#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AARS	16	genome.wustl.edu	37	16	70303578	70303578	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:70303578G>A	ENST00000261772.8	-	7	1048	c.905C>T	c.(904-906)gCt>gTt	p.A302V		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase									p.A302V(1)		breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		GATGGTCCGAGCGTGGTCAGC	0.597																																																	1	Substitution - Missense(1)	cervix(1)											196.0	163.0	174.0					16																	70303578		2198	4300	6498	SO:0001583	missense	16			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.905C>T	16.37:g.70303578G>A	ENSP00000261772:p.Ala302Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,pfscan_Ala-tRNA-synth_IIc_core,prints_Ala-tRNA-lgiase_IIc,tigrfam_Ala-tRNA-lgiase_IIc	p.A302V	ENST00000261772.8	37	c.905	CCDS32474.1	16	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772832	0.31411	.	.	ENSG00000090861	ENST00000261772	T	0.70399	-0.48	5.67	5.67	0.87782	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.046775	0.85682	D	0.000000	T	0.73171	0.3553	L	0.42744	1.35	0.80722	D	1	P;P	0.39737	0.685;0.537	P;P	0.50049	0.629;0.479	T	0.66948	-0.5794	10	0.21540	T	0.41	-18.5474	17.2644	0.87081	0.0:0.0:1.0:0.0	.	310;302	E7ETK8;P49588	.;SYAC_HUMAN	V	302	ENSP00000261772:A302V	ENSP00000261772:A302V	A	-	2	0	AARS	68861079	1.000000	0.71417	0.853000	0.33588	0.942000	0.58702	5.749000	0.68704	2.697000	0.92050	0.655000	0.94253	GCT	AARS	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,prints_Ala-tRNA-lgiase_IIc,tigrfam_Ala-tRNA-lgiase_IIc		0.597	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2	G	NM_001605		70303578	-1	no_errors	ENST00000261772	ensembl	human	known	70_37	missense	SNP	0.999	A
AARS	16	genome.wustl.edu	37	16	70303578	70303578	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:70303578G>A	ENST00000261772.8	-	7	1048	c.905C>T	c.(904-906)gCt>gTt	p.A302V		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase									p.A302V(1)		breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		GATGGTCCGAGCGTGGTCAGC	0.597																																																	1	Substitution - Missense(1)	cervix(1)											196.0	163.0	174.0					16																	70303578		2198	4300	6498	SO:0001583	missense	16			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.905C>T	16.37:g.70303578G>A	ENSP00000261772:p.Ala302Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,pfscan_Ala-tRNA-synth_IIc_core,prints_Ala-tRNA-lgiase_IIc,tigrfam_Ala-tRNA-lgiase_IIc	p.A302V	ENST00000261772.8	37	c.905	CCDS32474.1	16	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772832	0.31411	.	.	ENSG00000090861	ENST00000261772	T	0.70399	-0.48	5.67	5.67	0.87782	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.046775	0.85682	D	0.000000	T	0.73171	0.3553	L	0.42744	1.35	0.80722	D	1	P;P	0.39737	0.685;0.537	P;P	0.50049	0.629;0.479	T	0.66948	-0.5794	10	0.21540	T	0.41	-18.5474	17.2644	0.87081	0.0:0.0:1.0:0.0	.	310;302	E7ETK8;P49588	.;SYAC_HUMAN	V	302	ENSP00000261772:A302V	ENSP00000261772:A302V	A	-	2	0	AARS	68861079	1.000000	0.71417	0.853000	0.33588	0.942000	0.58702	5.749000	0.68704	2.697000	0.92050	0.655000	0.94253	GCT	AARS	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,prints_Ala-tRNA-lgiase_IIc,tigrfam_Ala-tRNA-lgiase_IIc		0.597	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2	G	NM_001605		70303578	-1	no_errors	ENST00000261772	ensembl	human	known	70_37	missense	SNP	0.999	A
ALPK1	80216	genome.wustl.edu	37	4	113353125	113353125	+	Missense_Mutation	SNP	A	A	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:113353125A>C	ENST00000458497.1	+	11	2701	c.2422A>C	c.(2422-2424)Aat>Cat	p.N808H	ALPK1_ENST00000177648.9_Missense_Mutation_p.N808H|ALPK1_ENST00000504176.2_Missense_Mutation_p.N730H	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	808							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.N808H(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGTCCTGCACAATTCTCTGGG	0.498																																																	1	Substitution - Missense(1)	cervix(1)											56.0	46.0	50.0					4																	113353125		2203	4300	6503	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2422A>C	4.37:g.113353125A>C	ENSP00000398048:p.Asn808His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.N808H	ENST00000458497.1	37	c.2422	CCDS3697.1	4	.	.	.	.	.	.	.	.	.	.	A	10.64	1.405699	0.25378	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02525	4.33;4.33;4.26	5.1	0.975	0.19721	.	1.693190	0.02695	N	0.111124	T	0.03011	0.0089	L	0.29908	0.895	0.09310	N	1	P;P;P	0.42337	0.763;0.776;0.65	B;B;B	0.38056	0.264;0.19;0.135	T	0.39881	-0.9592	10	0.44086	T	0.13	-0.5119	5.4141	0.16363	0.2068:0.0:0.5189:0.2744	.	730;730;808	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	H	808;808;730	ENSP00000398048:N808H;ENSP00000177648:N808H;ENSP00000426044:N730H	ENSP00000177648:N808H	N	+	1	0	ALPK1	113572574	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.050000	0.11904	-0.028000	0.13850	0.533000	0.62120	AAT	ALPK1	-	NULL		0.498	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	A	NM_025144		113353125	+1	no_errors	ENST00000177648	ensembl	human	known	70_37	missense	SNP	0.000	C
ALPK1	80216	genome.wustl.edu	37	4	113353125	113353125	+	Missense_Mutation	SNP	A	A	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:113353125A>C	ENST00000458497.1	+	11	2701	c.2422A>C	c.(2422-2424)Aat>Cat	p.N808H	ALPK1_ENST00000177648.9_Missense_Mutation_p.N808H|ALPK1_ENST00000504176.2_Missense_Mutation_p.N730H	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	808							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.N808H(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGTCCTGCACAATTCTCTGGG	0.498																																																	1	Substitution - Missense(1)	cervix(1)											56.0	46.0	50.0					4																	113353125		2203	4300	6503	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.2422A>C	4.37:g.113353125A>C	ENSP00000398048:p.Asn808His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.N808H	ENST00000458497.1	37	c.2422	CCDS3697.1	4	.	.	.	.	.	.	.	.	.	.	A	10.64	1.405699	0.25378	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02525	4.33;4.33;4.26	5.1	0.975	0.19721	.	1.693190	0.02695	N	0.111124	T	0.03011	0.0089	L	0.29908	0.895	0.09310	N	1	P;P;P	0.42337	0.763;0.776;0.65	B;B;B	0.38056	0.264;0.19;0.135	T	0.39881	-0.9592	10	0.44086	T	0.13	-0.5119	5.4141	0.16363	0.2068:0.0:0.5189:0.2744	.	730;730;808	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	H	808;808;730	ENSP00000398048:N808H;ENSP00000177648:N808H;ENSP00000426044:N730H	ENSP00000177648:N808H	N	+	1	0	ALPK1	113572574	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.050000	0.11904	-0.028000	0.13850	0.533000	0.62120	AAT	ALPK1	-	NULL		0.498	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	A	NM_025144		113353125	+1	no_errors	ENST00000177648	ensembl	human	known	70_37	missense	SNP	0.000	C
ANKRD30A	91074	genome.wustl.edu	37	10	37508593	37508594	+	Frame_Shift_Ins	INS	-	-	AG			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:37508593_37508594insAG	ENST00000602533.1	+	34	3884_3885	c.3785_3786insAG	c.(3784-3789)tctctafs	p.L1263fs	ANKRD30A_ENST00000374660.1_Frame_Shift_Ins_p.L1382fs|ANKRD30A_ENST00000361713.1_Frame_Shift_Ins_p.L1263fs			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1319					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CAGCAGGAGTCTCTAGATCAGA	0.361																																																	0																																										SO:0001589	frameshift_variant	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	Exception_encountered	10.37:g.37508593_37508594insAG	ENSP00000473551:p.Leu1263fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W025	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L1263fs	ENST00000602533.1	37	c.3785_3786		10																																																																																			ANKRD30A	-	NULL		0.361	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	NM_052997		37508594	+1	no_errors	ENST00000361713	ensembl	human	known	70_37	frame_shift_ins	INS	0.003:0.000	AG
AP4E1	23431	genome.wustl.edu	37	15	51210301	51210302	+	Intron	INS	-	-	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr15:51210301_51210302insA	ENST00000261842.5	+	3	452				AP4E1_ENST00000560508.1_Intron	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		tgtctcaaaagaaaaaaaaaaa	0.465																																																	0																																										SO:0001627	intron_variant	23431			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.346+2533->A	15.37:g.51210312_51210312dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	RNA	INS	-	NULL	ENST00000261842.5	37	NULL	CCDS32240.1	15																																																																																			AP4E1	-	-		0.465	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	-			51210302	+1	no_errors	ENST00000561004	ensembl	human	putative	70_37	rna	INS	0.008:0.007	A
ARHGEF1	9138	genome.wustl.edu	37	19	42396558	42396558	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:42396558C>T	ENST00000354532.3	+	6	515				ARHGEF1_ENST00000599846.1_Intron|ARHGEF1_ENST00000347545.4_Intron|ARHGEF1_ENST00000596957.1_3'UTR|ARHGEF1_ENST00000378152.4_Intron|ARHGEF1_ENST00000337665.4_Intron	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1						cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GAGATTCATTCATTCCTTCTT	0.647																																																	0																																										SO:0001627	intron_variant	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.367+114C>T	19.37:g.42396558C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	RNA	SNP	-	NULL	ENST00000354532.3	37	NULL	CCDS12591.1	19																																																																																			ARHGEF1	-	-		0.647	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	C	NM_199002		42396558	+1	no_errors	ENST00000596957	ensembl	human	known	70_37	rna	SNP	0.000	T
ARHGEF1	9138	genome.wustl.edu	37	19	42396558	42396558	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:42396558C>T	ENST00000354532.3	+	6	515				ARHGEF1_ENST00000599846.1_Intron|ARHGEF1_ENST00000347545.4_Intron|ARHGEF1_ENST00000596957.1_3'UTR|ARHGEF1_ENST00000378152.4_Intron|ARHGEF1_ENST00000337665.4_Intron	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1						cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GAGATTCATTCATTCCTTCTT	0.647																																																	0																																										SO:0001627	intron_variant	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.367+114C>T	19.37:g.42396558C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	RNA	SNP	-	NULL	ENST00000354532.3	37	NULL	CCDS12591.1	19																																																																																			ARHGEF1	-	-		0.647	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	C	NM_199002		42396558	+1	no_errors	ENST00000596957	ensembl	human	known	70_37	rna	SNP	0.000	T
BAGE2	85319	genome.wustl.edu	37	21	11038789	11038789	+	RNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr21:11038789C>T	ENST00000470054.1	-	0	1414							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTACCCATGCCAGTTTTTTG	0.418																																																	0																																												85319			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11038789C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K925|Q08ER0	RNA	SNP	-	NULL	ENST00000470054.1	37	NULL		21																																																																																			BAGE2	-	-		0.418	BAGE2-001	KNOWN	basic	processed_transcript	BAGE2	HGNC	pseudogene	OTTHUMT00000157417.3	C	NM_182482		11038789	-1	no_errors	ENST00000470054	ensembl	human	known	70_37	rna	SNP	1.000	T
BAI1	575	genome.wustl.edu	37	8	143614774	143614774	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr8:143614774G>A	ENST00000517894.1	+	25	4411	c.3517G>A	c.(3517-3519)Gac>Aac	p.D1173N	BAI1_ENST00000323289.5_Missense_Mutation_p.D1173N			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1173					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D1173N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCTGTCTTCGACTCGCTGGA	0.672																																																	1	Substitution - Missense(1)	cervix(1)											35.0	44.0	41.0					8																	143614774		2196	4290	6486	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3517G>A	8.37:g.143614774G>A	ENSP00000430945:p.Asp1173Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.D1173N	ENST00000517894.1	37	c.3517		8	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517841	0.64634	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.39406	1.08;1.08	4.56	3.65	0.41850	.	0.064020	0.64402	U	0.000011	T	0.21227	0.0511	N	0.00102	-2.13	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.44360	-0.9333	10	0.06494	T	0.89	.	13.6407	0.62249	0.0:0.1567:0.8433:0.0	.	1173	E9PBK0	.	N	1173	ENSP00000430945:D1173N;ENSP00000313046:D1173N	ENSP00000313046:D1173N	D	+	1	0	BAI1	143611776	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	4.566000	0.60843	0.980000	0.38523	0.655000	0.94253	GAC	BAI1	-	pfam_GPCR_2_secretin-like,prints_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	G	NM_001702		143614774	+1	no_errors	ENST00000323289	ensembl	human	known	70_37	missense	SNP	1.000	A
BAI1	575	genome.wustl.edu	37	8	143614774	143614774	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr8:143614774G>A	ENST00000517894.1	+	25	4411	c.3517G>A	c.(3517-3519)Gac>Aac	p.D1173N	BAI1_ENST00000323289.5_Missense_Mutation_p.D1173N			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1173					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D1173N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCTGTCTTCGACTCGCTGGA	0.672																																																	1	Substitution - Missense(1)	cervix(1)											35.0	44.0	41.0					8																	143614774		2196	4290	6486	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3517G>A	8.37:g.143614774G>A	ENSP00000430945:p.Asp1173Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.D1173N	ENST00000517894.1	37	c.3517		8	.	.	.	.	.	.	.	.	.	.	G	17.97	3.517841	0.64634	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.39406	1.08;1.08	4.56	3.65	0.41850	.	0.064020	0.64402	U	0.000011	T	0.21227	0.0511	N	0.00102	-2.13	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.44360	-0.9333	10	0.06494	T	0.89	.	13.6407	0.62249	0.0:0.1567:0.8433:0.0	.	1173	E9PBK0	.	N	1173	ENSP00000430945:D1173N;ENSP00000313046:D1173N	ENSP00000313046:D1173N	D	+	1	0	BAI1	143611776	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	4.566000	0.60843	0.980000	0.38523	0.655000	0.94253	GAC	BAI1	-	pfam_GPCR_2_secretin-like,prints_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	G	NM_001702		143614774	+1	no_errors	ENST00000323289	ensembl	human	known	70_37	missense	SNP	1.000	A
BARD1	580	genome.wustl.edu	37	2	215645967	215645968	+	Frame_Shift_Ins	INS	-	-	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:215645967_215645968insC	ENST00000260947.4	-	4	764_765	c.630_631insG	c.(628-633)actttafs	p.L211fs	BARD1_ENST00000471787.1_5'UTR|BARD1_ENST00000449967.2_Frame_Shift_Ins_p.L67fs	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	211					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTTCAGCTAAAGTTTTCTTTT	0.376									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																																								0																																										SO:0001589	frameshift_variant	580	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.630_631insG	2.37:g.215645967_215645968insC	ENSP00000260947:p.Leu211fs	Somatic		WXS	Illumina HiSeq	Phase_IV	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,pfam_BRCT_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_Ankyrin_rpt,smart_BRCT_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BRCT_dom,pfscan_Znf_RING,prints_Ankyrin_rpt	p.L210fs	ENST00000260947.4	37	c.631_630	CCDS2397.1	2																																																																																			BARD1	-	NULL		0.376	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARD1	HGNC	protein_coding	OTTHUMT00000256602.1	-	NM_000465		215645968	-1	no_errors	ENST00000260947	ensembl	human	known	70_37	frame_shift_ins	INS	0.942:0.919	C
BID	637	genome.wustl.edu	37	22	18222870	18222870	+	Intron	SNP	C	C	T	rs147461488|rs71690189	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:18222870C>T	ENST00000399774.3	-	4	393				BID_ENST00000317361.7_Intron|BID_ENST00000551952.1_Intron|BID_ENST00000399767.1_Intron|BID_ENST00000399765.1_Intron|BID_ENST00000342111.5_Missense_Mutation_p.G99D|BID_ENST00000473439.1_Intron	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		TCCATGAAGGCCACGCTCAAC	0.627																																																	0													24.0	28.0	27.0					22																	18222870		869	1985	2854	SO:0001627	intron_variant	637			AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.224-616G>A	22.37:g.18222870C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	pfam_BID	p.G99D	ENST00000399774.3	37	c.296	CCDS13748.1	22	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747039	0.30955	.	.	ENSG00000015475	ENST00000342111	T	0.22336	1.96	0.62	0.62	0.17637	.	.	.	.	.	T	0.23094	0.0558	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23762	-1.0179	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	D	99	ENSP00000344594:G99D	ENSP00000344594:G99D	G	-	2	0	BID	16602870	0.003000	0.15002	0.014000	0.15608	0.007000	0.05969	0.166000	0.16583	0.576000	0.29452	0.205000	0.17691	GGC	BID	-	NULL		0.627	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BID	HGNC	protein_coding	OTTHUMT00000316178.1	C	NM_197966		18222870	-1	no_errors	ENST00000342111	ensembl	human	known	70_37	missense	SNP	0.016	T
CASZ1	54897	genome.wustl.edu	37	1	10699536	10699536	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:10699536C>T	ENST00000377022.3	-	21	5060	c.4743G>A	c.(4741-4743)acG>acA	p.T1581T	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1581					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1581T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TGCCCACCACCGTGTGGCGGC	0.687																																																	1	Substitution - coding silent(1)	cervix(1)											16.0	25.0	22.0					1																	10699536		2069	4186	6255	SO:0001819	synonymous_variant	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4743G>A	1.37:g.10699536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1581	ENST00000377022.3	37	c.4743	CCDS41246.1	1																																																																																			CASZ1	-	smart_Znf_C2H2-like		0.687	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	C	NM_017766		10699536	-1	no_errors	ENST00000377022	ensembl	human	known	70_37	silent	SNP	0.996	T
CASZ1	54897	genome.wustl.edu	37	1	10699536	10699536	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:10699536C>T	ENST00000377022.3	-	21	5060	c.4743G>A	c.(4741-4743)acG>acA	p.T1581T	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1581					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1581T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TGCCCACCACCGTGTGGCGGC	0.687																																																	1	Substitution - coding silent(1)	cervix(1)											16.0	25.0	22.0					1																	10699536		2069	4186	6255	SO:0001819	synonymous_variant	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4743G>A	1.37:g.10699536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1581	ENST00000377022.3	37	c.4743	CCDS41246.1	1																																																																																			CASZ1	-	smart_Znf_C2H2-like		0.687	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	C	NM_017766		10699536	-1	no_errors	ENST00000377022	ensembl	human	known	70_37	silent	SNP	0.996	T
CDH20	28316	genome.wustl.edu	37	18	59166539	59166539	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:59166539G>A	ENST00000262717.4	+	3	765	c.367G>A	c.(367-369)Gac>Aac	p.D123N	CDH20_ENST00000536675.2_Missense_Mutation_p.D123N|CDH20_ENST00000538374.1_Missense_Mutation_p.D123N			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	123	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D123N(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TCAGAGGCTCGACCGAGAGGA	0.547																																																	1	Substitution - Missense(1)	cervix(1)											62.0	51.0	55.0					18																	59166539		2203	4300	6503	SO:0001583	missense	28316			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.367G>A	18.37:g.59166539G>A	ENSP00000262717:p.Asp123Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D123N	ENST00000262717.4	37	c.367	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.445026	0.96187	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.63417	-0.04;-0.04;-0.04	5.82	5.82	0.92795	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89420	0.6710	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93532	0.6870	10	0.87932	D	0	.	20.0851	0.97797	0.0:0.0:1.0:0.0	.	123	Q9HBT6	CAD20_HUMAN	N	123	ENSP00000444767:D123N;ENSP00000442226:D123N;ENSP00000262717:D123N	ENSP00000262717:D123N	D	+	1	0	CDH20	57317519	1.000000	0.71417	0.635000	0.29338	0.896000	0.52359	9.476000	0.97823	2.758000	0.94735	0.650000	0.86243	GAC	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.547	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	G	NM_031891		59166539	+1	no_errors	ENST00000262717	ensembl	human	known	70_37	missense	SNP	1.000	A
CDH20	28316	genome.wustl.edu	37	18	59166539	59166539	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:59166539G>A	ENST00000262717.4	+	3	765	c.367G>A	c.(367-369)Gac>Aac	p.D123N	CDH20_ENST00000536675.2_Missense_Mutation_p.D123N|CDH20_ENST00000538374.1_Missense_Mutation_p.D123N			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	123	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D123N(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TCAGAGGCTCGACCGAGAGGA	0.547																																																	1	Substitution - Missense(1)	cervix(1)											62.0	51.0	55.0					18																	59166539		2203	4300	6503	SO:0001583	missense	28316			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.367G>A	18.37:g.59166539G>A	ENSP00000262717:p.Asp123Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D123N	ENST00000262717.4	37	c.367	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.445026	0.96187	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.63417	-0.04;-0.04;-0.04	5.82	5.82	0.92795	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89420	0.6710	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93532	0.6870	10	0.87932	D	0	.	20.0851	0.97797	0.0:0.0:1.0:0.0	.	123	Q9HBT6	CAD20_HUMAN	N	123	ENSP00000444767:D123N;ENSP00000442226:D123N;ENSP00000262717:D123N	ENSP00000262717:D123N	D	+	1	0	CDH20	57317519	1.000000	0.71417	0.635000	0.29338	0.896000	0.52359	9.476000	0.97823	2.758000	0.94735	0.650000	0.86243	GAC	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.547	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	G	NM_031891		59166539	+1	no_errors	ENST00000262717	ensembl	human	known	70_37	missense	SNP	1.000	A
CLIP3	25999	genome.wustl.edu	37	19	36517911	36517911	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:36517911C>T	ENST00000360535.4	-	4	570	c.343G>A	c.(343-345)Ggg>Agg	p.G115R	CLIP3_ENST00000593074.1_Missense_Mutation_p.G115R|AC002116.7_ENST00000586962.1_RNA	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	115					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)	p.G115R(2)		cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCGGTCAGCCCGTCACGATCG	0.632																																																	2	Substitution - Missense(2)	cervix(1)|lung(1)											86.0	76.0	79.0					19																	36517911		2203	4300	6503	SO:0001583	missense	25999			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.343G>A	19.37:g.36517911C>T	ENSP00000353732:p.Gly115Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.G115R	ENST00000360535.4	37	c.343	CCDS12486.1	19	.	.	.	.	.	.	.	.	.	.	C	32	5.189050	0.94923	.	.	ENSG00000105270	ENST00000360535;ENST00000534959	T	0.52057	0.68	5.28	5.28	0.74379	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.62889	0.2465	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.63957	0.92	T	0.65792	-0.6082	10	0.87932	D	0	-25.4337	16.414	0.83728	0.0:1.0:0.0:0.0	.	115	Q96DZ5	CLIP3_HUMAN	R	115;91	ENSP00000353732:G115R	ENSP00000353732:G115R	G	-	1	0	CLIP3	41209751	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	7.452000	0.80683	2.465000	0.83290	0.455000	0.32223	GGG	CLIP3	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.632	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP3	HGNC	protein_coding	OTTHUMT00000457426.1	C	NM_015526		36517911	-1	no_errors	ENST00000360535	ensembl	human	known	70_37	missense	SNP	1.000	T
CLIP3	25999	genome.wustl.edu	37	19	36517911	36517911	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:36517911C>T	ENST00000360535.4	-	4	570	c.343G>A	c.(343-345)Ggg>Agg	p.G115R	CLIP3_ENST00000593074.1_Missense_Mutation_p.G115R|AC002116.7_ENST00000586962.1_RNA	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	115					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)	p.G115R(2)		cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCGGTCAGCCCGTCACGATCG	0.632																																																	2	Substitution - Missense(2)	cervix(1)|lung(1)											86.0	76.0	79.0					19																	36517911		2203	4300	6503	SO:0001583	missense	25999			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.343G>A	19.37:g.36517911C>T	ENSP00000353732:p.Gly115Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.G115R	ENST00000360535.4	37	c.343	CCDS12486.1	19	.	.	.	.	.	.	.	.	.	.	C	32	5.189050	0.94923	.	.	ENSG00000105270	ENST00000360535;ENST00000534959	T	0.52057	0.68	5.28	5.28	0.74379	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.62889	0.2465	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.63957	0.92	T	0.65792	-0.6082	10	0.87932	D	0	-25.4337	16.414	0.83728	0.0:1.0:0.0:0.0	.	115	Q96DZ5	CLIP3_HUMAN	R	115;91	ENSP00000353732:G115R	ENSP00000353732:G115R	G	-	1	0	CLIP3	41209751	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	7.452000	0.80683	2.465000	0.83290	0.455000	0.32223	GGG	CLIP3	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.632	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP3	HGNC	protein_coding	OTTHUMT00000457426.1	C	NM_015526		36517911	-1	no_errors	ENST00000360535	ensembl	human	known	70_37	missense	SNP	1.000	T
COL11A2	1302	genome.wustl.edu	37	6	33148097	33148097	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:33148097G>A	ENST00000374708.4	-	10	1297	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*	COL11A2_ENST00000374713.1_Nonsense_Mutation_p.R386*|COL11A2_ENST00000357486.1_Nonsense_Mutation_p.R412*|COL11A2_ENST00000374714.1_Nonsense_Mutation_p.R407*|COL11A2_ENST00000361917.1_Nonsense_Mutation_p.R326*|COL11A2_ENST00000374712.1_Nonsense_Mutation_p.R352*|COL11A2_ENST00000341947.2_Nonsense_Mutation_p.R433*|COL11A2_ENST00000395197.1_Nonsense_Mutation_p.R373*|COL11A2_ENST00000477772.1_5'Flank	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	433	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R433*(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						AGCCCTGCTCGGCCAGGGGGG	0.527																																					Melanoma(1;90 116 3946 5341 17093)												1	Substitution - Nonsense(1)	cervix(1)											52.0	61.0	58.0					6																	33148097		1508	2708	4216	SO:0001587	stop_gained	1302			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1039C>T	6.37:g.33148097G>A	ENSP00000363840:p.Arg347*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.R433*	ENST00000374708.4	37	c.1297	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.544840	0.98348	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	.	.	.	4.21	3.31	0.37934	.	0.255608	0.28647	N	0.014605	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2763	0.37700	0.0:0.0:0.7848:0.2152	.	.	.	.	X	347;433;412;407;386;373;352;326;433	.	ENSP00000339915:R433X	R	-	1	2	COL11A2	33256075	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.101000	0.50283	1.090000	0.41315	0.549000	0.68633	CGA	COL11A2	-	pfam_Collagen		0.527	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	G			33148097	-1	no_errors	ENST00000341947	ensembl	human	known	70_37	nonsense	SNP	1.000	A
COL11A2	1302	genome.wustl.edu	37	6	33148097	33148097	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:33148097G>A	ENST00000374708.4	-	10	1297	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*	COL11A2_ENST00000374713.1_Nonsense_Mutation_p.R386*|COL11A2_ENST00000357486.1_Nonsense_Mutation_p.R412*|COL11A2_ENST00000374714.1_Nonsense_Mutation_p.R407*|COL11A2_ENST00000361917.1_Nonsense_Mutation_p.R326*|COL11A2_ENST00000374712.1_Nonsense_Mutation_p.R352*|COL11A2_ENST00000341947.2_Nonsense_Mutation_p.R433*|COL11A2_ENST00000395197.1_Nonsense_Mutation_p.R373*|COL11A2_ENST00000477772.1_5'Flank	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	433	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.R433*(1)		biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						AGCCCTGCTCGGCCAGGGGGG	0.527																																					Melanoma(1;90 116 3946 5341 17093)												1	Substitution - Nonsense(1)	cervix(1)											52.0	61.0	58.0					6																	33148097		1508	2708	4216	SO:0001587	stop_gained	1302			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1039C>T	6.37:g.33148097G>A	ENSP00000363840:p.Arg347*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.R433*	ENST00000374708.4	37	c.1297	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.544840	0.98348	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	.	.	.	4.21	3.31	0.37934	.	0.255608	0.28647	N	0.014605	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2763	0.37700	0.0:0.0:0.7848:0.2152	.	.	.	.	X	347;433;412;407;386;373;352;326;433	.	ENSP00000339915:R433X	R	-	1	2	COL11A2	33256075	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.101000	0.50283	1.090000	0.41315	0.549000	0.68633	CGA	COL11A2	-	pfam_Collagen		0.527	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	G			33148097	-1	no_errors	ENST00000341947	ensembl	human	known	70_37	nonsense	SNP	1.000	A
CRYM-AS1	400508	genome.wustl.edu	37	16	21328281	21328281	+	lincRNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:21328281C>T	ENST00000444326.1	+	0	397							A6NIL9	CRAS1_HUMAN	CRYM antisense RNA 1							integral component of membrane (GO:0016021)		p.N53N(1)									TAAATAAGAACGGACCTTTCG	0.438																																																	1	Substitution - coding silent(1)	cervix(1)											225.0	206.0	212.0					16																	21328281		1875	4120	5995			400508					16p12.2	2012-10-12	2012-08-15	2011-08-11	ENSG00000189149	ENSG00000189149		"""Long non-coding RNAs"""	34405	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 169"", ""CRYM antisense RNA 1 (non-protein coding)"""	NCRNA00169			Standard	NR_026675		Approved	FLJ41766	uc010bwr.1	A6NIL9	OTTHUMG00000156701		16.37:g.21328281C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVZ2	RNA	SNP	-	NULL	ENST00000444326.1	37	NULL		16																																																																																			CRYM-AS1	-	-		0.438	CRYM-AS1-002	KNOWN	basic	lincRNA	CRYM-AS1	HGNC	lincRNA	OTTHUMT00000345335.1	C	NR_026675		21328281	+1	no_errors	ENST00000338573	ensembl	human	known	70_37	rna	SNP	0.000	T
CRYM-AS1	400508	genome.wustl.edu	37	16	21328281	21328281	+	lincRNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:21328281C>T	ENST00000444326.1	+	0	397							A6NIL9	CRAS1_HUMAN	CRYM antisense RNA 1							integral component of membrane (GO:0016021)		p.N53N(1)									TAAATAAGAACGGACCTTTCG	0.438																																																	1	Substitution - coding silent(1)	cervix(1)											225.0	206.0	212.0					16																	21328281		1875	4120	5995			400508					16p12.2	2012-10-12	2012-08-15	2011-08-11	ENSG00000189149	ENSG00000189149		"""Long non-coding RNAs"""	34405	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 169"", ""CRYM antisense RNA 1 (non-protein coding)"""	NCRNA00169			Standard	NR_026675		Approved	FLJ41766	uc010bwr.1	A6NIL9	OTTHUMG00000156701		16.37:g.21328281C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVZ2	RNA	SNP	-	NULL	ENST00000444326.1	37	NULL		16																																																																																			CRYM-AS1	-	-		0.438	CRYM-AS1-002	KNOWN	basic	lincRNA	CRYM-AS1	HGNC	lincRNA	OTTHUMT00000345335.1	C	NR_026675		21328281	+1	no_errors	ENST00000338573	ensembl	human	known	70_37	rna	SNP	0.000	T
CT45A1	541466	genome.wustl.edu	37	X	134847423	134847423	+	5'UTR	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:134847423G>A	ENST00000370741.3	+	0	239				CT45A1_ENST00000497301.2_Intron|CT45A1_ENST00000482795.1_5'UTR	NM_001017417.1	NP_001017417.1	Q5HYN5	CT451_HUMAN	cancer/testis antigen family 45, member A1																		cctccagcaaggtcaggactt	0.512																																																	0																																										SO:0001623	5_prime_UTR_variant	541466			AY743709	CCDS48174.1	Xq26.3	2009-03-12				ENSG00000268940			33267	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-1"""	300648				15905330	Standard	XM_005278141		Approved	CT45-1, CT45.1	uc004eyy.3	Q5HYN5		ENST00000370741.3:c.-7G>A	X.37:g.134847423G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIR8	RNA	SNP	-	NULL	ENST00000370741.3	37	NULL	CCDS48174.1	X																																																																																			CT45A1	-	-		0.512	CT45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT45A1	HGNC	protein_coding	OTTHUMT00000058428.1	G	NM_001017417		134847423	+1	no_errors	ENST00000482795	ensembl	human	known	70_37	rna	SNP	0.007	A
DDX41	51428	genome.wustl.edu	37	5	176938929	176938929	+	Splice_Site	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:176938929C>A	ENST00000507955.1	-	17	2256		c.e17-1		DOK3_ENST00000377112.4_5'Flank|DOK3_ENST00000312943.6_5'Flank|DOK3_ENST00000501403.2_5'Flank|DOK3_ENST00000357198.4_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41						apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CCGCGCTCTCCTGGGGGAATG	0.637																																																	0													42.0	45.0	44.0					5																	176938929		2203	4300	6503	SO:0001630	splice_region_variant	51428			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1733-1G>T	5.37:g.176938929C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Splice_Site	SNP	-	e17-1	ENST00000507955.1	37	c.1733-1	CCDS4427.1	5	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637454	0.87760	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9699	0.97282	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DDX41	176871535	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.306000	0.78905	2.724000	0.93272	0.655000	0.94253	.	DDX41	-	-		0.637	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2	C	NM_016222	Intron	176938929	-1	no_errors	ENST00000507955	ensembl	human	known	70_37	splice_site	SNP	1.000	A
DISP1	84976	genome.wustl.edu	37	1	223176989	223176989	+	Silent	SNP	C	C	T	rs377033862		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:223176989C>T	ENST00000284476.6	+	8	2414	c.2250C>T	c.(2248-2250)tcC>tcT	p.S750S		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	750					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.S750S(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TGGAGTTATCCGAGTTCCAGG	0.463																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)						C		0,4406		0,0,2203	110.0	107.0	108.0		2250	-10.9	0.0	1		108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DISP1	NM_032890.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		750/1525	223176989	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84976			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2250C>T	1.37:g.223176989C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.S750	ENST00000284476.6	37	c.2250	CCDS1536.1	1																																																																																			DISP1	-	NULL		0.463	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1	C	NM_032890		223176989	+1	no_errors	ENST00000284476	ensembl	human	known	70_37	silent	SNP	0.003	T
DISP1	84976	genome.wustl.edu	37	1	223176989	223176989	+	Silent	SNP	C	C	T	rs377033862		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:223176989C>T	ENST00000284476.6	+	8	2414	c.2250C>T	c.(2248-2250)tcC>tcT	p.S750S		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	750					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.S750S(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TGGAGTTATCCGAGTTCCAGG	0.463																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)						C		0,4406		0,0,2203	110.0	107.0	108.0		2250	-10.9	0.0	1		108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DISP1	NM_032890.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		750/1525	223176989	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84976			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2250C>T	1.37:g.223176989C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.S750	ENST00000284476.6	37	c.2250	CCDS1536.1	1																																																																																			DISP1	-	NULL		0.463	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1	C	NM_032890		223176989	+1	no_errors	ENST00000284476	ensembl	human	known	70_37	silent	SNP	0.003	T
DNAJC27-AS1	729723	genome.wustl.edu	37	2	25224348	25224348	+	RNA	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:25224348G>A	ENST00000434897.1	+	0	172				DNAJC27-AS1_ENST00000451291.1_RNA|DNAJC27-AS1_ENST00000428614.1_RNA|DNAJC27-AS1_ENST00000445389.1_RNA	NR_034113.1				DNAJC27 antisense RNA 1																		GAAAATGCCCGGAAGGATATG	0.488																																																	0																																												729723					2p23.3	2012-10-12	2012-08-15		ENSG00000224165	ENSG00000224165		"""Long non-coding RNAs"""	42943	non-coding RNA	RNA, long non-coding			"""DNAJC27 antisense RNA 1 (non-protein coding)"""				Standard	NR_034113		Approved		uc002rfv.4		OTTHUMG00000151981		2.37:g.25224348G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000434897.1	37	NULL		2																																																																																			DNAJC27-AS1	-	-		0.488	DNAJC27-AS1-004	KNOWN	basic	antisense	DNAJC27-AS1	HGNC	antisense	OTTHUMT00000324695.1	G	NR_034113		25224348	+1	no_errors	ENST00000434897	ensembl	human	known	70_37	rna	SNP	0.000	A
DPYSL2	1808	genome.wustl.edu	37	8	26477451	26477451	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr8:26477451C>T	ENST00000311151.5	+	4	725				DPYSL2_ENST00000523027.1_Intron|DPYSL2_ENST00000521913.1_Intron	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		GATGATCTGACGACACATCAT	0.517																																																	0																																										SO:0001627	intron_variant	1808			D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.314-4208C>T	8.37:g.26477451C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5H2|B4DR31|D3DSS7|O00424	RNA	SNP	-	NULL	ENST00000311151.5	37	NULL	CCDS6051.1	8																																																																																			DPYSL2	-	-		0.517	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL2	HGNC	protein_coding	OTTHUMT00000216904.3	C	NM_001386		26477451	+1	no_errors	ENST00000523690	ensembl	human	putative	70_37	rna	SNP	0.000	T
DSEL	92126	genome.wustl.edu	37	18	65181691	65181691	+	Missense_Mutation	SNP	G	G	T	rs200453320		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:65181691G>T	ENST00000310045.7	-	2	1658	c.185C>A	c.(184-186)cCc>cAc	p.P62H	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	52					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.P62H(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CTTTTGGTTGGGTCTGAAATC	0.373																																																	1	Substitution - Missense(1)	cervix(1)											120.0	111.0	114.0					18																	65181691		2203	4300	6503	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.185C>A	18.37:g.65181691G>T	ENSP00000310565:p.Pro62His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_Chondroitin_lyas	p.P62H	ENST00000310045.7	37	c.185	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857294	0.32791	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.22336	1.96	4.54	1.4	0.22301	.	0.346404	0.25944	U	0.027288	T	0.14830	0.0358	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18777	-1.0326	10	0.52906	T	0.07	-0.0604	7.9167	0.29822	0.0804:0.0:0.6388:0.2808	.	52	Q8IZU8	DSEL_HUMAN	H	62;52	ENSP00000310565:P62H	ENSP00000310565:P62H	P	-	2	0	DSEL	63332671	0.060000	0.20803	0.890000	0.34922	0.991000	0.79684	2.042000	0.41222	0.427000	0.26145	0.561000	0.74099	CCC	DSEL	-	NULL		0.373	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	G	NM_032160		65181691	-1	no_errors	ENST00000310045	ensembl	human	known	70_37	missense	SNP	0.050	T
DSEL	92126	genome.wustl.edu	37	18	65181691	65181691	+	Missense_Mutation	SNP	G	G	T	rs200453320		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:65181691G>T	ENST00000310045.7	-	2	1658	c.185C>A	c.(184-186)cCc>cAc	p.P62H	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	52					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.P62H(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CTTTTGGTTGGGTCTGAAATC	0.373																																																	1	Substitution - Missense(1)	cervix(1)											120.0	111.0	114.0					18																	65181691		2203	4300	6503	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.185C>A	18.37:g.65181691G>T	ENSP00000310565:p.Pro62His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_Chondroitin_lyas	p.P62H	ENST00000310045.7	37	c.185	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857294	0.32791	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.22336	1.96	4.54	1.4	0.22301	.	0.346404	0.25944	U	0.027288	T	0.14830	0.0358	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18777	-1.0326	10	0.52906	T	0.07	-0.0604	7.9167	0.29822	0.0804:0.0:0.6388:0.2808	.	52	Q8IZU8	DSEL_HUMAN	H	62;52	ENSP00000310565:P62H	ENSP00000310565:P62H	P	-	2	0	DSEL	63332671	0.060000	0.20803	0.890000	0.34922	0.991000	0.79684	2.042000	0.41222	0.427000	0.26145	0.561000	0.74099	CCC	DSEL	-	NULL		0.373	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	G	NM_032160		65181691	-1	no_errors	ENST00000310045	ensembl	human	known	70_37	missense	SNP	0.050	T
DZANK1	55184	genome.wustl.edu	37	20	18395005	18395005	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr20:18395005C>T	ENST00000358866.6	-	11	1251	c.1229G>A	c.(1228-1230)cGc>cAc	p.R410H	DZANK1_ENST00000329494.5_Missense_Mutation_p.R412H|DZANK1_ENST00000262547.5_Missense_Mutation_p.R410H|DZANK1_ENST00000357236.4_Missense_Mutation_p.R296H|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	410							zinc ion binding (GO:0008270)	p.R410H(2)		NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						AGAAAAAGGGCGAGGTTCCTC	0.537																																																	2	Substitution - Missense(2)	cervix(2)											55.0	56.0	55.0					20																	18395005		1898	4122	6020	SO:0001583	missense	55184			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1229G>A	20.37:g.18395005C>T	ENSP00000351734:p.Arg410His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.R410H	ENST00000358866.6	37	c.1229	CCDS46582.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.72|10.72	1.429433|1.429433	0.25726|0.25726	.|.	.|.	ENSG00000089091|ENSG00000089091	ENST00000358866|ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236	.|T;T;T;T	.|0.64260	.|0.08;-0.09;0.57;0.05	5.64|5.64	-0.139|-0.139	0.13460|0.13460	.|.	.|1.476590	.|0.03110	.|N	.|0.162313	T|T	0.52240|0.52240	0.1722|0.1722	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.18610	.|0.013;0.018;0.006;0.029	.|B;B;B;B	.|0.12156	.|0.003;0.007;0.003;0.003	T|T	0.32903|0.32903	-0.9889|-0.9889	5|10	.|0.45353	.|T	.|0.12	1.008|1.008	0.9235|0.9235	0.01320|0.01320	0.1639:0.336:0.1404:0.3597|0.1639:0.336:0.1404:0.3597	.|.	.|429;296;410;195	.|B7Z631;Q9NVP4-4;Q9NVP4;A6NKD0	.|.;.;DZAN1_HUMAN;.	T|H	209|237;410;412;236;195;296	.|ENSP00000366857:R237H;ENSP00000262547:R410H;ENSP00000328866:R412H;ENSP00000349774:R296H	.|ENSP00000262547:R410H	A|R	-|-	1|2	0|0	C20orf12|C20orf12	18343005|18343005	0.000000|0.000000	0.05858|0.05858	0.040000|0.040000	0.18447|0.18447	0.014000|0.014000	0.08584|0.08584	-0.520000|-0.520000	0.06252|0.06252	0.342000|0.342000	0.23796|0.23796	-0.251000|-0.251000	0.11542|0.11542	GCC|CGC	DZANK1	-	NULL		0.537	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	C	NM_001099407		18395005	-1	no_errors	ENST00000262547	ensembl	human	known	70_37	missense	SNP	0.000	T
DZANK1	55184	genome.wustl.edu	37	20	18395005	18395005	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr20:18395005C>T	ENST00000358866.6	-	11	1251	c.1229G>A	c.(1228-1230)cGc>cAc	p.R410H	DZANK1_ENST00000329494.5_Missense_Mutation_p.R412H|DZANK1_ENST00000262547.5_Missense_Mutation_p.R410H|DZANK1_ENST00000357236.4_Missense_Mutation_p.R296H|DZANK1_ENST00000487128.1_5'UTR			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	410							zinc ion binding (GO:0008270)	p.R410H(2)		NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						AGAAAAAGGGCGAGGTTCCTC	0.537																																																	2	Substitution - Missense(2)	cervix(2)											55.0	56.0	55.0					20																	18395005		1898	4122	6020	SO:0001583	missense	55184			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.1229G>A	20.37:g.18395005C>T	ENSP00000351734:p.Arg410His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.R410H	ENST00000358866.6	37	c.1229	CCDS46582.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.72|10.72	1.429433|1.429433	0.25726|0.25726	.|.	.|.	ENSG00000089091|ENSG00000089091	ENST00000358866|ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236	.|T;T;T;T	.|0.64260	.|0.08;-0.09;0.57;0.05	5.64|5.64	-0.139|-0.139	0.13460|0.13460	.|.	.|1.476590	.|0.03110	.|N	.|0.162313	T|T	0.52240|0.52240	0.1722|0.1722	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.18610	.|0.013;0.018;0.006;0.029	.|B;B;B;B	.|0.12156	.|0.003;0.007;0.003;0.003	T|T	0.32903|0.32903	-0.9889|-0.9889	5|10	.|0.45353	.|T	.|0.12	1.008|1.008	0.9235|0.9235	0.01320|0.01320	0.1639:0.336:0.1404:0.3597|0.1639:0.336:0.1404:0.3597	.|.	.|429;296;410;195	.|B7Z631;Q9NVP4-4;Q9NVP4;A6NKD0	.|.;.;DZAN1_HUMAN;.	T|H	209|237;410;412;236;195;296	.|ENSP00000366857:R237H;ENSP00000262547:R410H;ENSP00000328866:R412H;ENSP00000349774:R296H	.|ENSP00000262547:R410H	A|R	-|-	1|2	0|0	C20orf12|C20orf12	18343005|18343005	0.000000|0.000000	0.05858|0.05858	0.040000|0.040000	0.18447|0.18447	0.014000|0.014000	0.08584|0.08584	-0.520000|-0.520000	0.06252|0.06252	0.342000|0.342000	0.23796|0.23796	-0.251000|-0.251000	0.11542|0.11542	GCC|CGC	DZANK1	-	NULL		0.537	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	C	NM_001099407		18395005	-1	no_errors	ENST00000262547	ensembl	human	known	70_37	missense	SNP	0.000	T
ELMSAN1	91748	genome.wustl.edu	37	14	74206775	74206775	+	5'UTR	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:74206775C>T	ENST00000286523.5	-	0	719				ELMSAN1_ENST00000394071.2_5'UTR|ELMSAN1_ENST00000486739.1_5'UTR	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										CCTGGGGAAACGTCCTGCTGG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.-64G>A	14.37:g.74206775C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PK13|Q6PK59|Q6ZS23	RNA	SNP	-	NULL	ENST00000286523.5	37	NULL	CCDS9819.1	14																																																																																			ELMSAN1	-	-		0.622	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1	C	NM_194278		74206775	-1	no_errors	ENST00000486739	ensembl	human	known	70_37	rna	SNP	0.000	T
ELMSAN1	91748	genome.wustl.edu	37	14	74206775	74206775	+	5'UTR	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:74206775C>T	ENST00000286523.5	-	0	719				ELMSAN1_ENST00000394071.2_5'UTR|ELMSAN1_ENST00000486739.1_5'UTR	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										CCTGGGGAAACGTCCTGCTGG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.-64G>A	14.37:g.74206775C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PK13|Q6PK59|Q6ZS23	RNA	SNP	-	NULL	ENST00000286523.5	37	NULL	CCDS9819.1	14																																																																																			ELMSAN1	-	-		0.622	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1	C	NM_194278		74206775	-1	no_errors	ENST00000486739	ensembl	human	known	70_37	rna	SNP	0.000	T
RN7SKP189	106479180	genome.wustl.edu	37	X	144138901	144138901	+	RNA	SNP	A	A	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:144138901A>G	ENST00000365042.1	+	0	274									RNA, 7SK small nuclear pseudogene 189																		TATGTTAGACAGAACAATCAC	0.448																																																	0																																												0					Xq27.3	2013-03-19			ENSG00000201912	ENSG00000201912			45913	pseudogene	RNA, pseudogene							Standard			Approved						X.37:g.144138901A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000365042.1	37	NULL		X																																																																																			7SK	-	-		0.448	RN7SKP189-201	KNOWN	basic	misc_RNA	ENSG00000201912	RFAM	misc_RNA		A			144138901	+1	no_errors	ENST00000365042	ensembl	human	novel	70_37	rna	SNP	0.004	G
SPATA6	54558	genome.wustl.edu	37	1	48809985	48809985	+	Intron	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:48809985T>C	ENST00000371847.3	-	11	1359				SPATA6_ENST00000371843.3_Intron|RNU6-723P_ENST00000383973.1_RNA|SPATA6_ENST00000396199.3_Intron	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						attctatatttttcagacaag	0.413																																																	0																																										SO:0001627	intron_variant	0			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.1194+11356A>G	1.37:g.48809985T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3N7|Q8WUE6	RNA	SNP	-	NULL	ENST00000371847.3	37	NULL	CCDS551.1	1																																																																																			U6	-	-		0.413	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206700	RFAM	protein_coding	OTTHUMT00000021347.1	T	NM_019073		48809985	+1	no_errors	ENST00000383973	ensembl	human	novel	70_37	rna	SNP	0.122	C
AC008278.3	0	genome.wustl.edu	37	2	15808904	15808904	+	RNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:15808904C>T	ENST00000431117.1	-	0	471																											CTGCCCTCGTCCACCCCAGGC	0.522																																																	0																																												0																															2.37:g.15808904C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000431117.1	37	NULL		2																																																																																			AC008278.3	-	-		0.522	AC008278.3-001	KNOWN	basic	antisense	ENSG00000224194	Clone_based_vega_gene	antisense	OTTHUMT00000323667.1	C			15808904	-1	no_errors	ENST00000431117	ensembl	human	known	70_37	rna	SNP	0.403	T
AP000230.1	0	genome.wustl.edu	37	21	27548016	27548016	+	lincRNA	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr21:27548016G>A	ENST00000608591.1	+	0	182				AP001439.2_ENST00000455275.1_RNA																							AAGACAGAAGGACATGATTAA	0.383																																																	0																																												0																															21.37:g.27548016G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000608591.1	37	NULL		21																																																																																			AP001439.2	-	-		0.383	AP000230.1-001	KNOWN	basic	lincRNA	ENSG00000224541	Clone_based_vega_gene	lincRNA	OTTHUMT00000472109.1	G			27548016	+1	no_errors	ENST00000455275	ensembl	human	known	70_37	rna	SNP	0.004	A
RP11-417J8.1	0	genome.wustl.edu	37	1	142558868	142558868	+	lincRNA	SNP	T	T	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:142558868T>G	ENST00000445662.1	+	0	663																											TGACATGTTTTTAATGAAGCA	0.318																																																	0																																												0																															1.37:g.142558868T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445662.1	37	NULL		1																																																																																			AL583842.1	-	-		0.318	RP11-417J8.1-001	KNOWN	basic	lincRNA	ENSG00000227552	Clone_based_vega_gene	lincRNA	OTTHUMT00000036736.1	T			142558868	+1	no_errors	ENST00000445662	ensembl	human	known	70_37	rna	SNP	0.004	G
COL21A1	81578	genome.wustl.edu	37	6	56196760	56196760	+	Intron	SNP	A	A	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:56196760A>T	ENST00000370819.1	-	1	124				RP3-445N2.1_ENST00000415663.1_RNA			Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AAAAACAGGCATTACCACAAC	0.284																																																	0																																										SO:0001627	intron_variant	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000370819.1:c.37+62008T>A	6.37:g.56196760A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	RNA	SNP	-	NULL	ENST00000370819.1	37	NULL		6																																																																																			RP3-445N2.1	-	-		0.284	COL21A1-002	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	ENSG00000227602	Clone_based_vega_gene	protein_coding	OTTHUMT00000041005.1	A			56196760	-1	no_errors	ENST00000415663	ensembl	human	known	70_37	rna	SNP	1.000	T
TEX261	113419	genome.wustl.edu	37	2	71221896	71221896	+	5'UTR	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:71221896C>T	ENST00000272438.4	-	0	179				AC007040.6_ENST00000416229.1_RNA|AC007040.6_ENST00000601923.1_RNA|AC007040.11_ENST00000606025.1_5'UTR|TEX261_ENST00000466731.1_5'Flank	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261							integral component of membrane (GO:0016021)				NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						ATGGCGCCCCCACCCGCCCGC	0.751																																																	0													19.0	20.0	20.0					2																	71221896		2177	4263	6440	SO:0001623	5_prime_UTR_variant	0			AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.-9G>A	2.37:g.71221896C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A587|D6W5G9|Q8WUJ5	RNA	SNP	-	NULL	ENST00000272438.4	37	NULL	CCDS1914.1	2																																																																																			AC007040.6	-	-		0.751	TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228384	Clone_based_vega_gene	protein_coding	OTTHUMT00000251916.1	C	NM_144582		71221896	+1	no_errors	ENST00000601923	ensembl	human	known	70_37	rna	SNP	0.001	T
TEX261	113419	genome.wustl.edu	37	2	71221896	71221896	+	5'UTR	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:71221896C>T	ENST00000272438.4	-	0	179				AC007040.6_ENST00000416229.1_RNA|AC007040.6_ENST00000601923.1_RNA|AC007040.11_ENST00000606025.1_5'UTR|TEX261_ENST00000466731.1_5'Flank	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261							integral component of membrane (GO:0016021)				NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						ATGGCGCCCCCACCCGCCCGC	0.751																																																	0													19.0	20.0	20.0					2																	71221896		2177	4263	6440	SO:0001623	5_prime_UTR_variant	0			AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.-9G>A	2.37:g.71221896C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A587|D6W5G9|Q8WUJ5	RNA	SNP	-	NULL	ENST00000272438.4	37	NULL	CCDS1914.1	2																																																																																			AC007040.6	-	-		0.751	TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228384	Clone_based_vega_gene	protein_coding	OTTHUMT00000251916.1	C	NM_144582		71221896	+1	no_errors	ENST00000601923	ensembl	human	known	70_37	rna	SNP	0.001	T
GS1-542M4.4	0	genome.wustl.edu	37	X	8835639	8835640	+	lincRNA	INS	-	-	GA	rs61112464|rs373453019		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:8835639_8835640insGA	ENST00000440430.1	-	0	2_3																											acagaggaagcgagagagagag	0.475																																																	0																																												0																															X.37:g.8835648_8835649dupGA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000440430.1	37	NULL		X																																																																																			GS1-542M4.4	-	-		0.475	GS1-542M4.4-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000229012	Clone_based_vega_gene	lincRNA	OTTHUMT00000055698.1	-			8835640	-1	no_errors	ENST00000440430	ensembl	human	known	70_37	rna	INS	0.004:0.002	GA
TMEM44	93109	genome.wustl.edu	37	3	194353786	194353786	+	Intron	SNP	C	C	G	rs1675956	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:194353786C>G	ENST00000392432.2	-	1	343				TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron|TMEM44_ENST00000330115.3_Intron|AC046143.3_ENST00000447139.1_RNA|TMEM44_ENST00000347147.4_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CCCGACAGCCCCCCGACCCGT	0.672																																																	0													7.0	9.0	8.0					3																	194353786		1876	3621	5497	SO:0001627	intron_variant	0			AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.137+21G>C	3.37:g.194353786C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	RNA	SNP	-	NULL	ENST00000392432.2	37	NULL	CCDS54699.1	3																																																																																			AC046143.3	-	-		0.672	TMEM44-002	KNOWN	basic|CCDS	protein_coding	ENSG00000229334	Clone_based_vega_gene	protein_coding	OTTHUMT00000342750.1	C	NM_138399		194353786	+1	no_errors	ENST00000447139	ensembl	human	known	70_37	rna	SNP	0.030	G
AC113610.1	0	genome.wustl.edu	37	2	151113458	151113458	+	lincRNA	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:151113458C>A	ENST00000429317.1	-	0	63				AC016682.1_ENST00000437118.1_lincRNA																							AACACTGAAACCAGGAATTTA	0.378																																																	0																																												0																															2.37:g.151113458C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000429317.1	37	NULL		2																																																																																			AC113610.1	-	-		0.378	AC113610.1-001	KNOWN	basic	lincRNA	ENSG00000231420	Clone_based_vega_gene	lincRNA	OTTHUMT00000332351.1	C			151113458	-1	no_errors	ENST00000429317	ensembl	human	known	70_37	rna	SNP	0.000	A
LINC01360	101927295	genome.wustl.edu	37	1	73802686	73802686	+	lincRNA	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:73802686G>A	ENST00000440762.1	+	0	1997																											gctgaggcccgagaatggtgt	0.478																																																	0																																												0																															1.37:g.73802686G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000440762.1	37	NULL		1																																																																																			RP4-598G3.1	-	-		0.478	RP4-598G3.1-001	KNOWN	basic	lincRNA	ENSG00000233973	Clone_based_vega_gene	lincRNA	OTTHUMT00000026413.1	G			73802686	+1	no_errors	ENST00000440762	ensembl	human	known	70_37	rna	SNP	0.050	A
Unknown	0	genome.wustl.edu	37	9	137476214	137476214	+	IGR	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:137476214G>A								RP11-473E2.3 (30471 upstream) : COL5A1 (57405 downstream)																							ctgttacccaggctagagtac	0.428																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.137476214G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		9																																																																																			RP11-54A22.1	-	-	0	0.428					ENSG00000234960	Clone_based_vega_gene			G			137476214	+1	no_errors	ENST00000423455	ensembl	human	known	70_37	rna	SNP	0.001	A
HIVEP2	3097	genome.wustl.edu	37	6	143109406	143109406	+	Intron	SNP	G	G	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:143109406G>T	ENST00000367604.1	-	2	113				HIVEP2_ENST00000012134.2_Intron|RP1-67K17.4_ENST00000454411.1_lincRNA|HIVEP2_ENST00000474532.1_Intron|HIVEP2_ENST00000367603.2_Intron			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		taacaaacctgcacattgtgc	0.338																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0																																										SO:0001627	intron_variant	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.527-4654C>A	6.37:g.143109406G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q02646|Q5THT5|Q9NS05	RNA	SNP	-	NULL	ENST00000367604.1	37	NULL	CCDS43510.1	6																																																																																			RP1-67K17.4	-	-		0.338	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237851	Clone_based_vega_gene	protein_coding	OTTHUMT00000042495.1	G			143109406	+1	no_errors	ENST00000454411	ensembl	human	known	70_37	rna	SNP	0.050	T
MIATNB	102724827	genome.wustl.edu	37	22	27176082	27176082	+	lincRNA	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:27176082T>C	ENST00000437071.1	+	0	918																											ggggttggtttgttacgcagc	0.403																																																	0																																												0																															22.37:g.27176082T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000437071.1	37	NULL		22																																																																																			CTA-211A9.5	-	-		0.403	CTA-211A9.5-007	KNOWN	basic|exp_conf	lincRNA	ENSG00000244625	Clone_based_vega_gene	lincRNA	OTTHUMT00000320774.1	T			27176082	+1	no_errors	ENST00000437071	ensembl	human	known	70_37	rna	SNP	0.812	C
FRG1	2483	genome.wustl.edu	37	4	190860985	190860986	+	5'Flank	INS	-	-	T	rs375908580|rs562432972		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:190860985_190860986insT	ENST00000226798.4	+	0	0					NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		tacgttgatagcggtaaggacg	0.485																																																	0																																										SO:0001631	upstream_gene_variant	0			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202		4.37:g.190860985_190860986insT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K775	RNA	INS	-	NULL	ENST00000226798.4	37	NULL	CCDS34121.1	4																																																																																			AF146191.4	-	-		0.485	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000245685	Clone_based_vega_gene	protein_coding	OTTHUMT00000359622.4	-	NM_004477		190860986	-1	no_errors	ENST00000501825	ensembl	human	putative	70_37	rna	INS	0.000:0.000	T
LOC102724885	102724885	genome.wustl.edu	37	5	99785854	99785854	+	lincRNA	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:99785854C>A	ENST00000499025.1	-	0	1172																											gattttgtatccttaaacttt	0.303																																																	0																																												0																															5.37:g.99785854C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000499025.1	37	NULL		5																																																																																			CTD-2001C12.1	-	-		0.303	CTD-2001C12.1-002	KNOWN	basic	lincRNA	ENSG00000247877	Clone_based_vega_gene	lincRNA	OTTHUMT00000370444.1	C			99785854	-1	no_errors	ENST00000499025	ensembl	human	known	70_37	rna	SNP	0.006	A
RP11-364P22.2	0	genome.wustl.edu	37	4	158559035	158559035	+	lincRNA	SNP	C	C	T	rs62335698		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:158559035C>T	ENST00000507296.1	+	0	197																											GGTCGGGCGGCGGCGGCTGCG	0.771																																																	0																																												0																															4.37:g.158559035C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000507296.1	37	NULL		4																																																																																			RP11-364P22.2	-	-		0.771	RP11-364P22.2-001	KNOWN	basic	lincRNA	ENSG00000249275	Clone_based_vega_gene	lincRNA	OTTHUMT00000365220.1	C			158559035	+1	no_errors	ENST00000507296	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-114G22.1	0	genome.wustl.edu	37	12	23206992	23206992	+	lincRNA	SNP	G	G	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr12:23206992G>T	ENST00000540895.1	+	0	670																											AGCAAGATAGGAGTTGAAGTG	0.473																																																	0																																												0																															12.37:g.23206992G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000540895.1	37	NULL		12																																																																																			RP11-114G22.1	-	-		0.473	RP11-114G22.1-004	KNOWN	basic	lincRNA	ENSG00000256995	Clone_based_vega_gene	lincRNA	OTTHUMT00000401996.1	G			23206992	+1	no_errors	ENST00000540895	ensembl	human	known	70_37	rna	SNP	0.000	T
LOC100506869	100506869	genome.wustl.edu	37	12	59010884	59010885	+	Intron	INS	-	-	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr12:59010884_59010885insT	ENST00000546977.1	+	1	56				RP11-767I20.1_ENST00000550678.1_lincRNA|RP11-362K2.2_ENST00000548576.1_Intron																							TAATCCACTGATTTTTTTTTTT	0.361																																																	0																																										SO:0001627	intron_variant	0																														ENST00000546977.1:c.-608+72922->T	12.37:g.59010895_59010895dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000546977.1	37	NULL		12																																																																																			RP11-767I20.1	-	-		0.361	RP11-362K2.2-001	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	ENSG00000257259	Clone_based_vega_gene	protein_coding	OTTHUMT00000406685.1	-			59010885	-1	no_errors	ENST00000550678	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
ABHD12B	145447	genome.wustl.edu	37	14	51353173	51353173	+	Intron	SNP	A	A	G	rs533866666	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:51353173A>G	ENST00000337334.2	+	8	677				PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000554241.1_Intron|ABHD12B_ENST00000353130.1_Intron|ABHD12B_ENST00000395752.1_Intron	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B								hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					aaaaaaaaaaaaaagaaagaa	0.433													G|||	3	0.000599042	0.0008	0.0014	5008	,	,		18066	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.663-192A>G	14.37:g.51353173A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	RNA	SNP	-	NULL	ENST00000337334.2	37	NULL	CCDS55916.1	14																																																																																			RP11-218E20.6	-	-		0.433	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000258398	Clone_based_vega_gene	protein_coding	OTTHUMT00000411030.1	A			51353173	-1	no_errors	ENST00000554141	ensembl	human	known	70_37	rna	SNP	0.000	G
LINC01581	101927112	genome.wustl.edu	37	15	94608103	94608103	+	lincRNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr15:94608103C>T	ENST00000558874.1	-	0	1141																											ctatacattgcgaaacatttg	0.368																																																	0																																												0																															15.37:g.94608103C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000558874.1	37	NULL		15																																																																																			CTD-3049M7.1	-	-		0.368	CTD-2643K12.3-001	KNOWN	basic	lincRNA	ENSG00000258754	Clone_based_vega_gene	lincRNA	OTTHUMT00000419517.1	C			94608103	-1	no_errors	ENST00000555772	ensembl	human	known	70_37	rna	SNP	0.000	T
LINC01290	106144584	genome.wustl.edu	37	16	10608701	10608701	+	lincRNA	SNP	T	T	A	rs563114962		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:10608701T>A	ENST00000566787.1	-	0	499																											CCTTATCCTTTAAAAAAAAAA	0.313																																																	0																																												0																															16.37:g.10608701T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000566787.1	37	NULL		16																																																																																			RP11-27M24.3	-	-		0.313	RP11-27M24.3-001	KNOWN	basic	lincRNA	ENSG00000260468	Clone_based_vega_gene	lincRNA	OTTHUMT00000435303.1	T			10608701	-1	no_errors	ENST00000566787	ensembl	human	known	70_37	rna	SNP	0.003	A
RP11-426C22.5	0	genome.wustl.edu	37	16	29151049	29151049	+	lincRNA	SNP	C	C	T	rs535959143		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:29151049C>T	ENST00000562902.1	+	0	200																											AGCCAGGGCACGGGGCAGCTG	0.667																																																	0																																												0																															16.37:g.29151049C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562902.1	37	NULL		16																																																																																			RP11-426C22.5	-	-		0.667	RP11-426C22.5-001	KNOWN	basic	lincRNA	ENSG00000260517	Clone_based_vega_gene	lincRNA	OTTHUMT00000433246.1	C			29151049	+1	no_errors	ENST00000563477	ensembl	human	known	70_37	rna	SNP	0.000	T
TSC22D2	9819	genome.wustl.edu	37	3	150183978	150183979	+	3'UTR	INS	-	-	CA	rs200132826|rs398052359|rs71672299|rs66898777|rs35328902|rs374062794		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:150183978_150183979insCA	ENST00000361875.3	+	0	10914_10915					NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2						response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TTAAATcacatcacacacacac	0.376																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.*7556->CA	3.37:g.150183987_150183988dupCA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	RNA	INS	-	NULL	ENST00000361875.3	37	NULL	CCDS3149.1	3																																																																																			RP11-145F16.2	-	-		0.376	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000261050	Clone_based_vega_gene	protein_coding	OTTHUMT00000357123.2	-	NM_014779		150183979	+1	no_errors	ENST00000565554	ensembl	human	known	70_37	rna	INS	0.001:0.020	CA
RAB40B	10966	genome.wustl.edu	37	17	80632388	80632389	+	Intron	INS	-	-	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:80632388_80632389insC	ENST00000571995.1	-	2	274				RAB40B_ENST00000269347.6_Intron|RAB40B_ENST00000538809.2_Intron	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family						protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			ggtggcgggcacctgtagtccc	0.554																																																	0																																										SO:0001627	intron_variant	0			U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.143-9956->G	17.37:g.80632390_80632390dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WVG3	RNA	INS	-	NULL	ENST00000571995.1	37	NULL	CCDS11816.1	17																																																																																			RP11-388C12.2	-	-		0.554	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262415	Clone_based_vega_gene	protein_coding	OTTHUMT00000439007.1	-			80632389	-1	no_errors	ENST00000574080	ensembl	human	known	70_37	rna	INS	0.020:0.036	C
LOC105371919	105371919	genome.wustl.edu	37	17	77801194	77801194	+	lincRNA	SNP	G	G	A	rs386799712		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:77801194G>A	ENST00000576963.1	+	0	1479																											gcgcgcacacgtgtgcacgca	0.547																																																	0																																												0																															17.37:g.77801194G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000576963.1	37	NULL		17																																																																																			RP11-353N14.2	-	-		0.547	RP11-353N14.2-001	KNOWN	basic	lincRNA	ENSG00000262772	Clone_based_vega_gene	lincRNA	OTTHUMT00000437044.1	G			77801194	+1	no_errors	ENST00000576963	ensembl	human	known	70_37	rna	SNP	0.002	A
LRRC69	100130742	genome.wustl.edu	37	8	92151670	92151671	+	Intron	INS	-	-	TTT			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr8:92151670_92151671insTTT	ENST00000448384.2	+	5	651				RN7SL777P_ENST00000582630.1_RNA|LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69											endometrium(1)	1						ctcccagctaattttgtatttt	0.5																																																	0																																										SO:0001627	intron_variant	0			AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.651+3703->TTT	8.37:g.92151671_92151673dupTTT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000448384.2	37	NULL		8																																																																																			Metazoa_SRP	-	-		0.500	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	ENSG00000263888	RFAM	protein_coding	OTTHUMT00000415207.1	-	NM_001129890		92151671	+1	no_errors	ENST00000582630	ensembl	human	novel	70_37	rna	INS	0.153:0.158	TTT
RP11-94B19.4	0	genome.wustl.edu	37	18	73970021	73970021	+	5'Flank	SNP	A	A	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:73970021A>C	ENST00000577797.1	+	0	0				RP11-94B19.7_ENST00000579714.1_lincRNA|RP11-94B19.3_ENST00000579833.1_lincRNA																							TGCATGAAAAAACATCTCAAA	0.338																																																	0																																										SO:0001631	upstream_gene_variant	0																															18.37:g.73970021A>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000577797.1	37	NULL		18																																																																																			RP11-94B19.3	-	-		0.338	RP11-94B19.4-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000264212	Clone_based_vega_gene	protein_coding	OTTHUMT00000444931.1	A			73970021	+1	no_errors	ENST00000579833	ensembl	human	known	70_37	rna	SNP	0.000	C
C14orf159	80017	genome.wustl.edu	37	14	91614551	91614552	+	Intron	INS	-	-	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:91614551_91614552insT	ENST00000523771.1	+	2	522				C14orf159_ENST00000518868.1_Intron|C14orf159_ENST00000428926.2_Intron|C14orf159_ENST00000518665.2_Intron|C14orf159_ENST00000520328.1_Intron|C14orf159_ENST00000298858.4_Intron|C14orf159_ENST00000521077.2_Intron|C14orf159_ENST00000522322.1_Intron|C14orf159_ENST00000523816.1_Intron|RN7SL506P_ENST00000583824.1_RNA|C14orf159_ENST00000256324.10_Intron|C14orf159_ENST00000412671.2_Intron|C14orf159_ENST00000519019.1_Intron|C14orf159_ENST00000525393.2_Intron			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159							mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CTAACAAAGGAttttttttttt	0.495																																																	0																																										SO:0001627	intron_variant	0			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.-81-9431->T	14.37:g.91614562_91614562dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	RNA	INS	-	NULL	ENST00000523771.1	37	NULL	CCDS32141.1	14																																																																																			Metazoa_SRP	-	-		0.495	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000266343	RFAM	protein_coding	OTTHUMT00000381273.1	-	NM_024952		91614552	+1	no_errors	ENST00000583824	ensembl	human	novel	70_37	rna	INS	0.726:0.595	T
ZNF224	7767	genome.wustl.edu	37	19	44603857	44603858	+	Intron	INS	-	-	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:44603857_44603858insA	ENST00000336976.6	+	4	269				AC084219.3_ENST00000591772.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				agaaaaaaaagaaaaaaaCAAT	0.356																																																	0																																										SO:0001627	intron_variant	0			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.16-1096->A	19.37:g.44603864_44603864dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	RNA	INS	-	NULL	ENST00000336976.6	37	NULL	CCDS33046.1	19																																																																																			AC084219.3	-	-		0.356	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267163	Clone_based_vega_gene	protein_coding	OTTHUMT00000460477.1	-	NM_013398		44603858	-1	no_errors	ENST00000591772	ensembl	human	known	70_37	rna	INS	0.000:0.001	A
C17orf105	284067	genome.wustl.edu	37	17	41860184	41860184	+	Intron	SNP	G	G	A	rs373848973		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:41860184G>A	ENST00000449302.3	+	4	342				RP5-905N1.2_ENST00000591540.1_RNA	NM_001136483.1	NP_001129955.1	B2RV13	CQ105_HUMAN	chromosome 17 open reading frame 105																		GTCGCCAGCCGTTTGTGATTT	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		19227	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0				CCDS45695.1	17q21.31	2012-10-23			ENSG00000231256	ENSG00000231256			37241	protein-coding gene	gene with protein product							Standard	NM_001136483		Approved		uc002ieg.3	B2RV13	OTTHUMG00000180890	ENST00000449302.3:c.315-364G>A	17.37:g.41860184G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000449302.3	37	NULL	CCDS45695.1	17																																																																																			RP5-905N1.2	-	-		0.448	C17orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267604	Clone_based_vega_gene	protein_coding	OTTHUMT00000453508.1	G	NM_001136483		41860184	-1	no_errors	ENST00000591540	ensembl	human	known	70_37	rna	SNP	0.025	A
MAMDC2	256691	genome.wustl.edu	37	9	72808941	72808941	+	Intron	SNP	G	G	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:72808941G>T	ENST00000377182.4	+	11	2268				SMC5-AS1_ENST00000594708.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2						peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						AGTTTATTTTGTGTCTATCAG	0.333																																																	0																																										SO:0001627	intron_variant	0			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1651+23394G>T	9.37:g.72808941G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VW47|Q8WX43|Q96BM4	RNA	SNP	-	NULL	ENST00000377182.4	37	NULL	CCDS6631.1	9																																																																																			RP11-373A9.3	-	-		0.333	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268364	Clone_based_vega_gene	protein_coding	OTTHUMT00000052600.1	G	NM_153267		72808941	-1	no_errors	ENST00000594708	ensembl	human	known	70_37	rna	SNP	0.001	T
FCAR	2204	genome.wustl.edu	37	19	55402767	55402768	+	IGR	INS	-	-	A	rs139118041|rs368546519	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:55402767_55402768insA	ENST00000355524.3	+	0	1483				CTB-61M7.2_ENST00000594721.1_lincRNA	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for						immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GTCCTGTGATTAAAAAAAAAAT	0.332																																																	0																																										SO:0001628	intergenic_variant	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936		19.37:g.55402777_55402777dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	RNA	INS	-	NULL	ENST00000355524.3	37	NULL	CCDS12907.1	19																																																																																			CTB-61M7.2	-	-		0.332	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000268734	Clone_based_vega_gene	protein_coding	OTTHUMT00000141243.1	-	NM_002000		55402768	+1	no_errors	ENST00000594721	ensembl	human	known	70_37	rna	INS	0.843:0.928	A
SLC35E2B	728661	genome.wustl.edu	37	1	1604282	1604282	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:1604282C>T	ENST00000378662.1	-	6	1347				SLC35E2B_ENST00000234800.6_Intron|RP11-345P4.7_ENST00000596308.1_RNA			P0CK96	S352B_HUMAN	solute carrier family 35, member E2B							integral component of membrane (GO:0016021)				kidney(1)|lung(1)	2						ccgggtgcctcaggccctggc	0.542																																																	0																																										SO:0001627	intron_variant	0				CCDS44041.1	1p36.33	2013-05-22			ENSG00000189339	ENSG00000189339		"""Solute carriers"""	33941	protein-coding gene	gene with protein product							Standard	XM_006710870		Approved		uc001ahg.4	P0CK96	OTTHUMG00000078639	ENST00000378662.1:c.587-1214G>A	1.37:g.1604282C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q9Y3J8	RNA	SNP	-	NULL	ENST00000378662.1	37	NULL	CCDS44041.1	1																																																																																			RP11-345P4.7	-	-		0.542	SLC35E2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000269737	Clone_based_vega_gene	protein_coding	OTTHUMT00000171589.1	C			1604282	+1	no_errors	ENST00000596308	ensembl	human	known	70_37	rna	SNP	0.000	T
EP300	2033	genome.wustl.edu	37	22	41565529	41565529	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:41565529G>A	ENST00000263253.7	+	26	5414	c.4195G>A	c.(4195-4197)Gat>Aat	p.D1399N	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1399	Acetyl-CoA binding. {ECO:0000269|PubMed:24819397}.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with histone. {ECO:0000269|PubMed:18273021}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.D1399N(5)|p.D1399Y(2)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ATCTTACCTCGATAGTGTTCA	0.338			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	7	Substitution - Missense(7)	lung(3)|upper_aerodigestive_tract(1)|stomach(1)|central_nervous_system(1)|cervix(1)											98.0	93.0	95.0					22																	41565529		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4195G>A	22.37:g.41565529G>A	ENSP00000263253:p.Asp1399Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.D1399N	ENST00000263253.7	37	c.4195	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998529	0.93227	.	.	ENSG00000100393	ENST00000263253	D	0.99422	-5.88	5.55	5.55	0.83447	.	0.000000	0.46758	D	0.000275	D	0.99743	0.9898	H	0.96633	3.855	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.97288	0.9922	10	0.87932	D	0	-10.979	19.5071	0.95124	0.0:0.0:1.0:0.0	.	1399	Q09472	EP300_HUMAN	N	1399	ENSP00000263253:D1399N	ENSP00000263253:D1399N	D	+	1	0	EP300	39895475	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.760000	0.98935	2.617000	0.88574	0.557000	0.71058	GAT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109		0.338	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	G	NM_001429		41565529	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	missense	SNP	1.000	A
EP300	2033	genome.wustl.edu	37	22	41565529	41565529	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:41565529G>A	ENST00000263253.7	+	26	5414	c.4195G>A	c.(4195-4197)Gat>Aat	p.D1399N	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1399	Acetyl-CoA binding. {ECO:0000269|PubMed:24819397}.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with histone. {ECO:0000269|PubMed:18273021}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.D1399N(5)|p.D1399Y(2)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ATCTTACCTCGATAGTGTTCA	0.338			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	7	Substitution - Missense(7)	lung(3)|upper_aerodigestive_tract(1)|stomach(1)|central_nervous_system(1)|cervix(1)											98.0	93.0	95.0					22																	41565529		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4195G>A	22.37:g.41565529G>A	ENSP00000263253:p.Asp1399Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.D1399N	ENST00000263253.7	37	c.4195	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998529	0.93227	.	.	ENSG00000100393	ENST00000263253	D	0.99422	-5.88	5.55	5.55	0.83447	.	0.000000	0.46758	D	0.000275	D	0.99743	0.9898	H	0.96633	3.855	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.97288	0.9922	10	0.87932	D	0	-10.979	19.5071	0.95124	0.0:0.0:1.0:0.0	.	1399	Q09472	EP300_HUMAN	N	1399	ENSP00000263253:D1399N	ENSP00000263253:D1399N	D	+	1	0	EP300	39895475	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.760000	0.98935	2.617000	0.88574	0.557000	0.71058	GAT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109		0.338	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	G	NM_001429		41565529	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	missense	SNP	1.000	A
EPB41	2035	genome.wustl.edu	37	1	29314294	29314294	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:29314294G>A	ENST00000343067.4	+	2	472	c.345G>A	c.(343-345)gaG>gaA	p.E115E	EPB41_ENST00000373798.1_Silent_p.E115E|EPB41_ENST00000347529.3_Silent_p.E115E|EPB41_ENST00000373797.1_Silent_p.E115E|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000398863.2_Silent_p.E115E|EPB41_ENST00000356093.2_Silent_p.E115E|Y_RNA_ENST00000383977.1_RNA	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	115					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.E115E(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GTCAGAAAGAGATAGAATTTG	0.423																																																	1	Substitution - coding silent(1)	cervix(1)											125.0	130.0	128.0					1																	29314294		2203	4300	6503	SO:0001819	synonymous_variant	2035			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.345G>A	1.37:g.29314294G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.E115	ENST00000343067.4	37	c.345	CCDS53288.1	1																																																																																			EPB41	-	pirsf_Band_41_protein		0.423	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	G	NM_203342		29314294	+1	no_errors	ENST00000343067	ensembl	human	known	70_37	silent	SNP	0.082	A
EPB41	2035	genome.wustl.edu	37	1	29314294	29314294	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:29314294G>A	ENST00000343067.4	+	2	472	c.345G>A	c.(343-345)gaG>gaA	p.E115E	EPB41_ENST00000373798.1_Silent_p.E115E|EPB41_ENST00000347529.3_Silent_p.E115E|EPB41_ENST00000373797.1_Silent_p.E115E|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000398863.2_Silent_p.E115E|EPB41_ENST00000356093.2_Silent_p.E115E|Y_RNA_ENST00000383977.1_RNA	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	115					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.E115E(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GTCAGAAAGAGATAGAATTTG	0.423																																																	1	Substitution - coding silent(1)	cervix(1)											125.0	130.0	128.0					1																	29314294		2203	4300	6503	SO:0001819	synonymous_variant	2035			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.345G>A	1.37:g.29314294G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.E115	ENST00000343067.4	37	c.345	CCDS53288.1	1																																																																																			EPB41	-	pirsf_Band_41_protein		0.423	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	G	NM_203342		29314294	+1	no_errors	ENST00000343067	ensembl	human	known	70_37	silent	SNP	0.082	A
EYS	346007	genome.wustl.edu	37	6	66044995	66044998	+	Frame_Shift_Del	DEL	CTGA	CTGA	-			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	CTGA	CTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:66044995_66044998delCTGA	ENST00000370621.3	-	11	2167_2170	c.1641_1644delTCAG	c.(1639-1644)agtcagfs	p.SQ547fs	EYS_ENST00000342421.5_Frame_Shift_Del_p.SQ547fs|EYS_ENST00000370618.3_Frame_Shift_Del_p.SQ547fs|EYS_ENST00000503581.1_Frame_Shift_Del_p.SQ547fs|EYS_ENST00000393380.2_Frame_Shift_Del_p.SQ547fs|EYS_ENST00000370616.2_Frame_Shift_Del_p.SQ547fs			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	547					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Q548*(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACCGATATTCCTGACTGTCTTCTT	0.353																																																	2	Substitution - Nonsense(2)	lung(2)																																								SO:0001589	frameshift_variant	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1641_1644delTCAG	6.37:g.66044995_66044998delCTGA	ENSP00000359655:p.Ser547fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Frame_Shift_Del	DEL	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.S547fs	ENST00000370621.3	37	c.1644_1641		6																																																																																			EYS	-	NULL		0.353	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	CTGA	XM_294050		66044998	-1	no_errors	ENST00000370616	ensembl	human	known	70_37	frame_shift_del	DEL	0.000:0.000:0.000:0.000	-
FAM86B2	653333	genome.wustl.edu	37	8	12286158	12286158	+	Missense_Mutation	SNP	A	A	T	rs7844327	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr8:12286158A>T	ENST00000262365.4	-	6	725	c.726T>A	c.(724-726)gaT>gaA	p.D242E	FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000309608.5_Intron|FAM86B2_ENST00000351291.4_Missense_Mutation_p.D208E	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	242										endometrium(1)|kidney(2)	3						CAATGACAACATCTGGCTGGA	0.587																																																	0																																										SO:0001583	missense	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.726T>A	8.37:g.12286158A>T	ENSP00000262365:p.Asp242Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.D242E	ENST00000262365.4	37	c.726	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	a	13.43	2.233745	0.39498	.	.	ENSG00000145002	ENST00000262365;ENST00000351291;ENST00000527331	T;T;T	0.51574	0.7;0.7;0.7	1.16	-1.35	0.09114	.	.	.	.	.	T	0.62865	0.2463	M	0.83118	2.625	0.42913	D	0.994265	D	0.89917	1.0	D	0.87578	0.998	T	0.60667	-0.7218	9	0.54805	T	0.06	.	5.181	0.15160	0.6278:0.0:0.3722:0.0	.	242	P0C5J1	F86B2_HUMAN	E	242;208;208	ENSP00000262365:D242E;ENSP00000283479:D208E;ENSP00000432491:D208E	ENSP00000262365:D242E	D	-	3	2	FAM86B2	12330529	0.001000	0.12720	0.056000	0.19401	0.160000	0.22226	-0.344000	0.07780	-0.397000	0.07691	0.136000	0.15936	GAT	FAM86B2	-	pfam_Nicotinamide_N-MeTfrase-like		0.587	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		A	XM_928336		12286158	-1	no_errors	ENST00000262365	ensembl	human	known	70_37	missense	SNP	0.361	T
PDPK1	5170	genome.wustl.edu	37	16	2613067	2613067	+	Intron	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:2613067T>C	ENST00000342085.4	+	4	615				PDPK1_ENST00000389224.3_Intron|PDPK1_ENST00000354836.5_Intron|PDPK1_ENST00000268673.7_Intron|PDPK1_ENST00000441549.3_Intron|RP11-20I23.8_ENST00000569852.1_RNA	NM_002613.4	NP_002604.1	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase 1						actin cytoskeleton organization (GO:0030036)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|focal adhesion assembly (GO:0048041)|hyperosmotic response (GO:0006972)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of endothelial cell migration (GO:0010594)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of mast cell degranulation (GO:0043304)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	3-phosphoinositide-dependent protein kinase activity (GO:0004676)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7		Ovarian(90;0.17)			Celecoxib(DB00482)	GGGCGGGTGCTGGGCTGGCAT	0.642																																																	0																																										SO:0001627	intron_variant	645644			AF017995	CCDS10472.1, CCDS10473.1, CCDS58411.1	16p13.3	2014-03-20	2014-03-20		ENSG00000140992	ENSG00000140992			8816	protein-coding gene	gene with protein product	"""PkB kinase"""	605213				9094314, 9445477	Standard	NM_002613		Approved	PDK1	uc002cqs.4	O15530	OTTHUMG00000128874	ENST00000342085.4:c.466+1158T>C	16.37:g.2613067T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	H0Y4Z0|Q59EH6|Q6FI20|Q8IV52|Q9BRD5	RNA	SNP	-	NULL	ENST00000342085.4	37	NULL	CCDS10472.1	16																																																																																			RP11-20I23.8	-	-		0.642	PDPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ42627	Clone_based_vega_gene	protein_coding	OTTHUMT00000250831.3	T			2613067	-1	no_errors	ENST00000569852	ensembl	human	known	70_37	rna	SNP	0.001	C
FOXD4L1	200350	genome.wustl.edu	37	2	114257595	114257595	+	Silent	SNP	C	C	G	rs199633498	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:114257595C>G	ENST00000306507.5	+	1	935	c.762C>G	c.(760-762)ccC>ccG	p.P254P		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	254	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						ACACCGCCCCCGGGAGACGCC	0.726																																																	0													15.0	22.0	20.0					2																	114257595		1594	3087	4681	SO:0001819	synonymous_variant	200350			AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.762C>G	2.37:g.114257595C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWN1|B9EGF3	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P254	ENST00000306507.5	37	c.762	CCDS2117.1	2																																																																																			FOXD4L1	-	NULL		0.726	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L1	HGNC	protein_coding	OTTHUMT00000254148.1	C	NM_012184		114257595	+1	no_errors	ENST00000306507	ensembl	human	known	70_37	silent	SNP	0.866	G
FOXD4L1	200350	genome.wustl.edu	37	2	114257610	114257610	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:114257610C>T	ENST00000306507.5	+	1	950	c.777C>T	c.(775-777)taC>taT	p.Y259Y		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	259	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						GACGCCCTTACGCTCTGCTGC	0.731																																																	0													16.0	21.0	19.0					2																	114257610		1631	3173	4804	SO:0001819	synonymous_variant	200350			AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.777C>T	2.37:g.114257610C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWN1|B9EGF3	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Y259	ENST00000306507.5	37	c.777	CCDS2117.1	2																																																																																			FOXD4L1	-	NULL		0.731	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L1	HGNC	protein_coding	OTTHUMT00000254148.1	C	NM_012184		114257610	+1	no_errors	ENST00000306507	ensembl	human	known	70_37	silent	SNP	0.923	T
GAB1	2549	genome.wustl.edu	37	4	144359596	144359596	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:144359596G>A	ENST00000262994.4	+	4	1340	c.1038G>A	c.(1036-1038)ccG>ccA	p.P346P	GAB1_ENST00000262995.4_Silent_p.P346P|GAB1_ENST00000505913.1_Silent_p.P243P	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	346					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P346P(1)		breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					CTCGGCCACCGAAACCACATC	0.493																																																	1	Substitution - coding silent(1)	cervix(1)											152.0	123.0	133.0					4																	144359596		2203	4300	6503	SO:0001819	synonymous_variant	2549			U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1038G>A	4.37:g.144359596G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K152|Q4W5G2|Q6P1W2	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P346	ENST00000262994.4	37	c.1038	CCDS3759.1	4																																																																																			GAB1	-	NULL		0.493	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB1	HGNC	protein_coding	OTTHUMT00000364998.1	G	NM_002039		144359596	+1	no_errors	ENST00000262995	ensembl	human	known	70_37	silent	SNP	0.292	A
GAB1	2549	genome.wustl.edu	37	4	144359596	144359596	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:144359596G>A	ENST00000262994.4	+	4	1340	c.1038G>A	c.(1036-1038)ccG>ccA	p.P346P	GAB1_ENST00000262995.4_Silent_p.P346P|GAB1_ENST00000505913.1_Silent_p.P243P	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	346					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P346P(1)		breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					CTCGGCCACCGAAACCACATC	0.493																																																	1	Substitution - coding silent(1)	cervix(1)											152.0	123.0	133.0					4																	144359596		2203	4300	6503	SO:0001819	synonymous_variant	2549			U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1038G>A	4.37:g.144359596G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K152|Q4W5G2|Q6P1W2	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P346	ENST00000262994.4	37	c.1038	CCDS3759.1	4																																																																																			GAB1	-	NULL		0.493	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB1	HGNC	protein_coding	OTTHUMT00000364998.1	G	NM_002039		144359596	+1	no_errors	ENST00000262995	ensembl	human	known	70_37	silent	SNP	0.292	A
GADL1	339896	genome.wustl.edu	37	3	30820211	30820212	+	Intron	INS	-	-	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:30820211_30820212insT	ENST00000282538.5	-	14	1453				GADL1_ENST00000498387.1_5'UTR	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GATTACCTGTGAGATGATAACA	0.436																																																	0																																										SO:0001627	intron_variant	339896			AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1303-451->A	3.37:g.30820211_30820212insT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000282538.5	37	NULL	CCDS2649.2	3																																																																																			GADL1	-	-		0.436	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADL1	HGNC	protein_coding	OTTHUMT00000253106.2	-	NM_207359		30820212	-1	no_errors	ENST00000498387	ensembl	human	known	70_37	rna	INS	0.001:0.001	T
GALNT8	26290	genome.wustl.edu	37	12	4870147	4870147	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr12:4870147C>T	ENST00000252318.2	+	7	1534	c.1197C>T	c.(1195-1197)gtC>gtT	p.V399V		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	399	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V399V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GAGGGAAGGTCGAGATTTTGC	0.522																																					Colon(108;631 1558 7270 20097 39846)												1	Substitution - coding silent(1)	cervix(1)											179.0	148.0	159.0					12																	4870147		2203	4300	6503	SO:0001819	synonymous_variant	26290			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1197C>T	12.37:g.4870147C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU02	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V399	ENST00000252318.2	37	c.1197	CCDS8533.1	12																																																																																			GALNT8	-	NULL		0.522	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	C	NM_017417		4870147	+1	no_errors	ENST00000252318	ensembl	human	known	70_37	silent	SNP	0.000	T
GALNT8	26290	genome.wustl.edu	37	12	4870147	4870147	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr12:4870147C>T	ENST00000252318.2	+	7	1534	c.1197C>T	c.(1195-1197)gtC>gtT	p.V399V		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	399	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.V399V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GAGGGAAGGTCGAGATTTTGC	0.522																																					Colon(108;631 1558 7270 20097 39846)												1	Substitution - coding silent(1)	cervix(1)											179.0	148.0	159.0					12																	4870147		2203	4300	6503	SO:0001819	synonymous_variant	26290			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1197C>T	12.37:g.4870147C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU02	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V399	ENST00000252318.2	37	c.1197	CCDS8533.1	12																																																																																			GALNT8	-	NULL		0.522	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	C	NM_017417		4870147	+1	no_errors	ENST00000252318	ensembl	human	known	70_37	silent	SNP	0.000	T
GALNTL6	442117	genome.wustl.edu	37	4	172734709	172734709	+	5'UTR	SNP	T	T	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:172734709T>A	ENST00000506823.1	+	0	56				GALNTL6_ENST00000511251.1_5'UTR	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TCCGCCTCCATCCCCTTTACG	0.567																																																	0																																										SO:0001623	5_prime_UTR_variant	442117				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.-602T>A	4.37:g.172734709T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2L4S6	RNA	SNP	-	NULL	ENST00000506823.1	37	NULL	CCDS34104.1	4																																																																																			GALNTL6	-	-		0.567	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	T	NM_001034845		172734709	+1	no_errors	ENST00000504379	ensembl	human	known	70_37	rna	SNP	0.000	A
GOLPH3	64083	genome.wustl.edu	37	5	32136351	32136351	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:32136351C>T	ENST00000265070.6	-	3	673				Y_RNA_ENST00000363195.1_RNA|GOLPH3_ENST00000512668.1_Intron	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)						cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						cttgggaggccgaggcgggtg	0.517																																																	0																																										SO:0001627	intron_variant	64083			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.358-559G>A	5.37:g.32136351C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UIW5	RNA	SNP	-	NULL	ENST00000265070.6	37	NULL	CCDS3896.1	5																																																																																			GOLPH3	-	-		0.517	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	HGNC	protein_coding	OTTHUMT00000207363.2	C	NM_022130		32136351	-1	no_errors	ENST00000499354	ensembl	human	known	70_37	rna	SNP	0.004	T
GRIK3	2899	genome.wustl.edu	37	1	37270815	37270815	+	Missense_Mutation	SNP	T	T	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:37270815T>A	ENST00000373091.3	-	15	2354	c.2338A>T	c.(2338-2340)Acc>Tcc	p.T780S	GRIK3_ENST00000373093.4_Missense_Mutation_p.T780S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	780					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.T780S(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ATGGCGATGGTGATCTTGTCC	0.592																																																	1	Substitution - Missense(1)	cervix(1)											64.0	56.0	59.0					1																	37270815		2203	4300	6503	SO:0001583	missense	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2338A>T	1.37:g.37270815T>A	ENSP00000362183:p.Thr780Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T780S	ENST00000373091.3	37	c.2338	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	T	8.748	0.920561	0.17982	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.09817	2.94;2.94	5.1	5.1	0.69264	Ionotropic glutamate receptor (2);	0.059581	0.64402	D	0.000003	T	0.04998	0.0134	N	0.01800	-0.715	0.50632	D	0.999885	B;B	0.22851	0.076;0.076	B;B	0.34301	0.179;0.179	T	0.25187	-1.0139	10	0.02654	T	1	.	14.8695	0.70444	0.0:0.0:0.0:1.0	.	780;780	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	780	ENSP00000362183:T780S;ENSP00000362185:T780S	ENSP00000362183:T780S	T	-	1	0	GRIK3	37043402	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.993000	0.63895	1.915000	0.55452	0.519000	0.50382	ACC	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.592	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	T	NM_000831		37270815	-1	no_errors	ENST00000373091	ensembl	human	known	70_37	missense	SNP	1.000	A
GRIK3	2899	genome.wustl.edu	37	1	37270815	37270815	+	Missense_Mutation	SNP	T	T	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:37270815T>A	ENST00000373091.3	-	15	2354	c.2338A>T	c.(2338-2340)Acc>Tcc	p.T780S	GRIK3_ENST00000373093.4_Missense_Mutation_p.T780S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	780					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.T780S(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				ATGGCGATGGTGATCTTGTCC	0.592																																																	1	Substitution - Missense(1)	cervix(1)											64.0	56.0	59.0					1																	37270815		2203	4300	6503	SO:0001583	missense	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2338A>T	1.37:g.37270815T>A	ENSP00000362183:p.Thr780Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T780S	ENST00000373091.3	37	c.2338	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	T	8.748	0.920561	0.17982	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.09817	2.94;2.94	5.1	5.1	0.69264	Ionotropic glutamate receptor (2);	0.059581	0.64402	D	0.000003	T	0.04998	0.0134	N	0.01800	-0.715	0.50632	D	0.999885	B;B	0.22851	0.076;0.076	B;B	0.34301	0.179;0.179	T	0.25187	-1.0139	10	0.02654	T	1	.	14.8695	0.70444	0.0:0.0:0.0:1.0	.	780;780	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	780	ENSP00000362183:T780S;ENSP00000362185:T780S	ENSP00000362183:T780S	T	-	1	0	GRIK3	37043402	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.993000	0.63895	1.915000	0.55452	0.519000	0.50382	ACC	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.592	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	T	NM_000831		37270815	-1	no_errors	ENST00000373091	ensembl	human	known	70_37	missense	SNP	1.000	A
HLA-DMB	3109	genome.wustl.edu	37	6	32905075	32905075	+	Missense_Mutation	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:32905075C>A	ENST00000418107.2	-	3	758	c.496G>T	c.(496-498)Gcc>Tcc	p.A166S	AL645941.1_ENST00000390777.1_RNA|HLA-DMB_ENST00000416244.2_Missense_Mutation_p.A166S	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	166	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)	p.A166S(4)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						TTGGGCTGGGCAGTCTTGTGC	0.562																																																	4	Substitution - Missense(4)	cervix(2)|prostate(2)											172.0	128.0	143.0					6																	32905075		2203	4300	6503	SO:0001583	missense	3109				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.496G>T	6.37:g.32905075C>A	ENSP00000398890:p.Ala166Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.A166S	ENST00000418107.2	37	c.496	CCDS4760.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.21|12.21	1.870109|1.870109	0.33069|0.33069	.|.	.|.	ENSG00000242574|ENSG00000242574	ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244|ENST00000414017	T;T;T|.	0.13538|.	2.58;6.28;6.28|.	4.56|4.56	0.722|0.722	0.18225|0.18225	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	1.327040|.	0.04955|.	N|.	0.460905|.	T|T	0.09158|0.09158	0.0226|0.0226	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B;B;P|.	0.38020|.	0.06;0.428;0.086;0.038;0.615|.	B;P;B;B;P|.	0.50970|.	0.155;0.578;0.222;0.405;0.655|.	T|T	0.35001|0.35001	-0.9806|-0.9806	10|5	0.87932|.	D|.	0|.	.|.	3.4002|3.4002	0.07320|0.07320	0.18:0.5253:0.0:0.2947|0.18:0.5253:0.0:0.2947	.|.	166;166;48;55;166|.	E9PD01;A2AAT3;B0V061;B0V062;P28068|.	.;.;.;.;DMB_HUMAN|.	S|F	48;166;166;166|55	ENSP00000390848:A48S;ENSP00000398890:A166S;ENSP00000391010:A166S|.	ENSP00000391010:A166S|.	A|C	-|-	1|2	0|0	HLA-DMB|HLA-DMB	33013053|33013053	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.307000|0.307000	0.27823|0.27823	-0.689000|-0.689000	0.05144|0.05144	0.012000|0.012000	0.14892|0.14892	-0.477000|-0.477000	0.04895|0.04895	GCC|TGC	HLA-DMB	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like		0.562	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMB	HGNC	protein_coding	OTTHUMT00000076340.2	C	NM_002118		32905075	-1	no_errors	ENST00000418107	ensembl	human	known	70_37	missense	SNP	0.001	A
HLA-DMB	3109	genome.wustl.edu	37	6	32905075	32905075	+	Missense_Mutation	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:32905075C>A	ENST00000418107.2	-	3	758	c.496G>T	c.(496-498)Gcc>Tcc	p.A166S	AL645941.1_ENST00000390777.1_RNA|HLA-DMB_ENST00000416244.2_Missense_Mutation_p.A166S	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	166	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)	p.A166S(4)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						TTGGGCTGGGCAGTCTTGTGC	0.562																																																	4	Substitution - Missense(4)	cervix(2)|prostate(2)											172.0	128.0	143.0					6																	32905075		2203	4300	6503	SO:0001583	missense	3109				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.496G>T	6.37:g.32905075C>A	ENSP00000398890:p.Ala166Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.A166S	ENST00000418107.2	37	c.496	CCDS4760.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.21|12.21	1.870109|1.870109	0.33069|0.33069	.|.	.|.	ENSG00000242574|ENSG00000242574	ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244|ENST00000414017	T;T;T|.	0.13538|.	2.58;6.28;6.28|.	4.56|4.56	0.722|0.722	0.18225|0.18225	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	1.327040|.	0.04955|.	N|.	0.460905|.	T|T	0.09158|0.09158	0.0226|0.0226	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B;B;P|.	0.38020|.	0.06;0.428;0.086;0.038;0.615|.	B;P;B;B;P|.	0.50970|.	0.155;0.578;0.222;0.405;0.655|.	T|T	0.35001|0.35001	-0.9806|-0.9806	10|5	0.87932|.	D|.	0|.	.|.	3.4002|3.4002	0.07320|0.07320	0.18:0.5253:0.0:0.2947|0.18:0.5253:0.0:0.2947	.|.	166;166;48;55;166|.	E9PD01;A2AAT3;B0V061;B0V062;P28068|.	.;.;.;.;DMB_HUMAN|.	S|F	48;166;166;166|55	ENSP00000390848:A48S;ENSP00000398890:A166S;ENSP00000391010:A166S|.	ENSP00000391010:A166S|.	A|C	-|-	1|2	0|0	HLA-DMB|HLA-DMB	33013053|33013053	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.307000|0.307000	0.27823|0.27823	-0.689000|-0.689000	0.05144|0.05144	0.012000|0.012000	0.14892|0.14892	-0.477000|-0.477000	0.04895|0.04895	GCC|TGC	HLA-DMB	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like		0.562	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMB	HGNC	protein_coding	OTTHUMT00000076340.2	C	NM_002118		32905075	-1	no_errors	ENST00000418107	ensembl	human	known	70_37	missense	SNP	0.001	A
ITPK1	3705	genome.wustl.edu	37	14	93538192	93538193	+	Intron	INS	-	-	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:93538192_93538193insT	ENST00000267615.6	-	3	294				ITPK1_ENST00000556603.2_Intron|ITPK1_ENST00000354313.3_Intron|ITPK1-AS1_ENST00000553639.1_RNA|ITPK1_ENST00000555495.1_Intron			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase						blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		caatgttttaattttttttaat	0.267																																																	0																																										SO:0001627	intron_variant	319085			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.120+4746->A	14.37:g.93538200_93538200dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BTL6|Q9H2E7	RNA	INS	-	NULL	ENST00000267615.6	37	NULL	CCDS9907.1	14																																																																																			ITPK1-AS1	-	-		0.267	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1-AS1	HGNC	protein_coding	OTTHUMT00000412421.2	-	NM_014216		93538193	+1	no_errors	ENST00000553639	ensembl	human	known	70_37	rna	INS	0.003:0.005	T
KCNG1	3755	genome.wustl.edu	37	20	49626346	49626346	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr20:49626346G>A	ENST00000371571.4	-	2	815	c.530C>T	c.(529-531)gCg>gTg	p.A177V	KCNG1_ENST00000396017.3_Missense_Mutation_p.A177V|KCNG1_ENST00000506387.1_5'Flank|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	177					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.A177V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CACCATCTCCGCGAACTCCTC	0.701																																																	1	Substitution - Missense(1)	cervix(1)											36.0	37.0	37.0					20																	49626346		2199	4293	6492	SO:0001583	missense	3755			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.530C>T	20.37:g.49626346G>A	ENSP00000360626:p.Ala177Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.A177V	ENST00000371571.4	37	c.530	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035639	0.54896	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.51	5.51	0.81932	BTB/POZ fold (2);	3.063890	0.01278	N	0.009656	T	0.56877	0.2015	M	0.69823	2.125	0.40957	D	0.984595	D;P	0.53745	0.962;0.651	B;B	0.43508	0.422;0.1	T	0.58885	-0.7557	9	.	.	.	.	19.4133	0.94685	0.0:0.0:1.0:0.0	.	177;177	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	V	177	ENSP00000360626:A177V;ENSP00000379338:A177V;ENSP00000394075:A177V;ENSP00000394093:A177V	.	A	-	2	0	KCNG1	49059753	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.063000	0.76714	2.579000	0.87056	0.561000	0.74099	GCG	KCNG1	-	superfamily_BTB/POZ_fold		0.701	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	G	NM_002237		49626346	-1	no_errors	ENST00000371571	ensembl	human	known	70_37	missense	SNP	0.997	A
KCNG1	3755	genome.wustl.edu	37	20	49626346	49626346	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr20:49626346G>A	ENST00000371571.4	-	2	815	c.530C>T	c.(529-531)gCg>gTg	p.A177V	KCNG1_ENST00000396017.3_Missense_Mutation_p.A177V|KCNG1_ENST00000506387.1_5'Flank|RP5-955M13.4_ENST00000424566.1_RNA	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	177					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.A177V(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CACCATCTCCGCGAACTCCTC	0.701																																																	1	Substitution - Missense(1)	cervix(1)											36.0	37.0	37.0					20																	49626346		2199	4293	6492	SO:0001583	missense	3755			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.530C>T	20.37:g.49626346G>A	ENSP00000360626:p.Ala177Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.A177V	ENST00000371571.4	37	c.530	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035639	0.54896	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.51	5.51	0.81932	BTB/POZ fold (2);	3.063890	0.01278	N	0.009656	T	0.56877	0.2015	M	0.69823	2.125	0.40957	D	0.984595	D;P	0.53745	0.962;0.651	B;B	0.43508	0.422;0.1	T	0.58885	-0.7557	9	.	.	.	.	19.4133	0.94685	0.0:0.0:1.0:0.0	.	177;177	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	V	177	ENSP00000360626:A177V;ENSP00000379338:A177V;ENSP00000394075:A177V;ENSP00000394093:A177V	.	A	-	2	0	KCNG1	49059753	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.063000	0.76714	2.579000	0.87056	0.561000	0.74099	GCG	KCNG1	-	superfamily_BTB/POZ_fold		0.701	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	G	NM_002237		49626346	-1	no_errors	ENST00000371571	ensembl	human	known	70_37	missense	SNP	0.997	A
KLHDC7B	113730	genome.wustl.edu	37	22	50987890	50987890	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:50987890C>T	ENST00000395676.2	+	1	1429	c.1295C>T	c.(1294-1296)gCg>gTg	p.A432V	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	432								p.A333V(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCCCACGCGCGCCACTCCCC	0.672																																																	1	Substitution - Missense(1)	cervix(1)											73.0	75.0	74.0					22																	50987890		2201	4298	6499	SO:0001583	missense	113730			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1295C>T	22.37:g.50987890C>T	ENSP00000379034:p.Ala432Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.A432V	ENST00000395676.2	37	c.1295	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218684	0.58560	.	.	ENSG00000130487	ENST00000395676	T	0.80304	-1.36	5.35	4.31	0.51392	Kelch-type beta propeller (1);	0.000000	0.41294	U	0.000918	D	0.89203	0.6648	M	0.80982	2.52	0.35711	D	0.816394	D	0.89917	1.0	D	0.91635	0.999	D	0.92898	0.6337	10	0.87932	D	0	.	13.0304	0.58839	0.1623:0.8376:0.0:0.0	.	432	Q96G42	KLD7B_HUMAN	V	432	ENSP00000379034:A432V	ENSP00000379034:A432V	A	+	2	0	KLHDC7B	49334756	1.000000	0.71417	0.456000	0.27044	0.083000	0.17756	7.596000	0.82721	1.231000	0.43661	0.491000	0.48974	GCG	KLHDC7B	-	pfam_Kelch_1,smart_Kelch_1		0.672	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	C	NM_138433		50987890	+1	no_errors	ENST00000395676	ensembl	human	known	70_37	missense	SNP	0.986	T
KLHDC7B	113730	genome.wustl.edu	37	22	50987890	50987890	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:50987890C>T	ENST00000395676.2	+	1	1429	c.1295C>T	c.(1294-1296)gCg>gTg	p.A432V	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	432								p.A333V(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCCCACGCGCGCCACTCCCC	0.672																																																	1	Substitution - Missense(1)	cervix(1)											73.0	75.0	74.0					22																	50987890		2201	4298	6499	SO:0001583	missense	113730			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1295C>T	22.37:g.50987890C>T	ENSP00000379034:p.Ala432Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.A432V	ENST00000395676.2	37	c.1295	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218684	0.58560	.	.	ENSG00000130487	ENST00000395676	T	0.80304	-1.36	5.35	4.31	0.51392	Kelch-type beta propeller (1);	0.000000	0.41294	U	0.000918	D	0.89203	0.6648	M	0.80982	2.52	0.35711	D	0.816394	D	0.89917	1.0	D	0.91635	0.999	D	0.92898	0.6337	10	0.87932	D	0	.	13.0304	0.58839	0.1623:0.8376:0.0:0.0	.	432	Q96G42	KLD7B_HUMAN	V	432	ENSP00000379034:A432V	ENSP00000379034:A432V	A	+	2	0	KLHDC7B	49334756	1.000000	0.71417	0.456000	0.27044	0.083000	0.17756	7.596000	0.82721	1.231000	0.43661	0.491000	0.48974	GCG	KLHDC7B	-	pfam_Kelch_1,smart_Kelch_1		0.672	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	C	NM_138433		50987890	+1	no_errors	ENST00000395676	ensembl	human	known	70_37	missense	SNP	0.986	T
KPNA5	3841	genome.wustl.edu	37	6	117053428	117053428	+	Missense_Mutation	SNP	A	A	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:117053428A>T	ENST00000368564.1	+	14	1710	c.1562A>T	c.(1561-1563)aAc>aTc	p.N521I	KPNA5_ENST00000356348.1_Missense_Mutation_p.N521I			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	518					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		GTGGATGAAAACCAACAACAG	0.373																																																	0													99.0	97.0	98.0					6																	117053428		2203	4300	6503	SO:0001583	missense	3841			AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.1562A>T	6.37:g.117053428A>T	ENSP00000357552:p.Asn521Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAI5|Q86X23	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.N521I	ENST00000368564.1	37	c.1562	CCDS5111.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.51|12.51	1.960541|1.960541	0.34565|0.34565	.|.	.|.	ENSG00000196911|ENSG00000196911	ENST00000392517|ENST00000368564;ENST00000356348	.|T;T	.|0.29397	.|1.57;1.57	5.73|5.73	0.775|0.775	0.18527|0.18527	.|.	.|0.432276	.|0.23746	.|N	.|0.044962	T|T	0.05364|0.05364	0.0142|0.0142	N|N	0.14661|0.14661	0.345|0.345	0.24350|0.24350	N|N	0.994923|0.994923	.|B	.|0.25719	.|0.132	.|B	.|0.23716	.|0.048	T|T	0.33675|0.33675	-0.9859|-0.9859	5|10	.|0.41790	.|T	.|0.15	.|.	6.5368|6.5368	0.22359|0.22359	0.4974:0.1311:0.3715:0.0|0.4974:0.1311:0.3715:0.0	.|.	.|518	.|O15131	.|IMA5_HUMAN	N|I	103|521	.|ENSP00000357552:N521I;ENSP00000348704:N521I	.|ENSP00000348704:N521I	K|N	+|+	3|2	2|0	KPNA5|KPNA5	117160121|117160121	0.007000|0.007000	0.16637|0.16637	0.946000|0.946000	0.38457|0.38457	0.987000|0.987000	0.75469|0.75469	-0.063000|-0.063000	0.11655|0.11655	-0.082000|-0.082000	0.12640|0.12640	-0.250000|-0.250000	0.11733|0.11733	AAA|AAC	KPNA5	-	NULL		0.373	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA5	HGNC	protein_coding	OTTHUMT00000041967.1	A	NM_002269		117053428	+1	no_errors	ENST00000356348	ensembl	human	known	70_37	missense	SNP	0.939	T
KRTAP5-3	387266	genome.wustl.edu	37	11	1629043	1629043	+	Silent	SNP	T	T	C	rs12795274		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:1629043T>C	ENST00000399685.1	-	1	650	c.573A>G	c.(571-573)aaA>aaG	p.K191K		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	191	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		aacagcagggtttgcagcagc	0.632																																																	0													167.0	168.0	168.0					11																	1629043		2202	4290	6492	SO:0001819	synonymous_variant	387266			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.573A>G	11.37:g.1629043T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PL44|Q701N3	Silent	SNP	NULL	p.K191	ENST00000399685.1	37	c.573	CCDS41591.1	11																																																																																			KRTAP5-3	-	NULL		0.632	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	HGNC	protein_coding	OTTHUMT00000127924.1	T			1629043	-1	no_errors	ENST00000399685	ensembl	human	known	70_37	silent	SNP	0.000	C
L3MBTL3	84456	genome.wustl.edu	37	6	130399706	130399706	+	Silent	SNP	T	T	C	rs535706193	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr6:130399706T>C	ENST00000529410.1	+	16	1727	c.1248T>C	c.(1246-1248)tgT>tgC	p.C416C	L3MBTL3_ENST00000368136.2_Silent_p.C416C|L3MBTL3_ENST00000533560.1_Silent_p.C391C|L3MBTL3_ENST00000361794.2_Silent_p.C416C|L3MBTL3_ENST00000368139.2_Silent_p.C391C|L3MBTL3_ENST00000526019.1_Silent_p.C391C			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	416					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.C416C(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CTTTCAGGTGTGAAGCATCAA	0.338													T|||	6	0.00119808	0.0	0.0	5008	,	,		16968	0.0		0.0	False		,,,				2504	0.0061																1	Substitution - coding silent(1)	cervix(1)											151.0	147.0	149.0					6																	130399706		2203	4300	6503	SO:0001819	synonymous_variant	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1248T>C	6.37:g.130399706T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Silent	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.C416	ENST00000529410.1	37	c.1248	CCDS34537.1	6																																																																																			L3MBTL3	-	pfam_Mbt,smart_Mbt,pfscan_Mbt		0.338	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	T	XM_027074		130399706	+1	no_errors	ENST00000361794	ensembl	human	known	70_37	silent	SNP	1.000	C
LAMTOR5-AS1	101410535	genome.wustl.edu	37	1	110968536	110968536	+	RNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:110968536C>T	ENST00000585433.2	+	0	182				LAMTOR5-AS1_ENST00000599202.1_RNA|LAMTOR5-AS1_ENST00000597455.1_RNA|LAMTOR5-AS1_ENST00000596890.1_RNA|LAMTOR5-AS1_ENST00000598350.1_RNA|LAMTOR5-AS1_ENST00000598158.1_RNA					LAMTOR5 antisense RNA 1																		ATCTACGCCTCCCAGCGCAGC	0.562																																																	0																																												101410535			HY022359, BE547292, BG718030		1p13.3	2012-10-12			ENSG00000224699	ENSG00000224699		"""Long non-coding RNAs"""	40823	non-coding RNA	RNA, long non-coding							Standard	NR_102697		Approved		uc031pnm.1		OTTHUMG00000019824		1.37:g.110968536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000585433.2	37	NULL		1																																																																																			LAMTOR5-AS1	-	-		0.562	LAMTOR5-AS1-004	KNOWN	basic	antisense	LAMTOR5-AS1	HGNC	antisense	OTTHUMT00000448955.2	C			110968536	+1	no_errors	ENST00000596890	ensembl	human	known	70_37	rna	SNP	0.000	T
LDB3	11155	genome.wustl.edu	37	10	88494845	88494845	+	3'UTR	SNP	C	C	A	rs562841583		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:88494845C>A	ENST00000361373.4	+	0	4317				LDB3_ENST00000352360.5_3'UTR|LDB3_ENST00000458213.2_3'UTR|LDB3_ENST00000429277.2_3'UTR|LDB3_ENST00000263066.6_3'UTR	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						cacacacacacacacacacac	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.*2112C>A	10.37:g.88494845C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000361373.4	37	NULL	CCDS7377.1	10																																																																																			LDB3	-	-		0.348	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LDB3	HGNC	protein_coding	OTTHUMT00000049160.2	C			88494845	+1	no_errors	ENST00000480727	ensembl	human	known	70_37	rna	SNP	0.000	A
LILRB5	10990	genome.wustl.edu	37	19	54754838	54754839	+	Intron	INS	-	-	G	rs373363902|rs531467777|rs527853571	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:54754838_54754839insG	ENST00000316219.5	-	13	1734				CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000345866.6_Intron|LILRB5_ENST00000450632.1_Frame_Shift_Ins_p.P599fs|LILRB5_ENST00000449561.2_Intron	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTGGTGGGGGTGGGGAGGCCTG	0.604														824	0.164537	0.0938	0.1196	5008	,	,		11633	0.4206		0.1074	False		,,,				2504	0.0869																0																																										SO:0001627	intron_variant	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1627-42->C	19.37:g.54754842_54754842dupG		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N760	Frame_Shift_Ins	INS	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P600fs	ENST00000316219.5	37	c.1797_1796	CCDS12885.1	19																																																																																			LILRB5	-	NULL		0.604	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	-			54754839	-1	no_errors	ENST00000450632	ensembl	human	known	70_37	frame_shift_ins	INS	0.001:0.329	G
LINC00086	399668	genome.wustl.edu	37	X	134556390	134556390	+	lincRNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:134556390C>T	ENST00000417443.2	+	0	523					NR_024359.1				long intergenic non-protein coding RNA 86																		AGCTgggccgcggcggggggc	0.811																																																	0																																												399668			BC030620, BC051704		Xq26.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000178947	ENSG00000178947		"""Long non-coding RNAs"""	34499	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 86"""	NCRNA00086			Standard	NR_024359		Approved	MGC39606	uc004eyv.4		OTTHUMG00000022479		X.37:g.134556390C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000417443.2	37	NULL		X																																																																																			LINC00086	-	-		0.811	LINC00086-001	KNOWN	basic	lincRNA	LINC00086	HGNC	lincRNA	OTTHUMT00000058412.2	C			134556390	+1	no_errors	ENST00000417443	ensembl	human	known	70_37	rna	SNP	0.000	T
LINC00479	150135	genome.wustl.edu	37	21	43132708	43132708	+	lincRNA	SNP	G	G	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr21:43132708G>C	ENST00000412102.1	-	0	1004					NR_027272.1		Q96M42	CU129_HUMAN	long intergenic non-protein coding RNA 479																		cccaggtctgggagcggcgtg	0.657																																																	0																																												150135			AK057397		21q22.3	2012-10-12	2011-08-31	2011-08-31	ENSG00000236384	ENSG00000236384		"""Long non-coding RNAs"""	19727	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 129"""	C21orf129			Standard	NR_027272		Approved	PRED76, FLJ32835	uc010got.1	Q96M42	OTTHUMG00000086773		21.37:g.43132708G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSJ3	RNA	SNP	-	NULL	ENST00000412102.1	37	NULL		21																																																																																			LINC00479	-	-		0.657	LINC00479-001	KNOWN	basic	lincRNA	LINC00479	HGNC	lincRNA	OTTHUMT00000195207.3	G			43132708	-1	no_errors	ENST00000412102	ensembl	human	known	70_37	rna	SNP	0.001	C
LINC00520	645687	genome.wustl.edu	37	14	56259940	56259941	+	RNA	INS	-	-	A	rs34999384|rs398118235	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:56259940_56259941insA	ENST00000560336.2	-	0	175									long intergenic non-protein coding RNA 520																		AAATTGCGAACAAAAAAAAAAC	0.371													|||unknown(HR)	682	0.136182	0.0318	0.1585	5008	,	,		20518	0.0685		0.2803	False		,,,				2504	0.183																0																																												645687			BF572611		14q22.3	2012-10-12	2011-11-29	2011-11-29	ENSG00000258791	ENSG00000258791		"""Long non-coding RNAs"""	19843	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 34"""	C14orf34			Standard	NR_026796		Approved		uc010trd.2		OTTHUMG00000171059		14.37:g.56259950_56259950dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000560336.2	37	NULL		14																																																																																			LINC00520	-	-		0.371	LINC00520-006	KNOWN	basic	lincRNA	LINC00520	HGNC	processed_transcript	OTTHUMT00000416948.2	-			56259941	-1	no_errors	ENST00000554186	ensembl	human	known	70_37	rna	INS	0.000:0.000	A
LINC00665	100506930	genome.wustl.edu	37	19	36806927	36806927	+	IGR	SNP	T	T	C	rs199967412		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:36806927T>C								CTD-3162L10.1 (3363 upstream) : LINC00665 (8911 downstream)																							TAGAAAACTCTGCCAGGGAGC	0.537																																																	0																																										SO:0001628	intergenic_variant	100506930																															19.37:g.36806927T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		19																																																																																			LINC00665	-	-	0	0.537					LINC00665	HGNC			T			36806927	-1	no_errors	ENST00000412740	ensembl	human	known	70_37	rna	SNP	0.001	C
LNPEP	4012	genome.wustl.edu	37	5	96322254	96322254	+	Silent	SNP	C	C	T	rs142457895		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:96322254C>T	ENST00000231368.5	+	4	1703	c.1011C>T	c.(1009-1011)gtC>gtT	p.V337V	LNPEP_ENST00000395770.3_Silent_p.V323V	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	337					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V337V(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGTCATCAGTCGTTCTAGATG	0.383																																																	1	Substitution - coding silent(1)	cervix(1)						C	,	0,4406		0,0,2203	190.0	183.0	185.0		1011,969	-3.2	0.0	5	dbSNP_134	185	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LNPEP	NM_005575.2,NM_175920.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	337/1026,323/1012	96322254	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4012			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1011C>T	5.37:g.96322254C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.V337	ENST00000231368.5	37	c.1011	CCDS4087.1	5																																																																																			LNPEP	-	pfam_Peptidase_M1_N		0.383	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	HGNC	protein_coding	OTTHUMT00000250624.1	C	NM_005575		96322254	+1	no_errors	ENST00000231368	ensembl	human	known	70_37	silent	SNP	0.000	T
LNPEP	4012	genome.wustl.edu	37	5	96322254	96322254	+	Silent	SNP	C	C	T	rs142457895		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:96322254C>T	ENST00000231368.5	+	4	1703	c.1011C>T	c.(1009-1011)gtC>gtT	p.V337V	LNPEP_ENST00000395770.3_Silent_p.V323V	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	337					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V337V(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGTCATCAGTCGTTCTAGATG	0.383																																																	1	Substitution - coding silent(1)	cervix(1)						C	,	0,4406		0,0,2203	190.0	183.0	185.0		1011,969	-3.2	0.0	5	dbSNP_134	185	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LNPEP	NM_005575.2,NM_175920.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	337/1026,323/1012	96322254	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4012			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1011C>T	5.37:g.96322254C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.V337	ENST00000231368.5	37	c.1011	CCDS4087.1	5																																																																																			LNPEP	-	pfam_Peptidase_M1_N		0.383	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	HGNC	protein_coding	OTTHUMT00000250624.1	C	NM_005575		96322254	+1	no_errors	ENST00000231368	ensembl	human	known	70_37	silent	SNP	0.000	T
POMZP3	22932	genome.wustl.edu	37	7	76255948	76255948	+	Intron	SNP	A	A	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:76255948A>T	ENST00000310842.4	-	1	534				UPK3B_ENST00000419923.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000443097.2_Intron|POMZP3_ENST00000275569.4_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				TTGATGAAAAAGCAAATCGGA	0.522																																																	0																																										SO:0001627	intron_variant	100133091			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.150+76T>A	7.37:g.76255948A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	F6STJ3|Q12903|Q9BWB4	RNA	SNP	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																			AC004980.7	-	-		0.522	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133091	Clone_based_vega_gene	protein_coding	OTTHUMT00000341775.1	A	NM_012230		76255948	+1	no_errors	ENST00000418663	ensembl	human	known	70_37	rna	SNP	0.033	T
LINC01123	440894	genome.wustl.edu	37	2	110742222	110742222	+	lincRNA	SNP	A	A	G	rs170878	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:110742222A>G	ENST00000419296.1	+	0	0					NR_046110.1																						GATCTACCTAATACTGCAGCT	0.622													a|||	4342	0.867013	0.6112	0.9222	5008	,	,		16745	0.9821		0.9781	False		,,,				2504	0.9407																0																																												100507334																															2.37:g.110742222A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000419296.1	37	NULL		2																																																																																			AC013271.3	-	-		0.622	AC013268.5-003	KNOWN	basic	lincRNA	LOC100507334	Clone_based_vega_gene	lincRNA	OTTHUMT00000337869.1	A			110742222	+1	no_errors	ENST00000454928	ensembl	human	known	70_37	rna	SNP	1.000	G
LINC00842	643650	genome.wustl.edu	37	10	47151670	47151670	+	lincRNA	SNP	C	C	T	rs375125814		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:47151670C>T	ENST00000422732.2	-	0	0					NR_033957.2				long intergenic non-protein coding RNA 842																		GGGAAAGGGGCCGTCCGGGGA	0.632											OREG0020158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												101060462					10q11.22	2013-01-04			ENSG00000223477	ENSG00000274909		"""Long non-coding RNAs"""	44989	non-coding RNA	RNA, long non-coding							Standard	NR_033957		Approved		uc001jef.3		OTTHUMG00000018109		10.37:g.47151670C>T		Somatic	944	WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.G60D	ENST00000422732.2	37	c.179		10	.	.	.	.	.	.	.	.	.	.	C	4.321	0.058943	0.08339	.	.	ENSG00000179251	ENST00000319426	.	.	.	1.84	0.385	0.16249	.	.	.	.	.	T	0.47637	0.1456	.	.	.	.	.	.	.	.	.	.	.	.	T	0.57039	-0.7879	4	0.87932	D	0	.	6.7217	0.23334	0.0:0.4593:0.5407:0.0	.	.	.	.	D	60	.	ENSP00000385877:G60D	G	-	2	0	AL391137.1	46571676	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	0.220000	0.17660	0.080000	0.16959	0.205000	0.17691	GGC	AL391137.1	-	NULL		0.632	LINC00842-002	KNOWN	basic	lincRNA	LOC101060462	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000047838.2	C	NR_033957		47151670	-1	no_errors	ENST00000319426	ensembl	human	known	70_37	missense	SNP	0.001	T
C2orf74	339804	genome.wustl.edu	37	2	61369385	61369385	+	5'Flank	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:61369385C>T	ENST00000426997.1	+	0	0				AC016747.3_ENST00000420918.2_RNA	NM_001143960.1	NP_001137432.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74							integral component of membrane (GO:0016021)				endometrium(1)	1						CCTGGCTGGTCCATTTTCTGA	0.443																																																	0																																										SO:0001631	upstream_gene_variant	339803					2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97			2.37:g.61369385C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JP62	RNA	SNP	-	NULL	ENST00000426997.1	37	NULL		2																																																																																			AC016747.3	-	-		0.443	C2orf74-201	KNOWN	basic	protein_coding	LOC339803	Clone_based_vega_gene	protein_coding		C	NM_001143959		61369385	-1	no_errors	ENST00000420918	ensembl	human	known	70_37	rna	SNP	0.171	T
C2orf74	339804	genome.wustl.edu	37	2	61370117	61370117	+	5'Flank	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:61370117C>T	ENST00000426997.1	+	0	0				AC016747.3_ENST00000420918.2_RNA	NM_001143960.1	NP_001137432.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74							integral component of membrane (GO:0016021)				endometrium(1)	1						tcaaaaggttcttttgaagtc	0.343																																																	0																																										SO:0001631	upstream_gene_variant	339803					2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97			2.37:g.61370117C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JP62	RNA	SNP	-	NULL	ENST00000426997.1	37	NULL		2																																																																																			AC016747.3	-	-		0.343	C2orf74-201	KNOWN	basic	protein_coding	LOC339803	Clone_based_vega_gene	protein_coding		C	NM_001143959		61370117	-1	no_errors	ENST00000420918	ensembl	human	known	70_37	rna	SNP	0.659	T
C2orf74	339804	genome.wustl.edu	37	2	61370430	61370430	+	5'Flank	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:61370430C>T	ENST00000426997.1	+	0	0				AC016747.3_ENST00000420918.2_RNA	NM_001143960.1	NP_001137432.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74							integral component of membrane (GO:0016021)				endometrium(1)	1						aaataaaactcatctgatgag	0.363																																																	0																																										SO:0001631	upstream_gene_variant	339803					2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97			2.37:g.61370430C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JP62	RNA	SNP	-	NULL	ENST00000426997.1	37	NULL		2																																																																																			AC016747.3	-	-		0.363	C2orf74-201	KNOWN	basic	protein_coding	LOC339803	Clone_based_vega_gene	protein_coding		C	NM_001143959		61370430	-1	no_errors	ENST00000420918	ensembl	human	known	70_37	rna	SNP	0.075	T
PLEKHB2	55041	genome.wustl.edu	37	2	132054516	132054516	+	Intron	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:132054516G>A	ENST00000404460.1	+	7	477				AC131180.4_ENST00000560285.1_RNA|PLEKHB2_ENST00000303908.3_Intron			Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		TGCAGCAGGAGAGCAGGAACC	0.498																																																	0																																										SO:0001627	intron_variant	440910				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000404460.1:c.424-56077G>A	2.37:g.132054516G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	RNA	SNP	-	NULL	ENST00000404460.1	37	NULL		2																																																																																			AC131180.4	-	-		0.498	PLEKHB2-002	KNOWN	basic	protein_coding	LOC440910	Clone_based_vega_gene	protein_coding	OTTHUMT00000318943.2	G	NM_017958		132054516	+1	no_errors	ENST00000560285	ensembl	human	known	70_37	rna	SNP	1.000	A
PLEKHB2	55041	genome.wustl.edu	37	2	132055839	132055839	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:132055839C>T	ENST00000404460.1	+	7	477				AC131180.4_ENST00000560285.1_RNA|PLEKHB2_ENST00000303908.3_Intron			Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CTCATTATTGCGGTATGTATA	0.338																																																	0																																										SO:0001627	intron_variant	440910				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000404460.1:c.424-54754C>T	2.37:g.132055839C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	RNA	SNP	-	NULL	ENST00000404460.1	37	NULL		2																																																																																			AC131180.4	-	-		0.338	PLEKHB2-002	KNOWN	basic	protein_coding	LOC440910	Clone_based_vega_gene	protein_coding	OTTHUMT00000318943.2	C	NM_017958		132055839	+1	no_errors	ENST00000560285	ensembl	human	known	70_37	rna	SNP	1.000	T
LINC00969	440993	genome.wustl.edu	37	3	195404651	195404651	+	lincRNA	SNP	C	C	G	rs1996904		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:195404651C>G	ENST00000445430.1	+	0	1508									long intergenic non-protein coding RNA 969																		TGTCACGAATCTTGACAAATT	0.418																																																	0																																												440993			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195404651C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			AC069513.3	-	-		0.418	LINC00969-038	KNOWN	basic	lincRNA	LOC440993	Clone_based_vega_gene	lincRNA	OTTHUMT00000341951.1	C			195404651	+1	no_errors	ENST00000414625	ensembl	human	known	70_37	rna	SNP	1.000	G
LOC642929	642929	genome.wustl.edu	37	9	43140695	43140695	+	lincRNA	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:43140695C>T	ENST00000453939.1	-	0	223					NR_027472.1																						ACCGTGGACTCGAGAGCTGAC	0.433																																																	0																																												642929																															9.37:g.43140695C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000453939.1	37	NULL		9																																																																																			RP11-327I22.6	-	-		0.433	RP11-327I22.6-001	KNOWN	basic	lincRNA	LOC642929	Clone_based_vega_gene	lincRNA	OTTHUMT00000037045.1	C			43140695	-1	no_errors	ENST00000453939	ensembl	human	known	70_37	rna	SNP	0.106	T
LRRN4CL	221091	genome.wustl.edu	37	11	62455621	62455621	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:62455621G>A	ENST00000317449.4	-	2	837	c.360C>T	c.(358-360)gaC>gaT	p.D120D		NM_203422.2	NP_981967.1	Q8ND94	LRN4L_HUMAN	LRRN4 C-terminal like	120	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)		p.D120D(1)		cervix(1)|kidney(1)	2						CCTCGCTGCCGTCCCAAAGCA	0.657																																																	1	Substitution - coding silent(1)	cervix(1)											12.0	14.0	13.0					11																	62455621		2121	4166	6287	SO:0001819	synonymous_variant	221091			AK291334	CCDS8030.1	11q12.3	2013-02-11				ENSG00000177363		"""Fibronectin type III domain containing"""	33724	protein-coding gene	gene with protein product							Standard	NM_203422		Approved		uc001nun.3	Q8ND94		ENST00000317449.4:c.360C>T	11.37:g.62455621G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5L9	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D120	ENST00000317449.4	37	c.360	CCDS8030.1	11																																																																																			LRRN4CL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	LRRN4CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN4CL	HGNC	protein_coding	OTTHUMT00000395168.1	G	NM_203422		62455621	-1	no_errors	ENST00000317449	ensembl	human	known	70_37	silent	SNP	0.793	A
LRRN4CL	221091	genome.wustl.edu	37	11	62455621	62455621	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:62455621G>A	ENST00000317449.4	-	2	837	c.360C>T	c.(358-360)gaC>gaT	p.D120D		NM_203422.2	NP_981967.1	Q8ND94	LRN4L_HUMAN	LRRN4 C-terminal like	120	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)		p.D120D(1)		cervix(1)|kidney(1)	2						CCTCGCTGCCGTCCCAAAGCA	0.657																																																	1	Substitution - coding silent(1)	cervix(1)											12.0	14.0	13.0					11																	62455621		2121	4166	6287	SO:0001819	synonymous_variant	221091			AK291334	CCDS8030.1	11q12.3	2013-02-11				ENSG00000177363		"""Fibronectin type III domain containing"""	33724	protein-coding gene	gene with protein product							Standard	NM_203422		Approved		uc001nun.3	Q8ND94		ENST00000317449.4:c.360C>T	11.37:g.62455621G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5L9	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D120	ENST00000317449.4	37	c.360	CCDS8030.1	11																																																																																			LRRN4CL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	LRRN4CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN4CL	HGNC	protein_coding	OTTHUMT00000395168.1	G	NM_203422		62455621	-1	no_errors	ENST00000317449	ensembl	human	known	70_37	silent	SNP	0.793	A
MAGED1	9500	genome.wustl.edu	37	X	51642270	51642270	+	Intron	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:51642270G>A	ENST00000375722.1	+	10	2096				MAGED1_ENST00000375772.3_Intron|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Intron|MAGED1_ENST00000375695.2_Intron			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					acggagtttcgctcttgttgc	0.438										Multiple Myeloma(10;0.10)																																							0																																										SO:0001627	intron_variant	9500			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1844+531G>A	X.37:g.51642270G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	RNA	SNP	-	NULL	ENST00000375722.1	37	NULL	CCDS14337.1	X																																																																																			MAGED1	-	-		0.438	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	G	NM_001005332		51642270	+1	no_errors	ENST00000494718	ensembl	human	known	70_37	rna	SNP	0.035	A
MAPK8IP3	23162	genome.wustl.edu	37	16	1810463	1810463	+	Silent	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:1810463T>C	ENST00000250894.4	+	12	1541	c.1384T>C	c.(1384-1386)Ttg>Ctg	p.L462L	MAPK8IP3_ENST00000356010.5_Silent_p.L456L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	462					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.L462L(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GAGGGGCGAGTTGGAGGCTGC	0.532																																																	1	Substitution - coding silent(1)	cervix(1)											96.0	108.0	104.0					16																	1810463		2098	4212	6310	SO:0001819	synonymous_variant	23162			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1384T>C	16.37:g.1810463T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L462	ENST00000250894.4	37	c.1384	CCDS10442.2	16																																																																																			MAPK8IP3	-	NULL		0.532	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	T	NM_001040439		1810463	+1	no_errors	ENST00000250894	ensembl	human	known	70_37	silent	SNP	0.997	C
MAPK8IP3	23162	genome.wustl.edu	37	16	1810463	1810463	+	Silent	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:1810463T>C	ENST00000250894.4	+	12	1541	c.1384T>C	c.(1384-1386)Ttg>Ctg	p.L462L	MAPK8IP3_ENST00000356010.5_Silent_p.L456L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	462					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.L462L(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GAGGGGCGAGTTGGAGGCTGC	0.532																																																	1	Substitution - coding silent(1)	cervix(1)											96.0	108.0	104.0					16																	1810463		2098	4212	6310	SO:0001819	synonymous_variant	23162			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.1384T>C	16.37:g.1810463T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L462	ENST00000250894.4	37	c.1384	CCDS10442.2	16																																																																																			MAPK8IP3	-	NULL		0.532	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	T	NM_001040439		1810463	+1	no_errors	ENST00000250894	ensembl	human	known	70_37	silent	SNP	0.997	C
PHLPP2	23035	genome.wustl.edu	37	16	71675964	71675964	+	IGR	SNP	G	G	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr16:71675964G>C	ENST00000568954.1	-	0	8317				MARVELD3_ENST00000561682.1_3'UTR|PHLPP2_ENST00000540628.1_Intron			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						TCTCGTTATGGTCTTTTTGCT	0.348																																																	0																																										SO:0001628	intergenic_variant	91862			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8			16.37:g.71675964G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L374|Q9NV17|Q9Y2E3	RNA	SNP	-	NULL	ENST00000568954.1	37	NULL	CCDS32479.1	16																																																																																			MARVELD3	-	-		0.348	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MARVELD3	HGNC	protein_coding	OTTHUMT00000434139.1	G	NM_015020		71675964	+1	no_errors	ENST00000561682	ensembl	human	known	70_37	rna	SNP	0.000	C
MBD3L1	85509	genome.wustl.edu	37	19	8953854	8953854	+	Missense_Mutation	SNP	G	G	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:8953854G>C	ENST00000595891.1	+	3	731	c.500G>C	c.(499-501)aGa>aCa	p.R167T	MBD3L1_ENST00000305625.2_Missense_Mutation_p.R167T			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R167T(1)		NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GTCAGAGAGAGACTCGCAATA	0.478																																																	1	Substitution - Missense(1)	cervix(1)											46.0	42.0	43.0					19																	8953854		2203	4299	6502	SO:0001583	missense	85509			AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.500G>C	19.37:g.8953854G>C	ENSP00000471575:p.Arg167Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BUM6|Q2M291	Missense_Mutation	SNP	NULL	p.R167T	ENST00000595891.1	37	c.500	CCDS12209.1	19	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863095	0.51482	.	.	ENSG00000170948	ENST00000305625	T	0.57595	0.39	3.92	2.88	0.33553	.	0.141960	0.29767	N	0.011253	T	0.61800	0.2376	M	0.81497	2.545	0.40910	D	0.984227	D	0.60575	0.988	P	0.53266	0.722	T	0.66917	-0.5802	10	0.87932	D	0	-8.6954	7.7997	0.29168	0.1139:0.0:0.8861:0.0	.	167	Q8WWY6	MB3L1_HUMAN	T	167	ENSP00000304198:R167T	ENSP00000304198:R167T	R	+	2	0	MBD3L1	8814854	0.961000	0.32948	0.712000	0.30502	0.014000	0.08584	1.827000	0.39102	1.217000	0.43442	0.655000	0.94253	AGA	MBD3L1	-	NULL		0.478	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	HGNC	protein_coding	OTTHUMT00000459973.1	G	NM_145208		8953854	+1	no_errors	ENST00000305625	ensembl	human	known	70_37	missense	SNP	0.787	C
MBD3L1	85509	genome.wustl.edu	37	19	8953854	8953854	+	Missense_Mutation	SNP	G	G	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:8953854G>C	ENST00000595891.1	+	3	731	c.500G>C	c.(499-501)aGa>aCa	p.R167T	MBD3L1_ENST00000305625.2_Missense_Mutation_p.R167T			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R167T(1)		NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GTCAGAGAGAGACTCGCAATA	0.478																																																	1	Substitution - Missense(1)	cervix(1)											46.0	42.0	43.0					19																	8953854		2203	4299	6502	SO:0001583	missense	85509			AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.500G>C	19.37:g.8953854G>C	ENSP00000471575:p.Arg167Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BUM6|Q2M291	Missense_Mutation	SNP	NULL	p.R167T	ENST00000595891.1	37	c.500	CCDS12209.1	19	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863095	0.51482	.	.	ENSG00000170948	ENST00000305625	T	0.57595	0.39	3.92	2.88	0.33553	.	0.141960	0.29767	N	0.011253	T	0.61800	0.2376	M	0.81497	2.545	0.40910	D	0.984227	D	0.60575	0.988	P	0.53266	0.722	T	0.66917	-0.5802	10	0.87932	D	0	-8.6954	7.7997	0.29168	0.1139:0.0:0.8861:0.0	.	167	Q8WWY6	MB3L1_HUMAN	T	167	ENSP00000304198:R167T	ENSP00000304198:R167T	R	+	2	0	MBD3L1	8814854	0.961000	0.32948	0.712000	0.30502	0.014000	0.08584	1.827000	0.39102	1.217000	0.43442	0.655000	0.94253	AGA	MBD3L1	-	NULL		0.478	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	HGNC	protein_coding	OTTHUMT00000459973.1	G	NM_145208		8953854	+1	no_errors	ENST00000305625	ensembl	human	known	70_37	missense	SNP	0.787	C
MIPOL1	145282	genome.wustl.edu	37	14	37854916	37854916	+	Intron	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:37854916C>A	ENST00000327441.7	+	11	1402				MIPOL1_ENST00000556451.1_Intron|MIPOL1_ENST00000396294.2_Intron|MIPOL1_ENST00000539062.2_Intron|MIPOL1_ENST00000545536.1_Intron|MIPOL1_ENST00000537471.1_Intron|MIPOL1_ENST00000536774.1_Intron	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1							nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		TATAATGTAACCATTTTTTAA	0.249																																																	0																																										SO:0001627	intron_variant	145282			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.936+16087C>A	14.37:g.37854916C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSA4|Q7Z3J0|Q8IV14	RNA	SNP	-	NULL	ENST00000327441.7	37	NULL	CCDS9664.1	14																																																																																			MIPOL1	-	-		0.249	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	HGNC	protein_coding	OTTHUMT00000276734.1	C	NM_138731		37854916	+1	no_errors	ENST00000554930	ensembl	human	known	70_37	rna	SNP	0.001	A
MIPOL1	145282	genome.wustl.edu	37	14	37854919	37854920	+	Intron	INS	-	-	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr14:37854919_37854920insA	ENST00000327441.7	+	11	1402				MIPOL1_ENST00000556451.1_Intron|MIPOL1_ENST00000396294.2_Intron|MIPOL1_ENST00000539062.2_Intron|MIPOL1_ENST00000545536.1_Intron|MIPOL1_ENST00000537471.1_Intron|MIPOL1_ENST00000536774.1_Intron	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1							nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AATGTAACCATTTTTTAAAAAA	0.248																																																	0																																										SO:0001627	intron_variant	145282			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.936+16090->A	14.37:g.37854919_37854920insA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSA4|Q7Z3J0|Q8IV14	RNA	INS	-	NULL	ENST00000327441.7	37	NULL	CCDS9664.1	14																																																																																			MIPOL1	-	-		0.248	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	HGNC	protein_coding	OTTHUMT00000276734.1	-	NM_138731		37854920	+1	no_errors	ENST00000554930	ensembl	human	known	70_37	rna	INS	0.227:0.224	A
MIR205HG	642587	genome.wustl.edu	37	1	209605636	209605637	+	lincRNA	INS	-	-	AGC	rs565985624|rs57779889|rs71788170|rs74820836|rs3842530	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:209605636_209605637insAGC	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		gccaccaccgTagcagcagcag	0.564														337	0.0672923	0.23	0.0231	5008	,	,		19679	0.003		0.005	False		,,,				2504	0.0092																0																																												642587					1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605643_209605645dupAGC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000384891.1	37	NULL		1																																																																																			MIR205HG	-	-		0.564	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	HGNC	lincRNA		-			209605637	+1	no_errors	ENST00000366437	ensembl	human	known	70_37	rna	INS	0.001:0.000	AGC
APEH	327	genome.wustl.edu	37	3	49722905	49722906	+	IGR	INS	-	-	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:49722905_49722906insG	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|MST1_ENST00000449682.2_Splice_Site_p.P474fs|MST1_ENST00000383728.3_3'UTR|AC099668.5_ENST00000563780.1_RNA	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACTCCTAACCTGGGGGGTCCAG	0.589																																																	0																																										SO:0001628	intergenic_variant	4485			D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49722911_49722911dupG		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQ33|Q9P0Y2	Frame_Shift_Ins	INS	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.D475fs	ENST00000296456.5	37	c.1422_1421	CCDS2801.1	3																																																																																			MST1	-	superfamily_Kringle-like		0.589	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346415.2	-			49722906	-1	no_errors	ENST00000449682	ensembl	human	known	70_37	frame_shift_ins	INS	0.996:0.969	G
MUC12	10071	genome.wustl.edu	37	7	100646140	100646140	+	Missense_Mutation	SNP	T	T	C	rs139823939	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:100646140T>C	ENST00000379442.3	+	5	12725	c.12725T>C	c.(12724-12726)gTc>gCc	p.V4242A	MUC12_ENST00000536621.1_Missense_Mutation_p.V4099A			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4242	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACCACAGCAGTCCCTGTTGAA	0.542													C|||	1237	0.247005	0.1679	0.1787	5008	,	,		17291	0.3661		0.2992	False		,,,				2504	0.226																0													46.0	43.0	44.0					7																	100646140		521	1084	1605	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12725T>C	7.37:g.100646140T>C	ENSP00000368755:p.Val4242Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.V4242A	ENST00000379442.3	37	c.12725		7	.	.	.	.	.	.	.	.	.	.	-	0.949	-0.706930	0.03230	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12672	2.66;2.66	0.53	-0.585	0.11698	.	.	.	.	.	T	0.04724	0.0128	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.42310	-0.9459	7	0.02654	T	1	.	5.4843	0.16741	0.0:0.2625:0.0:0.7375	.	.	.	.	A	4242;4099	ENSP00000368755:V4242A;ENSP00000441929:V4099A	ENSP00000368755:V4242A	V	+	2	0	MUC12	100432860	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.654000	0.01984	-1.268000	0.02439	-1.063000	0.02288	GTC	MUC12	-	NULL		0.542	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	T	XM_379904		100646140	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.000	C
MUC15	143662	genome.wustl.edu	37	11	26587073	26587074	+	Frame_Shift_Ins	INS	-	-	T	rs267602835		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:26587073_26587074insT	ENST00000455601.2	-	2	450_451	c.332_333insA	c.(331-333)cccfs	p.P111fs	MUC15_ENST00000527569.1_Frame_Shift_Ins_p.P138fs|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000436318.2_Frame_Shift_Ins_p.P138fs|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000529533.1_Frame_Shift_Ins_p.P138fs|ANO3_ENST00000256737.3_Intron|MUC15_ENST00000281268.8_Frame_Shift_Ins_p.P138fs|ANO3_ENST00000531568.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	111					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TATGGATCAAGGGAGGGCTTGT	0.46																																																	0																																										SO:0001589	frameshift_variant	143662			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.332_333insA	11.37:g.26587073_26587074insT	ENSP00000397339:p.Pro111fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Frame_Shift_Ins	INS	NULL	p.I140fs	ENST00000455601.2	37	c.414_413	CCDS7859.1	11																																																																																			MUC15	-	NULL		0.460	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	-	NM_145650		26587074	-1	no_errors	ENST00000436318	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.038	T
MUC4	4585	genome.wustl.edu	37	3	195513382	195513383	+	Frame_Shift_Ins	INS	-	-	A	rs80123784	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:195513382_195513383insA	ENST00000463781.3	-	2	5527_5528	c.5068_5069insT	c.(5068-5070)accfs	p.T1690fs	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Ins_p.T1690fs|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCATCTGTGGTAGCTGAGGAA	0.599																																																	0																																										SO:0001589	frameshift_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5068_5069insT	3.37:g.195513382_195513383insA	ENSP00000417498:p.Thr1690fs	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T1690fs	ENST00000463781.3	37	c.5069_5068	CCDS54700.1	3																																																																																			MUC4	-	NULL		0.599	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	NM_018406		195513383	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	frame_shift_ins	INS	0.251:0.029	A
NOTCH2	4853	genome.wustl.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	GG	-	rs372504208		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:120612003_120612004delGG	ENST00000256646.2	-	1	236_237	c.17_18delCC	c.(16-18)cccfs	p.P6fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	6					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.P6fs*27(2)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGCAGAGCGGGGCGCAGGGC	0.762			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	2	Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)																																								SO:0001589	frameshift_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.17_18delCC	1.37:g.120612005_120612006delGG	ENSP00000256646:p.Pro6fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P6fs	ENST00000256646.2	37	c.18_17	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch		0.762	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	GG	NM_024408		120612004	-1	no_errors	ENST00000256646	ensembl	human	known	70_37	frame_shift_del	DEL	0.101:0.700	-
NBPF15	284565	genome.wustl.edu	37	1	148594456	148594456	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:148594456G>A	ENST00000369187.3	+	19	2318	c.1829G>A	c.(1828-1830)aGa>aAa	p.R610K	NBPF15_ENST00000442702.2_Missense_Mutation_p.R610K	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	610	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.R610K(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					TCACTGGATAGATGTTATTCG	0.453																																																	1	Substitution - Missense(1)	cervix(1)											195.0	254.0	234.0					1																	148594456		2203	4299	6502	SO:0001583	missense	284565			BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1829G>A	1.37:g.148594456G>A	ENSP00000358188:p.Arg610Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3BBV9|Q8IX77	Missense_Mutation	SNP	pfam_NBPF_dom	p.R610K	ENST00000369187.3	37	c.1829	CCDS932.1	1	.	.	.	.	.	.	.	.	.	.	.	7.985	0.751974	0.15778	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.07688	3.17;3.17	0.502	-1.0	0.10196	DUF1220 (2);	.	.	.	.	T	0.04770	0.0129	M	0.76002	2.32	0.09310	N	1	P	0.37122	0.583	B	0.42882	0.401	T	0.29671	-1.0004	8	0.52906	T	0.07	.	.	.	.	.	610	Q8N660	NBPFF_HUMAN	K	610	ENSP00000416864:R610K;ENSP00000358188:R610K	ENSP00000358188:R610K	R	+	2	0	NBPF15	146861080	0.949000	0.32298	0.000000	0.03702	0.001000	0.01503	-1.277000	0.02812	-0.522000	0.06417	-0.561000	0.04177	AGA	NBPF15	-	pfam_NBPF_dom		0.453	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF15	HGNC	protein_coding	OTTHUMT00000038609.3	G	NM_173638		148594456	+1	no_errors	ENST00000369187	ensembl	human	known	70_37	missense	SNP	0.000	A
NBPF15	284565	genome.wustl.edu	37	1	148594456	148594456	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:148594456G>A	ENST00000369187.3	+	19	2318	c.1829G>A	c.(1828-1830)aGa>aAa	p.R610K	NBPF15_ENST00000442702.2_Missense_Mutation_p.R610K	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	610	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.R610K(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					TCACTGGATAGATGTTATTCG	0.453																																																	1	Substitution - Missense(1)	cervix(1)											195.0	254.0	234.0					1																	148594456		2203	4299	6502	SO:0001583	missense	284565			BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1829G>A	1.37:g.148594456G>A	ENSP00000358188:p.Arg610Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3BBV9|Q8IX77	Missense_Mutation	SNP	pfam_NBPF_dom	p.R610K	ENST00000369187.3	37	c.1829	CCDS932.1	1	.	.	.	.	.	.	.	.	.	.	.	7.985	0.751974	0.15778	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.07688	3.17;3.17	0.502	-1.0	0.10196	DUF1220 (2);	.	.	.	.	T	0.04770	0.0129	M	0.76002	2.32	0.09310	N	1	P	0.37122	0.583	B	0.42882	0.401	T	0.29671	-1.0004	8	0.52906	T	0.07	.	.	.	.	.	610	Q8N660	NBPFF_HUMAN	K	610	ENSP00000416864:R610K;ENSP00000358188:R610K	ENSP00000358188:R610K	R	+	2	0	NBPF15	146861080	0.949000	0.32298	0.000000	0.03702	0.001000	0.01503	-1.277000	0.02812	-0.522000	0.06417	-0.561000	0.04177	AGA	NBPF15	-	pfam_NBPF_dom		0.453	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF15	HGNC	protein_coding	OTTHUMT00000038609.3	G	NM_173638		148594456	+1	no_errors	ENST00000369187	ensembl	human	known	70_37	missense	SNP	0.000	A
PASD1	139135	genome.wustl.edu	37	X	150841059	150841059	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:150841059G>A	ENST00000370357.4	+	14	2087	c.1842G>A	c.(1840-1842)caG>caA	p.Q614Q		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	614						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.Q614Q(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTGTCCAGAGAGCAGCTG	0.488																																																	2	Substitution - coding silent(2)	cervix(2)											134.0	102.0	113.0					X																	150841059		2203	4300	6503	SO:0001819	synonymous_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1842G>A	X.37:g.150841059G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.Q614	ENST00000370357.4	37	c.1842	CCDS35431.1	X																																																																																			PASD1	-	NULL		0.488	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	G	NM_173493		150841059	+1	no_errors	ENST00000370357	ensembl	human	known	70_37	silent	SNP	0.000	A
PASD1	139135	genome.wustl.edu	37	X	150841059	150841059	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:150841059G>A	ENST00000370357.4	+	14	2087	c.1842G>A	c.(1840-1842)caG>caA	p.Q614Q		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	614						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.Q614Q(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTGTCCAGAGAGCAGCTG	0.488																																																	2	Substitution - coding silent(2)	cervix(2)											134.0	102.0	113.0					X																	150841059		2203	4300	6503	SO:0001819	synonymous_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1842G>A	X.37:g.150841059G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.Q614	ENST00000370357.4	37	c.1842	CCDS35431.1	X																																																																																			PASD1	-	NULL		0.488	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	G	NM_173493		150841059	+1	no_errors	ENST00000370357	ensembl	human	known	70_37	silent	SNP	0.000	A
PCBP1	5093	genome.wustl.edu	37	2	70314461	70314462	+	5'Flank	INS	-	-	T	rs537128271	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:70314461_70314462insT	ENST00000303577.5	+	0	0				PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000596665.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						GTGTCAGAAGGTTTTTTTTTTA	0.446																																					Colon(85;1146 1307 3484 18706 25380)												0																																										SO:0001631	upstream_gene_variant	400960				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645		2.37:g.70314471_70314471dupT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13157|Q14975	RNA	INS	-	NULL	ENST00000303577.5	37	NULL	CCDS1898.1	2																																																																																			PCBP1-AS1	-	-		0.446	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1-AS1	HGNC	protein_coding	OTTHUMT00000251844.1	-	NM_006196		70314462	-1	no_errors	ENST00000413791	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
PCDHA8	56140	genome.wustl.edu	37	5	140222139	140222139	+	Silent	SNP	C	C	T	rs147149527	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:140222139C>T	ENST00000531613.1	+	1	1233	c.1233C>T	c.(1231-1233)agC>agT	p.S411S	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.S411S|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGACAGCGCCCTGGACC	0.627													.|||	6	0.00119808	0.0	0.0043	5008	,	,		16950	0.001		0.0	False		,,,				2504	0.002																0								C	,,,,,,,,,,	2,4402	4.2+/-10.8	0,2,2200	130.0	113.0	118.0		,,,,,,,1233,,,1233	1.7	0.8	5	dbSNP_134	118	9,8569	4.3+/-15.6	1,7,4281	no	intron,intron,intron,intron,intron,intron,intron,coding-synonymous,intron,intron,coding-synonymous	PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031856.1	,,,,,,,,,,	1,9,6481	TT,TC,CC		0.1049,0.0454,0.0847	,,,,,,,,,,	,,,,,,,411/951,,,411/815	140222139	11,12971	2202	4289	6491	SO:0001819	synonymous_variant	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1233C>T	5.37:g.140222139C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S411	ENST00000531613.1	37	c.1233	CCDS54919.1	5																																																																																			PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.627	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	C	NM_018911		140222139	+1	no_errors	ENST00000531613	ensembl	human	known	70_37	silent	SNP	0.000	T
PCDHB16	57717	genome.wustl.edu	37	5	140563728	140563728	+	Missense_Mutation	SNP	A	A	G	rs2697532	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:140563728A>G	ENST00000361016.2	+	1	2749	c.1594A>G	c.(1594-1596)Agc>Ggc	p.S532G		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	532	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		S -> G (in dbSNP:rs2697532). {ECO:0000269|PubMed:11322959, ECO:0000269|PubMed:15489334}.		calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTCCGCGTGAGCGCCACAGA	0.682													G|||	939	0.1875	0.1339	0.1931	5008	,	,		10582	0.1855		0.2863	False		,,,				2504	0.1564																0													35.0	38.0	37.0					5																	140563728		1856	3453	5309	SO:0001583	missense	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1594A>G	5.37:g.140563728A>G	ENSP00000354293:p.Ser532Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S532G	ENST00000361016.2	37	c.1594	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	N	0.027	-1.361903	0.01235	.	.	ENSG00000196963	ENST00000361016	T	0.01804	4.63	4.26	-1.08	0.09936	Cadherin (5);Cadherin-like (1);	0.236103	0.21995	N	0.066089	T	0.00967	0.0032	N	0.25201	0.72	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48502	-0.9030	9	0.02654	T	1	.	3.6001	0.08021	0.2321:0.5022:0.139:0.1267	rs61743494	532	Q9NRJ7	PCDBG_HUMAN	G	532	ENSP00000354293:S532G	ENSP00000354293:S532G	S	+	1	0	PCDHB16	140543912	0.000000	0.05858	0.984000	0.44739	0.358000	0.29455	-1.167000	0.03126	-0.365000	0.08076	-0.204000	0.12730	AGC	PCDHB16	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.682	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	HGNC	protein_coding	OTTHUMT00000251800.1	A	NM_020957		140563728	+1	no_errors	ENST00000361016	ensembl	human	known	70_37	missense	SNP	0.015	G
PDE1C	5137	genome.wustl.edu	37	7	32209496	32209496	+	Missense_Mutation	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:32209496C>A	ENST00000396193.1	-	3	802	c.209G>T	c.(208-210)aGg>aTg	p.R70M		NM_001191058.1	NP_001177987.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	0					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	AATTGTTGGCCTTGGCTTCTC	0.522																																																	0													235.0	201.0	211.0					7																	32209496		876	1991	2867	SO:0001583	missense	5137			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396193.1:c.209G>T	7.37:g.32209496C>A	ENSP00000379496:p.Arg70Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R70M	ENST00000396193.1	37	c.209	CCDS55100.1	7	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861608	0.51482	.	.	ENSG00000154678	ENST00000396193	T	0.74106	-0.81	5.75	3.73	0.42828	.	2.735230	0.02828	U	0.126419	T	0.63177	0.2489	N	0.19112	0.55	0.80722	D	1	B	0.32693	0.38	B	0.34873	0.191	T	0.60732	-0.7205	10	0.51188	T	0.08	.	4.4249	0.11498	0.0:0.5699:0.0:0.4301	.	70	E9PE92	.	M	70	ENSP00000379496:R70M	ENSP00000379496:R70M	R	-	2	0	PDE1C	32176021	0.433000	0.25562	0.995000	0.50966	0.978000	0.69477	1.444000	0.35068	1.454000	0.47793	0.655000	0.94253	AGG	PDE1C	-	NULL		0.522	PDE1C-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000215075.1	C			32209496	-1	no_errors	ENST00000396193	ensembl	human	novel	70_37	missense	SNP	0.999	A
PDE4DIP	9659	genome.wustl.edu	37	1	144891398	144891398	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:144891398C>T	ENST00000369354.3	-	22	3094				PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000313431.9_3'UTR|PDE4DIP_ENST00000369349.3_3'UTR|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000369351.3_3'UTR|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000524974.1_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGGGAAGGTCGGGTACAGCT	0.428			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001627	intron_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2904+1102G>A	1.37:g.144891398C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000369354.3	37	NULL	CCDS30824.1	1																																																																																			PDE4DIP	-	-		0.428	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	C	NM_022359		144891398	-1	no_errors	ENST00000467859	ensembl	human	known	70_37	rna	SNP	0.000	T
PHF6	84295	genome.wustl.edu	37	X	133549136	133549136	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:133549136C>T	ENST00000332070.3	+	8	1022	c.820C>T	c.(820-822)Cga>Tga	p.R274*	PHF6_ENST00000416404.2_Nonsense_Mutation_p.R240*|PHF6_ENST00000370803.3_Nonsense_Mutation_p.R274*|PHF6_ENST00000394292.1_Nonsense_Mutation_p.R275*|PHF6_ENST00000370800.4_Nonsense_Mutation_p.R275*|PHF6_ENST00000370799.1_Nonsense_Mutation_p.R275*	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	274	Extended PHD2 domain (ePHD2).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.R274*(4)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					GGAGATTAAACGAGGAAAAAG	0.343			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)			Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	4	Substitution - Nonsense(4)	cervix(2)|haematopoietic_and_lymphoid_tissue(2)											80.0	73.0	76.0					X																	133549136		2203	4298	6501	SO:0001587	stop_gained	84295			AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.820C>T	X.37:g.133549136C>T	ENSP00000329097:p.Arg274*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.R275*	ENST00000332070.3	37	c.823	CCDS14639.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.084297	0.97267	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6319	12.94	0.58337	0.1725:0.8275:0.0:0.0	.	.	.	.	X	274;274;275;275;240;275	.	ENSP00000329097:R274X	R	+	1	2	PHF6	133376802	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.466000	0.60148	2.410000	0.81850	0.594000	0.82650	CGA	PHF6	-	superfamily_Znf_FYVE_PHD		0.343	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF6	HGNC	protein_coding	OTTHUMT00000058367.1	C	NM_032458		133549136	+1	no_errors	ENST00000394292	ensembl	human	known	70_37	nonsense	SNP	1.000	T
PLEKHM2	23207	genome.wustl.edu	37	1	16044409	16044409	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:16044409C>T	ENST00000375799.3	+	4	526	c.299C>T	c.(298-300)gCc>gTc	p.A100V	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.A100V	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	100	Interaction with KIF5B.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)	p.A203V(1)|p.A100V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTGTACCTGGCCCTCAACGAG	0.562																																																	2	Substitution - Missense(2)	cervix(2)											64.0	66.0	65.0					1																	16044409		1956	4153	6109	SO:0001583	missense	23207			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.299C>T	1.37:g.16044409C>T	ENSP00000364956:p.Ala100Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.A100V	ENST00000375799.3	37	c.299	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.716487	0.96830	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.43294	0.95;0.95	5.17	5.17	0.71159	RUN (3);	0.000000	0.85682	D	0.000000	T	0.64616	0.2614	M	0.75884	2.315	0.80722	D	1	D	0.57571	0.98	D	0.63957	0.92	T	0.66248	-0.5971	10	0.52906	T	0.07	-25.6353	19.0574	0.93070	0.0:1.0:0.0:0.0	.	100	Q8IWE5	PKHM2_HUMAN	V	100	ENSP00000364956:A100V;ENSP00000364950:A100V	ENSP00000364950:A100V	A	+	2	0	PLEKHM2	15916996	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.734000	0.84928	2.578000	0.87016	0.655000	0.94253	GCC	PLEKHM2	-	pfam_Run,smart_Run,pfscan_Run		0.562	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	C	NM_015164		16044409	+1	no_errors	ENST00000375799	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEKHM2	23207	genome.wustl.edu	37	1	16044409	16044409	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:16044409C>T	ENST00000375799.3	+	4	526	c.299C>T	c.(298-300)gCc>gTc	p.A100V	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.A100V	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	100	Interaction with KIF5B.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)	p.A203V(1)|p.A100V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTGTACCTGGCCCTCAACGAG	0.562																																																	2	Substitution - Missense(2)	cervix(2)											64.0	66.0	65.0					1																	16044409		1956	4153	6109	SO:0001583	missense	23207			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.299C>T	1.37:g.16044409C>T	ENSP00000364956:p.Ala100Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.A100V	ENST00000375799.3	37	c.299	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.716487	0.96830	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.43294	0.95;0.95	5.17	5.17	0.71159	RUN (3);	0.000000	0.85682	D	0.000000	T	0.64616	0.2614	M	0.75884	2.315	0.80722	D	1	D	0.57571	0.98	D	0.63957	0.92	T	0.66248	-0.5971	10	0.52906	T	0.07	-25.6353	19.0574	0.93070	0.0:1.0:0.0:0.0	.	100	Q8IWE5	PKHM2_HUMAN	V	100	ENSP00000364956:A100V;ENSP00000364950:A100V	ENSP00000364950:A100V	A	+	2	0	PLEKHM2	15916996	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.734000	0.84928	2.578000	0.87016	0.655000	0.94253	GCC	PLEKHM2	-	pfam_Run,smart_Run,pfscan_Run		0.562	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	C	NM_015164		16044409	+1	no_errors	ENST00000375799	ensembl	human	known	70_37	missense	SNP	1.000	T
PIK3C2B	5287	genome.wustl.edu	37	1	204408075	204408075	+	Silent	SNP	G	G	A	rs368654473		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:204408075G>A	ENST00000367187.3	-	24	4060	c.3504C>T	c.(3502-3504)gaC>gaT	p.D1168D	PIK3C2B_ENST00000424712.2_Silent_p.D1140D	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1168	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.D1168D(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCTCATACTCGTCCTCCCCAG	0.597																																																	1	Substitution - coding silent(1)	cervix(1)						G		1,4405	2.1+/-5.4	0,1,2202	143.0	102.0	116.0		3504	-6.5	0.7	1		116	0,8600		0,0,4300	no	coding-synonymous	PIK3C2B	NM_002646.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1168/1635	204408075	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3504C>T	1.37:g.204408075G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95666|Q5SW99	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.D1168	ENST00000367187.3	37	c.3504	CCDS1446.1	1																																																																																			PIK3C2B	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.597	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	G	NM_002646		204408075	-1	no_errors	ENST00000367187	ensembl	human	known	70_37	silent	SNP	0.317	A
PLEKHM3	389072	genome.wustl.edu	37	2	208865987	208865987	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:208865987C>T	ENST00000427836.2	-	2	866	c.377G>A	c.(376-378)cGg>cAg	p.R126Q	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.R126Q|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.R126Q	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	126					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)	p.R126Q(2)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCGGTCCCTCCGACGCTGACA	0.468																																																	2	Substitution - Missense(2)	cervix(2)											105.0	105.0	105.0					2																	208865987		2085	4222	6307	SO:0001583	missense	389072			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.377G>A	2.37:g.208865987C>T	ENSP00000417003:p.Arg126Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EKV2|Q8WW68	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R126Q	ENST00000427836.2	37	c.377	CCDS42808.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.219264	0.95139	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	D;D;D	0.86230	-2.0;-2.02;-2.09	5.56	5.56	0.83823	.	0.069336	0.53938	D	0.000043	D	0.90092	0.6905	L	0.27053	0.805	0.43279	D	0.99524	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.91108	0.4920	10	0.87932	D	0	.	19.9626	0.97256	0.0:1.0:0.0:0.0	.	126;126	C9J119;Q6ZWE6	.;PKHM3_HUMAN	Q	126	ENSP00000417003:R126Q;ENSP00000373899:R126Q;ENSP00000400150:R126Q	ENSP00000373899:R126Q	R	-	2	0	PLEKHM3	208574232	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.039000	0.57325	2.784000	0.95788	0.644000	0.83932	CGG	PLEKHM3	-	NULL		0.468	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1	C	NM_001080475		208865987	-1	no_errors	ENST00000427836	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEKHM3	389072	genome.wustl.edu	37	2	208865987	208865987	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:208865987C>T	ENST00000427836.2	-	2	866	c.377G>A	c.(376-378)cGg>cAg	p.R126Q	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.R126Q|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.R126Q	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	126					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)	p.R126Q(2)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCGGTCCCTCCGACGCTGACA	0.468																																																	2	Substitution - Missense(2)	cervix(2)											105.0	105.0	105.0					2																	208865987		2085	4222	6307	SO:0001583	missense	389072			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.377G>A	2.37:g.208865987C>T	ENSP00000417003:p.Arg126Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EKV2|Q8WW68	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R126Q	ENST00000427836.2	37	c.377	CCDS42808.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.219264	0.95139	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	D;D;D	0.86230	-2.0;-2.02;-2.09	5.56	5.56	0.83823	.	0.069336	0.53938	D	0.000043	D	0.90092	0.6905	L	0.27053	0.805	0.43279	D	0.99524	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.91108	0.4920	10	0.87932	D	0	.	19.9626	0.97256	0.0:1.0:0.0:0.0	.	126;126	C9J119;Q6ZWE6	.;PKHM3_HUMAN	Q	126	ENSP00000417003:R126Q;ENSP00000373899:R126Q;ENSP00000400150:R126Q	ENSP00000373899:R126Q	R	-	2	0	PLEKHM3	208574232	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.039000	0.57325	2.784000	0.95788	0.644000	0.83932	CGG	PLEKHM3	-	NULL		0.468	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1	C	NM_001080475		208865987	-1	no_errors	ENST00000427836	ensembl	human	known	70_37	missense	SNP	1.000	T
PLXNA3	55558	genome.wustl.edu	37	X	153693147	153693147	+	Missense_Mutation	SNP	G	G	A	rs149034613		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:153693147G>A	ENST00000369682.3	+	10	2154	c.1979G>A	c.(1978-1980)cGc>cAc	p.R660H		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	660					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.R660H(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTAAGTACCGCCACACGTGT	0.652																																																	1	Substitution - Missense(1)	cervix(1)						G	HIS/ARG	0,3822		0,0,1628,566	47.0	33.0	38.0		1979	4.6	1.0	X	dbSNP_134	38	1,6720		0,1,2426,1867	no	missense	PLXNA3	NM_017514.3	29	0,1,4054,2433	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging	660/1872	153693147	1,10542	2194	4294	6488	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1979G>A	X.37:g.153693147G>A	ENSP00000358696:p.Arg660His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R660H	ENST00000369682.3	37	c.1979	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444022	0.83993	0.0	1.49E-4	ENSG00000130827	ENST00000369682	T	0.17854	2.25	5.42	4.56	0.56223	.	0.155122	0.64402	N	0.000014	T	0.45276	0.1334	M	0.87097	2.86	0.54753	D	0.999985	D	0.89917	1.0	D	0.74348	0.983	T	0.50693	-0.8798	10	0.59425	D	0.04	.	12.2064	0.54355	0.0862:0.0:0.9138:0.0	.	660	P51805	PLXA3_HUMAN	H	660	ENSP00000358696:R660H	ENSP00000358696:R660H	R	+	2	0	PLXNA3	153346341	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.594000	0.67557	1.168000	0.42723	0.529000	0.55759	CGC	PLXNA3	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like		0.652	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	G	NM_017514		153693147	+1	no_errors	ENST00000369682	ensembl	human	known	70_37	missense	SNP	1.000	A
PLXNA3	55558	genome.wustl.edu	37	X	153693147	153693147	+	Missense_Mutation	SNP	G	G	A	rs149034613		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:153693147G>A	ENST00000369682.3	+	10	2154	c.1979G>A	c.(1978-1980)cGc>cAc	p.R660H		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	660					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.R660H(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTAAGTACCGCCACACGTGT	0.652																																																	1	Substitution - Missense(1)	cervix(1)						G	HIS/ARG	0,3822		0,0,1628,566	47.0	33.0	38.0		1979	4.6	1.0	X	dbSNP_134	38	1,6720		0,1,2426,1867	no	missense	PLXNA3	NM_017514.3	29	0,1,4054,2433	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging	660/1872	153693147	1,10542	2194	4294	6488	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1979G>A	X.37:g.153693147G>A	ENSP00000358696:p.Arg660His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.R660H	ENST00000369682.3	37	c.1979	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444022	0.83993	0.0	1.49E-4	ENSG00000130827	ENST00000369682	T	0.17854	2.25	5.42	4.56	0.56223	.	0.155122	0.64402	N	0.000014	T	0.45276	0.1334	M	0.87097	2.86	0.54753	D	0.999985	D	0.89917	1.0	D	0.74348	0.983	T	0.50693	-0.8798	10	0.59425	D	0.04	.	12.2064	0.54355	0.0862:0.0:0.9138:0.0	.	660	P51805	PLXA3_HUMAN	H	660	ENSP00000358696:R660H	ENSP00000358696:R660H	R	+	2	0	PLXNA3	153346341	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.594000	0.67557	1.168000	0.42723	0.529000	0.55759	CGC	PLXNA3	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like		0.652	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	HGNC	protein_coding	OTTHUMT00000081634.1	G	NM_017514		153693147	+1	no_errors	ENST00000369682	ensembl	human	known	70_37	missense	SNP	1.000	A
PRADC1	84279	genome.wustl.edu	37	2	73456064	73456064	+	Missense_Mutation	SNP	C	C	A	rs372220247		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:73456064C>A	ENST00000258083.2	-	4	372	c.305G>T	c.(304-306)cGg>cTg	p.R102L	PRADC1_ENST00000480093.1_Intron	NM_032319.1	NP_115695.1	Q9BSG0	PADC1_HUMAN	protease-associated domain containing 1	102	PA.					extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(1)|lung(2)	4						CTGGACCACCCGAGTCTTGGA	0.592																																																	0													29.0	29.0	29.0					2																	73456064		2203	4300	6503	SO:0001583	missense	84279			BC005069	CCDS1924.1	2p13.2	2012-10-31	2011-04-15	2011-04-15	ENSG00000135617	ENSG00000135617			16047	protein-coding gene	gene with protein product	"""protease-associated domain-containing glycoprotein 21 kDa"""		"""chromosome 2 open reading frame 7"""	C2orf7		15498570	Standard	NM_032319		Approved	MGC13004, PAP21, hPAP21	uc002siy.3	Q9BSG0	OTTHUMG00000129773	ENST00000258083.2:c.305G>T	2.37:g.73456064C>A	ENSP00000258083:p.Arg102Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2Z1P2	Missense_Mutation	SNP	pfam_Protease-assoc_domain	p.R102L	ENST00000258083.2	37	c.305	CCDS1924.1	2	.	.	.	.	.	.	.	.	.	.	C	11.02	1.517398	0.27123	.	.	ENSG00000135617	ENST00000258083	T	0.06371	3.31	4.97	4.97	0.65823	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	N	0.26042	0.785	0.58432	D	0.999998	D	0.61697	0.99	D	0.79784	0.993	T	0.22173	-1.0224	10	0.08599	T	0.76	-23.4944	17.3245	0.87244	0.0:1.0:0.0:0.0	.	102	Q9BSG0	PADC1_HUMAN	L	102	ENSP00000258083:R102L	ENSP00000258083:R102L	R	-	2	0	PRADC1	73309572	0.996000	0.38824	0.982000	0.44146	0.922000	0.55478	3.747000	0.55134	2.748000	0.94277	0.650000	0.86243	CGG	PRADC1	-	pfam_Protease-assoc_domain		0.592	PRADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRADC1	HGNC	protein_coding	OTTHUMT00000251989.1	C	NM_032319		73456064	-1	no_errors	ENST00000258083	ensembl	human	known	70_37	missense	SNP	0.988	A
PSD4	23550	genome.wustl.edu	37	2	113955395	113955395	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:113955395C>T	ENST00000245796.6	+	14	2724	c.2529C>T	c.(2527-2529)caC>caT	p.H843H	PSD4_ENST00000441564.3_Silent_p.H814H	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	843	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.H843H(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGGGGTGCACCACTCGCTGG	0.642																																																	1	Substitution - coding silent(1)	cervix(1)											32.0	33.0	33.0					2																	113955395		2203	4300	6503	SO:0001819	synonymous_variant	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2529C>T	2.37:g.113955395C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.H843	ENST00000245796.6	37	c.2529	CCDS33276.1	2																																																																																			PSD4	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.642	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	C	NM_012455		113955395	+1	no_errors	ENST00000245796	ensembl	human	known	70_37	silent	SNP	1.000	T
PSD4	23550	genome.wustl.edu	37	2	113955395	113955395	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:113955395C>T	ENST00000245796.6	+	14	2724	c.2529C>T	c.(2527-2529)caC>caT	p.H843H	PSD4_ENST00000441564.3_Silent_p.H814H	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	843	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.H843H(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGGGGTGCACCACTCGCTGG	0.642																																																	1	Substitution - coding silent(1)	cervix(1)											32.0	33.0	33.0					2																	113955395		2203	4300	6503	SO:0001819	synonymous_variant	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2529C>T	2.37:g.113955395C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.H843	ENST00000245796.6	37	c.2529	CCDS33276.1	2																																																																																			PSD4	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.642	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	C	NM_012455		113955395	+1	no_errors	ENST00000245796	ensembl	human	known	70_37	silent	SNP	1.000	T
POTEF	728378	genome.wustl.edu	37	2	130877709	130877709	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr2:130877709G>A	ENST00000409914.2	-	3	779	c.380C>T	c.(379-381)gCc>gTc	p.A127V	POTEF_ENST00000360967.5_Missense_Mutation_p.A127V|POTEF_ENST00000361163.4_Missense_Mutation_p.A127V|POTEF_ENST00000357462.5_Missense_Mutation_p.A127V	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	127					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A127V(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTCCATGAAGGCACTGTCATC	0.587																																																	2	Substitution - Missense(2)	cervix(2)											85.0	99.0	94.0					2																	130877709		2201	4299	6500	SO:0001583	missense	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.380C>T	2.37:g.130877709G>A	ENSP00000386786:p.Ala127Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC34	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.A127V	ENST00000409914.2	37	c.380	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	9.983	1.228614	0.22542	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.76448	-1.02;-1.02;0.69;0.69	1.05	-2.11	0.07187	.	.	.	.	.	T	0.67841	0.2936	L	0.58101	1.795	0.09310	N	1	B	0.17667	0.023	B	0.11329	0.006	T	0.54931	-0.8219	9	0.87932	D	0	.	2.8072	0.05431	0.3814:0.2562:0.3624:0.0	.	127	A5A3E0	POTEF_HUMAN	V	127	ENSP00000350052:A127V;ENSP00000386786:A127V;ENSP00000354232:A127V;ENSP00000355012:A127V	ENSP00000350052:A127V	A	-	2	0	POTEF	130594179	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.949000	0.03893	-1.320000	0.02283	0.162000	0.16502	GCC	POTEF	-	NULL		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	G	NM_001099771		130877709	-1	no_errors	ENST00000357462	ensembl	human	known	70_37	missense	SNP	0.000	A
PTPN12	5782	genome.wustl.edu	37	7	77267950	77267950	+	Missense_Mutation	SNP	C	C	T	rs377606271		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:77267950C>T	ENST00000248594.6	+	17	2455	c.2183C>T	c.(2182-2184)gCg>gTg	p.A728V	PTPN12_ENST00000435495.2_Missense_Mutation_p.A598V|PTPN12_ENST00000415482.2_Missense_Mutation_p.A609V	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	728					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.A728V(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GATCATCCAGCGGGAGGTATT	0.358																																																	1	Substitution - Missense(1)	cervix(1)						T	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	105.0	106.0	106.0		1826,1793,2183	1.5	0.1	7		106	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PTPN12	NM_001131008.1,NM_001131009.1,NM_002835.3	64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	609/662,598/651,728/781	77267950	1,13005	2203	4300	6503	SO:0001583	missense	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.2183C>T	7.37:g.77267950C>T	ENSP00000248594:p.Ala728Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-12,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A728V	ENST00000248594.6	37	c.2183	CCDS5592.1	7	.	.	.	.	.	.	.	.	.	.	c	0.025	-1.384535	0.01194	0.0	1.16E-4	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000435495;ENST00000407343	T;T;T;T	0.28666	3.88;3.29;3.29;1.6	5.5	1.48	0.22813	.	1.065310	0.07224	N	0.861328	T	0.22003	0.0530	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31194	-0.9952	10	0.15952	T	0.53	.	3.6874	0.08334	0.2298:0.5105:0.0:0.2597	.	728	Q05209	PTN12_HUMAN	V	728;609;598;210	ENSP00000248594:A728V;ENSP00000392429:A609V;ENSP00000397991:A598V;ENSP00000385079:A210V	ENSP00000248594:A728V	A	+	2	0	PTPN12	77105886	0.002000	0.14202	0.100000	0.21137	0.001000	0.01503	0.240000	0.18042	0.818000	0.34468	-1.041000	0.02371	GCG	PTPN12	-	pirsf_Tyr_Pase_non-rcpt_typ-12		0.358	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN12	HGNC	protein_coding	OTTHUMT00000253183.3	C			77267950	+1	no_errors	ENST00000248594	ensembl	human	known	70_37	missense	SNP	0.009	T
PTPN12	5782	genome.wustl.edu	37	7	77267950	77267950	+	Missense_Mutation	SNP	C	C	T	rs377606271		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:77267950C>T	ENST00000248594.6	+	17	2455	c.2183C>T	c.(2182-2184)gCg>gTg	p.A728V	PTPN12_ENST00000435495.2_Missense_Mutation_p.A598V|PTPN12_ENST00000415482.2_Missense_Mutation_p.A609V	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	728					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.A728V(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GATCATCCAGCGGGAGGTATT	0.358																																																	1	Substitution - Missense(1)	cervix(1)						T	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	105.0	106.0	106.0		1826,1793,2183	1.5	0.1	7		106	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PTPN12	NM_001131008.1,NM_001131009.1,NM_002835.3	64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	609/662,598/651,728/781	77267950	1,13005	2203	4300	6503	SO:0001583	missense	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.2183C>T	7.37:g.77267950C>T	ENSP00000248594:p.Ala728Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-12,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A728V	ENST00000248594.6	37	c.2183	CCDS5592.1	7	.	.	.	.	.	.	.	.	.	.	c	0.025	-1.384535	0.01194	0.0	1.16E-4	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000435495;ENST00000407343	T;T;T;T	0.28666	3.88;3.29;3.29;1.6	5.5	1.48	0.22813	.	1.065310	0.07224	N	0.861328	T	0.22003	0.0530	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31194	-0.9952	10	0.15952	T	0.53	.	3.6874	0.08334	0.2298:0.5105:0.0:0.2597	.	728	Q05209	PTN12_HUMAN	V	728;609;598;210	ENSP00000248594:A728V;ENSP00000392429:A609V;ENSP00000397991:A598V;ENSP00000385079:A210V	ENSP00000248594:A728V	A	+	2	0	PTPN12	77105886	0.002000	0.14202	0.100000	0.21137	0.001000	0.01503	0.240000	0.18042	0.818000	0.34468	-1.041000	0.02371	GCG	PTPN12	-	pirsf_Tyr_Pase_non-rcpt_typ-12		0.358	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN12	HGNC	protein_coding	OTTHUMT00000253183.3	C			77267950	+1	no_errors	ENST00000248594	ensembl	human	known	70_37	missense	SNP	0.009	T
PTPRZ1	5803	genome.wustl.edu	37	7	121513405	121513405	+	5'UTR	SNP	A	A	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr7:121513405A>C	ENST00000393386.2	+	0	263				PTPRZ1_ENST00000449182.1_5'Flank	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						cacacacacaaacacacatac	0.468																																																	0																																										SO:0001623	5_prime_UTR_variant	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.-149A>C	7.37:g.121513405A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	RNA	SNP	-	NULL	ENST00000393386.2	37	NULL	CCDS34740.1	7																																																																																			PTPRZ1	-	-		0.468	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	A	NM_002851		121513405	+1	no_errors	ENST00000471837	ensembl	human	known	70_37	rna	SNP	0.004	C
MSMP	692094	genome.wustl.edu	37	9	35752745	35752745	+	IGR	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:35752745G>A	ENST00000436428.2	-	0	670				GBA2_ENST00000545786.1_5'Flank|RGP1_ENST00000456972.2_Nonsense_Mutation_p.W390*|MSMP_ENST00000414286.1_5'Flank|RGP1_ENST00000378078.4_Nonsense_Mutation_p.W350*	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated							cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.W390*(1)|p.W350*(1)		endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						CTACCACCTGGACAGGACCTG	0.557																																																	2	Substitution - Nonsense(2)	cervix(2)											64.0	61.0	62.0					9																	35752745		1962	4154	6116	SO:0001628	intergenic_variant	9827			DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882		9.37:g.35752745G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Rgp1	p.W390*	ENST00000436428.2	37	c.1170	CCDS43797.1	9	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465089	0.84425	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3942	19.3249	0.94258	0.0:0.0:1.0:0.0	.	.	.	.	X	390;350	.	ENSP00000367318:W350X	W	+	3	0	RGP1	35742745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.442000	0.90317	2.805000	0.96524	0.655000	0.94253	TGG	RGP1	-	NULL		0.557	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000052384.2	G	NM_001044264		35752745	+1	no_errors	ENST00000456972	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MSMP	692094	genome.wustl.edu	37	9	35752745	35752745	+	IGR	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:35752745G>A	ENST00000436428.2	-	0	670				GBA2_ENST00000545786.1_5'Flank|RGP1_ENST00000456972.2_Nonsense_Mutation_p.W390*|MSMP_ENST00000414286.1_5'Flank|RGP1_ENST00000378078.4_Nonsense_Mutation_p.W350*	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated							cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.W390*(1)|p.W350*(1)		endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						CTACCACCTGGACAGGACCTG	0.557																																																	2	Substitution - Nonsense(2)	cervix(2)											64.0	61.0	62.0					9																	35752745		1962	4154	6116	SO:0001628	intergenic_variant	9827			DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882		9.37:g.35752745G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Rgp1	p.W390*	ENST00000436428.2	37	c.1170	CCDS43797.1	9	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465089	0.84425	.	.	ENSG00000107185	ENST00000456972;ENST00000378078	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3942	19.3249	0.94258	0.0:0.0:1.0:0.0	.	.	.	.	X	390;350	.	ENSP00000367318:W350X	W	+	3	0	RGP1	35742745	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.442000	0.90317	2.805000	0.96524	0.655000	0.94253	TGG	RGP1	-	NULL		0.557	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGP1	HGNC	protein_coding	OTTHUMT00000052384.2	G	NM_001044264		35752745	+1	no_errors	ENST00000456972	ensembl	human	known	70_37	nonsense	SNP	1.000	A
RECK	8434	genome.wustl.edu	37	9	36117064	36117064	+	Missense_Mutation	SNP	G	G	A	rs142114378		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:36117064G>A	ENST00000377966.3	+	17	2709	c.2143G>A	c.(2143-2145)Gcg>Acg	p.A715T		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	715	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A715T(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AAGACAGCTCGCGTGTGACCA	0.458																																																	1	Substitution - Missense(1)	cervix(1)						G	THR/ALA	0,4406		0,0,2203	171.0	150.0	157.0		2143	-0.1	0.5	9	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	no	missense	RECK	NM_021111.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	715/972	36117064	1,13005	2203	4300	6503	SO:0001583	missense	8434			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2143G>A	9.37:g.36117064G>A	ENSP00000367202:p.Ala715Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Prot_inh_PMP,smart_Prot_inh_Kazal	p.A715T	ENST00000377966.3	37	c.2143	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	0.232	-1.020125	0.02078	0.0	1.16E-4	ENSG00000122707	ENST00000377966	T	0.42900	0.96	5.91	-0.0732	0.13736	Proteinase inhibitor I1, Kazal (1);	0.639785	0.16643	N	0.205522	T	0.10035	0.0246	N	0.00707	-1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36553	-0.9743	10	0.02654	T	1	-1.7436	7.5055	0.27542	0.7548:0.0:0.109:0.1362	.	715;715	A8K9D8;O95980	.;RECK_HUMAN	T	715	ENSP00000367202:A715T	ENSP00000367202:A715T	A	+	1	0	RECK	36107064	0.000000	0.05858	0.463000	0.27130	0.389000	0.30415	0.524000	0.22940	-0.217000	0.10033	-0.700000	0.03674	GCG	RECK	-	smart_Prot_inh_Kazal		0.458	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	G			36117064	+1	no_errors	ENST00000377966	ensembl	human	known	70_37	missense	SNP	0.030	A
RECK	8434	genome.wustl.edu	37	9	36117064	36117064	+	Missense_Mutation	SNP	G	G	A	rs142114378		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:36117064G>A	ENST00000377966.3	+	17	2709	c.2143G>A	c.(2143-2145)Gcg>Acg	p.A715T		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	715	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A715T(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AAGACAGCTCGCGTGTGACCA	0.458																																																	1	Substitution - Missense(1)	cervix(1)						G	THR/ALA	0,4406		0,0,2203	171.0	150.0	157.0		2143	-0.1	0.5	9	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	no	missense	RECK	NM_021111.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	715/972	36117064	1,13005	2203	4300	6503	SO:0001583	missense	8434			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2143G>A	9.37:g.36117064G>A	ENSP00000367202:p.Ala715Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Prot_inh_PMP,smart_Prot_inh_Kazal	p.A715T	ENST00000377966.3	37	c.2143	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	0.232	-1.020125	0.02078	0.0	1.16E-4	ENSG00000122707	ENST00000377966	T	0.42900	0.96	5.91	-0.0732	0.13736	Proteinase inhibitor I1, Kazal (1);	0.639785	0.16643	N	0.205522	T	0.10035	0.0246	N	0.00707	-1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36553	-0.9743	10	0.02654	T	1	-1.7436	7.5055	0.27542	0.7548:0.0:0.109:0.1362	.	715;715	A8K9D8;O95980	.;RECK_HUMAN	T	715	ENSP00000367202:A715T	ENSP00000367202:A715T	A	+	1	0	RECK	36107064	0.000000	0.05858	0.463000	0.27130	0.389000	0.30415	0.524000	0.22940	-0.217000	0.10033	-0.700000	0.03674	GCG	RECK	-	smart_Prot_inh_Kazal		0.458	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	G			36117064	+1	no_errors	ENST00000377966	ensembl	human	known	70_37	missense	SNP	0.030	A
RNA5SP174	106478998	genome.wustl.edu	37	4	190936378	190936379	+	RNA	INS	-	-	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr4:190936378_190936379insA	ENST00000362702.1	+	0	86_87				RNA5SP175_ENST00000364275.1_RNA					RNA, 5S ribosomal pseudogene 174																		tacttggatggattccgcctgg	0.644																																																	0																																												0					4q35.2	2012-08-07	2012-08-09	2012-08-09	ENSG00000199572	ENSG00000199572			43074	pseudogene	RNA, pseudogene			"""RNA, 5S ribosomal 174"""	RN5S174			Standard			Approved						4.37:g.190936379_190936379dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000362702.1	37	NULL		4																																																																																			RNA5SP174	-	-		0.644	RNA5SP174-201	KNOWN	basic	rRNA	RNA5SP174	HGNC	rRNA		-			190936379	+1	no_errors	ENST00000362702	ensembl	human	known	70_37	rna	INS	0.177:0.178	A
RRNAD1	51093	genome.wustl.edu	37	1	156706166	156706166	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:156706166C>T	ENST00000368216.4	+	8	1936				MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000481920.1_3'UTR|RRNAD1_ENST00000368218.4_Intron|RRNAD1_ENST00000476229.1_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1							integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						TATTAAGATTCCTACCAAATC	0.512																																																	0																																										SO:0001627	intron_variant	51093			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1307-258C>T	1.37:g.156706166C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	RNA	SNP	-	NULL	ENST00000368216.4	37	NULL	CCDS1154.1	1																																																																																			RRNAD1	-	-		0.512	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	C	NM_015997		156706166	+1	no_errors	ENST00000481920	ensembl	human	putative	70_37	rna	SNP	0.004	T
SEC61A2	55176	genome.wustl.edu	37	10	12198972	12198972	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:12198972G>A	ENST00000298428.9	+	8	772	c.683G>A	c.(682-684)cGa>cAa	p.R228Q	SEC61A2_ENST00000379020.4_Missense_Mutation_p.R228Q|SEC61A2_ENST00000379033.3_Missense_Mutation_p.R206Q|SEC61A2_ENST00000304267.8_Missense_Mutation_p.R228Q|SEC61A2_ENST00000495368.1_3'UTR	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)	228					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)	p.R228Q(2)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				GACAAAGTCCGAGCTTTACGG	0.443																																																	2	Substitution - Missense(2)	cervix(2)											190.0	177.0	181.0					10																	12198972		2203	4300	6503	SO:0001583	missense	55176			AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.683G>A	10.37:g.12198972G>A	ENSP00000298428:p.Arg228Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8D0|B4DX72|F8W773	Missense_Mutation	SNP	pfam_SecY/SEC61-alpha,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	p.R228Q	ENST00000298428.9	37	c.683	CCDS7088.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.755200	0.96898	.	.	ENSG00000065665	ENST00000379033;ENST00000441368;ENST00000298428;ENST00000304267;ENST00000379020	.	.	.	6.07	6.07	0.98685	SecY subunit domain (2);	0.000000	0.56097	D	0.000025	T	0.68274	0.2983	M	0.84948	2.725	0.80722	D	1	B;P;P	0.50943	0.161;0.848;0.94	B;B;B	0.41036	0.131;0.346;0.342	T	0.69727	-0.5067	9	0.25751	T	0.34	-4.7081	19.6321	0.95713	0.0:0.0:1.0:0.0	.	206;228;228	F8W773;Q9H9S3-2;Q9H9S3	.;.;S61A2_HUMAN	Q	206;140;228;228;228	.	ENSP00000298428:R228Q	R	+	2	0	SEC61A2	12238978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.884000	0.98904	0.655000	0.94253	CGA	SEC61A2	-	pfam_SecY/SEC61-alpha,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha		0.443	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A2	HGNC	protein_coding	OTTHUMT00000046795.1	G	NM_018144		12198972	+1	no_errors	ENST00000298428	ensembl	human	known	70_37	missense	SNP	1.000	A
SEC61A2	55176	genome.wustl.edu	37	10	12198972	12198972	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:12198972G>A	ENST00000298428.9	+	8	772	c.683G>A	c.(682-684)cGa>cAa	p.R228Q	SEC61A2_ENST00000379020.4_Missense_Mutation_p.R228Q|SEC61A2_ENST00000379033.3_Missense_Mutation_p.R206Q|SEC61A2_ENST00000304267.8_Missense_Mutation_p.R228Q|SEC61A2_ENST00000495368.1_3'UTR	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)	228					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)	p.R228Q(2)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				GACAAAGTCCGAGCTTTACGG	0.443																																																	2	Substitution - Missense(2)	cervix(2)											190.0	177.0	181.0					10																	12198972		2203	4300	6503	SO:0001583	missense	55176			AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.683G>A	10.37:g.12198972G>A	ENSP00000298428:p.Arg228Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8D0|B4DX72|F8W773	Missense_Mutation	SNP	pfam_SecY/SEC61-alpha,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	p.R228Q	ENST00000298428.9	37	c.683	CCDS7088.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.755200	0.96898	.	.	ENSG00000065665	ENST00000379033;ENST00000441368;ENST00000298428;ENST00000304267;ENST00000379020	.	.	.	6.07	6.07	0.98685	SecY subunit domain (2);	0.000000	0.56097	D	0.000025	T	0.68274	0.2983	M	0.84948	2.725	0.80722	D	1	B;P;P	0.50943	0.161;0.848;0.94	B;B;B	0.41036	0.131;0.346;0.342	T	0.69727	-0.5067	9	0.25751	T	0.34	-4.7081	19.6321	0.95713	0.0:0.0:1.0:0.0	.	206;228;228	F8W773;Q9H9S3-2;Q9H9S3	.;.;S61A2_HUMAN	Q	206;140;228;228;228	.	ENSP00000298428:R228Q	R	+	2	0	SEC61A2	12238978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.884000	0.98904	0.655000	0.94253	CGA	SEC61A2	-	pfam_SecY/SEC61-alpha,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha		0.443	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A2	HGNC	protein_coding	OTTHUMT00000046795.1	G	NM_018144		12198972	+1	no_errors	ENST00000298428	ensembl	human	known	70_37	missense	SNP	1.000	A
SECISBP2	79048	genome.wustl.edu	37	9	91939384	91939384	+	Intron	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:91939384C>T	ENST00000375807.3	+	3	253				SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000339901.4_Intron|SECISBP2_ENST00000534113.2_Intron	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2						translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						AAGCAGTAAACGTTATTATAT	0.323																																																	0																																										SO:0001627	intron_variant	79048			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.183-958C>T	9.37:g.91939384C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	RNA	SNP	-	NULL	ENST00000375807.3	37	NULL	CCDS6683.1	9																																																																																			SECISBP2	-	-		0.323	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	HGNC	protein_coding	OTTHUMT00000052990.3	C	NM_024077		91939384	+1	no_errors	ENST00000470305	ensembl	human	known	70_37	rna	SNP	0.003	T
SLC25A1	6576	genome.wustl.edu	37	22	19165323	19165323	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:19165323C>T	ENST00000215882.5	-	4	514	c.358G>A	c.(358-360)Gac>Aac	p.D120N	SLC25A1_ENST00000461267.1_5'UTR|CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000451283.1_Missense_Mutation_p.D17N	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	120					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)	p.D120N(1)		cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CGCGTGCTGTCCAGCCGTCCC	0.701																																																	1	Substitution - Missense(1)	cervix(1)											19.0	21.0	20.0					22																	19165323		2198	4291	6489	SO:0001583	missense	6576			U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.358G>A	22.37:g.19165323C>T	ENSP00000215882:p.Asp120Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8E8|Q9BSK6	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.D120N	ENST00000215882.5	37	c.358	CCDS13758.1	22	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266271	0.59540	.	.	ENSG00000100075	ENST00000215882;ENST00000451283	T;T	0.77750	-1.12;-1.12	4.31	3.26	0.37387	Mitochondrial carrier domain (2);	0.098316	0.64402	D	0.000002	T	0.65196	0.2668	N	0.25380	0.74	0.58432	D	0.999997	B;B	0.09022	0.002;0.001	B;B	0.15052	0.012;0.008	T	0.63932	-0.6525	10	0.42905	T	0.14	-9.1507	12.6471	0.56742	0.0:0.9171:0.0:0.0829	.	127;120	D9HTE9;P53007	.;TXTP_HUMAN	N	120;17	ENSP00000215882:D120N;ENSP00000401480:D17N	ENSP00000215882:D120N	D	-	1	0	SLC25A1	17545323	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	2.329000	0.43876	2.210000	0.71456	0.491000	0.48974	GAC	SLC25A1	-	superfamily_Mt_carrier_dom		0.701	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A1	HGNC	protein_coding	OTTHUMT00000316441.1	C	NM_005984		19165323	-1	no_errors	ENST00000215882	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC25A1	6576	genome.wustl.edu	37	22	19165323	19165323	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:19165323C>T	ENST00000215882.5	-	4	514	c.358G>A	c.(358-360)Gac>Aac	p.D120N	SLC25A1_ENST00000461267.1_5'UTR|CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000451283.1_Missense_Mutation_p.D17N	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	120					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)	p.D120N(1)		cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CGCGTGCTGTCCAGCCGTCCC	0.701																																																	1	Substitution - Missense(1)	cervix(1)											19.0	21.0	20.0					22																	19165323		2198	4291	6489	SO:0001583	missense	6576			U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.358G>A	22.37:g.19165323C>T	ENSP00000215882:p.Asp120Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8E8|Q9BSK6	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.D120N	ENST00000215882.5	37	c.358	CCDS13758.1	22	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266271	0.59540	.	.	ENSG00000100075	ENST00000215882;ENST00000451283	T;T	0.77750	-1.12;-1.12	4.31	3.26	0.37387	Mitochondrial carrier domain (2);	0.098316	0.64402	D	0.000002	T	0.65196	0.2668	N	0.25380	0.74	0.58432	D	0.999997	B;B	0.09022	0.002;0.001	B;B	0.15052	0.012;0.008	T	0.63932	-0.6525	10	0.42905	T	0.14	-9.1507	12.6471	0.56742	0.0:0.9171:0.0:0.0829	.	127;120	D9HTE9;P53007	.;TXTP_HUMAN	N	120;17	ENSP00000215882:D120N;ENSP00000401480:D17N	ENSP00000215882:D120N	D	-	1	0	SLC25A1	17545323	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	2.329000	0.43876	2.210000	0.71456	0.491000	0.48974	GAC	SLC25A1	-	superfamily_Mt_carrier_dom		0.701	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A1	HGNC	protein_coding	OTTHUMT00000316441.1	C	NM_005984		19165323	-1	no_errors	ENST00000215882	ensembl	human	known	70_37	missense	SNP	1.000	T
SEZ6L	23544	genome.wustl.edu	37	22	26565671	26565671	+	Silent	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr22:26565671C>T	ENST00000248933.6	+	1	131	c.36C>T	c.(34-36)cgC>cgT	p.R12R	SEZ6L_ENST00000404234.3_Silent_p.R12R|SEZ6L_ENST00000360929.3_Silent_p.R12R|SEZ6L_ENST00000343706.4_Silent_p.R12R|SEZ6L_ENST00000529632.2_Silent_p.R12R			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	12					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CGGGACTCCGCGGGATCTCGC	0.786																																																	0													1.0	1.0	1.0					22																	26565671		642	1494	2136	SO:0001819	synonymous_variant	23544			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.36C>T	22.37:g.26565671C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.R12	ENST00000248933.6	37	c.36	CCDS13833.1	22																																																																																			SEZ6L	-	NULL		0.786	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	C			26565671	+1	no_errors	ENST00000248933	ensembl	human	known	70_37	silent	SNP	0.066	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965389	18965389	+	lincRNA	SNP	C	C	T	rs200849137		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:18965389C>T	ENST00000363359.1	+	0	165				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		cattgatgatcgttcttctct	0.537																																																	0								C		0,1726		0,0,863	40.0	17.0	24.0				0.1	17		24	1,3377		0,1,1688	no	intergenic				0,1,2551	TT,TC,CC		0.0296,0.0,0.0196			18965389	1,5103	863	1689	2552			26851			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965389C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			SNORD3B-1	-	-		0.537	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	HGNC	lincRNA		C	NR_003271		18965389	+1	no_errors	ENST00000363359	ensembl	human	known	70_37	rna	SNP	0.075	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965389	18965389	+	lincRNA	SNP	C	C	T	rs200849137		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:18965389C>T	ENST00000363359.1	+	0	165				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		cattgatgatcgttcttctct	0.537																																																	0								C		0,1726		0,0,863	40.0	17.0	24.0				0.1	17		24	1,3377		0,1,1688	no	intergenic				0,1,2551	TT,TC,CC		0.0296,0.0,0.0196			18965389	1,5103	863	1689	2552			26851			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965389C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			SNORD3B-1	-	-		0.537	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	HGNC	lincRNA		C	NR_003271		18965389	+1	no_errors	ENST00000363359	ensembl	human	known	70_37	rna	SNP	0.075	T
SNORD3D	780854	genome.wustl.edu	37	17	19015785	19015785	+	lincRNA	SNP	G	G	A	rs534577893		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:19015785G>A	ENST00000362793.1	-	0	164									small nucleolar RNA, C/D box 3D																		agagaagaacgatcatcaatg	0.537																																																	0													9.0	14.0	12.0					17																	19015785		844	1954	2798			780854					17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015785G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			SNORD3D	-	-		0.537	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	HGNC	lincRNA		G	NR_006882		19015785	-1	no_errors	ENST00000362793	ensembl	human	known	70_37	rna	SNP	0.037	A
SNORD1C	677850	genome.wustl.edu	37	17	74554514	74554514	+	RNA	SNP	G	G	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:74554514G>T	ENST00000589963.1	-	0	0				SNORD1B_ENST00000363091.1_RNA|RP11-666A8.8_ENST00000592622.1_RNA|SNHG16_ENST00000363315.1_RNA|RP11-666A8.8_ENST00000591967.1_RNA																							CAGGTTGAAGGATCAGAGTAA	0.488																																																	0																																												100507246																															17.37:g.74554514G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000589963.1	37	NULL		17																																																																																			SNHG16	-	-		0.488	RP11-666A8.8-001	KNOWN	basic	antisense	SNHG16	HGNC	antisense	OTTHUMT00000450606.1	G			74554514	+1	no_errors	ENST00000586846	ensembl	human	known	70_37	rna	SNP	0.000	T
TBC1D10C	374403	genome.wustl.edu	37	11	67177148	67177149	+	Frame_Shift_Ins	INS	-	-	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:67177148_67177149insG	ENST00000542590.1	+	9	1278_1279	c.1264_1265insG	c.(1264-1266)cggfs	p.R422fs	TBC1D10C_ENST00000312390.5_Frame_Shift_Ins_p.R422fs|TBC1D10C_ENST00000526387.1_3'UTR			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	422	Interaction with calcineurin.				retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GCTCCTGACTCGGGCCCGGGGC	0.698																																																	0										34,3566		0,34,1766						3.0	1.0			10	68,7198		4,60,3569	no	frameshift	TBC1D10C	NM_198517.2		4,94,5335	A1A1,A1R,RR		0.9359,0.9444,0.9387				102,10764				SO:0001589	frameshift_variant	374403			BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.1267dupG	11.37:g.67177151_67177151dupG	ENSP00000443654:p.Arg422fs	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V1D6	Frame_Shift_Ins	INS	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A423fs	ENST00000542590.1	37	c.1264_1265	CCDS8162.1	11																																																																																			TBC1D10C	-	NULL		0.698	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10C	HGNC	protein_coding	OTTHUMT00000395492.2	-	NM_198517		67177149	+1	no_errors	ENST00000312390	ensembl	human	known	70_37	frame_shift_ins	INS	0.951:0.936	G
TENM4	26011	genome.wustl.edu	37	11	79151904	79151905	+	5'Flank	INS	-	-	GT	rs71050222|rs376495468|rs61884097|rs149799566	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:79151904_79151905insGT	ENST00000278550.7	-	0	0					NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4						cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										cgcgtgtgtgagtgtgtgtgtg	0.639														2283	0.455871	0.4622	0.4769	5008	,	,		10952	0.4365		0.4821	False		,,,				2504	0.4254																0																																										SO:0001631	upstream_gene_variant	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022			11.37:g.79151913_79151914dupGT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	RNA	INS	-	NULL	ENST00000278550.7	37	NULL	CCDS44688.1	11																																																																																			TENM4	-	-		0.639	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-			79151905	-1	no_errors	ENST00000531583	ensembl	human	known	70_37	rna	INS	0.072:0.244	GT
TMCO6	55374	genome.wustl.edu	37	5	140021374	140021374	+	Intron	DEL	G	G	-			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:140021374delG	ENST00000394671.3	+	3	415				NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000537378.1_Intron|TMCO6_ENST00000252100.6_Intron|TMCO6_ENST00000511410.1_Frame_Shift_Del_p.W108fs	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6						protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGTCAGTGTGGATGGTGTGG	0.597																																																	0													37.0	40.0	39.0					5																	140021374		2091	4227	6318	SO:0001627	intron_variant	55374			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.314+9G>-	5.37:g.140021374delG		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUU0|Q9P198	Frame_Shift_Del	DEL	superfamily_ARM-type_fold,pfscan_Importin-a_IBB	p.W108fs	ENST00000394671.3	37	c.323	CCDS4233.2	5																																																																																			TMCO6	-	NULL		0.597	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	G	NM_018502		140021374	+1	no_errors	ENST00000511410	ensembl	human	putative	70_37	frame_shift_del	DEL	0.005	-
TMEM132E	124842	genome.wustl.edu	37	17	32956104	32956104	+	Missense_Mutation	SNP	C	C	T	rs371393529		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:32956104C>T	ENST00000321639.5	+	5	1277	c.949C>T	c.(949-951)Cgg>Tgg	p.R317W		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	317						integral component of membrane (GO:0016021)		p.R317W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCAGTCAAGCGGAGGATCAT	0.612																																																	1	Substitution - Missense(1)	cervix(1)							TRP/ARG	0,4406		0,0,2203	100.0	93.0	95.0		949	3.5	1.0	17		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMEM132E	NM_207313.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	317/985	32956104	1,13005	2203	4300	6503	SO:0001583	missense	124842			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.949C>T	17.37:g.32956104C>T	ENSP00000316532:p.Arg317Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.R317W	ENST00000321639.5	37	c.949	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	c	13.27	2.187608	0.38609	0.0	1.16E-4	ENSG00000181291	ENST00000321639	T	0.19532	2.14	4.51	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	M	0.65975	2.015	0.51233	D	0.999917	D	0.89917	1.0	D	0.91635	0.999	T	0.35943	-0.9768	10	0.72032	D	0.01	-29.8251	11.4588	0.50197	0.3265:0.6735:0.0:0.0	.	317	Q6IEE7	T132E_HUMAN	W	317	ENSP00000316532:R317W	ENSP00000316532:R317W	R	+	1	2	TMEM132E	29980217	0.995000	0.38212	0.984000	0.44739	0.044000	0.14063	1.296000	0.33389	1.236000	0.43740	0.447000	0.29281	CGG	TMEM132E	-	NULL		0.612	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	C	NM_207313		32956104	+1	no_errors	ENST00000321639	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM132E	124842	genome.wustl.edu	37	17	32956104	32956104	+	Missense_Mutation	SNP	C	C	T	rs371393529		TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr17:32956104C>T	ENST00000321639.5	+	5	1277	c.949C>T	c.(949-951)Cgg>Tgg	p.R317W		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	317						integral component of membrane (GO:0016021)		p.R317W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCAGTCAAGCGGAGGATCAT	0.612																																																	1	Substitution - Missense(1)	cervix(1)							TRP/ARG	0,4406		0,0,2203	100.0	93.0	95.0		949	3.5	1.0	17		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMEM132E	NM_207313.1	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	317/985	32956104	1,13005	2203	4300	6503	SO:0001583	missense	124842			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.949C>T	17.37:g.32956104C>T	ENSP00000316532:p.Arg317Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.R317W	ENST00000321639.5	37	c.949	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	c	13.27	2.187608	0.38609	0.0	1.16E-4	ENSG00000181291	ENST00000321639	T	0.19532	2.14	4.51	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	M	0.65975	2.015	0.51233	D	0.999917	D	0.89917	1.0	D	0.91635	0.999	T	0.35943	-0.9768	10	0.72032	D	0.01	-29.8251	11.4588	0.50197	0.3265:0.6735:0.0:0.0	.	317	Q6IEE7	T132E_HUMAN	W	317	ENSP00000316532:R317W	ENSP00000316532:R317W	R	+	1	2	TMEM132E	29980217	0.995000	0.38212	0.984000	0.44739	0.044000	0.14063	1.296000	0.33389	1.236000	0.43740	0.447000	0.29281	CGG	TMEM132E	-	NULL		0.612	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	C	NM_207313		32956104	+1	no_errors	ENST00000321639	ensembl	human	known	70_37	missense	SNP	1.000	T
TMLHE	55217	genome.wustl.edu	37	X	154842494	154842494	+	5'UTR	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chrX:154842494G>A	ENST00000334398.3	-	0	103				TMLHE-AS1_ENST00000452506.1_RNA|TMLHE_ENST00000461075.1_5'UTR|TMLHE_ENST00000369439.4_5'UTR	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon						carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)			breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	AGAGTGGGCAGAATTCCAAGC	0.632																																																	0																																										SO:0001623	5_prime_UTR_variant	55217			AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.-43C>T	X.37:g.154842494G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	RNA	SNP	-	NULL	ENST00000334398.3	37	NULL	CCDS14768.1	X																																																																																			TMLHE	-	-		0.632	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMLHE	HGNC	protein_coding	OTTHUMT00000058817.1	G	NM_018196		154842494	-1	no_errors	ENST00000461075	ensembl	human	known	70_37	rna	SNP	0.001	A
TOPORS	10210	genome.wustl.edu	37	9	32551295	32551295	+	Intron	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr9:32551295C>A	ENST00000360538.2	-	2	120				TOPORS-AS1_ENST00000425533.1_RNA|TOPORS_ENST00000379858.1_Intron|TOPORS-AS1_ENST00000458036.1_RNA|TOPORS-AS1_ENST00000453396.1_RNA|TOPORS-AS1_ENST00000450093.1_RNA|TOPORS-AS1_ENST00000540066.1_RNA	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CCAAACTCTGCGGAAACTTAG	0.473																																																	0																																										SO:0001627	intron_variant	100129250			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.4-329G>T	9.37:g.32551295C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O43273|Q6P987|Q9NS55|Q9UNR9	RNA	SNP	-	NULL	ENST00000360538.2	37	NULL	CCDS6527.1	9																																																																																			TOPORS-AS1	-	-		0.473	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS-AS1	HGNC	protein_coding	OTTHUMT00000052007.1	C	NM_005802		32551295	+1	no_errors	ENST00000453396	ensembl	human	known	70_37	rna	SNP	0.000	A
TP73	7161	genome.wustl.edu	37	1	3653920	3653920	+	IGR	SNP	T	T	C			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:3653920T>C	ENST00000378295.4	+	0	5188				TP73-AS1_ENST00000423764.1_RNA|TP73-AS1_ENST00000419973.1_RNA|TP73-AS1_ENST00000608600.1_RNA|TP73-AS1_ENST00000587071.1_RNA|TP73-AS1_ENST00000418088.1_RNA|TP73-AS1_ENST00000452079.1_RNA	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73						activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		GGCTGCAAAATGGAAAGGAGA	0.537																																																	0																																										SO:0001628	intergenic_variant	57212			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610		1.37:g.3653920T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	RNA	SNP	-	NULL	ENST00000378295.4	37	NULL	CCDS49.1	1																																																																																			TP73-AS1	-	-		0.537	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73-AS1	HGNC	protein_coding	OTTHUMT00000001468.4	T	NM_005427		3653920	-1	no_errors	ENST00000418088	ensembl	human	known	70_37	rna	SNP	0.000	C
TPR	7175	genome.wustl.edu	37	1	186295304	186295304	+	Missense_Mutation	SNP	C	C	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:186295304C>A	ENST00000367478.4	-	41	6249	c.5953G>T	c.(5953-5955)Ggt>Tgt	p.G1985C		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1985					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ctatcttcaccctcatcTCCC	0.403			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0													137.0	137.0	137.0					1																	186295304		2087	4219	6306	SO:0001583	missense	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5953G>T	1.37:g.186295304C>A	ENSP00000356448:p.Gly1985Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.G1985C	ENST00000367478.4	37	c.5953	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025170	0.75390	.	.	ENSG00000047410	ENST00000367478	T	0.28666	1.6	4.27	4.27	0.50696	.	0.195693	0.53938	D	0.000048	T	0.40767	0.1130	M	0.61703	1.905	0.58432	D	0.999994	D	0.56746	0.977	P	0.48368	0.575	T	0.41070	-0.9529	10	0.51188	T	0.08	.	17.6148	0.88064	0.0:1.0:0.0:0.0	.	1985	P12270	TPR_HUMAN	C	1985	ENSP00000356448:G1985C	ENSP00000356448:G1985C	G	-	1	0	TPR	184561927	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.080000	0.50112	2.660000	0.90430	0.655000	0.94253	GGT	TPR	-	NULL		0.403	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	C	NM_003292		186295304	-1	no_errors	ENST00000367478	ensembl	human	known	70_37	missense	SNP	1.000	A
TTC3	7267	genome.wustl.edu	37	21	38445615	38445616	+	5'UTR	INS	-	-	GCT	rs377605725|rs113166620|rs16998912|rs34786501|rs71328547	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr21:38445615_38445616insGCT	ENST00000355666.1	+	0	45_46				PIGP_ENST00000360525.4_5'Flank|PIGP_ENST00000329667.3_5'Flank|TTC3_ENST00000540756.1_5'UTR|PIGP_ENST00000399103.1_5'Flank|TTC3_ENST00000399010.1_5'UTR|PIGP_ENST00000464265.1_5'Flank|PIGP_ENST00000399102.1_5'Flank|PIGP_ENST00000399098.1_5'Flank	NM_001001894.1	NP_001001894.1	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				cggcggcggcggcTGCTGCTGC	0.782														1913	0.381989	0.3147	0.3876	5008	,	,		7044	0.3313		0.5338	False		,,,				2504	0.365				Ovarian(38;194 1649 35661)												0																																										SO:0001623	5_prime_UTR_variant	7267			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000355666.1:c.-60->GCT	21.37:g.38445622_38445624dupGCT		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	RNA	INS	-	NULL	ENST00000355666.1	37	NULL	CCDS13651.1	21																																																																																			TTC3	-	-		0.782	TTC3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	-			38445616	+1	no_errors	ENST00000463216	ensembl	human	known	70_37	rna	INS	0.000:0.001	GCT
VPS13D	55187	genome.wustl.edu	37	1	12570579	12570580	+	3'UTR	INS	-	-	TG	rs3831905|rs386353816|rs397731722|rs200052428	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:12570579_12570580insTG	ENST00000358136.3	+	0	14798_14799				VPS13D_ENST00000471923.1_3'UTR|VPS13D_ENST00000496628.1_3'UTR|VPS13D_ENST00000356315.4_3'UTR	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		gtgtctgtgtctgtgtgtgtgt	0.495														3120	0.623003	0.5802	0.6037	5008	,	,		18984	0.6409		0.6392	False		,,,				2504	0.6595																0																																										SO:0001624	3_prime_UTR_variant	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.*1502->TG	1.37:g.12570588_12570589dupTG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000358136.3	37	NULL	CCDS30588.1	1																																																																																			VPS13D	-	-		0.495	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	NM_015378		12570580	+1	no_errors	ENST00000496628	ensembl	human	known	70_37	rna	INS	0.000:0.000	TG
VSTM1	284415	genome.wustl.edu	37	19	54551654	54551654	+	Intron	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:54551654G>A	ENST00000338372.2	-	4	570				VSTM1_ENST00000425006.2_Missense_Mutation_p.A133V|VSTM1_ENST00000366170.2_Intron|VSTM1_ENST00000376626.1_Intron	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1						immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		acagacgtgagccactgcgcc	0.423																																																	0																																										SO:0001627	intron_variant	284415			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.394+3009C>T	19.37:g.54551654G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.A133V	ENST00000338372.2	37	c.398	CCDS12872.1	19	.	.	.	.	.	.	.	.	.	.	G	5.959	0.360880	0.11296	.	.	ENSG00000189068	ENST00000425006	T	0.00555	6.63	0.391	0.391	0.16282	.	.	.	.	.	T	0.00580	0.0019	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.49418	-0.8942	5	0.46703	T	0.11	.	.	.	.	.	.	.	.	V	133	ENSP00000413006:A133V	ENSP00000413006:A133V	A	-	2	0	VSTM1	59243466	0.016000	0.18221	0.010000	0.14722	0.020000	0.10135	0.362000	0.20284	0.452000	0.26830	0.460000	0.39030	GCT	VSTM1	-	NULL		0.423	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM1	HGNC	protein_coding	OTTHUMT00000139358.3	G	NM_198481		54551654	-1	no_errors	ENST00000425006	ensembl	human	known	70_37	missense	SNP	0.011	A
WDR7	23335	genome.wustl.edu	37	18	54605881	54605881	+	Missense_Mutation	SNP	A	A	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:54605881A>G	ENST00000254442.3	+	24	4160	c.3949A>G	c.(3949-3951)Atg>Gtg	p.M1317V	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.M1284V	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1317					hematopoietic progenitor cell differentiation (GO:0002244)			p.M1317V(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TATTGAAAAGATGCCCACAGA	0.353																																																	1	Substitution - Missense(1)	cervix(1)											93.0	88.0	90.0					18																	54605881		2203	4300	6503	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3949A>G	18.37:g.54605881A>G	ENSP00000254442:p.Met1317Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1317V	ENST00000254442.3	37	c.3949	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421491	0.83559	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.17213	2.29;2.29	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	L	0.57536	1.79	0.58432	D	0.999999	P;P	0.43578	0.811;0.713	P;P	0.60789	0.879;0.761	T	0.01460	-1.1349	10	0.38643	T	0.18	.	16.1557	0.81666	1.0:0.0:0.0:0.0	.	1284;1317	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	V	1317;1284;642;1284	ENSP00000254442:M1317V;ENSP00000350187:M1284V	ENSP00000254442:M1317V	M	+	1	0	WDR7	52756879	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.118000	0.94355	2.291000	0.77112	0.533000	0.62120	ATG	WDR7	-	superfamily_ARM-type_fold		0.353	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	A			54605881	+1	no_errors	ENST00000254442	ensembl	human	known	70_37	missense	SNP	1.000	G
WDR7	23335	genome.wustl.edu	37	18	54605881	54605881	+	Missense_Mutation	SNP	A	A	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr18:54605881A>G	ENST00000254442.3	+	24	4160	c.3949A>G	c.(3949-3951)Atg>Gtg	p.M1317V	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.M1284V	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1317					hematopoietic progenitor cell differentiation (GO:0002244)			p.M1317V(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TATTGAAAAGATGCCCACAGA	0.353																																																	1	Substitution - Missense(1)	cervix(1)											93.0	88.0	90.0					18																	54605881		2203	4300	6503	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3949A>G	18.37:g.54605881A>G	ENSP00000254442:p.Met1317Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1317V	ENST00000254442.3	37	c.3949	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421491	0.83559	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.17213	2.29;2.29	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	L	0.57536	1.79	0.58432	D	0.999999	P;P	0.43578	0.811;0.713	P;P	0.60789	0.879;0.761	T	0.01460	-1.1349	10	0.38643	T	0.18	.	16.1557	0.81666	1.0:0.0:0.0:0.0	.	1284;1317	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	V	1317;1284;642;1284	ENSP00000254442:M1317V;ENSP00000350187:M1284V	ENSP00000254442:M1317V	M	+	1	0	WDR7	52756879	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.118000	0.94355	2.291000	0.77112	0.533000	0.62120	ATG	WDR7	-	superfamily_ARM-type_fold		0.353	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	A			54605881	+1	no_errors	ENST00000254442	ensembl	human	known	70_37	missense	SNP	1.000	G
XYLB	9942	genome.wustl.edu	37	3	38411732	38411733	+	Intron	DEL	CA	CA	-	rs564435167	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr3:38411732_38411733delCA	ENST00000207870.3	+	9	855				XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		CACTGTAGCGcacacacacaca	0.5																																																	0																																										SO:0001627	intron_variant	9942			AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.765+67CA>-	3.37:g.38411742_38411743delCA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAW4|B4DDT2|B9EH64	RNA	DEL	-	NULL	ENST00000207870.3	37	NULL	CCDS2678.1	3																																																																																			XYLB	-	-		0.500	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	HGNC	protein_coding	OTTHUMT00000254062.2	CA	NM_005108		38411733	+1	no_errors	ENST00000487569	ensembl	human	putative	70_37	rna	DEL	0.000:0.000	-
ZDHHC11	79844	genome.wustl.edu	37	5	712139	712139	+	Intron	SNP	T	T	A	rs111351502	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr5:712139T>A	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR|ZDHHC11B_ENST00000508859.2_3'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562													t|||	2442	0.48762	0.5522	0.4683	5008	,	,		24038	0.5248		0.4911	False		,,,				2504	0.3722																0																																										SO:0001627	intron_variant	653082			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1140A>T	5.37:g.712139T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-		0.562	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		T	NM_024786		712139	-1	no_errors	ENST00000522356	ensembl	human	known	70_37	rna	SNP	0.000	A
ZMYM1	79830	genome.wustl.edu	37	1	35579239	35579239	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:35579239G>A	ENST00000373330.1	+	11	1982	c.1808G>A	c.(1807-1809)cGa>cAa	p.R603Q	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.R603Q			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	603						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R603Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAAACATTTCGACTTATGAAT	0.318																																																	1	Substitution - Missense(1)	cervix(1)											43.0	42.0	43.0					1																	35579239		1829	4066	5895	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1808G>A	1.37:g.35579239G>A	ENSP00000362427:p.Arg603Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_HATC,superfamily_RNaseH-like_dom,smart_TRASH	p.R603Q	ENST00000373330.1	37	c.1808	CCDS41302.1	1	.	.	.	.	.	.	.	.	.	.	G	3.170	-0.170222	0.06461	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.19532	2.4;2.14;2.4	4.44	-1.88	0.07713	.	0.540328	0.15615	N	0.253162	T	0.11110	0.0271	L	0.41236	1.265	0.09310	N	1	P;B	0.48834	0.916;0.12	B;B	0.35312	0.2;0.019	T	0.23691	-1.0181	9	.	.	.	-0.2192	5.9949	0.19489	0.5092:0.1394:0.3514:0.0	.	584;603	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	Q	603;528;603	ENSP00000352920:R603Q;ENSP00000362426:R528Q;ENSP00000362427:R603Q	.	R	+	2	0	ZMYM1	35351826	0.000000	0.05858	0.112000	0.21494	0.458000	0.32498	-0.385000	0.07379	-0.344000	0.08338	-0.218000	0.12543	CGA	ZMYM1	-	NULL		0.318	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	G	NM_024772		35579239	+1	no_errors	ENST00000359858	ensembl	human	known	70_37	missense	SNP	0.018	A
ZMYM1	79830	genome.wustl.edu	37	1	35579239	35579239	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr1:35579239G>A	ENST00000373330.1	+	11	1982	c.1808G>A	c.(1807-1809)cGa>cAa	p.R603Q	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.R603Q			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	603						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R603Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAAACATTTCGACTTATGAAT	0.318																																																	1	Substitution - Missense(1)	cervix(1)											43.0	42.0	43.0					1																	35579239		1829	4066	5895	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1808G>A	1.37:g.35579239G>A	ENSP00000362427:p.Arg603Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_HATC,superfamily_RNaseH-like_dom,smart_TRASH	p.R603Q	ENST00000373330.1	37	c.1808	CCDS41302.1	1	.	.	.	.	.	.	.	.	.	.	G	3.170	-0.170222	0.06461	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.19532	2.4;2.14;2.4	4.44	-1.88	0.07713	.	0.540328	0.15615	N	0.253162	T	0.11110	0.0271	L	0.41236	1.265	0.09310	N	1	P;B	0.48834	0.916;0.12	B;B	0.35312	0.2;0.019	T	0.23691	-1.0181	9	.	.	.	-0.2192	5.9949	0.19489	0.5092:0.1394:0.3514:0.0	.	584;603	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	Q	603;528;603	ENSP00000352920:R603Q;ENSP00000362426:R528Q;ENSP00000362427:R603Q	.	R	+	2	0	ZMYM1	35351826	0.000000	0.05858	0.112000	0.21494	0.458000	0.32498	-0.385000	0.07379	-0.344000	0.08338	-0.218000	0.12543	CGA	ZMYM1	-	NULL		0.318	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	G	NM_024772		35579239	+1	no_errors	ENST00000359858	ensembl	human	known	70_37	missense	SNP	0.018	A
ZNF202	7753	genome.wustl.edu	37	11	123611150	123611150	+	5'UTR	SNP	A	A	G			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr11:123611150A>G	ENST00000336139.4	-	0	216				ZNF202_ENST00000525391.1_5'UTR|ZNF202_ENST00000529691.1_Intron|ZNF202_ENST00000530393.1_5'UTR			O95125	ZN202_HUMAN	zinc finger protein 202						lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TCCTGGATCAAGCCCCACGGG	0.567																																																	0																																										SO:0001623	5_prime_UTR_variant	7753			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000336139.4:c.-147T>C	11.37:g.123611150A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	RNA	SNP	-	NULL	ENST00000336139.4	37	NULL	CCDS8443.1	11																																																																																			ZNF202	-	-		0.567	ZNF202-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387417.1	A	NM_003455		123611150	-1	no_errors	ENST00000525391	ensembl	human	known	70_37	rna	SNP	0.171	G
ZNF33A	7581	genome.wustl.edu	37	10	38343652	38343652	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:38343652G>A	ENST00000458705.2	+	5	755	c.597G>A	c.(595-597)ctG>ctA	p.L199L	ZNF33A_ENST00000307441.9_Silent_p.L199L|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Silent_p.L200L|ZNF33A_ENST00000432900.2_Silent_p.L206L			Q06730	ZN33A_HUMAN	zinc finger protein 33A	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L199L(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GGAACACACTGAGTCATCATG	0.348																																																	1	Substitution - coding silent(1)	cervix(1)											78.0	77.0	78.0					10																	38343652		2203	4300	6503	SO:0001819	synonymous_variant	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.597G>A	10.37:g.38343652G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L206	ENST00000458705.2	37	c.618	CCDS31182.1	10																																																																																			ZNF33A	-	NULL		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	G	NM_006974		38343652	+1	no_errors	ENST00000432900	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF33A	7581	genome.wustl.edu	37	10	38343652	38343652	+	Silent	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:38343652G>A	ENST00000458705.2	+	5	755	c.597G>A	c.(595-597)ctG>ctA	p.L199L	ZNF33A_ENST00000307441.9_Silent_p.L199L|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Silent_p.L200L|ZNF33A_ENST00000432900.2_Silent_p.L206L			Q06730	ZN33A_HUMAN	zinc finger protein 33A	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L199L(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GGAACACACTGAGTCATCATG	0.348																																																	1	Substitution - coding silent(1)	cervix(1)											78.0	77.0	78.0					10																	38343652		2203	4300	6503	SO:0001819	synonymous_variant	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.597G>A	10.37:g.38343652G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L206	ENST00000458705.2	37	c.618	CCDS31182.1	10																																																																																			ZNF33A	-	NULL		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	G	NM_006974		38343652	+1	no_errors	ENST00000432900	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF33A	7581	genome.wustl.edu	37	10	38343662	38343662	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:38343662G>A	ENST00000458705.2	+	5	765	c.607G>A	c.(607-609)Gag>Aag	p.E203K	ZNF33A_ENST00000307441.9_Missense_Mutation_p.E203K|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.E204K|ZNF33A_ENST00000432900.2_Missense_Mutation_p.E210K			Q06730	ZN33A_HUMAN	zinc finger protein 33A	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E203K(1)|p.E203Q(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GAGTCATCATGAGGAGACTTT	0.348																																																	2	Substitution - Missense(2)	cervix(1)|lung(1)											80.0	79.0	80.0					10																	38343662		2203	4300	6503	SO:0001583	missense	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.607G>A	10.37:g.38343662G>A	ENSP00000387713:p.Glu203Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E210K	ENST00000458705.2	37	c.628	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	9.336	1.061788	0.19987	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.05855	3.38;3.38;3.38;3.38	1.68	1.68	0.24146	.	0.676432	0.12138	N	0.496083	T	0.10981	0.0268	L	0.50333	1.59	0.09310	N	1	D;D;P	0.58620	0.973;0.983;0.909	P;P;P	0.51016	0.64;0.656;0.48	T	0.18681	-1.0329	10	0.49607	T	0.09	.	9.3384	0.38065	0.0:0.0:1.0:0.0	.	210;203;204	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	K	204;210;203;203	ENSP00000363747:E204K;ENSP00000402467:E210K;ENSP00000387713:E203K;ENSP00000304268:E203K	ENSP00000304268:E203K	E	+	1	0	ZNF33A	38383668	.	.	0.017000	0.16124	0.006000	0.05464	.	.	1.239000	0.43787	0.460000	0.39030	GAG	ZNF33A	-	NULL		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	G	NM_006974		38343662	+1	no_errors	ENST00000432900	ensembl	human	known	70_37	missense	SNP	0.005	A
ZNF33A	7581	genome.wustl.edu	37	10	38343662	38343662	+	Missense_Mutation	SNP	G	G	A			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr10:38343662G>A	ENST00000458705.2	+	5	765	c.607G>A	c.(607-609)Gag>Aag	p.E203K	ZNF33A_ENST00000307441.9_Missense_Mutation_p.E203K|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Missense_Mutation_p.E204K|ZNF33A_ENST00000432900.2_Missense_Mutation_p.E210K			Q06730	ZN33A_HUMAN	zinc finger protein 33A	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E203K(1)|p.E203Q(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GAGTCATCATGAGGAGACTTT	0.348																																																	2	Substitution - Missense(2)	cervix(1)|lung(1)											80.0	79.0	80.0					10																	38343662		2203	4300	6503	SO:0001583	missense	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.607G>A	10.37:g.38343662G>A	ENSP00000387713:p.Glu203Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E210K	ENST00000458705.2	37	c.628	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	9.336	1.061788	0.19987	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.05855	3.38;3.38;3.38;3.38	1.68	1.68	0.24146	.	0.676432	0.12138	N	0.496083	T	0.10981	0.0268	L	0.50333	1.59	0.09310	N	1	D;D;P	0.58620	0.973;0.983;0.909	P;P;P	0.51016	0.64;0.656;0.48	T	0.18681	-1.0329	10	0.49607	T	0.09	.	9.3384	0.38065	0.0:0.0:1.0:0.0	.	210;203;204	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	K	204;210;203;203	ENSP00000363747:E204K;ENSP00000402467:E210K;ENSP00000387713:E203K;ENSP00000304268:E203K	ENSP00000304268:E203K	E	+	1	0	ZNF33A	38383668	.	.	0.017000	0.16124	0.006000	0.05464	.	.	1.239000	0.43787	0.460000	0.39030	GAG	ZNF33A	-	NULL		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	G	NM_006974		38343662	+1	no_errors	ENST00000432900	ensembl	human	known	70_37	missense	SNP	0.005	A
ZNF493	284443	genome.wustl.edu	37	19	21607379	21607379	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:21607379C>T	ENST00000355504.4	+	2	1800	c.1534C>T	c.(1534-1536)Cgg>Tgg	p.R512W	ZNF493_ENST00000392288.2_Missense_Mutation_p.R640W|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R512W(1)|p.R640W(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AGCTTTTAAGCGGTCCTCACA	0.388																																																	2	Substitution - Missense(2)	cervix(2)											41.0	46.0	45.0					19																	21607379		2200	4293	6493	SO:0001583	missense	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1534C>T	19.37:g.21607379C>T	ENSP00000347691:p.Arg512Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R512W	ENST00000355504.4	37	c.1534	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	2.897	-0.228334	0.06022	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.07444	3.19;3.19	0.361	-0.721	0.11189	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06416	0.0165	L	0.41710	1.295	0.09310	N	1	B;B	0.16603	0.018;0.015	B;B	0.14023	0.01;0.001	T	0.39440	-0.9614	9	0.33141	T	0.24	.	4.7016	0.12830	0.0:0.5121:0.0:0.4879	.	512;640	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	W	640;512	ENSP00000376110:R640W;ENSP00000347691:R512W	ENSP00000347691:R512W	R	+	1	2	ZNF493	21399219	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.200000	0.03029	-0.487000	0.06735	-0.474000	0.04947	CGG	ZNF493	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1	C	NM_175910		21607379	+1	no_errors	ENST00000355504	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF493	284443	genome.wustl.edu	37	19	21607379	21607379	+	Missense_Mutation	SNP	C	C	T			TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:21607379C>T	ENST00000355504.4	+	2	1800	c.1534C>T	c.(1534-1536)Cgg>Tgg	p.R512W	ZNF493_ENST00000392288.2_Missense_Mutation_p.R640W|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R512W(1)|p.R640W(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AGCTTTTAAGCGGTCCTCACA	0.388																																																	2	Substitution - Missense(2)	cervix(2)											41.0	46.0	45.0					19																	21607379		2200	4293	6493	SO:0001583	missense	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1534C>T	19.37:g.21607379C>T	ENSP00000347691:p.Arg512Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R512W	ENST00000355504.4	37	c.1534	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	2.897	-0.228334	0.06022	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.07444	3.19;3.19	0.361	-0.721	0.11189	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06416	0.0165	L	0.41710	1.295	0.09310	N	1	B;B	0.16603	0.018;0.015	B;B	0.14023	0.01;0.001	T	0.39440	-0.9614	9	0.33141	T	0.24	.	4.7016	0.12830	0.0:0.5121:0.0:0.4879	.	512;640	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	W	640;512	ENSP00000376110:R640W;ENSP00000347691:R512W	ENSP00000347691:R512W	R	+	1	2	ZNF493	21399219	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.200000	0.03029	-0.487000	0.06735	-0.474000	0.04947	CGG	ZNF493	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1	C	NM_175910		21607379	+1	no_errors	ENST00000355504	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF765	91661	genome.wustl.edu	37	19	53926416	53926416	+	3'UTR	SNP	C	C	G	rs558899180	byFrequency	TCGA-EX-A1H5-01A-31D-A13W-08	TCGA-EX-A1H5-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	679411e8-ac8e-4d12-b15d-a2a3fac880c8	0a3a2d94-7e83-40a5-af85-0f76840a3037	g.chr19:53926416C>G	ENST00000594030.1	+	0	338							Q7L2R6	ZN765_HUMAN	zinc finger protein 765						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		TTAAAGGGAACGCCCCCAAGC	0.577													c|||	33	0.00658946	0.0227	0.0043	5008	,	,		17975	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	91661			BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000594030.1:c.*61C>G	19.37:g.53926416C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	NULL	p.N39K	ENST00000594030.1	37	c.117		19																																																																																			ZNF765	-	NULL		0.577	ZNF765-009	PUTATIVE	basic	protein_coding	ZNF765	HGNC	protein_coding	OTTHUMT00000464547.1	C	NM_138372		53926416	+1	no_errors	ENST00000507045	ensembl	human	known	70_37	missense	SNP	0.003	G
