.08648	0.981000	0.71138	0.280000	0.18790	0.325000	0.23359	0.650000	0.86243	TCA	RTTN	-	NULL		0.378	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	G	NM_173630		67718769	-1	no_errors	ENST00000255674	ensembl	human	known	70_37	nonsense	SNP	0.000	C
S100A9	6280	genome.wustl.edu	37	1	153330788	153330788	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:153330788G>C	ENST00000368738.3	+	2	72	c.29G>C	c.(28-30)cGc>cCc	p.R10P		NM_002965.3	NP_002956.1	P06702	S10A9_HUMAN	S100 calcium binding protein A9	10					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|chemokine production (GO:0032602)|chronic inflammatory response (GO:0002544)|cytokine production (GO:0001816)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|neutrophil aggregation (GO:0070488)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell growth (GO:0030307)|positive regulation of inflammatory response (GO:0050729)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of cytoskeleton organization (GO:0051493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to zinc ion (GO:0010043)|sequestering of zinc ion (GO:0032119)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	antioxidant activity (GO:0016209)|arachidonic acid binding (GO:0050544)|calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|RAGE receptor binding (GO:0050786)|signal transducer activity (GO:0004871)|Toll-like receptor 4 binding (GO:0035662)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGCTGGAACGCAACATAGAG	0.478																																																	0													112.0	100.0	104.0					1																	153330788		2203	4300	6503	SO:0001583	missense	6280			BC047681	CCDS1036.1	1q21	2013-01-10	2006-09-11		ENSG00000163220	ENSG00000163220		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10499	protein-coding gene	gene with protein product		123886	"""S100 calcium-binding protein A9 (calgranulin B)"", ""S100 calcium binding protein A9 (calgranulin B)"""	CAGB, CFAG			Standard	NM_002965		Approved	P14, MIF, NIF, LIAG, MRP14, MAC387, 60B8AG, CGLB	uc001fbq.3	P06702	OTTHUMG00000013125	ENST00000368738.3:c.29G>C	1.37:g.153330788G>C	ENSP00000357727:p.Arg10Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DV36|Q6FGA1|Q9NYM0|Q9UCJ1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.R10P	ENST00000368738.3	37	c.29	CCDS1036.1	1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069951	0.36566	.	.	ENSG00000163220	ENST00000368738	T	0.11277	2.79	4.45	-3.42	0.04825	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	2.040550	0.01851	N	0.035918	T	0.06690	0.0171	M	0.64404	1.975	0.09310	N	1	D	0.53885	0.963	P	0.49502	0.613	T	0.18903	-1.0322	10	0.37606	T	0.19	.	6.12	0.20148	0.58:0.1528:0.2672:0.0	.	10	P06702	S10A9_HUMAN	P	10	ENSP00000357727:R10P	ENSP00000357727:R10P	R	+	2	0	S100A9	151597412	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.075000	0.11431	-0.570000	0.06022	0.462000	0.41574	CGC	S100A9	-	pfam_S100_Ca-bd_sub		0.478	S100A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A9	HGNC	protein_coding	OTTHUMT00000036793.1	G	NM_002965		153330788	+1	no_errors	ENST00000368738	ensembl	human	known	70_37	missense	SNP	0.000	C
CIB1	10519	genome.wustl.edu	37	15	90771715	90771715	+	IGR	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:90771715G>A	ENST00000328649.6	-	0	1247				SEMA4B_ENST00000411539.2_Missense_Mutation_p.R785Q|SEMA4B_ENST00000379122.3_Intron|SEMA4B_ENST00000332496.6_Missense_Mutation_p.R785Q	NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CTCGATCACCGAGGGTACCAG	0.647																																																	0													20.0	23.0	22.0					15																	90771715		1935	4117	6052	SO:0001628	intergenic_variant	10509			U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808		15.37:g.90771715G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.R785Q	ENST00000328649.6	37	c.2354	CCDS10360.1	15	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892552	0.33442	.	.	ENSG00000185033	ENST00000332496;ENST00000411539	T;T	0.77620	-1.11;-1.11	4.75	1.85	0.25348	.	0.142348	0.44688	N	0.000422	T	0.48466	0.1501	N	0.03608	-0.345	0.80722	D	1	B;B	0.30741	0.293;0.293	B;B	0.17098	0.017;0.017	T	0.47341	-0.9125	10	0.72032	D	0.01	.	5.6077	0.17389	0.4676:0.0:0.5324:0.0	.	785;780	Q2NL81;Q9NPR2	.;SEM4B_HUMAN	Q	785	ENSP00000332204:R785Q;ENSP00000394720:R785Q	ENSP00000332204:R785Q	R	+	2	0	SEMA4B	88572719	1.000000	0.71417	0.998000	0.56505	0.204000	0.24138	4.595000	0.61048	0.719000	0.32188	0.561000	0.74099	CGA	SEMA4B	-	NULL		0.647	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4B	HGNC	protein_coding	OTTHUMT00000313419.1	G			90771715	+1	no_errors	ENST00000332496	ensembl	human	known	70_37	missense	SNP	1.000	A
SENP1	29843	genome.wustl.edu	37	12	48477376	48477376	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:48477376C>T	ENST00000004980.5	-	6	1028	c.550G>A	c.(550-552)Gag>Aag	p.E184K	SENP1_ENST00000549595.1_Missense_Mutation_p.E184K|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000448372.1_Missense_Mutation_p.E184K|RNU6-1203P_ENST00000410703.1_RNA|SENP1_ENST00000547886.1_5'UTR|SENP1_ENST00000551330.1_Missense_Mutation_p.E184K|SENP1_ENST00000549518.1_Missense_Mutation_p.E184K			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	184					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TTCCTTACCTCTTCTGCTGTA	0.403																																																	0													106.0	101.0	102.0					12																	48477376		1866	4093	5959	SO:0001583	missense	29843			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.550G>A	12.37:g.48477376C>T	ENSP00000004980:p.Glu184Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7P5|Q86XC8	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.E184K	ENST00000004980.5	37	c.550	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829037	0.90955	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.30981	1.52;1.51;1.52;1.51;1.52	3.96	3.96	0.45880	.	0.062472	0.64402	N	0.000011	T	0.42017	0.1184	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.76071	0.971;0.987	T	0.13818	-1.0495	10	0.25106	T	0.35	-12.0609	16.9143	0.86147	0.0:1.0:0.0:0.0	.	184;184	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	K	184	ENSP00000004980:E184K;ENSP00000394791:E184K;ENSP00000446681:E184K;ENSP00000450076:E184K;ENSP00000447328:E184K	ENSP00000004980:E184K	E	-	1	0	SENP1	46763643	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.577000	0.60922	2.508000	0.84585	0.655000	0.94253	GAG	SENP1	-	NULL		0.403	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	C	NM_014554		48477376	-1	no_errors	ENST00000004980	ensembl	human	known	70_37	missense	SNP	1.000	T
SENP7	57337	genome.wustl.edu	37	3	101056409	101056409	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:101056409G>C	ENST00000394095.2	-	17	2477	c.2424C>G	c.(2422-2424)ttC>ttG	p.F808L	SENP7_ENST00000394094.2_Missense_Mutation_p.F743L|SENP7_ENST00000358203.3_Missense_Mutation_p.F644L|SENP7_ENST00000348610.3_Missense_Mutation_p.F775L|SENP7_ENST00000314261.7_Missense_Mutation_p.F742L|SENP7_ENST00000394091.1_Missense_Mutation_p.F644L	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	808	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AGCATTTATAGAAAAAGCTAC	0.289																																																	0													61.0	65.0	64.0					3																	101056409		2203	4299	6502	SO:0001583	missense	57337				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2424C>G	3.37:g.101056409G>C	ENSP00000377655:p.Phe808Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.F808L	ENST00000394095.2	37	c.2424	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233458	0.79688	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	5.68	3.56	0.40772	.	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.89163	3.01	0.49687	D	0.999814	D;D;D;D	0.89917	1.0;0.999;1.0;0.986	D;D;D;D	0.91635	0.997;0.993;0.999;0.98	T	0.73458	-0.3976	10	0.87932	D	0	-9.3831	11.3123	0.49370	0.17:0.0:0.83:0.0	.	644;742;775;808	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	L	808;743;742;644;644;775	ENSP00000377655:F808L;ENSP00000377654:F743L;ENSP00000313624:F742L;ENSP00000377651:F644L;ENSP00000350936:F644L;ENSP00000342159:F775L	ENSP00000313624:F742L	F	-	3	2	SENP7	102539099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.593000	0.54001	1.391000	0.46566	0.655000	0.94253	TTC	SENP7	-	pfam_Peptidase_C48,pfscan_Peptidase_C48		0.289	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	HGNC	protein_coding	OTTHUMT00000313957.2	G	NM_020654		101056409	-1	no_errors	ENST00000394095	ensembl	human	known	70_37	missense	SNP	1.000	C
SEPT3	55964	genome.wustl.edu	37	22	42383277	42383277	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:42383277C>G	ENST00000396426.3	+	4	654	c.399C>G	c.(397-399)atC>atG	p.I133M	SEPT3_ENST00000396425.3_Missense_Mutation_p.I133M|SEPT3_ENST00000328414.8_Intron|SEPT3_ENST00000406029.1_Missense_Mutation_p.I69M|SEPT3_ENST00000291236.11_Missense_Mutation_p.I69M	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	133	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						GAGACCAAATCAACAATGAAA	0.468																																																	0													86.0	82.0	83.0					22																	42383277		2203	4300	6503	SO:0001583	missense	55964			AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.399C>G	22.37:g.42383277C>G	ENSP00000379704:p.Ile133Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1,pirsf_Septin,prints_Septin3	p.I133M	ENST00000396426.3	37	c.399	CCDS14026.2	22	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646445	0.67358	.	.	ENSG00000100167	ENST00000449288;ENST00000396426;ENST00000406029;ENST00000396425;ENST00000291236	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.70971	0.3285	M	0.75150	2.29	0.80722	D	1	D;D;D;D	0.69078	0.997;0.996;0.997;0.997	D;D;D;D	0.83275	0.995;0.979;0.991;0.996	T	0.73827	-0.3860	10	0.87932	D	0	.	12.7071	0.57067	0.0:0.9245:0.0:0.0755	.	69;69;133;133	B7Z686;B1AHR1;Q9UH03-2;Q9UH03	.;.;.;SEPT3_HUMAN	M	120;133;69;133;69	ENSP00000391416:I120M;ENSP00000379704:I133M;ENSP00000383956:I69M;ENSP00000379703:I133M;ENSP00000291236:I69M	ENSP00000291236:I69M	I	+	3	3	SEPT3	40713223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.531000	0.36018	2.656000	0.90262	0.650000	0.86243	ATC	SEPT3	-	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1,pirsf_Septin		0.468	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT3	HGNC	protein_coding	OTTHUMT00000322051.1	C	NM_145734		42383277	+1	no_errors	ENST00000396426	ensembl	human	known	70_37	missense	SNP	1.000	G
SFXN4	119559	genome.wustl.edu	37	10	120920455	120920455	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:120920455G>T	ENST00000355697.2	-	5	325	c.306C>A	c.(304-306)aaC>aaA	p.N102K	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Missense_Mutation_p.N93K	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	102					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		TGGGGATCAGGTTGCTGCTGT	0.448																																																	0													174.0	169.0	171.0					10																	120920455		2203	4300	6503	SO:0001583	missense	119559				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.306C>A	10.37:g.120920455G>T	ENSP00000347924:p.Asn102Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6WSU4|Q86TD9	Missense_Mutation	SNP	pfam_Mtc	p.N102K	ENST00000355697.2	37	c.306	CCDS7610.1	10	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.053121	0.00394	.	.	ENSG00000183605	ENST00000355697;ENST00000330036	T;T	0.27402	1.67;1.67	5.09	-9.82	0.00484	.	1.021060	0.07798	N	0.955948	T	0.13500	0.0327	N	0.12746	0.255	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.35276	-0.9795	10	0.40728	T	0.16	-6.9813	9.9765	0.41786	0.0886:0.7169:0.0875:0.1069	.	102	Q6P4A7	SFXN4_HUMAN	K	102;93	ENSP00000347924:N102K;ENSP00000333200:N93K	ENSP00000333200:N93K	N	-	3	2	SFXN4	120910445	0.081000	0.21417	0.267000	0.24556	0.210000	0.24377	-0.770000	0.04705	-1.355000	0.02186	-1.085000	0.02201	AAC	SFXN4	-	pfam_Mtc		0.448	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	HGNC	protein_coding	OTTHUMT00000050642.3	G	XM_058406		120920455	-1	no_errors	ENST00000355697	ensembl	human	known	70_37	missense	SNP	0.015	T
SH3RF1	57630	genome.wustl.edu	37	4	170038882	170038882	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:170038882C>G	ENST00000284637.9	-	9	1910	c.1569G>C	c.(1567-1569)caG>caC	p.Q523H	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	523	Interaction with AKT2. {ECO:0000250}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CCCGACTTGTCTGGCCAGCTG	0.567																																																	0													49.0	48.0	48.0					4																	170038882		2203	4300	6503	SO:0001583	missense	57630			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.1569G>C	4.37:g.170038882C>G	ENSP00000284637:p.Gln523His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.Q523H	ENST00000284637.9	37	c.1569	CCDS34099.1	4	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899226	0.33535	.	.	ENSG00000154447	ENST00000284637	T	0.14022	2.54	5.72	3.98	0.46160	Src homology-3 domain (1);	0.107657	0.64402	D	0.000004	T	0.14527	0.0351	L	0.52573	1.65	0.40271	D	0.978283	D	0.56521	0.976	P	0.47744	0.556	T	0.16630	-1.0396	10	0.14656	T	0.56	-10.9323	7.6051	0.28097	0.0:0.6974:0.0:0.3026	.	523	Q7Z6J0	SH3R1_HUMAN	H	523	ENSP00000284637:Q523H	ENSP00000284637:Q523H	Q	-	3	2	SH3RF1	170275457	0.992000	0.36948	0.163000	0.22734	0.130000	0.20726	0.855000	0.27805	0.751000	0.32900	0.561000	0.74099	CAG	SH3RF1	-	superfamily_SH3_domain		0.567	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3	C	NM_020870		170038882	-1	no_errors	ENST00000284637	ensembl	human	known	70_37	missense	SNP	0.799	G
SIGLEC6	946	genome.wustl.edu	37	19	52033111	52033111	+	Silent	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:52033111C>G	ENST00000425629.3	-	5	1033	c.879G>C	c.(877-879)ctG>ctC	p.L293L	SIGLEC6_ENST00000436458.1_Silent_p.L241L|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000343300.4_Silent_p.L293L|SIGLEC6_ENST00000359982.4_Silent_p.L304L|SIGLEC6_ENST00000391797.3_Silent_p.L282L|SIGLEC6_ENST00000346477.3_Silent_p.L277L	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	293	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GGGTGGCGTTCAGGGCGGGGA	0.642																																																	0													59.0	68.0	65.0					19																	52033111		2197	4295	6492	SO:0001819	synonymous_variant	946			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.879G>C	19.37:g.52033111C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L293	ENST00000425629.3	37	c.879	CCDS12834.3	19																																																																																			SIGLEC6	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.642	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	C	NM_001245		52033111	-1	no_errors	ENST00000425629	ensembl	human	known	70_37	silent	SNP	0.000	G
SIK1	150094	genome.wustl.edu	37	21	44839823	44839823	+	Silent	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr21:44839823G>C	ENST00000270162.6	-	9	1167	c.1035C>G	c.(1033-1035)ctC>ctG	p.L345L		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	345					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GATACTCCTTGAGCCGCTCAA	0.607																																																	0													45.0	43.0	44.0					21																	44839823		2200	4296	6496	SO:0001819	synonymous_variant	150094			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1035C>G	21.37:g.44839823G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L345	ENST00000270162.6	37	c.1035	CCDS33575.1	21																																																																																			SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2		0.607	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1	G	NM_173354		44839823	-1	no_errors	ENST00000270162	ensembl	human	known	70_37	silent	SNP	1.000	C
SLC24A1	9187	genome.wustl.edu	37	15	65942798	65942798	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:65942798G>A	ENST00000261892.6	+	7	2598	c.2311G>A	c.(2311-2313)Gag>Aag	p.E771K	SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000339868.6_Missense_Mutation_p.E753K|SLC24A1_ENST00000546330.1_Missense_Mutation_p.E753K|SLC24A1_ENST00000544319.2_Missense_Mutation_p.E657K|SLC24A1_ENST00000399033.4_Missense_Mutation_p.E771K|SLC24A1_ENST00000537259.1_Missense_Mutation_p.E753K	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	771					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						tgaaactgaagagaaaagtgg	0.463																																																	0													74.0	80.0	78.0					15																	65942798		1490	2942	4432	SO:0001583	missense	9187			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2311G>A	15.37:g.65942798G>A	ENSP00000261892:p.Glu771Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O43485|O75184|Q17RM9	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K/Na/Ca-exchanger	p.E771K	ENST00000261892.6	37	c.2311	CCDS45284.1	15	.	.	.	.	.	.	.	.	.	.	g	13.25	2.182429	0.38511	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.65732	0.04;-0.13;-0.17;2.0;-0.11;-0.17	3.32	2.38	0.29361	.	1.905410	0.02186	N	0.060889	T	0.55369	0.1916	L	0.50333	1.59	0.09310	N	1	B;B;B;B;B;B	0.32829	0.267;0.386;0.267;0.267;0.386;0.267	B;B;B;B;B;B	0.25291	0.026;0.058;0.026;0.026;0.058;0.059	T	0.35525	-0.9785	10	0.18276	T	0.48	.	9.9936	0.41885	0.0:0.2092:0.7908:0.0	.	98;753;771;771;753;753	B4DUG1;O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;.;NCKX1_HUMAN;.;.	K	753;771;753;657;771;753	ENSP00000439693:E753K;ENSP00000261892:E771K;ENSP00000341837:E753K;ENSP00000445163:E657K;ENSP00000381991:E771K;ENSP00000439190:E753K	ENSP00000261892:E771K	E	+	1	0	SLC24A1	63729852	0.499000	0.26083	0.012000	0.15200	0.255000	0.26057	0.982000	0.29539	0.577000	0.29470	0.289000	0.19496	GAG	SLC24A1	-	tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K/Na/Ca-exchanger		0.463	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	G	NM_004727		65942798	+1	no_errors	ENST00000261892	ensembl	human	known	70_37	missense	SNP	0.044	A
SLC25A35	399512	genome.wustl.edu	37	17	8197763	8197763	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:8197763G>A	ENST00000577745.1	-	1	873	c.363C>T	c.(361-363)agC>agT	p.S121S	SLC25A35_ENST00000396278.1_Silent_p.S121S|SLC25A35_ENST00000579192.1_Silent_p.S121S|SLC25A35_ENST00000580340.1_Silent_p.S121S|SLC25A35_ENST00000380067.2_Silent_p.S121S			Q3KQZ1	S2535_HUMAN	solute carrier family 25, member 35	121					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(2)|large_intestine(2)|lung(2)	6						TGTAGATGGGGCTCCCCAAGT	0.617																																																	0													24.0	23.0	23.0					17																	8197763		2181	4252	6433	SO:0001819	synonymous_variant	399512			AY498866	CCDS11138.1	17p13.1	2013-05-22			ENSG00000125434	ENSG00000125434		"""Solute carriers"""	31921	protein-coding gene	gene with protein product		610818					Standard	NM_201520		Approved	FLJ40217	uc002gku.1	Q3KQZ1		ENST00000577745.1:c.363C>T	17.37:g.8197763G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q494X5|Q6RGS3|Q8N7Y5	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.S121	ENST00000577745.1	37	c.363		17																																																																																			SLC25A35	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.617	SLC25A35-002	KNOWN	basic|appris_principal	protein_coding	SLC25A35	HGNC	protein_coding	OTTHUMT00000442146.1	G	NM_201520		8197763	-1	no_errors	ENST00000577745	ensembl	human	known	70_37	silent	SNP	1.000	A
SLC39A7	7922	genome.wustl.edu	37	6	33169070	33169070	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:33169070G>A	ENST00000374677.3	+	1	421	c.48G>A	c.(46-48)ctG>ctA	p.L16L	RXRB_ENST00000374685.4_5'Flank|RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000413614.2_5'Flank|SLC39A7_ENST00000374675.3_Silent_p.L16L|RXRB_ENST00000374680.3_5'Flank|RNY4P10_ENST00000365571.1_RNA	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7	16					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGGGACTGCTGACCTGGGCGA	0.637																																																	0													56.0	67.0	64.0					6																	33169070		1991	4159	6150	SO:0001819	synonymous_variant	7922			AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.48G>A	6.37:g.33169070G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0UXF6|Q5STP8|Q9UIQ0	Silent	SNP	pfam_ZIP,prints_Kininogen	p.L16	ENST00000374677.3	37	c.48	CCDS43453.1	6																																																																																			SLC39A7	-	NULL		0.637	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A7	HGNC	protein_coding	OTTHUMT00000076499.2	G	NM_006979		33169070	+1	no_errors	ENST00000374675	ensembl	human	known	70_37	silent	SNP	1.000	A
SLC41A3	54946	genome.wustl.edu	37	3	125745256	125745256	+	Missense_Mutation	SNP	C	C	G	rs373931665		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:125745256C>G	ENST00000315891.6	-	5	758	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	SLC41A3_ENST00000508835.1_Missense_Mutation_p.E57Q|SLC41A3_ENST00000514023.1_5'UTR|SLC41A3_ENST00000383598.2_Missense_Mutation_p.E148Q|SLC41A3_ENST00000346785.5_Missense_Mutation_p.E138Q|SLC41A3_ENST00000360370.4_Missense_Mutation_p.E174Q	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TCCACTTCCTCTCGAGACACC	0.612																																																	0													92.0	67.0	76.0					3																	125745256		2194	4291	6485	SO:0001583	missense	54946				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.520G>C	3.37:g.125745256C>G	ENSP00000326070:p.Glu174Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr,superfamily_Acyl_Trfase/lysoPLipase	p.E174Q	ENST00000315891.6	37	c.520	CCDS33843.1	3	.	.	.	.	.	.	.	.	.	.	C	6.145	0.394987	0.11638	.	.	ENSG00000114544	ENST00000360370;ENST00000346785;ENST00000383598;ENST00000458524;ENST00000315891;ENST00000508835;ENST00000514677;ENST00000513723;ENST00000512470;ENST00000510651	T;T;T;T;T;T;T;T	0.32515	1.45;1.48;1.46;1.45;1.5;1.5;1.46;1.52	4.58	0.423	0.16463	MgtE magnesium transporter, integral membrane (1);	0.342406	0.32548	N	0.005953	T	0.10508	0.0257	N	0.02802	-0.49	0.09310	N	1	B;B;B;B;B;B	0.27853	0.011;0.028;0.034;0.191;0.116;0.005	B;B;B;B;B;B	0.30316	0.016;0.067;0.068;0.069;0.114;0.017	T	0.31943	-0.9925	10	0.18710	T	0.47	-9.1856	6.334	0.21287	0.0:0.5092:0.3044:0.1865	.	57;174;174;138;174;148	B7Z4Y2;A8MQ22;E7ENY4;Q96GZ6-3;Q96GZ6;Q96GZ6-7	.;.;.;.;S41A3_HUMAN;.	Q	174;138;148;165;174;57;189;226;174;165	ENSP00000353533:E174Q;ENSP00000264471:E138Q;ENSP00000373092:E148Q;ENSP00000326070:E174Q;ENSP00000422828:E189Q;ENSP00000425373:E226Q;ENSP00000421008:E174Q;ENSP00000423524:E165Q	ENSP00000326070:E174Q	E	-	1	0	SLC41A3	127227946	0.698000	0.27777	0.105000	0.21289	0.003000	0.03518	2.488000	0.45276	0.174000	0.19809	0.491000	0.48974	GAG	SLC41A3	-	pfam_MgtE_Mg_transptr_membr		0.612	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	HGNC	protein_coding	OTTHUMT00000370886.1	C	NM_017836		125745256	-1	no_errors	ENST00000315891	ensembl	human	known	70_37	missense	SNP	0.008	G
SLC9A6	10479	genome.wustl.edu	37	X	135080293	135080293	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:135080293C>T	ENST00000370698.3	+	3	491	c.456C>T	c.(454-456)ttC>ttT	p.F152F	SLC9A6_ENST00000370701.1_Silent_p.F132F|SLC9A6_ENST00000370695.4_Silent_p.F184F	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	152					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AAGTATTTTTCAACATATTAC	0.299																																																	0													59.0	62.0	61.0					X																	135080293		2201	4293	6494	SO:0001819	synonymous_variant	10479			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.456C>T	X.37:g.135080293C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F184	ENST00000370698.3	37	c.552	CCDS14654.1	X																																																																																			SLC9A6	-	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger		0.299	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	C	NM_006359		135080293	+1	no_errors	ENST00000370695	ensembl	human	known	70_37	silent	SNP	1.000	T
SLIT3	6586	genome.wustl.edu	37	5	168123399	168123399	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr5:168123399C>T	ENST00000519560.1	-	28	3399	c.2980G>A	c.(2980-2982)Gag>Aag	p.E994K	SLIT3_ENST00000332966.8_Missense_Mutation_p.E1001K|SLIT3_ENST00000404867.3_Missense_Mutation_p.E994K	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	994	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.		E -> G (in dbSNP:rs2305993).		apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGTTGATCTCACACCGCTGC	0.577																																					Ovarian(29;311 847 10864 17279 24903)												0													190.0	153.0	166.0					5																	168123399		2203	4300	6503	SO:0001583	missense	6586			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2980G>A	5.37:g.168123399C>T	ENSP00000430333:p.Glu994Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.E994K	ENST00000519560.1	37	c.2980	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.134987	0.94517	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.91631	-2.88;-2.88;-2.88	5.31	5.31	0.75309	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93485	0.7921	M	0.86097	2.795	0.80722	D	1	B	0.33549	0.417	B	0.35813	0.211	D	0.93693	0.7009	10	0.72032	D	0.01	.	19.0167	0.92897	0.0:1.0:0.0:0.0	.	994	O75094	SLIT3_HUMAN	K	994;1001;994	ENSP00000430333:E994K;ENSP00000332164:E1001K;ENSP00000384890:E994K	ENSP00000332164:E1001K	E	-	1	0	SLIT3	168055977	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.668000	0.83897	2.484000	0.83849	0.655000	0.94253	GAG	SLIT3	-	smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.577	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	C	NM_003062		168123399	-1	no_errors	ENST00000519560	ensembl	human	known	70_37	missense	SNP	1.000	T
SMG5	23381	genome.wustl.edu	37	1	156228856	156228856	+	Silent	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:156228856G>C	ENST00000361813.5	-	16	2526	c.2382C>G	c.(2380-2382)gtC>gtG	p.V794V	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	794					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GGGCAATGCTGACGAAGATGC	0.602																																																	0													80.0	66.0	71.0					1																	156228856		2203	4300	6503	SO:0001819	synonymous_variant	23381			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2382C>G	1.37:g.156228856G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Silent	SNP	pfam_EST1,smart_PINc_nuc-bd	p.V794	ENST00000361813.5	37	c.2382	CCDS1137.1	1																																																																																			SMG5	-	NULL		0.602	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	G	NM_015327		156228856	-1	no_errors	ENST00000361813	ensembl	human	known	70_37	silent	SNP	1.000	C
SOS1	6654	genome.wustl.edu	37	2	39240630	39240630	+	Missense_Mutation	SNP	C	C	T	rs483352826		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:39240630C>T	ENST00000426016.1	-	14	2224	c.2138G>A	c.(2137-2139)cGa>cAa	p.R713Q	SOS1_ENST00000402219.2_Missense_Mutation_p.R713Q|SOS1_ENST00000395038.2_Missense_Mutation_p.R713Q			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	713	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TTCTTCCATTCGTTGCAAAAG	0.333									Noonan syndrome																																								0													108.0	111.0	110.0					2																	39240630		2203	4298	6501	SO:0001583	missense	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.2138G>A	2.37:g.39240630C>T	ENSP00000387784:p.Arg713Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2G3|B4DXG2	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R713Q	ENST00000426016.1	37	c.2138	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891736	0.52014	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.48201	0.82;0.82;0.82	5.92	5.92	0.95590	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.071371	0.53938	D	0.000056	T	0.41926	0.1180	L	0.47716	1.5	0.80722	D	1	P	0.35542	0.508	B	0.18263	0.021	T	0.39099	-0.9630	10	0.54805	T	0.06	.	20.327	0.98704	0.0:1.0:0.0:0.0	.	713	Q07889	SOS1_HUMAN	Q	713;713;445;713;713	ENSP00000387784:R713Q;ENSP00000384675:R713Q;ENSP00000378479:R713Q	ENSP00000263879:R713Q	R	-	2	0	SOS1	39094134	0.044000	0.20184	1.000000	0.80357	0.994000	0.84299	1.629000	0.37071	2.794000	0.96219	0.650000	0.86243	CGA	SOS1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N		0.333	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	C	NM_005633		39240630	-1	no_errors	ENST00000402219	ensembl	human	known	70_37	missense	SNP	0.901	T
SPEM1	374768	genome.wustl.edu	37	17	7324764	7324764	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:7324764C>G	ENST00000323675.3	+	3	795	c.770C>G	c.(769-771)tCa>tGa	p.S257*	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	257					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CACCGCTCCTCAGGCCGAATA	0.667																																																	0													29.0	32.0	31.0					17																	7324764		1969	4128	6097	SO:0001587	stop_gained	374768			AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.770C>G	17.37:g.7324764C>G	ENSP00000315554:p.Ser257*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	NULL	p.S257*	ENST00000323675.3	37	c.770	CCDS42254.1	17	.	.	.	.	.	.	.	.	.	.	C	24.7	4.562071	0.86335	.	.	ENSG00000181323	ENST00000323675	.	.	.	5.48	4.51	0.55191	.	0.524046	0.15288	N	0.270314	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-7.8002	9.2114	0.37320	0.0:0.9036:0.0:0.0964	.	.	.	.	X	257	.	ENSP00000315554:S257X	S	+	2	0	SPEM1	7265488	0.789000	0.28775	0.644000	0.29465	0.962000	0.63368	1.497000	0.35649	2.566000	0.86566	0.655000	0.94253	TCA	SPEM1	-	NULL		0.667	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEM1	HGNC	protein_coding	OTTHUMT00000440932.1	C	NM_199339		7324764	+1	no_errors	ENST00000323675	ensembl	human	known	70_37	nonsense	SNP	0.681	G
SP2	6668	genome.wustl.edu	37	17	45994224	45994224	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:45994224G>A	ENST00000376741.4	+	3	924	c.787G>A	c.(787-789)Gag>Aag	p.E263K	AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000433001.1_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	263					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						GGCTGTGGCTGAGCAGGTGGA	0.592																																																	0													102.0	108.0	106.0					17																	45994224		2203	4300	6503	SO:0001583	missense	6668				CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.787G>A	17.37:g.45994224G>A	ENSP00000365931:p.Glu263Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NK74	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E263K	ENST00000376741.4	37	c.787	CCDS11521.2	17	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164840	0.57476	.	.	ENSG00000167182	ENST00000376741	T	0.09911	2.93	5.39	5.39	0.77823	.	0.173555	0.49916	D	0.000127	T	0.14399	0.0348	L	0.50333	1.59	0.51012	D	0.999905	P	0.52463	0.953	P	0.47603	0.551	T	0.01152	-1.1435	10	0.28530	T	0.3	.	11.4901	0.50377	0.0824:0.0:0.9176:0.0	.	263	Q02086	SP2_HUMAN	K	263	ENSP00000365931:E263K	ENSP00000365931:E263K	E	+	1	0	SP2	43349223	1.000000	0.71417	0.989000	0.46669	0.967000	0.64934	6.128000	0.71650	2.809000	0.96659	0.467000	0.42956	GAG	SP2	-	NULL		0.592	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP2	HGNC	protein_coding	OTTHUMT00000316777.1	G	NM_003110		45994224	+1	no_errors	ENST00000376741	ensembl	human	known	70_37	missense	SNP	0.998	A
SPEN	23013	genome.wustl.edu	37	1	16255901	16255902	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:16255901_16255902delAG	ENST00000375759.3	+	11	3370_3371	c.3166_3167delAG	c.(3166-3168)agafs	p.R1056fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1056					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CAAACTGGACAGACTTAATACT	0.465																																																	0																																										SO:0001589	frameshift_variant	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3166_3167delAG	1.37:g.16255901_16255902delAG	ENSP00000364912:p.Arg1056fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R1056fs	ENST00000375759.3	37	c.3166_3167	CCDS164.1	1																																																																																			SPEN	-	NULL		0.465	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	AG	NM_015001		16255902	+1	no_errors	ENST00000375759	ensembl	human	known	70_37	frame_shift_del	DEL	1.000:1.000	-
SPG11	80208	genome.wustl.edu	37	15	44888480	44888480	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:44888480G>A	ENST00000261866.7	-	25	4251	c.4235C>T	c.(4234-4236)tCa>tTa	p.S1412L	SPG11_ENST00000427534.2_Missense_Mutation_p.S1412L|SPG11_ENST00000558319.1_Missense_Mutation_p.S1412L|SPG11_ENST00000535302.2_Missense_Mutation_p.S1412L	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1412					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GGTGGGCACTGAGGGCAAGTT	0.443																																																	0													104.0	103.0	103.0					15																	44888480		2198	4298	6496	SO:0001583	missense	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.4235C>T	15.37:g.44888480G>A	ENSP00000261866:p.Ser1412Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.S1412L	ENST00000261866.7	37	c.4235	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	0.028	-1.351328	0.01256	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.79554	-1.28;-1.28;-1.28	5.45	3.57	0.40892	.	0.779565	0.12191	N	0.491234	T	0.80053	0.4553	M	0.69823	2.125	0.09310	N	0.999996	B;B;B	0.15473	0.002;0.013;0.007	B;B;B	0.16289	0.004;0.009;0.015	T	0.68503	-0.5391	10	0.59425	D	0.04	.	12.5476	0.56208	0.1514:0.0:0.8486:0.0	.	1412;1412;1412	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	L	1412	ENSP00000261866:S1412L;ENSP00000445278:S1412L;ENSP00000396110:S1412L	ENSP00000261866:S1412L	S	-	2	0	SPG11	42675772	0.001000	0.12720	0.001000	0.08648	0.151000	0.21798	0.878000	0.28126	0.282000	0.22254	-0.797000	0.03246	TCA	SPG11	-	NULL		0.443	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	G			44888480	-1	no_errors	ENST00000261866	ensembl	human	known	70_37	missense	SNP	0.002	A
SPINK4	27290	genome.wustl.edu	37	9	33221052	33221052	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:33221052G>A	ENST00000379725.1	+	2	198	c.76G>A	c.(76-78)Gat>Aat	p.D26N	SPINK4_ENST00000379723.1_Missense_Mutation_p.D26N			O60575	ISK4_HUMAN	serine peptidase inhibitor, Kazal type 4	0					response to drug (GO:0042493)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			lung(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			CCTGCTGGGGGATGCTTCGCA	0.522																																																	0													61.0	55.0	57.0					9																	33221052		876	1991	2867	SO:0001583	missense	27290			AF048700	CCDS6536.1	9p13.3	2011-08-31	2005-08-17		ENSG00000122711	ENSG00000122711		"""Serine peptidase inhibitors, Kazal type"""	16646	protein-coding gene	gene with protein product		613929	"""serine protease inhibitor, Kazal type 4"""			1400298, 17333166	Standard	NM_014471		Approved	PEC-60, MGC133107	uc003zsh.3	O60575	OTTHUMG00000019762	ENST00000379725.1:c.76G>A	9.37:g.33221052G>A	ENSP00000369048:p.Asp26Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YDT7	Missense_Mutation	SNP	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	p.D26N	ENST00000379725.1	37	c.76		9	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315300	0.23908	.	.	ENSG00000122711	ENST00000379725;ENST00000379723	T;T	0.73152	-0.72;-0.72	2.66	-0.361	0.12564	.	2.903640	0.00934	N	0.002746	T	0.66046	0.2750	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.55134	-0.8188	7	0.87932	D	0	.	5.4333	0.16466	0.4241:0.0:0.5759:0.0	.	.	.	.	N	26	ENSP00000369048:D26N;ENSP00000369046:D26N	ENSP00000369046:D26N	D	+	1	0	SPINK4	33211052	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.323000	0.07997	-0.086000	0.12550	0.563000	0.77884	GAT	SPINK4	-	NULL		0.522	SPINK4-002	KNOWN	basic	protein_coding	SPINK4	HGNC	protein_coding	OTTHUMT00000052036.1	G	NM_014471		33221052	+1	no_errors	ENST00000379723	ensembl	human	known	70_37	missense	SNP	0.000	A
SRGAP1	57522	genome.wustl.edu	37	12	64383826	64383826	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:64383826G>A	ENST00000355086.3	+	3	924	c.400G>A	c.(400-402)Gag>Aag	p.E134K	SRGAP1_ENST00000543397.1_Missense_Mutation_p.E94K|SRGAP1_ENST00000357825.3_Missense_Mutation_p.E134K	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	134	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GCAGATAAGTGAGGATTCTAC	0.413																																																	0													213.0	179.0	190.0					12																	64383826		2203	4300	6503	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.400G>A	12.37:g.64383826G>A	ENSP00000347198:p.Glu134Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E134K	ENST00000355086.3	37	c.400	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.468318	0.96274	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.40476	1.03;1.03;2.6	5.42	5.42	0.78866	.	0.000000	0.35067	U	0.003461	T	0.69878	0.3160	M	0.87180	2.865	0.80722	D	1	P;P;D	0.64830	0.952;0.939;0.994	P;P;D	0.66847	0.764;0.814;0.947	T	0.73471	-0.3972	9	.	.	.	.	19.5862	0.95490	0.0:0.0:1.0:0.0	.	134;94;134	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	K	134;134;94	ENSP00000347198:E134K;ENSP00000350480:E134K;ENSP00000437948:E94K	.	E	+	1	0	SRGAP1	62670093	1.000000	0.71417	0.997000	0.53966	0.823000	0.46562	9.694000	0.98686	2.711000	0.92665	0.561000	0.74099	GAG	SRGAP1	-	NULL		0.413	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	G			64383826	+1	no_errors	ENST00000355086	ensembl	human	known	70_37	missense	SNP	1.000	A
SRP9	6726	genome.wustl.edu	37	1	225977058	225977058	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:225977058G>A	ENST00000304786.7	+	3	370	c.258G>A	c.(256-258)gaG>gaA	p.E86E	SRP9_ENST00000366839.4_3'UTR|SRP9_ENST00000366838.1_3'UTR	NM_003133.5	NP_003124.1	P49458	SRP09_HUMAN	signal recognition particle 9kDa	86					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|negative regulation of translational elongation (GO:0045900)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|signal recognition particle receptor complex (GO:0005785)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|RNA binding (GO:0003723)|signal recognition particle binding (GO:0005047)			endometrium(1)|kidney(1)|skin(1)	3						TGGAAACTGAGTGAATGGTTT	0.378																																																	0													30.0	29.0	29.0					1																	225977058		2201	4278	6479	SO:0001819	synonymous_variant	6726			BC015094	CCDS1546.1, CCDS44323.1	1q42.12	2010-06-03	2002-08-29		ENSG00000143742	ENSG00000143742			11304	protein-coding gene	gene with protein product		600707	"""signal recognition particle 9kD"""			7730321	Standard	NM_001130440		Approved		uc001hpg.3	P49458	OTTHUMG00000037738	ENST00000304786.7:c.258G>A	1.37:g.225977058G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0N0|Q6NVX0|Q8WTW0	Silent	SNP	pfam_Signal_recog_particle_SRP9,superfamily_Signal_recog_particle_SRP9/14,pirsf_Signal_recog_particle_SRP9	p.E86	ENST00000304786.7	37	c.258	CCDS1546.1	1																																																																																			SRP9	-	NULL		0.378	SRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP9	HGNC	protein_coding	OTTHUMT00000092054.1	G	NM_003133		225977058	+1	no_errors	ENST00000304786	ensembl	human	known	70_37	silent	SNP	1.000	A
SSH1	54434	genome.wustl.edu	37	12	109185927	109185927	+	Intron	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:109185927G>A	ENST00000326495.5	-	14	1987				SSH1_ENST00000360239.3_Intron|SSH1_ENST00000551165.1_Silent_p.L676L|SSH1_ENST00000326470.5_Silent_p.L687L	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1						actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGGGGGCCCAGAGGAGACAAT	0.522																																																	0													16.0	18.0	17.0					12																	109185927		692	1591	2283	SO:0001627	intron_variant	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1893+134C>T	12.37:g.109185927G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.L687	ENST00000326495.5	37	c.2061	CCDS9121.1	12																																																																																			SSH1	-	NULL		0.522	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	HGNC	protein_coding	OTTHUMT00000403724.1	G	NM_018984		109185927	-1	no_errors	ENST00000326470	ensembl	human	known	70_37	silent	SNP	0.000	A
SSNA1	8636	genome.wustl.edu	37	9	140084301	140084301	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:140084301G>A	ENST00000322310.5	+	3	375	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	ANAPC2_ENST00000323927.2_5'Flank|SSNA1_ENST00000459860.1_3'UTR|TPRN_ENST00000541945.1_5'Flank	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1	99					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		TCTCAAGAGGGAAGCTGGGAA	0.592																																																	0													60.0	62.0	61.0					9																	140084301		2202	4300	6502	SO:0001583	missense	8636			Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.295G>A	9.37:g.140084301G>A	ENSP00000313752:p.Glu99Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSG0|Q6FG70|Q9BVW8	Missense_Mutation	SNP	NULL	p.E99K	ENST00000322310.5	37	c.295	CCDS7034.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090235	0.76756	.	.	ENSG00000176101	ENST00000322310	.	.	.	3.54	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.85945	2.785	0.50313	D	0.999865	D	0.55605	0.972	P	0.51453	0.67	T	0.74386	-0.3682	9	0.72032	D	0.01	-12.7462	10.4707	0.44635	0.0:0.0:1.0:0.0	.	99	O43805	SSNA1_HUMAN	K	99	.	ENSP00000313752:E99K	E	+	1	0	SSNA1	139204122	1.000000	0.71417	0.997000	0.53966	0.438000	0.31896	4.892000	0.63193	1.813000	0.52934	0.462000	0.41574	GAA	SSNA1	-	NULL		0.592	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSNA1	HGNC	protein_coding	OTTHUMT00000055311.1	G	NM_003731		140084301	+1	no_errors	ENST00000322310	ensembl	human	known	70_37	missense	SNP	1.000	A
STMN3	50861	genome.wustl.edu	37	20	62272750	62272750	+	Splice_Site	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:62272750C>G	ENST00000370053.1	-	5	565	c.484G>C	c.(484-486)Gag>Cag	p.E162Q	STMN3_ENST00000540534.1_Splice_Site_p.E151Q	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	162	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			GCGTGCAGCTCCTGCAGGACA	0.746																																																	0													9.0	9.0	9.0					20																	62272750		2143	4197	6340	SO:0001630	splice_region_variant	50861			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.484-1G>C	20.37:g.62272750C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	p.E162Q	ENST00000370053.1	37	c.484	CCDS13529.1	20	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019056	0.75275	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	4.8	4.8	0.61643	.	0.000000	0.53938	U	0.000059	D	0.83450	0.5257	M	0.83012	2.62	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	D	0.86130	0.1574	9	0.66056	D	0.02	-19.6497	18.2166	0.89887	0.0:1.0:0.0:0.0	.	162	Q9NZ72	STMN3_HUMAN	Q	162;151	.	ENSP00000359070:E162Q	E	-	1	0	STMN3	61743194	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	7.560000	0.82277	2.388000	0.81334	0.563000	0.77884	GAG	STMN3	-	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam		0.746	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN3	HGNC	protein_coding	OTTHUMT00000080163.1	C	NM_015894	Missense_Mutation	62272750	-1	no_errors	ENST00000370053	ensembl	human	known	70_37	missense	SNP	1.000	G
STMN3	50861	genome.wustl.edu	37	20	62275132	62275132	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:62275132C>G	ENST00000370053.1	-	3	349	c.268G>C	c.(268-270)Gag>Cag	p.E90Q	STMN3_ENST00000540534.1_Missense_Mutation_p.E79Q	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	90	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			TCGGCTGCCTCCAGCCGCTTT	0.642																																																	0													39.0	43.0	42.0					20																	62275132		2203	4300	6503	SO:0001583	missense	50861			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.268G>C	20.37:g.62275132C>G	ENSP00000359070:p.Glu90Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	p.E90Q	ENST00000370053.1	37	c.268	CCDS13529.1	20	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544764	0.65198	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	5.09	5.09	0.68999	.	0.000000	0.64402	U	0.000009	D	0.82829	0.5122	M	0.82056	2.57	0.58432	D	0.999992	D	0.76494	0.999	D	0.81914	0.995	D	0.84263	0.0484	9	0.51188	T	0.08	-21.1161	18.4619	0.90741	0.0:1.0:0.0:0.0	.	90	Q9NZ72	STMN3_HUMAN	Q	90;79	.	ENSP00000359070:E90Q	E	-	1	0	STMN3	61745576	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	7.629000	0.83207	2.379000	0.81126	0.491000	0.48974	GAG	STMN3	-	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam		0.642	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN3	HGNC	protein_coding	OTTHUMT00000080163.1	C	NM_015894		62275132	-1	no_errors	ENST00000370053	ensembl	human	known	70_37	missense	SNP	1.000	G
SUPT16H	11198	genome.wustl.edu	37	14	21852049	21852049	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr14:21852049C>T	ENST00000216297.2	-	1	376	c.38G>A	c.(37-39)cGa>cAa	p.R13Q	RP11-524O1.4_ENST00000565098.1_RNA|SUPT16H_ENST00000555943.1_Missense_Mutation_p.R13Q	NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	13					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TCTCTTCACTCGCCGATAATA	0.572																																																	0													74.0	78.0	76.0					14																	21852049		2203	4300	6503	SO:0001583	missense	11198			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.38G>A	14.37:g.21852049C>T	ENSP00000216297:p.Arg13Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.R13Q	ENST00000216297.2	37	c.38	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165679	0.57476	.	.	ENSG00000092201	ENST00000216297;ENST00000538230;ENST00000555943	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.77772	0.4180	M	0.91818	3.245	0.23661	N	0.997176	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.998;0.986;0.976	T	0.72795	-0.4185	9	0.87932	D	0	-1.4557	15.1039	0.72306	0.0:1.0:0.0:0.0	.	13;13;13	G3V2X0;G3V401;Q9Y5B9	.;.;SP16H_HUMAN	Q	13	.	ENSP00000216297:R13Q	R	-	2	0	SUPT16H	20921889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.464000	0.60134	2.562000	0.86427	0.563000	0.77884	CGA	SUPT16H	-	NULL		0.572	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	C			21852049	-1	no_errors	ENST00000216297	ensembl	human	known	70_37	missense	SNP	1.000	T
SYNGAP1	8831	genome.wustl.edu	37	6	33403358	33403358	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:33403358G>C	ENST00000418600.2	+	7	831	c.730G>C	c.(730-732)Gag>Cag	p.E244Q	MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.E244Q|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.E185Q	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	244	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CAAATGGATTGAGAATCTGCA	0.517																																																	0													143.0	134.0	137.0					6																	33403358		2203	4300	6503	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.730G>C	6.37:g.33403358G>C	ENSP00000403636:p.Glu244Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.E244Q	ENST00000418600.2	37	c.730	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169385	0.78339	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	D;D;D	0.93426	-3.22;-3.22;-3.22	4.62	3.75	0.43078	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.93210	0.7837	L	0.58669	1.825	0.58432	D	0.999999	D;D;P	0.64830	0.99;0.994;0.63	P;D;B	0.63033	0.815;0.91;0.358	D	0.93369	0.6733	10	0.66056	D	0.02	.	10.6726	0.45768	0.094:0.0:0.906:0.0	.	244;244;244	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	Q	244;244;244;185	ENSP00000293748:E244Q;ENSP00000403636:E244Q;ENSP00000412475:E185Q	ENSP00000293748:E244Q	E	+	1	0	SYNGAP1	33511336	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.657000	0.98554	1.160000	0.42584	0.591000	0.81541	GAG	SYNGAP1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.517	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	HGNC	protein_coding	OTTHUMT00000076151.4	G	XM_166407		33403358	+1	no_errors	ENST00000418600	ensembl	human	known	70_37	missense	SNP	1.000	C
TBPL1	9519	genome.wustl.edu	37	6	134305526	134305526	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:134305526G>C	ENST00000237264.4	+	5	570	c.295G>C	c.(295-297)Gat>Cat	p.D99H	TBPL1_ENST00000477527.1_Intron|TBPL1_ENST00000367871.1_Missense_Mutation_p.D99H	NM_001253676.1|NM_004865.3	NP_001240605.1|NP_004856.1	P62380	TBPL1_HUMAN	TBP-like 1	99					acrosome assembly (GO:0001675)|DNA-templated transcription, initiation (GO:0006352)|dTTP biosynthetic process (GO:0006235)|regulation of transcription, DNA-templated (GO:0006355)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	6	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00591)|OV - Ovarian serous cystadenocarcinoma(155;0.00848)		AATATTTACAGATTTTAAGGT	0.323																																																	0													45.0	44.0	44.0					6																	134305526		2203	4300	6503	SO:0001583	missense	9519			AB020881	CCDS5168.1	6q22.1-q22.3	2008-05-23			ENSG00000028839	ENSG00000028839			11589	protein-coding gene	gene with protein product		605521				10082669, 10220372, 15767669	Standard	NM_001253676		Approved	TLP, STUD, TRF2, TLF	uc010kgg.3	P62380	OTTHUMG00000015609	ENST00000237264.4:c.295G>C	6.37:g.134305526G>C	ENSP00000237264:p.Asp99His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8F5|O95753|Q9BWD5|Q9Z2Z0	Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.D99H	ENST00000237264.4	37	c.295	CCDS5168.1	6	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354174	0.61293	.	.	ENSG00000028839	ENST00000416965;ENST00000367871;ENST00000237264	.	.	.	5.81	5.81	0.92471	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (2);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.088152	0.85682	D	0.000000	T	0.57725	0.2073	M	0.65320	2	0.58432	D	0.999998	B	0.12013	0.005	B	0.13407	0.009	T	0.57642	-0.7776	9	0.72032	D	0.01	-21.468	19.0715	0.93140	0.0:0.0:1.0:0.0	.	99	P62380	TBPL1_HUMAN	H	99	.	ENSP00000237264:D99H	D	+	1	0	TBPL1	134347219	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.273000	0.95719	2.756000	0.94617	0.655000	0.94253	GAT	TBPL1	-	pfam_TBP		0.323	TBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBPL1	HGNC	protein_coding	OTTHUMT00000042294.2	G			134305526	+1	no_errors	ENST00000237264	ensembl	human	known	70_37	missense	SNP	1.000	C
TAB2	23118	genome.wustl.edu	37	6	149699569	149699569	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:149699569G>C	ENST00000367456.1	+	4	1095	c.518G>C	c.(517-519)aGa>aCa	p.R173T	TAB2_ENST00000392282.1_Missense_Mutation_p.R173T|TAB2_ENST00000536230.1_Missense_Mutation_p.R141T|TAB2_ENST00000538427.1_Missense_Mutation_p.R173T|TAB2_ENST00000286332.5_Missense_Mutation_p.R173T			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	173					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						CAAACTCCCAGATTTAATCCC	0.423																																																	0													79.0	77.0	78.0					6																	149699569		2203	4300	6503	SO:0001583	missense	23118			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.518G>C	6.37:g.149699569G>C	ENSP00000356426:p.Arg173Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.R173T	ENST00000367456.1	37	c.518	CCDS5214.1	6	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593805	0.46214	.	.	ENSG00000055208	ENST00000536230;ENST00000392282;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T;T	0.80994	-1.44;-1.38;-1.4;-1.4;-1.4	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.87208	0.6120	M	0.63843	1.955	0.80722	D	1	D;D	0.57899	0.981;0.981	D;D	0.69824	0.966;0.966	D	0.85997	0.1492	10	0.52906	T	0.07	-10.6231	20.2119	0.98289	0.0:0.0:1.0:0.0	.	141;173	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	T	141;173;173;173;173	ENSP00000443206:R141T;ENSP00000376106:R173T;ENSP00000445752:R173T;ENSP00000356426:R173T;ENSP00000286332:R173T	ENSP00000286332:R173T	R	+	2	0	TAB2	149741262	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	9.230000	0.95299	2.784000	0.95788	0.585000	0.79938	AGA	TAB2	-	NULL		0.423	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3	G			149699569	+1	no_errors	ENST00000286332	ensembl	human	known	70_37	missense	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152671384	152671384	+	Silent	SNP	C	C	T	rs140054849		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:152671384C>T	ENST00000367255.5	-	72	12421	c.11820G>A	c.(11818-11820)caG>caA	p.Q3940Q	SYNE1_ENST00000341594.5_Silent_p.Q3864Q|SYNE1_ENST00000265368.4_Silent_p.Q3940Q|SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000448038.1_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3940					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCCAGACATCTGCAGCAGCC	0.532										HNSCC(10;0.0054)																																							0													105.0	95.0	99.0					6																	152671384		2203	4300	6503	SO:0001819	synonymous_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11820G>A	6.37:g.152671384C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q3940	ENST00000367255.5	37	c.11820	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.532	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152671384	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	silent	SNP	1.000	T
TCF20	6942	genome.wustl.edu	37	22	42610495	42610495	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:42610495C>T	ENST00000359486.3	-	1	953	c.817G>A	c.(817-819)Gaa>Aaa	p.E273K	TCF20_ENST00000335626.4_Missense_Mutation_p.E273K	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TTGTGTCCTTCATACTGAGAT	0.453																																																	0													204.0	183.0	190.0					22																	42610495		2203	4300	6503	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.817G>A	22.37:g.42610495C>T	ENSP00000352463:p.Glu273Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.E273K	ENST00000359486.3	37	c.817	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296655	0.81025	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.34072	1.38;1.38	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	T	0.48750	0.1517	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.98	T	0.50767	-0.8789	10	0.62326	D	0.03	-19.6282	19.2001	0.93708	0.0:1.0:0.0:0.0	.	273;273	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	K	273	ENSP00000352463:E273K;ENSP00000335561:E273K	ENSP00000335561:E273K	E	-	1	0	TCF20	40940439	0.991000	0.36638	1.000000	0.80357	0.994000	0.84299	2.654000	0.46699	2.768000	0.95171	0.655000	0.94253	GAA	TCF20	-	NULL		0.453	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	C	NM_181492		42610495	-1	no_errors	ENST00000359486	ensembl	human	known	70_37	missense	SNP	1.000	T
TEDDM1	127670	genome.wustl.edu	37	1	182369456	182369456	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:182369456C>T	ENST00000367565.1	-	1	295	c.165G>A	c.(163-165)atG>atA	p.M55I		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	55						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						CTTGCTTCCTCATGAGCACCA	0.478																																																	0													167.0	138.0	148.0					1																	182369456		2203	4300	6503	SO:0001583	missense	127670			AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.165G>A	1.37:g.182369456C>T	ENSP00000356536:p.Met55Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVJ0	Missense_Mutation	SNP	pfam_DUF716_TMEM45	p.M55I	ENST00000367565.1	37	c.165	CCDS30953.1	1	.	.	.	.	.	.	.	.	.	.	C	0.320	-0.962226	0.02249	.	.	ENSG00000203730	ENST00000367565	T	0.38240	1.15	5.05	0.863	0.19062	.	0.334872	0.30028	N	0.010598	T	0.13543	0.0328	N	0.13168	0.305	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.28299	-1.0048	10	0.02654	T	1	-43.4949	4.0847	0.09942	0.2822:0.4974:0.1375:0.0828	.	55	Q5T9Z0	TEDM1_HUMAN	I	55	ENSP00000356536:M55I	ENSP00000356536:M55I	M	-	3	0	TEDDM1	180636079	0.001000	0.12720	0.094000	0.20943	0.005000	0.04900	0.510000	0.22723	0.687000	0.31509	0.655000	0.94253	ATG	TEDDM1	-	NULL		0.478	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEDDM1	HGNC	protein_coding	OTTHUMT00000091029.1	C	NM_172000		182369456	-1	no_errors	ENST00000367565	ensembl	human	known	70_37	missense	SNP	0.001	T
TET2	54790	genome.wustl.edu	37	4	106157383	106157383	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:106157383C>T	ENST00000540549.1	+	3	3144	c.2284C>T	c.(2284-2286)Cac>Tac	p.H762Y	TET2_ENST00000305737.2_Missense_Mutation_p.H762Y|TET2_ENST00000413648.2_Missense_Mutation_p.H762Y|TET2_ENST00000545826.1_Missense_Mutation_p.H762Y|TET2_ENST00000394764.1_Missense_Mutation_p.H762Y|TET2_ENST00000513237.1_Missense_Mutation_p.H783Y|TET2_ENST00000380013.4_Missense_Mutation_p.H762Y			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	762	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GACTTTTCCTCACCCCCAAAG	0.383			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													62.0	66.0	64.0					4																	106157383		2203	4300	6503	SO:0001583	missense	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2284C>T	4.37:g.106157383C>T	ENSP00000442788:p.His762Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.H762Y	ENST00000540549.1	37	c.2284	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087306	0.36855	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	T;T;T;T;T;T;T	0.04654	3.58;4.3;3.58;4.29;4.3;3.58;3.59	5.63	3.9	0.45041	.	.	.	.	.	T	0.07548	0.0190	N	0.24115	0.695	0.25488	N	0.987673	P;P;D	0.53885	0.895;0.895;0.963	B;B;P	0.52424	0.328;0.328;0.698	T	0.24584	-1.0156	9	0.87932	D	0	.	10.8237	0.46620	0.1311:0.8015:0.0:0.0674	.	783;762;762	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	Y	762;762;762;783;762;762;762	ENSP00000306705:H762Y;ENSP00000442788:H762Y;ENSP00000442867:H762Y;ENSP00000425443:H783Y;ENSP00000369351:H762Y;ENSP00000378245:H762Y;ENSP00000391448:H762Y	ENSP00000265149:H762Y	H	+	1	0	TET2	106376832	0.898000	0.30612	0.071000	0.20095	0.791000	0.44710	1.698000	0.37794	0.729000	0.32403	-0.181000	0.13052	CAC	TET2	-	NULL		0.383	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106157383	+1	no_errors	ENST00000380013	ensembl	human	known	70_37	missense	SNP	0.961	T
TJP1	7082	genome.wustl.edu	37	15	29996371	29996371	+	Intron	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:29996371G>A	ENST00000346128.6	-	27	5627				TJP1_ENST00000545208.2_Intron|TJP1_ENST00000356107.6_Missense_Mutation_p.S1736L|TJP1_ENST00000400011.2_Missense_Mutation_p.S1660L	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1						apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CATACCCGACGAGGAGTCGGA	0.517																																					Melanoma(77;681 1843 6309 6570)												0													59.0	56.0	57.0					15																	29996371		692	1591	2283	SO:0001627	intron_variant	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.5152+54C>T	15.37:g.29996371G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.S1736L	ENST00000346128.6	37	c.5207	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.351269	0.95830	.	.	ENSG00000104067	ENST00000400011;ENST00000545208	T	0.06768	3.26	5.3	5.3	0.74995	.	.	.	.	.	T	0.31451	0.0797	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.01725	-1.1287	8	0.54805	T	0.06	.	18.9747	0.92731	0.0:0.0:1.0:0.0	.	1729;1660	A9CQZ8;G5E9E7	.;.	L	1660;1736	ENSP00000382890:S1660L	ENSP00000382890:S1660L	S	-	2	0	TJP1	27783663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.488000	0.83962	0.563000	0.77884	TCG	TJP1	-	smart_ZU5,pfscan_ZU5		0.517	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	G	NM_003257		29996371	-1	no_errors	ENST00000356107	ensembl	human	novel	70_37	missense	SNP	1.000	A
TICRR	90381	genome.wustl.edu	37	15	90129000	90129000	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:90129000C>G	ENST00000268138.7	+	4	1343	c.1238C>G	c.(1237-1239)tCt>tGt	p.S413C	RP11-429B14.1_ENST00000559041.1_RNA|TICRR_ENST00000560985.1_Missense_Mutation_p.S412C			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	413					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										TCCCCACTCTCTGCCAGTGCT	0.532																																																	0													73.0	76.0	75.0					15																	90129000		1967	4156	6123	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1238C>G	15.37:g.90129000C>G	ENSP00000268138:p.Ser413Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	NULL	p.S413C	ENST00000268138.7	37	c.1238	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016001	0.54468	.	.	ENSG00000140534	ENST00000268138	T	0.18960	2.18	5.39	5.39	0.77823	.	0.060152	0.64402	D	0.000001	T	0.46580	0.1400	M	0.70275	2.135	0.38590	D	0.950399	D	0.76494	0.999	D	0.68483	0.958	T	0.49925	-0.8887	10	0.87932	D	0	-13.1089	17.3119	0.87212	0.0:1.0:0.0:0.0	.	413	Q7Z2Z1	TICRR_HUMAN	C	413	ENSP00000268138:S413C	ENSP00000268138:S413C	S	+	2	0	C15orf42	87930004	0.850000	0.29656	0.080000	0.20451	0.366000	0.29705	4.690000	0.61731	2.703000	0.92315	0.637000	0.83480	TCT	TICRR	-	NULL		0.532	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	C	NM_152259		90129000	+1	no_errors	ENST00000268138	ensembl	human	known	70_37	missense	SNP	0.506	G
TMEM57	55219	genome.wustl.edu	37	1	25812143	25812143	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:25812143G>C	ENST00000374343.4	+	8	1532	c.1353G>C	c.(1351-1353)caG>caC	p.Q451H	TMEM57_ENST00000399766.3_Missense_Mutation_p.Q224H|TMEM57_ENST00000399763.3_Missense_Mutation_p.Q93H	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	451					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		AAGACAAGCAGAATATCAGCC	0.358																																																	0													95.0	101.0	99.0					1																	25812143		2203	4300	6503	SO:0001583	missense	55219			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.1353G>C	1.37:g.25812143G>C	ENSP00000363463:p.Gln451His	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Missense_Mutation	SNP	pfam_Macoilin,superfamily_Prefoldin	p.Q451H	ENST00000374343.4	37	c.1353	CCDS30638.1	1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400469	0.62177	.	.	ENSG00000204178	ENST00000399766;ENST00000399763;ENST00000374343	T;D;T	0.84370	2.58;-1.84;2.52	5.97	3.13	0.36017	.	0.000000	0.85682	D	0.000000	D	0.89976	0.6871	M	0.70842	2.15	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.999;0.999	P;D;D	0.74348	0.904;0.969;0.983	D	0.88637	0.3173	10	0.72032	D	0.01	-13.528	9.4067	0.38466	0.3001:0.0:0.6999:0.0	.	93;224;451	Q8N5G2-2;Q8N5G2-3;Q8N5G2	.;.;MACOI_HUMAN	H	224;93;451	ENSP00000382668:Q224H;ENSP00000382666:Q93H;ENSP00000363463:Q451H	ENSP00000363463:Q451H	Q	+	3	2	TMEM57	25684730	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.033000	0.49743	0.436000	0.26393	-0.150000	0.13652	CAG	TMEM57	-	pfam_Macoilin,superfamily_Prefoldin		0.358	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2	G	NM_018202		25812143	+1	no_errors	ENST00000374343	ensembl	human	known	70_37	missense	SNP	1.000	C
TRIOBP	11078	genome.wustl.edu	37	22	38130481	38130481	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:38130481G>T	ENST00000406386.3	+	9	4393	c.4138G>T	c.(4138-4140)Gag>Tag	p.E1380*		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1380					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TTGGAGTCCTGAGAAGAGACC	0.647																																																	0													28.0	31.0	30.0					22																	38130481		1919	4115	6034	SO:0001587	stop_gained	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4138G>T	22.37:g.38130481G>T	ENSP00000384312:p.Glu1380*	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E1380*	ENST00000406386.3	37	c.4138	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	41	8.770424	0.98948	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	.	.	.	5.57	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999978	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	5.8175	0.18500	0.1699:0.1608:0.6693:0.0	.	.	.	.	X	1380;1341	.	ENSP00000384312:E1380X	E	+	1	0	TRIOBP	36460427	0.010000	0.17322	0.324000	0.25361	0.009000	0.06853	0.034000	0.13776	0.664000	0.31047	0.563000	0.77884	GAG	TRIOBP	-	NULL		0.647	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	G			38130481	+1	no_errors	ENST00000406386	ensembl	human	known	70_37	nonsense	SNP	0.048	T
TRIOBP	11078	genome.wustl.edu	37	22	38130493	38130493	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:38130493G>A	ENST00000406386.3	+	9	4405	c.4150G>A	c.(4150-4152)Gag>Aag	p.E1384K		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1384					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAAGAGACCTGAGGGAGATCG	0.647																																																	0													25.0	28.0	27.0					22																	38130493		1906	4104	6010	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4150G>A	22.37:g.38130493G>A	ENSP00000384312:p.Glu1384Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E1384K	ENST00000406386.3	37	c.4150	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049544	0.55218	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.29917	1.55	5.45	4.43	0.53597	.	.	.	.	.	T	0.18718	0.0449	L	0.27053	0.805	0.80722	D	1	P	0.38788	0.647	B	0.28385	0.089	T	0.04065	-1.0980	9	0.52906	T	0.07	.	11.5483	0.50706	0.0843:0.0:0.9157:0.0	.	1384	Q9H2D6	TARA_HUMAN	K	1384;1345	ENSP00000384312:E1384K	ENSP00000384312:E1384K	E	+	1	0	TRIOBP	36460439	0.996000	0.38824	0.595000	0.28798	0.018000	0.09664	3.574000	0.53863	1.290000	0.44636	0.563000	0.77884	GAG	TRIOBP	-	NULL		0.647	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	G			38130493	+1	no_errors	ENST00000406386	ensembl	human	known	70_37	missense	SNP	0.962	A
TRPC1	7220	genome.wustl.edu	37	3	142462353	142462353	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:142462353C>T	ENST00000476941.1	+	3	840	c.354C>T	c.(352-354)atC>atT	p.I118I	TRPC1_ENST00000273482.6_Intron	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	118					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TGGTGGCAATCGACTCTGAAG	0.299																																																	0																																										SO:0001819	synonymous_variant	7220			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.354C>T	3.37:g.142462353C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CE4	Silent	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.I118	ENST00000476941.1	37	c.354	CCDS58856.1	3																																																																																			TRPC1	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel		0.299	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	C	NM_003304		142462353	+1	no_errors	ENST00000476941	ensembl	human	known	70_37	silent	SNP	1.000	T
TRPS1	7227	genome.wustl.edu	37	8	116616498	116616498	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:116616498G>A	ENST00000220888.5	-	3	1818	c.1659C>T	c.(1657-1659)ctC>ctT	p.L553L	TRPS1_ENST00000520276.1_Silent_p.L557L|TRPS1_ENST00000395715.3_Silent_p.L566L|TRPS1_ENST00000519674.1_Silent_p.L553L|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	553					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GAATGTTATGGAGCTGTTGAT	0.433									Langer-Giedion syndrome																																								0													85.0	85.0	85.0					8																	116616498		1930	4136	6066	SO:0001819	synonymous_variant	7227	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1659C>T	8.37:g.116616498G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.L566	ENST00000220888.5	37	c.1698		8																																																																																			TRPS1	-	smart_Znf_C2H2-like		0.433	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	G	NM_014112		116616498	-1	no_errors	ENST00000395715	ensembl	human	known	70_37	silent	SNP	1.000	A
TSPAN14	81619	genome.wustl.edu	37	10	82279344	82279344	+	3'UTR	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:82279344C>G	ENST00000429989.3	+	0	2648				TSPAN14_ENST00000265450.5_3'UTR|TSPAN14_ENST00000372164.3_3'UTR	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14						establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			TGATGCTTCTCTTTGACTGCC	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	81619			AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.*1612C>G	10.37:g.82279344C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	RNA	SNP	-	NULL	ENST00000429989.3	37	NULL	CCDS7369.1	10																																																																																			TSPAN14	-	-		0.343	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN14	HGNC	protein_coding	OTTHUMT00000049081.2	C	NM_030927		82279344	+1	no_errors	ENST00000265450	ensembl	human	known	70_37	rna	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179433825	179433825	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:179433825C>G	ENST00000591111.1	-	276	72335	c.72111G>C	c.(72109-72111)gaG>gaC	p.E24037D	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E16738D|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E16613D|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E23110D|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E16805D|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E25678D|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24037	Fibronectin type-III 74. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATACTCATTCTCAGCTGTGA	0.423																																																	0													167.0	162.0	164.0					2																	179433825		1970	4152	6122	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72111G>C	2.37:g.179433825C>G	ENSP00000465570:p.Glu24037Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E23110D	ENST00000591111.1	37	c.69330		2	.	.	.	.	.	.	.	.	.	.	C	9.234	1.036527	0.19669	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.93	3.79	0.43588	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79981	0.4540	H	0.97491	4.015	0.47476	D	0.999438	D;D;D;D	0.64830	0.994;0.994;0.994;0.974	D;D;D;D	0.76071	0.987;0.987;0.987;0.971	D	0.84736	0.0748	9	0.87932	D	0	.	10.2963	0.43627	0.0:0.7273:0.0:0.2727	.	16613;16738;16805;24037	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	23110;16613;16805;16738;16611	ENSP00000343764:E23110D;ENSP00000434586:E16613D;ENSP00000340554:E16805D;ENSP00000352154:E16738D	ENSP00000340554:E16805D	E	-	3	2	TTN	179142071	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	0.537000	0.23144	1.480000	0.48289	0.650000	0.86243	GAG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179433825	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	G
TULP4	56995	genome.wustl.edu	37	6	158834175	158834175	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:158834175C>T	ENST00000367097.3	+	2	1688	c.331C>T	c.(331-333)Cag>Tag	p.Q111*	TULP4_ENST00000367094.2_Nonsense_Mutation_p.Q111*	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	111					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CGTGTGGATTCAGTACGAGGG	0.602																																																	0													149.0	123.0	132.0					6																	158834175		2203	4300	6503	SO:0001587	stop_gained	56995				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.331C>T	6.37:g.158834175C>T	ENSP00000356064:p.Gln111*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Nonsense_Mutation	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q111*	ENST00000367097.3	37	c.331	CCDS34561.1	6	.	.	.	.	.	.	.	.	.	.	C	50	16.450468	0.99863	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.4749	20.1358	0.98028	0.0:1.0:0.0:0.0	.	.	.	.	X	111	.	ENSP00000356061:Q111X	Q	+	1	0	TULP4	158754163	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.484000	0.81180	2.865000	0.98341	0.655000	0.94253	CAG	TULP4	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.602	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	C	NM_020245		158834175	+1	no_errors	ENST00000367097	ensembl	human	known	70_37	nonsense	SNP	1.000	T
UBC	7316	genome.wustl.edu	37	12	125396957	125396957	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr12:125396957C>G	ENST00000536769.1	-	1	2937	c.1361G>C	c.(1360-1362)aGa>aCa	p.R454T	UBC_ENST00000339647.5_Missense_Mutation_p.R454T|UBC_ENST00000546120.1_Missense_Mutation_p.R378T|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000538617.1_Intron			P0CG48	UBC_HUMAN	ubiquitin C	454	Ubiquitin-like 6. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		CATCCCACCTCTAAGACGGAG	0.517																																																	0													6.0	7.0	7.0					12																	125396957		1914	3727	5641	SO:0001583	missense	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1361G>C	12.37:g.125396957C>G	ENSP00000441543:p.Arg454Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.R454T	ENST00000536769.1	37	c.1361	CCDS9260.1	12	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767786	0.31320	.	.	ENSG00000150991	ENST00000536769;ENST00000541046;ENST00000339647;ENST00000546120	T;T;T	0.75050	-0.9;-0.9;-0.9	3.59	3.59	0.41128	Ubiquitin supergroup (1);Ubiquitin (1);	0.000000	0.52532	U	0.000065	D	0.84419	0.5468	M	0.91612	3.225	0.30529	N	0.767651	D	0.61080	0.989	P	0.59487	0.858	T	0.82973	-0.0191	10	0.87932	D	0	.	6.7917	0.23703	0.0:0.8724:0.0:0.1276	.	454	P0CG48	UBC_HUMAN	T	454;378;454;378	ENSP00000441543:R454T;ENSP00000344818:R454T;ENSP00000438394:R378T	ENSP00000344818:R454T	R	-	2	0	UBC	123962910	0.004000	0.15560	0.767000	0.31495	0.908000	0.53690	1.735000	0.38176	1.844000	0.53588	0.511000	0.50034	AGA	UBC	-	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup		0.517	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400177.1	C	NM_021009		125396957	-1	no_errors	ENST00000339647	ensembl	human	known	70_37	missense	SNP	0.238	G
UBN1	29855	genome.wustl.edu	37	16	4925053	4925053	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:4925053C>T	ENST00000396658.4	+	14	3345	c.2642C>T	c.(2641-2643)tCt>tTt	p.S881F	UBN1_ENST00000590769.1_Missense_Mutation_p.S881F|UBN1_ENST00000545171.1_Missense_Mutation_p.S881F|UBN1_ENST00000262376.6_Missense_Mutation_p.S881F	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	881	Ser-rich.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						TCGTCCTCTTCTGCCCTGAGC	0.572																																																	0													63.0	63.0	63.0					16																	4925053		2197	4300	6497	SO:0001583	missense	29855			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2642C>T	16.37:g.4925053C>T	ENSP00000379894:p.Ser881Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	NULL	p.S881F	ENST00000396658.4	37	c.2642	CCDS10525.1	16	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489126	0.26686	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.46063	1.38;0.88;1.38	5.2	5.2	0.72013	.	0.885835	0.09969	N	0.732493	T	0.33556	0.0867	N	0.14661	0.345	0.09310	N	1	B;B	0.27791	0.189;0.002	B;B	0.35607	0.206;0.001	T	0.28964	-1.0027	10	0.59425	D	0.04	-0.0337	11.5096	0.50486	0.0:0.9182:0.0:0.0818	.	881;881	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	F	881	ENSP00000262376:S881F;ENSP00000442379:S881F;ENSP00000379894:S881F	ENSP00000262376:S881F	S	+	2	0	UBN1	4865054	0.049000	0.20398	0.012000	0.15200	0.761000	0.43186	3.637000	0.54324	2.709000	0.92574	0.563000	0.77884	TCT	UBN1	-	NULL		0.572	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	C	NM_016936		4925053	+1	no_errors	ENST00000262376	ensembl	human	known	70_37	missense	SNP	0.013	T
UBTF	7343	genome.wustl.edu	37	17	42289777	42289777	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr17:42289777G>A	ENST00000302904.4	-	8	1198	c.706C>T	c.(706-708)Cag>Tag	p.Q236*	CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Intron|UBTF_ENST00000529383.1_Nonsense_Mutation_p.Q236*|UBTF_ENST00000533177.1_Intron|UBTF_ENST00000343638.5_Intron|UBTF_ENST00000436088.1_Nonsense_Mutation_p.Q236*|UBTF_ENST00000393606.3_Intron|UBTF_ENST00000537550.1_5'Flank|UBTF_ENST00000527034.1_Intron			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	236					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TCCGAGAGCTGAGACCACTGC	0.617																																																	0													112.0	104.0	107.0					17																	42289777		2203	4300	6503	SO:0001587	stop_gained	7343			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.706C>T	17.37:g.42289777G>A	ENSP00000302640:p.Gln236*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6R8	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_ARM-type_fold,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q236*	ENST00000302904.4	37	c.706	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	g	39	7.799703	0.98495	.	.	ENSG00000108312	ENST00000302904;ENST00000436088;ENST00000529383	.	.	.	4.94	2.85	0.33270	.	0.124620	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-15.0667	9.6679	0.39996	0.0794:0.1435:0.7771:0.0	.	.	.	.	X	236	.	ENSP00000302640:Q236X	Q	-	1	0	UBTF	39645303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.881000	0.87252	1.153000	0.42468	0.456000	0.33151	CAG	UBTF	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_ARM-type_fold,smart_HMG_superfamily,pfscan_HMG_superfamily		0.617	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1	G	NM_014233		42289777	-1	no_errors	ENST00000302904	ensembl	human	known	70_37	nonsense	SNP	1.000	A
UBXN11	91544	genome.wustl.edu	37	1	26620814	26620814	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:26620814G>A	ENST00000374222.1	-	9	905	c.441C>T	c.(439-441)ctC>ctT	p.L147L	UBXN11_ENST00000535108.1_5'UTR|UBXN11_ENST00000314675.7_Intron|UBXN11_ENST00000436301.2_Silent_p.L72L|UBXN11_ENST00000374223.1_Intron|UBXN11_ENST00000357089.4_Silent_p.L114L|UBXN11_ENST00000374221.3_Silent_p.L147L|UBXN11_ENST00000374217.2_Silent_p.L114L			Q5T124	UBX11_HUMAN	UBX domain protein 11	147						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						CATAGTCACTGAGGAACCGCT	0.622																																																	0													65.0	66.0	65.0					1																	26620814		2062	4205	6267	SO:0001819	synonymous_variant	91544			AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.441C>T	1.37:g.26620814G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Silent	SNP	pfam_SEP_domain,superfamily_SEP_domain,pfscan_UBX	p.L147	ENST00000374222.1	37	c.441	CCDS41288.1	1																																																																																			UBXN11	-	NULL		0.622	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBXN11	HGNC	protein_coding	OTTHUMT00000009500.1	G	NM_145345		26620814	-1	no_errors	ENST00000374221	ensembl	human	known	70_37	silent	SNP	0.299	A
UHMK1	127933	genome.wustl.edu	37	1	162467847	162467847	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:162467847C>T	ENST00000489294.1	+	1	215	c.57C>T	c.(55-57)ttC>ttT	p.F19F	UHMK1_ENST00000545294.1_Intron|UHMK1_ENST00000538489.1_Silent_p.F19F	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1	19					cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)			endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGGAGGCCTTCGGGCGGCTGT	0.726																																																	0													16.0	20.0	18.0					1																	162467847		2112	4203	6315	SO:0001819	synonymous_variant	127933			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.57C>T	1.37:g.162467847C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8K4|G3V1M1|Q96C22	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RRM_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Prot_kinase_cat_dom	p.F19	ENST00000489294.1	37	c.57	CCDS1239.1	1																																																																																			UHMK1	-	superfamily_Kinase-like_dom		0.726	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	HGNC	protein_coding	OTTHUMT00000076788.1	C	NM_175866		162467847	+1	no_errors	ENST00000489294	ensembl	human	known	70_37	silent	SNP	0.999	T
UHRF1BP1	54887	genome.wustl.edu	37	6	34802138	34802138	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:34802138G>C	ENST00000192788.5	+	5	654	c.483G>C	c.(481-483)caG>caC	p.Q161H	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.Q161H	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	161							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						ACTGGCAGCAGAGTGACCTTC	0.512																																																	0													65.0	63.0	64.0					6																	34802138		1994	4160	6154	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.483G>C	6.37:g.34802138G>C	ENSP00000192788:p.Gln161His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NXE0	Missense_Mutation	SNP	NULL	p.Q161H	ENST00000192788.5	37	c.483	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	G	2.687	-0.273961	0.05679	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.08634	3.07;3.07	4.71	3.84	0.44239	.	0.171942	0.46442	D	0.000284	T	0.00845	0.0028	N	0.03324	-0.35	0.35229	D	0.776716	P	0.36438	0.553	B	0.29176	0.099	T	0.40403	-0.9565	10	0.07644	T	0.81	-5.1336	8.2115	0.31486	0.0798:0.0:0.7655:0.1547	.	161	Q6BDS2	URFB1_HUMAN	H	161	ENSP00000192788:Q161H;ENSP00000400628:Q161H	ENSP00000192788:Q161H	Q	+	3	2	UHRF1BP1	34910116	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.512000	0.35812	1.211000	0.43351	-0.150000	0.13652	CAG	UHRF1BP1	-	NULL		0.512	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	G	NM_017754		34802138	+1	no_errors	ENST00000192788	ensembl	human	known	70_37	missense	SNP	1.000	C
URB1	9875	genome.wustl.edu	37	21	33692951	33692951	+	Splice_Site	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr21:33692951C>G	ENST00000382751.3	-	35	5600		c.e35-1			NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)							nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						GAATCCAATTCTGAAAACCCC	0.378																																																	0													53.0	47.0	49.0					21																	33692951		692	1591	2283	SO:0001630	splice_region_variant	9875			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.5485-1G>C	21.37:g.33692951C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSE5|Q96NX1|Q9NYQ1	Splice_Site	SNP	-	e35-1	ENST00000382751.3	37	c.5485-1	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043515	0.75732	.	.	ENSG00000142207	ENST00000382751	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.138	0.86745	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	URB1	32614822	1.000000	0.71417	0.942000	0.38095	0.940000	0.58332	6.344000	0.72991	2.211000	0.71520	0.561000	0.74099	.	URB1	-	-		0.378	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	C		Intron	33692951	-1	no_errors	ENST00000382751	ensembl	human	known	70_37	splice_site	SNP	0.999	G
USP26	83844	genome.wustl.edu	37	X	132161543	132161543	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chrX:132161543C>A	ENST00000511190.1	-	6	1175	c.706G>T	c.(706-708)Gaa>Taa	p.E236*	USP26_ENST00000406273.1_Nonsense_Mutation_p.E236*|USP26_ENST00000370832.1_Nonsense_Mutation_p.E236*	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	236					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CATGAAGATTCACATTCCAAT	0.368																																					NSCLC(104;342 1621 36940 47097 52632)												0													96.0	77.0	83.0					X																	132161543		2203	4300	6503	SO:0001587	stop_gained	83844			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.706G>T	X.37:g.132161543C>A	ENSP00000423390:p.Glu236*	Somatic		WXS	Illumina HiSeq	Phase_IV	B9WRT6|Q5H9H4	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E236*	ENST00000511190.1	37	c.706	CCDS14635.1	X	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136952	0.77775	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	.	.	.	3.76	0.881	0.19166	.	2.577270	0.01795	N	0.032562	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	2.6609	2.8834	0.05654	0.2176:0.5307:0.0:0.2516	.	.	.	.	X	236	.	ENSP00000359869:E236X	E	-	1	0	USP26	131989209	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-1.329000	0.02677	0.050000	0.15949	0.513000	0.50165	GAA	USP26	-	NULL		0.368	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1	C	NM_031907		132161543	-1	no_errors	ENST00000370832	ensembl	human	known	70_37	nonsense	SNP	0.000	A
USP8	9101	genome.wustl.edu	37	15	50786321	50786321	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr15:50786321G>T	ENST00000396444.3	+	16	2840	c.2502G>T	c.(2500-2502)atG>atT	p.M834I	USP8_ENST00000307179.4_Missense_Mutation_p.M834I|USP8_ENST00000425032.3_Missense_Mutation_p.M728I|USP8_ENST00000433963.1_Missense_Mutation_p.M834I|RP11-562A8.5_ENST00000560159.1_lincRNA	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	834	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GTATAATCATGAAAGCCCTGT	0.368																																																	0													110.0	106.0	108.0					15																	50786321		2196	4294	6490	SO:0001583	missense	9101			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2502G>T	15.37:g.50786321G>T	ENSP00000379721:p.Met834Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_DUF1873,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_Rsp5_WWP,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19	p.M834I	ENST00000396444.3	37	c.2502	CCDS10137.1	15	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659880	0.47572	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	5.18	5.18	0.71444	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.13586	0.0329	N	0.04260	-0.245	0.80722	D	1	B;B	0.24618	0.107;0.107	B;B	0.29942	0.109;0.109	T	0.07751	-1.0756	10	0.02654	T	1	-18.8338	19.0607	0.93091	0.0:0.0:1.0:0.0	.	728;834	B4DKA8;P40818	.;UBP8_HUMAN	I	834;834;834;728;59;54	ENSP00000379721:M834I;ENSP00000405537:M834I;ENSP00000302239:M834I;ENSP00000412682:M728I	ENSP00000302239:M834I	M	+	3	0	USP8	48573613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.577000	0.86979	0.650000	0.86243	ATG	USP8	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.368	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	G	NM_005154		50786321	+1	no_errors	ENST00000307179	ensembl	human	known	70_37	missense	SNP	1.000	T
VANGL2	57216	genome.wustl.edu	37	1	160395021	160395021	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:160395021G>A	ENST00000368061.2	+	8	1893	c.1419G>A	c.(1417-1419)aaG>aaA	p.K473K		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	473					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACGGCCTCAAGGATGGCATCG	0.547																																																	0													91.0	78.0	82.0					1																	160395021		2203	4300	6503	SO:0001819	synonymous_variant	57216			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.1419G>A	1.37:g.160395021G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVE9|Q5T212	Silent	SNP	pfam_Strabismus,pirsf_Strabismus	p.K473	ENST00000368061.2	37	c.1419	CCDS30915.1	1																																																																																			VANGL2	-	pfam_Strabismus,pirsf_Strabismus		0.547	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	G	NM_020335		160395021	+1	no_errors	ENST00000368061	ensembl	human	known	70_37	silent	SNP	0.978	A
VCPIP1	80124	genome.wustl.edu	37	8	67547485	67547485	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr8:67547485C>G	ENST00000310421.4	-	3	3178	c.2920G>C	c.(2920-2922)Gat>Cat	p.D974H		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	974					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TCTTCAACATCAGGACCAATG	0.433																																					NSCLC(179;265 2915 6144 43644)												0													125.0	120.0	122.0					8																	67547485		2203	4300	6503	SO:0001583	missense	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.2920G>C	8.37:g.67547485C>G	ENSP00000309031:p.Asp974His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.D974H	ENST00000310421.4	37	c.2920	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	C	12.89	2.074477	0.36566	.	.	ENSG00000175073	ENST00000310421	T	0.37915	1.17	6.08	5.03	0.67393	.	0.091651	0.85682	D	0.000000	T	0.31638	0.0803	N	0.24115	0.695	0.54753	D	0.999987	B	0.34103	0.437	B	0.38655	0.278	T	0.19778	-1.0295	10	0.87932	D	0	-17.0045	16.2916	0.82756	0.0:0.9271:0.0:0.0729	.	974	Q96JH7	VCIP1_HUMAN	H	974	ENSP00000309031:D974H	ENSP00000309031:D974H	D	-	1	0	VCPIP1	67710039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.759000	0.68785	2.894000	0.99253	0.591000	0.81541	GAT	VCPIP1	-	NULL		0.433	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	C			67547485	-1	no_errors	ENST00000310421	ensembl	human	known	70_37	missense	SNP	1.000	G
VIL1	7429	genome.wustl.edu	37	2	219292983	219292983	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:219292983G>T	ENST00000248444.5	+	6	578	c.490G>T	c.(490-492)Gat>Tat	p.D164Y	VIL1_ENST00000440053.1_Missense_Mutation_p.D164Y|VIL1_ENST00000392114.2_Intron	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	164	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAACCGAGGGGATGTTTTCCT	0.547																																																	0													148.0	134.0	139.0					2																	219292983		2203	4300	6503	SO:0001583	missense	7429			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.490G>T	2.37:g.219292983G>T	ENSP00000248444:p.Asp164Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.D164Y	ENST00000248444.5	37	c.490	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914308	0.92178	.	.	ENSG00000127831	ENST00000248444;ENST00000440053	T;T	0.38887	1.11;1.11	4.86	4.86	0.63082	Gelsolin domain (1);	0.150776	0.43747	D	0.000536	T	0.76821	0.4041	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.84414	0.0567	10	0.52906	T	0.07	-24.089	18.1862	0.89793	0.0:0.0:1.0:0.0	.	164;164	Q96AC8;P09327	.;VILI_HUMAN	Y	164	ENSP00000248444:D164Y;ENSP00000409270:D164Y	ENSP00000248444:D164Y	D	+	1	0	VIL1	219001227	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.720000	0.84759	2.540000	0.85666	0.462000	0.41574	GAT	VIL1	-	pfam_Gelsolin_dom,smart_Gelsolin		0.547	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3	G	NM_007127		219292983	+1	no_errors	ENST00000248444	ensembl	human	known	70_37	missense	SNP	1.000	T
WASIR2	100132169	genome.wustl.edu	37	16	73077	73077	+	RNA	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:73077G>A	ENST00000527434.1	+	0	168				Z84812.4_ENST00000568710.1_RNA|WASIR2_ENST00000329244.5_RNA					WASH and IL9R antisense RNA 2																		ACTTGGGGCCGAGGCCAAGGT	0.667																																																	0																																												100132169			BC032901, CR605219		16p13.3	2012-10-12	2012-08-15	2011-04-28	ENSG00000231439	ENSG00000231439		"""Long non-coding RNAs"""	38609	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 286A"", ""WASH and IL9R antisense RNA 2 (non-protein coding)"""	NCRNA00286A		11157797	Standard	XR_243326		Approved				OTTHUMG00000060721		16.37:g.73077G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000527434.1	37	NULL		16																																																																																			WASIR2	-	-		0.667	WASIR2-001	KNOWN	basic	antisense	WASIR2	HGNC	antisense	OTTHUMT00000134191.1	G	XR_078518		73077	+1	no_errors	ENST00000329244	ensembl	human	known	70_37	rna	SNP	0.011	A
WDR78	79819	genome.wustl.edu	37	1	67340544	67340544	+	Silent	SNP	G	G	C			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:67340544G>C	ENST00000371026.3	-	5	775	c.720C>G	c.(718-720)ctC>ctG	p.L240L	WDR78_ENST00000371022.3_Silent_p.L240L|WDR78_ENST00000371023.3_Silent_p.L240L|WDR78_ENST00000431318.1_5'UTR	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	240					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						CTGTCTCTGTGAGTATTATCT	0.353																																																	0													150.0	142.0	145.0					1																	67340544		2203	4300	6503	SO:0001819	synonymous_variant	79819			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.720C>G	1.37:g.67340544G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L240	ENST00000371026.3	37	c.720	CCDS635.1	1																																																																																			WDR78	-	NULL		0.353	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	G	NM_024763		67340544	-1	no_errors	ENST00000371026	ensembl	human	known	70_37	silent	SNP	0.965	C
YAP1	10413	genome.wustl.edu	37	11	101981896	101981896	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr11:101981896G>A	ENST00000282441.5	+	1	705	c.317G>A	c.(316-318)cGa>cAa	p.R106Q	YAP1_ENST00000531439.1_Missense_Mutation_p.R106Q|YAP1_ENST00000526343.1_Missense_Mutation_p.R106Q|YAP1_ENST00000537274.1_Missense_Mutation_p.R106Q|RP11-732A21.2_ENST00000566440.1_RNA|YAP1_ENST00000345877.2_Missense_Mutation_p.R106Q|YAP1_ENST00000524575.1_5'Flank	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	106					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TCCCACTCCCGACAGGTAACC	0.701																																					Colon(50;247 1103 7861 28956)												0													23.0	28.0	26.0					11																	101981896		2180	4268	6448	SO:0001583	missense	10413				CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.317G>A	11.37:g.101981896G>A	ENSP00000282441:p.Arg106Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.R106Q	ENST00000282441.5	37	c.317	CCDS44716.1	11	.	.	.	.	.	.	.	.	.	.	G	15.81	2.942846	0.53079	.	.	ENSG00000137693	ENST00000526343;ENST00000282441;ENST00000537274;ENST00000345877;ENST00000445250;ENST00000531439	T;T	0.50813	0.73;0.74	2.53	2.53	0.30540	.	0.159451	0.41294	U	0.000908	T	0.47838	0.1467	M	0.74467	2.265	0.80722	D	1	B;P;B;B	0.40083	0.188;0.702;0.033;0.196	B;B;B;B	0.40864	0.014;0.342;0.003;0.011	T	0.49881	-0.8892	10	0.23302	T	0.38	.	13.0242	0.58806	0.0:0.0:1.0:0.0	.	106;106;106;106	E9PRV2;P46937-2;P46937;P46937-3	.;.;YAP1_HUMAN;.	Q	106;106;106;106;21;106	ENSP00000434134:R106Q;ENSP00000331023:R106Q	ENSP00000282441:R106Q	R	+	2	0	YAP1	101487106	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	7.793000	0.85851	1.410000	0.46936	0.289000	0.19496	CGA	YAP1	-	NULL		0.701	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YAP1	HGNC	protein_coding	OTTHUMT00000394151.1	G	NM_006106		101981896	+1	no_errors	ENST00000282441	ensembl	human	known	70_37	missense	SNP	1.000	A
ZAP70	7535	genome.wustl.edu	37	2	98340609	98340609	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr2:98340609G>T	ENST00000264972.5	+	3	325	c.110G>T	c.(109-111)cGc>cTc	p.R37L	ZAP70_ENST00000442208.1_5'Flank	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	37	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						TTCCTGCTGCGCCAGTGCCTG	0.687																																																	0													14.0	12.0	13.0					2																	98340609		2190	4277	6467	SO:0001583	missense	7535			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.110G>T	2.37:g.98340609G>T	ENSP00000264972:p.Arg37Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.R37L	ENST00000264972.5	37	c.110	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.067993	0.93950	.	.	ENSG00000115085	ENST00000264972	D	0.99287	-5.69	4.6	4.6	0.57074	SH2 motif (4);	0.000000	0.50627	D	0.000112	D	0.99701	0.9886	H	0.99249	4.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97019	0.9742	10	0.87932	D	0	.	15.3022	0.73962	0.0:0.0:1.0:0.0	.	37;37	B4E0E2;P43403	.;ZAP70_HUMAN	L	37	ENSP00000264972:R37L	ENSP00000264972:R37L	R	+	2	0	ZAP70	97707041	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.373000	0.97168	2.306000	0.77630	0.460000	0.39030	CGC	ZAP70	-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2		0.687	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1	G			98340609	+1	no_errors	ENST00000264972	ensembl	human	known	70_37	missense	SNP	1.000	T
ZBTB40	9923	genome.wustl.edu	37	1	22850819	22850819	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr1:22850819C>T	ENST00000375647.4	+	17	3614	c.3407C>T	c.(3406-3408)cCc>cTc	p.P1136L	ZBTB40_ENST00000374651.4_Missense_Mutation_p.P1024L|ZBTB40_ENST00000404138.1_Missense_Mutation_p.P1136L	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1136					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ACCACCTTCCCCTGTGAGCTC	0.567																																																	0													82.0	79.0	80.0					1																	22850819		2203	4300	6503	SO:0001583	missense	9923			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3407C>T	1.37:g.22850819C>T	ENSP00000364798:p.Pro1136Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P1136L	ENST00000375647.4	37	c.3407	CCDS224.1	1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869010	0.51588	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.77620	-1.11;-1.11;-1.11	5.71	4.74	0.60224	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.267347	0.26983	N	0.021502	T	0.69214	0.3086	N	0.24115	0.695	0.38366	D	0.944745	P;P	0.43231	0.763;0.801	B;B	0.43889	0.308;0.435	T	0.75693	-0.3229	10	0.62326	D	0.03	-20.032	13.6742	0.62443	0.0:0.7243:0.2757:0.0	.	1024;1136	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	L	1136;1136;1024	ENSP00000384527:P1136L;ENSP00000364798:P1136L;ENSP00000363782:P1024L	ENSP00000363782:P1024L	P	+	2	0	ZBTB40	22723406	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	1.858000	0.39408	2.689000	0.91719	0.561000	0.74099	CCC	ZBTB40	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.567	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	C	NM_014870		22850819	+1	no_errors	ENST00000375647	ensembl	human	known	70_37	missense	SNP	1.000	T
ZFAND4	93550	genome.wustl.edu	37	10	46147460	46147460	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr10:46147460C>T	ENST00000344646.5	-	4	497	c.282G>A	c.(280-282)ttG>ttA	p.L94L	ZFAND4_ENST00000374370.1_5'Flank|ZFAND4_ENST00000374366.3_Silent_p.L20L|ZFAND4_ENST00000374371.2_Silent_p.L94L|ZFAND4_ENST00000335258.7_Silent_p.L94L	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	94	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.						zinc ion binding (GO:0008270)										AAACTAGCTTCAAGGTACACC	0.333																																																	0													76.0	73.0	74.0					10																	46147460		2203	4300	6503	SO:0001819	synonymous_variant	93550			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.282G>A	10.37:g.46147460C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8V4|B2RAX2|Q5VVY5	Silent	SNP	pfam_Ubiquitin,pfam_Znf_AN1,smart_Ubiquitin,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.L94	ENST00000344646.5	37	c.282	CCDS7214.1	10																																																																																			ZFAND4	-	pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr		0.333	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	C	NM_174890		46147460	-1	no_errors	ENST00000344646	ensembl	human	known	70_37	silent	SNP	1.000	T
ZIC4	84107	genome.wustl.edu	37	3	147113918	147113918	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:147113918C>T	ENST00000383075.3	-	3	921	c.409G>A	c.(409-411)Ggc>Agc	p.G137S	ZIC4_ENST00000525172.2_Missense_Mutation_p.G187S|ZIC4_ENST00000484399.1_Missense_Mutation_p.G137S|ZIC4_ENST00000473123.1_Missense_Mutation_p.G137S|ZIC4_ENST00000425731.3_Missense_Mutation_p.G175S|ZIC4_ENST00000491672.1_Intron	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	137						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GTCGCGGTGCCGTCGGCCGCC	0.657																																																	0													30.0	39.0	36.0					3																	147113918		2201	4299	6500	SO:0001583	missense	84107			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.409G>A	3.37:g.147113918C>T	ENSP00000372553:p.Gly137Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G187S	ENST00000383075.3	37	c.559	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	C	8.524	0.869509	0.17322	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	T;T;T;T;T;T	0.12255	2.88;2.82;2.82;2.88;2.88;2.7	3.81	-1.5	0.08691	.	0.431072	0.19334	N	0.116824	T	0.04770	0.0129	N	0.08118	0	0.20403	N	0.999903	B;B	0.14438	0.01;0.0	B;B	0.11329	0.006;0.001	T	0.26430	-1.0103	10	0.48119	T	0.1	.	1.1148	0.01712	0.159:0.2501:0.1565:0.4344	.	187;137	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	S	137;175;187;137;137;137	ENSP00000372553:G137S;ENSP00000397695:G175S;ENSP00000435509:G187S;ENSP00000417855:G137S;ENSP00000420775:G137S;ENSP00000420627:G137S	ENSP00000372553:G137S	G	-	1	0	ZIC4	148596608	0.001000	0.12720	0.008000	0.14137	0.621000	0.37620	-1.293000	0.02770	-0.325000	0.08577	0.511000	0.50034	GGC	ZIC4	-	NULL		0.657	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	C			147113918	-1	no_errors	ENST00000525172	ensembl	human	known	70_37	missense	SNP	0.053	T
ZNF133	7692	genome.wustl.edu	37	20	18296266	18296266	+	Silent	SNP	C	C	T	rs111530866		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:18296266C>T	ENST00000316358.4	+	4	868	c.771C>T	c.(769-771)ctC>ctT	p.L257L	ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000377671.3_Silent_p.L256L|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000538547.1_Silent_p.L162L|ZNF133_ENST00000396026.3_Silent_p.L260L|ZNF133_ENST00000402618.2_Silent_p.L194L|ZNF133_ENST00000535822.1_Silent_p.L162L|ZNF133_ENST00000401790.1_Silent_p.L257L	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	257					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						AGAAGAGCCTCGCCAGACACC	0.547																																																	0								C	,	1,4405	2.1+/-5.4	0,1,2202	54.0	51.0	52.0		768,768	-8.3	0.5	20	dbSNP_132	52	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ZNF133	NM_001083330.1,NM_003434.4	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	256/654,256/654	18296266	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7692			AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.771C>T	20.37:g.18296266C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L260	ENST00000316358.4	37	c.780		20																																																																																			ZNF133	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.547	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	ZNF133	HGNC	protein_coding	OTTHUMT00000127616.1	C	NM_003434		18296266	+1	no_errors	ENST00000396026	ensembl	human	known	70_37	silent	SNP	0.001	T
ZNF20	7568	genome.wustl.edu	37	19	12246343	12246343	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:12246343C>T	ENST00000334213.5	-	3	396	c.172G>A	c.(172-174)Gag>Aag	p.E58K	ZNF20_ENST00000600335.1_Missense_Mutation_p.E55K|ZNF20_ENST00000485451.1_5'UTR|ZNF625-ZNF20_ENST00000430024.1_3'UTR	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TTTTTGTACTCATCTTCAATG	0.348																																																	0													135.0	124.0	128.0					19																	12246343		1856	4132	5988	SO:0001583	missense	7568			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.172G>A	19.37:g.12246343C>T	ENSP00000335437:p.Glu58Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N457|Q9UG41	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E58K	ENST00000334213.5	37	c.172	CCDS45986.1	19	.	.	.	.	.	.	.	.	.	.	C	3.696	-0.062435	0.07273	.	.	ENSG00000132010	ENST00000334213;ENST00000292241;ENST00000418866	T;T	0.00745	5.75;5.75	1.18	-2.36	0.06663	Krueppel-associated box (3);	.	.	.	.	T	0.00552	0.0018	N	0.17564	0.495	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43621	-0.9380	9	0.23891	T	0.37	.	4.2593	0.10733	0.0:0.4406:0.3277:0.2317	.	58	P17024	ZNF20_HUMAN	K	58;58;55	ENSP00000335437:E58K;ENSP00000390115:E55K	ENSP00000292241:E58K	E	-	1	0	ZNF20	12107343	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.911000	0.04050	-1.851000	0.01168	-0.752000	0.03492	GAG	ZNF20	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.348	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF20	HGNC	protein_coding	OTTHUMT00000344101.1	C	NM_021143		12246343	-1	no_errors	ENST00000334213	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF160	90338	genome.wustl.edu	37	19	53571571	53571571	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:53571571C>T	ENST00000429604.1	-	7	2631	c.2216G>A	c.(2215-2217)gGc>gAc	p.G739D	ZNF160_ENST00000418871.1_Missense_Mutation_p.G739D|ZNF160_ENST00000599056.1_Missense_Mutation_p.G739D|ZNF160_ENST00000601421.1_Missense_Mutation_p.G703D	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	739					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AAAGACCTTGCCACATTCATT	0.448																																																	0													135.0	131.0	132.0					19																	53571571		2203	4300	6503	SO:0001583	missense	90338			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2216G>A	19.37:g.53571571C>T	ENSP00000406201:p.Gly739Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G739D	ENST00000429604.1	37	c.2216	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	C	14.72	2.620945	0.46736	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.01430	4.9;4.9	2.47	-3.78	0.04333	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02649	0.0080	N	0.20304	0.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.47302	-0.9128	9	0.59425	D	0.04	.	9.2512	0.37555	0.0:0.7868:0.0:0.2132	.	739	Q9HCG1	ZN160_HUMAN	D	739	ENSP00000406201:G739D;ENSP00000409597:G739D	ENSP00000409597:G739D	G	-	2	0	ZNF160	58263383	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.225000	0.17757	-0.896000	0.03915	0.561000	0.74099	GGC	ZNF160	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.448	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	C	NM_033288		53571571	-1	no_errors	ENST00000418871	ensembl	human	known	70_37	missense	SNP	0.928	T
ZNF280A	129025	genome.wustl.edu	37	22	22868860	22868860	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr22:22868860G>A	ENST00000302097.3	-	2	1347	c.1095C>T	c.(1093-1095)gtC>gtT	p.V365V		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		AGATTTTACAGACAGCAGAGG	0.507																																																	0													110.0	100.0	104.0					22																	22868860		2203	4300	6503	SO:0001819	synonymous_variant	129025			D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1095C>T	22.37:g.22868860G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V365	ENST00000302097.3	37	c.1095	CCDS13800.1	22																																																																																			ZNF280A	-	smart_Znf_C2H2-like		0.507	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280A	HGNC	protein_coding	OTTHUMT00000075433.3	G	NM_080740		22868860	-1	no_errors	ENST00000302097	ensembl	human	known	70_37	silent	SNP	0.499	A
ZBTB21	49854	genome.wustl.edu	37	21	43412671	43412671	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr21:43412671C>G	ENST00000310826.5	-	3	1717	c.1534G>C	c.(1534-1536)Gag>Cag	p.E512Q	ZBTB21_ENST00000398499.1_Missense_Mutation_p.E512Q|ZBTB21_ENST00000398511.3_Missense_Mutation_p.E512Q|ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398505.3_Missense_Mutation_p.E512Q	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	512					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										GAGCCTTCCTCAAAATTATCT	0.448																																																	0													87.0	87.0	87.0					21																	43412671		2203	4300	6503	SO:0001583	missense	49854			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.1534G>C	21.37:g.43412671C>G	ENSP00000308759:p.Glu512Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E512Q	ENST00000310826.5	37	c.1534	CCDS13678.1	21	.	.	.	.	.	.	.	.	.	.	C	6.317	0.426526	0.11987	.	.	ENSG00000173276	ENST00000398505;ENST00000310826;ENST00000398499;ENST00000398511	T;T;T;T	0.08008	3.25;3.14;3.14;3.14	5.77	3.94	0.45596	.	0.591286	0.16410	N	0.215633	T	0.08044	0.0201	L	0.31926	0.97	0.27639	N	0.947782	B;B	0.32693	0.077;0.38	B;B	0.22386	0.039;0.037	T	0.07693	-1.0759	10	0.52906	T	0.07	-13.5421	16.5538	0.84479	0.0:0.7539:0.2461:0.0	.	512;512	Q9ULJ3-2;Q9ULJ3	.;ZN295_HUMAN	Q	512	ENSP00000381517:E512Q;ENSP00000308759:E512Q;ENSP00000381512:E512Q;ENSP00000381523:E512Q	ENSP00000308759:E512Q	E	-	1	0	ZNF295	42285740	0.995000	0.38212	0.032000	0.17829	0.082000	0.17680	2.158000	0.42329	0.756000	0.33013	0.655000	0.94253	GAG	ZNF295	-	NULL		0.448	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF295	HGNC	protein_coding	OTTHUMT00000195308.1	C	NM_020727		43412671	-1	no_errors	ENST00000310826	ensembl	human	known	70_37	missense	SNP	0.639	G
ZNF324B	388569	genome.wustl.edu	37	19	58966858	58966858	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:58966858C>T	ENST00000336614.4	+	4	654	c.547C>T	c.(547-549)Cgg>Tgg	p.R183W	ZNF324B_ENST00000391696.1_Missense_Mutation_p.R173W|ZNF324B_ENST00000545523.1_Missense_Mutation_p.R183W	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CACAGAGTACCGGGTGCCTGG	0.672																																																	0													36.0	44.0	41.0					19																	58966858		2203	4300	6503	SO:0001583	missense	388569			AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.547C>T	19.37:g.58966858C>T	ENSP00000337473:p.Arg183Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R183W	ENST00000336614.4	37	c.547	CCDS33138.1	19	.	.	.	.	.	.	.	.	.	.	C	8.999	0.979617	0.18812	.	.	ENSG00000249471	ENST00000336614;ENST00000545523;ENST00000391696	T;T;T	0.07567	3.32;3.32;3.18	2.48	-3.12	0.05282	.	1.356660	0.05156	N	0.496848	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	P;P	0.49559	0.925;0.84	B;B	0.36766	0.232;0.058	T	0.29971	-0.9994	10	0.72032	D	0.01	.	3.4508	0.07498	0.1671:0.2246:0.4946:0.1137	.	183;173	Q6AW86;C9JTQ8	Z324B_HUMAN;.	W	183;183;173	ENSP00000337473:R183W;ENSP00000438930:R183W;ENSP00000375578:R173W	ENSP00000337473:R183W	R	+	1	2	ZNF324B	63658670	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.201000	0.09464	-0.557000	0.06126	-1.477000	0.00996	CGG	ZNF324B	-	NULL		0.672	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	HGNC	protein_coding	OTTHUMT00000467038.1	C	NM_207395		58966858	+1	no_errors	ENST00000336614	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF343	79175	genome.wustl.edu	37	20	2465219	2465219	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr20:2465219G>A	ENST00000278772.4	-	6	875	c.388C>T	c.(388-390)Cag>Tag	p.Q130*	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	130	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						AGGAAGATCTGAAGTACATGT	0.478																																																	0													88.0	88.0	88.0					20																	2465219		2203	4300	6503	SO:0001587	stop_gained	79175			AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.388C>T	20.37:g.2465219G>A	ENSP00000278772:p.Gln130*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q130*	ENST00000278772.4	37	c.388	CCDS13028.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.162393	0.97338	.	.	ENSG00000088876	ENST00000278772;ENST00000445484	.	.	.	3.35	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.41015	D	0.985031	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	6.7391	0.23424	0.1338:0.0:0.8662:0.0	.	.	.	.	X	130	.	ENSP00000278772:Q130X	Q	-	1	0	ZNF343	2413219	0.297000	0.24408	0.075000	0.20258	0.401000	0.30781	1.584000	0.36589	0.760000	0.33108	0.467000	0.42956	CAG	ZNF343	-	pfscan_Krueppel-associated_box		0.478	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF343	HGNC	protein_coding	OTTHUMT00000077617.1	G	NM_024325		2465219	-1	no_errors	ENST00000278772	ensembl	human	known	70_37	nonsense	SNP	0.454	A
ZNF385D	79750	genome.wustl.edu	37	3	21465528	21465528	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr3:21465528C>T	ENST00000281523.2	-	7	1399	c.881G>A	c.(880-882)aGa>aAa	p.R294K		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	294						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						CCCAGCAGCTCTGTCTTTGTG	0.398																																																	0													160.0	156.0	157.0					3																	21465528		2203	4300	6503	SO:0001583	missense	79750			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.881G>A	3.37:g.21465528C>T	ENSP00000281523:p.Arg294Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.R294K	ENST00000281523.2	37	c.881	CCDS2636.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.201026	0.94997	.	.	ENSG00000151789	ENST00000281523	T	0.39997	1.05	5.6	5.6	0.85130	Zinc finger, U1-type (1);	0.048859	0.85682	D	0.000000	T	0.59293	0.2183	L	0.52905	1.665	0.51012	D	0.999901	D	0.58970	0.984	D	0.65443	0.935	T	0.49409	-0.8943	10	0.23302	T	0.38	-17.1993	19.589	0.95499	0.0:1.0:0.0:0.0	.	294	Q9H6B1	Z385D_HUMAN	K	294	ENSP00000281523:R294K	ENSP00000281523:R294K	R	-	2	0	ZNF385D	21440532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.625000	0.88918	0.561000	0.74099	AGA	ZNF385D	-	smart_Znf_U1		0.398	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	C	NM_024697		21465528	-1	no_errors	ENST00000281523	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF500	26048	genome.wustl.edu	37	16	4812281	4812281	+	Silent	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr16:4812281G>A	ENST00000219478.6	-	4	953	c.654C>T	c.(652-654)gcC>gcT	p.A218A	ZNF500_ENST00000545009.1_Silent_p.A218A			O60304	ZN500_HUMAN	zinc finger protein 500	218					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CCTGGGACCAGGCCGAAAGGA	0.627																																																	0													49.0	42.0	44.0					16																	4812281		2193	4298	6491	SO:0001819	synonymous_variant	26048			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.654C>T	16.37:g.4812281G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A218	ENST00000219478.6	37	c.654	CCDS32383.1	16																																																																																			ZNF500	-	superfamily_Krueppel-associated_box		0.627	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF500	HGNC	protein_coding	OTTHUMT00000432461.1	G	XM_085507		4812281	-1	no_errors	ENST00000219478	ensembl	human	known	70_37	silent	SNP	0.987	A
ZNF595	152687	genome.wustl.edu	37	4	87250	87250	+	3'UTR	SNP	C	C	G			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr4:87250C>G	ENST00000339368.6	+	0	2059							Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GGAGAGAAATCCTACAAATGT	0.403																																																	0													38.0	42.0	41.0					4																	87250		2154	4268	6422	SO:0001624	3_prime_UTR_variant	152687			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000339368.6:c.*2056C>G	4.37:g.87250C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000339368.6	37	NULL		4																																																																																			ZNF595	-	-		0.403	ZNF595-001	KNOWN	basic	processed_transcript	ZNF595	HGNC	protein_coding	OTTHUMT00000357814.2	C	NM_182524		87250	+1	no_errors	ENST00000339368	ensembl	human	known	70_37	rna	SNP	0.240	G
ZNF613	79898	genome.wustl.edu	37	19	52443955	52443955	+	Silent	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:52443955C>T	ENST00000293471.6	+	5	907	c.228C>T	c.(226-228)atC>atT	p.I76I	ZNF613_ENST00000391794.4_Silent_p.I40I	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	76	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ACAGCCAAATCTGTCCAGGTG	0.493																																																	0													92.0	77.0	82.0					19																	52443955		2203	4300	6503	SO:0001819	synonymous_variant	79898			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.228C>T	19.37:g.52443955C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96SS9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I76	ENST00000293471.6	37	c.228	CCDS33089.1	19																																																																																			ZNF613	-	pfscan_Krueppel-associated_box		0.493	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	C	NM_024840		52443955	+1	no_errors	ENST00000293471	ensembl	human	known	70_37	silent	SNP	0.000	T
ZNF658	26149	genome.wustl.edu	37	9	40774575	40774575	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr9:40774575G>A	ENST00000602553.1	-	5	994	c.700C>T	c.(700-702)Cag>Tag	p.Q234*	ZNF658_ENST00000377626.3_Nonsense_Mutation_p.Q234*|ZNF658_ENST00000441795.1_Nonsense_Mutation_p.Q232*			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAAAACTCTGAGGTGTAATA	0.328																																																	0													24.0	28.0	27.0					9																	40774575		2166	4238	6404	SO:0001587	stop_gained	26149			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.700C>T	9.37:g.40774575G>A	ENSP00000473484:p.Gln234*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q234*	ENST00000602553.1	37	c.700	CCDS35023.1	9	.	.	.	.	.	.	.	.	.	.	g	14.72	2.620219	0.46736	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	.	.	.	1.66	-3.32	0.04973	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	1.0361	0.01548	0.1928:0.2177:0.3869:0.2026	.	.	.	.	X	232;234	.	ENSP00000366853:Q234X	Q	-	1	0	ZNF658	40764575	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-4.370000	0.00245	-0.934000	0.03733	-0.782000	0.03352	CAG	ZNF658	-	NULL		0.328	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	G	NM_033160		40774575	-1	no_errors	ENST00000377626	ensembl	human	known	70_37	nonsense	SNP	0.000	A
ZNF83	55769	genome.wustl.edu	37	19	53116855	53116856	+	Missense_Mutation	DNP	CT	CT	TA	rs199873537|rs7247359		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:53116855_53116856CT>TA	ENST00000597597.1	-	2	3215_3216	c.962_963AG>TA	c.(961-963)gAG>gTA	p.E321V	ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Missense_Mutation_p.E321V|ZNF83_ENST00000541777.2_Missense_Mutation_p.E321V|ZNF83_ENST00000391789.4_Missense_Mutation_p.E293V|ZNF83_ENST00000301096.3_Missense_Mutation_p.E321V|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_Missense_Mutation_p.E321V|ZNF83_ENST00000536937.1_Missense_Mutation_p.E321V			P51522	ZNF83_HUMAN	zinc finger protein 83	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CCTTGCCACACTCATTACATTT	0.411																																																	0																																										SO:0001583	missense	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.962_963delinsTA	19.37:g.53116855_53116856delinsTA	ENSP00000472619:p.Glu321Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MT75|Q3ZCX0|Q6PI08	Silent|Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E321|p.E321V	ENST00000597597.1	37	c.963|c.962	CCDS12854.1	19																																																																																			ZNF83	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.411	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	C|T	NM_018300		53116855|53116856	-1	no_errors	ENST00000301096	ensembl	human	known	70_37	silent|missense	SNP	0.415|0.418	T|A
ZNF83	55769	genome.wustl.edu	37	19	53116865	53116865	+	Missense_Mutation	SNP	T	T	C	rs141749555		TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr19:53116865T>C	ENST00000597597.1	-	2	3206	c.953A>G	c.(952-954)aAa>aGa	p.K318R	ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Missense_Mutation_p.K318R|ZNF83_ENST00000541777.2_Missense_Mutation_p.K318R|ZNF83_ENST00000391789.4_Missense_Mutation_p.K290R|ZNF83_ENST00000301096.3_Missense_Mutation_p.K318R|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_Missense_Mutation_p.K318R|ZNF83_ENST00000536937.1_Missense_Mutation_p.K318R			P51522	ZNF83_HUMAN	zinc finger protein 83	318					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTCATTACATTTGTAAGGTTT	0.413																																																	0													98.0	104.0	102.0					19																	53116865		2203	4300	6503	SO:0001583	missense	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.953A>G	19.37:g.53116865T>C	ENSP00000472619:p.Lys318Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K318R	ENST00000597597.1	37	c.953	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	N	8.722	0.914503	0.17907	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	2.16	1.09	0.20402	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22551	0.0544	N	0.16201	0.385	0.09310	N	1	B;D	0.69078	0.017;0.997	B;D	0.81914	0.01;0.995	T	0.10706	-1.0618	9	0.54805	T	0.06	.	3.4318	0.07432	0.0:0.144:0.2323:0.6237	.	290;318	P51522-2;P51522	.;ZNF83_HUMAN	R	318;318;318;290;318;318;290	ENSP00000445993:K318R;ENSP00000301096:K318R;ENSP00000445470:K318R;ENSP00000440713:K318R;ENSP00000439681:K318R;ENSP00000375666:K290R	ENSP00000301096:K318R	K	-	2	0	ZNF83	57808677	0.000000	0.05858	0.706000	0.30403	0.082000	0.17680	-0.250000	0.08830	0.101000	0.17610	-0.540000	0.04249	AAA	ZNF83	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	T	NM_018300		53116865	-1	no_errors	ENST00000301096	ensembl	human	known	70_37	missense	SNP	0.056	C
ZSCAN23	222696	genome.wustl.edu	37	6	28403285	28403285	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A3GJ-01A-21D-A20U-09	TCGA-EK-A3GJ-11A-11D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	eeec3f16-0e6d-409f-91cb-732488e46db1	f27085a9-4270-498d-bbac-d8314d57bb38	g.chr6:28403285C>T	ENST00000289788.4	-	3	653	c.508G>A	c.(508-510)Gag>Aag	p.E170K	ZSCAN23_ENST00000486481.1_5'UTR	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	170					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						CCAAGTTGCTCTTCCAAGGTT	0.468																																																	0													84.0	73.0	76.0					6																	28403285		692	1591	2283	SO:0001583	missense	222696			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.508G>A	6.37:g.28403285C>T	ENSP00000289788:p.Glu170Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E170K	ENST00000289788.4	37	c.508	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622689	0.28889	.	.	ENSG00000187987	ENST00000289788	T	0.05139	3.49	3.75	0.961	0.19638	.	0.618460	0.14085	N	0.342429	T	0.01222	0.0040	L	0.44542	1.39	0.21822	N	0.999522	B	0.06786	0.001	B	0.04013	0.001	T	0.48614	-0.9020	10	0.06891	T	0.86	.	5.6641	0.17684	0.0:0.6452:0.0:0.3548	.	170	Q3MJ62	ZSC23_HUMAN	K	170	ENSP00000289788:E170K	ENSP00000289788:E170K	E	-	1	0	ZSCAN23	28511264	0.000000	0.05858	0.039000	0.18376	0.496000	0.33645	-0.248000	0.08854	0.175000	0.19841	0.557000	0.71058	GAG	ZSCAN23	-	NULL		0.468	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	C	XM_167147		28403285	-1	no_errors	ENST00000289788	ensembl	human	known	70_37	missense	SNP	0.766	T
