#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACTL6A	86	genome.wustl.edu	37	3	179287873	179287873	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr3:179287873A>G	ENST00000429709.2	+	3	334	c.121A>G	c.(121-123)Att>Gtt	p.I41V	ACTL6A_ENST00000450518.2_5'UTR|ACTL6A_ENST00000392662.1_5'UTR	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	41					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			TCCTACAGCTATTGGTATGGT	0.378																																																	0													150.0	140.0	143.0					3																	179287873		2203	4300	6503	SO:0001583	missense	86			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.121A>G	3.37:g.179287873A>G	ENSP00000397552:p.Ile41Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.I41V	ENST00000429709.2	37	c.121	CCDS3231.1	3	.	.	.	.	.	.	.	.	.	.	A	5.805	0.332811	0.11013	.	.	ENSG00000136518	ENST00000429709	D	0.93547	-3.24	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.80336	0.4604	N	0.01618	-0.8	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.77670	-0.2501	10	0.02654	T	1	.	15.9692	0.79998	1.0:0.0:0.0:0.0	.	41	O96019	ACL6A_HUMAN	V	41	ENSP00000397552:I41V	ENSP00000397552:I41V	I	+	1	0	ACTL6A	180770567	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	5.961000	0.70356	2.162000	0.67917	0.528000	0.53228	ATT	ACTL6A	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like		0.378	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6A	HGNC	protein_coding	OTTHUMT00000349599.1	A	NM_004301		179287873	+1	no_errors	ENST00000429709	ensembl	human	known	70_37	missense	SNP	0.998	G
AGAP1	116987	genome.wustl.edu	37	2	236653346	236653346	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:236653346C>A	ENST00000304032.8	+	5	981	c.401C>A	c.(400-402)gCc>gAc	p.A134D	AGAP1_ENST00000336665.5_Missense_Mutation_p.A134D|AGAP1_ENST00000409457.1_Missense_Mutation_p.A134D|AGAP1_ENST00000428334.2_5'Flank|AGAP1_ENST00000409538.1_Missense_Mutation_p.A399D	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	134	Small GTPase-like.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CCCTAGTTTGCCATGTGGGTG	0.512																																																	0													144.0	133.0	136.0					2																	236653346		2203	4300	6503	SO:0001583	missense	116987			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.401C>A	2.37:g.236653346C>A	ENSP00000307634:p.Ala134Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.A134D	ENST00000304032.8	37	c.401	CCDS33408.1	2	.	.	.	.	.	.	.	.	.	.	C	19.66	3.870009	0.72065	.	.	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000402604;ENST00000409538	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.36	5.36	0.76844	Mitochondrial Rho-like (1);	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.951;0.998	D	0.84414	0.0567	10	0.87932	D	0	.	19.0839	0.93194	0.0:1.0:0.0:0.0	.	134;134	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	D	134;134;134;81;399	ENSP00000387174:A134D;ENSP00000307634:A134D;ENSP00000338378:A134D;ENSP00000385492:A81D;ENSP00000386897:A399D	ENSP00000307634:A134D	A	+	2	0	AGAP1	236318085	1.000000	0.71417	0.997000	0.53966	0.110000	0.19582	7.666000	0.83877	2.513000	0.84729	0.650000	0.86243	GCC	AGAP1	-	pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type		0.512	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	C	NM_014914		236653346	+1	no_errors	ENST00000304032	ensembl	human	known	70_37	missense	SNP	1.000	A
AGMAT	79814	genome.wustl.edu	37	1	15904321	15904321	+	Silent	SNP	C	C	T	rs149178480		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:15904321C>T	ENST00000375826.3	-	5	901	c.759G>A	c.(757-759)aaG>aaA	p.K253K	DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	253					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		GAACCAGCGACTTCATCCAGC	0.537																																					NSCLC(126;1678 1780 25805 43508 49531)												0								C		1,4405	2.1+/-5.4	0,1,2202	79.0	71.0	74.0		759	5.8	1.0	1	dbSNP_134	74	0,8600		0,0,4300	no	coding-synonymous	AGMAT	NM_024758.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		253/353	15904321	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79814			AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.759G>A	1.37:g.15904321C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TDH1|Q9H5J3	Silent	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	p.K253	ENST00000375826.3	37	c.759	CCDS160.1	1																																																																																			AGMAT	-	pfam_Ureohydrolase,tigrfam_Agmatinase-rel		0.537	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMAT	HGNC	protein_coding	OTTHUMT00000006763.1	C	NM_024758		15904321	-1	no_errors	ENST00000375826	ensembl	human	known	70_37	silent	SNP	1.000	T
ANKRD18B	441459	genome.wustl.edu	37	9	33541216	33541216	+	Missense_Mutation	SNP	G	G	C	rs111814125		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:33541216G>C	ENST00000290943.6	+	7	976	c.880G>C	c.(880-882)Ggt>Cgt	p.G294R		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	294								p.G294R(1)		NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						aagaaaagaaGGTGCAAAAGG	0.343																																																	1	Substitution - Missense(1)	prostate(1)																																								SO:0001583	missense	441459					9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.880G>C	9.37:g.33541216G>C	ENSP00000290943:p.Gly294Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G294R	ENST00000290943.6	37	c.880		9	.	.	.	.	.	.	.	.	.	.	g	0.030	-1.339649	0.01277	.	.	ENSG00000230453	ENST00000290943	T	0.26660	1.72	0.225	0.225	0.15325	.	.	.	.	.	T	0.18087	0.0434	.	.	.	0.23076	N	0.998333	.	.	.	.	.	.	T	0.34625	-0.9821	4	0.19147	T	0.46	.	.	.	.	.	.	.	.	R	294	ENSP00000290943:G294R	ENSP00000290943:G294R	G	+	1	0	ANKRD18B	33531216	0.013000	0.17824	0.008000	0.14137	0.008000	0.06430	0.337000	0.19841	0.300000	0.22699	0.305000	0.20034	GGT	ANKRD18B	-	NULL		0.343	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	G	XM_001718334		33541216	+1	no_errors	ENST00000290943	ensembl	human	known	70_37	missense	SNP	0.009	C
ANKRD36C	400986	genome.wustl.edu	37	2	96601243	96601243	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:96601243T>C	ENST00000456556.1	-	24	1778	c.1694A>G	c.(1693-1695)aAa>aGa	p.K565R				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	565							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CATGGCTGCTTTTGAACTGGG	0.338																																																	0																																										SO:0001583	missense	400986			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1694A>G	2.37:g.96601243T>C	ENSP00000403302:p.Lys565Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K565R	ENST00000456556.1	37	c.1694		2	.	.	.	.	.	.	.	.	.	.	-	9.240	1.037983	0.19669	.	.	ENSG00000174501	ENST00000456556	T	0.76448	-1.02	0.967	0.967	0.19674	.	.	.	.	.	T	0.46852	0.1414	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42344	-0.9457	6	0.02654	T	1	.	4.1465	0.10219	0.0:0.0:0.0:1.0	.	.	.	.	R	565	ENSP00000403302:K565R	ENSP00000403302:K565R	K	-	2	0	AC073995.2	95964970	0.001000	0.12720	0.001000	0.08648	0.055000	0.15305	0.915000	0.28638	0.687000	0.31509	0.148000	0.16107	AAA	ANKRD36C	-	NULL		0.338	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	T	NM_001010914		96601243	-1	no_errors	ENST00000456556	ensembl	human	known	70_37	missense	SNP	0.001	C
AP1B1	162	genome.wustl.edu	37	22	29727818	29727818	+	Silent	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr22:29727818C>T	ENST00000405198.1	-	17	2428	c.2397G>A	c.(2395-2397)acG>acA	p.T799T	AP1B1_ENST00000415447.1_Silent_p.T792T|AP1B1_ENST00000432560.2_Silent_p.T792T|AP1B1_ENST00000402502.1_Silent_p.T792T|AP1B1_ENST00000357586.2_Silent_p.T799T|AP1B1_ENST00000356015.2_Silent_p.T792T|SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000472057.1_5'UTR|AP1B1_ENST00000317368.7_Silent_p.T772T			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	799					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGAGCCCACCGTGCTGAGAG	0.667																																																	0													70.0	64.0	66.0					22																	29727818		2203	4300	6503	SO:0001819	synonymous_variant	162			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2397G>A	22.37:g.29727818C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu_1_2_4	p.T799	ENST00000405198.1	37	c.2397	CCDS13855.1	22																																																																																			AP1B1	-	pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig		0.667	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	C	NM_001127		29727818	-1	no_errors	ENST00000357586	ensembl	human	known	70_37	silent	SNP	0.016	T
ATR	545	genome.wustl.edu	37	3	142266662	142266662	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr3:142266662G>C	ENST00000350721.4	-	16	3383	c.3262C>G	c.(3262-3264)Caa>Gaa	p.Q1088E	ATR_ENST00000383101.3_Missense_Mutation_p.Q1024E	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1088					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AAAACCTGTTGATAGTGTTCT	0.398								Other conserved DNA damage response genes																																									0													113.0	110.0	111.0					3																	142266662		2203	4300	6503	SO:0001583	missense	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.3262C>G	3.37:g.142266662G>C	ENSP00000343741:p.Gln1088Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.Q1088E	ENST00000350721.4	37	c.3262	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097576	0.56075	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.03124	4.04;4.08	5.89	5.89	0.94794	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.03608	0.0103	N	0.24115	0.695	0.80722	D	1	B	0.27656	0.184	B	0.25614	0.062	T	0.43310	-0.9399	10	0.06494	T	0.89	-16.7092	20.2566	0.98424	0.0:0.0:1.0:0.0	.	1088	Q13535	ATR_HUMAN	E	1088;1024	ENSP00000343741:Q1088E;ENSP00000372581:Q1024E	ENSP00000343741:Q1088E	Q	-	1	0	ATR	143749352	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.675000	0.98638	2.793000	0.96121	0.561000	0.74099	CAA	ATR	-	superfamily_ARM-type_fold		0.398	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	G	NM_001184		142266662	-1	no_errors	ENST00000350721	ensembl	human	known	70_37	missense	SNP	1.000	C
CASZ1	54897	genome.wustl.edu	37	1	10720361	10720361	+	Silent	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:10720361G>A	ENST00000377022.3	-	6	1055	c.738C>T	c.(736-738)ctC>ctT	p.L246L	CASZ1_ENST00000344008.5_Silent_p.L246L|CASZ1_ENST00000478728.2_5'Flank	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	246					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CGCCAGCCTTGAGCTTGCGGA	0.687																																																	0													40.0	46.0	44.0					1																	10720361		2203	4300	6503	SO:0001819	synonymous_variant	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.738C>T	1.37:g.10720361G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L246	ENST00000377022.3	37	c.738	CCDS41246.1	1																																																																																			CASZ1	-	NULL		0.687	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	G	NM_017766		10720361	-1	no_errors	ENST00000377022	ensembl	human	known	70_37	silent	SNP	1.000	A
CELSR1	9620	genome.wustl.edu	37	22	46829324	46829325	+	Frame_Shift_Ins	INS	-	-	TG	rs371109251|rs377640697		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr22:46829324_46829325insTG	ENST00000262738.3	-	5	4575_4576	c.4576_4577insCA	c.(4576-4578)cggfs	p.R1526fs		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1526	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGAGTGCCACCGCCCGTCACTC	0.649																																																	0																																										SO:0001589	frameshift_variant	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4576_4577insCA	22.37:g.46829324_46829325insTG	ENSP00000262738:p.Arg1526fs	Somatic		WXS	Illumina HiSeq	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R1526fs	ENST00000262738.3	37	c.4577_4576	CCDS14076.1	22																																																																																			CELSR1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.649	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	-	NM_014246		46829325	-1	no_errors	ENST00000262738	ensembl	human	known	70_37	frame_shift_ins	INS	0.985:0.991	TG
CFP	5199	genome.wustl.edu	37	X	47486559	47486559	+	Silent	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:47486559G>A	ENST00000396992.3	-	5	867	c.747C>T	c.(745-747)acC>acT	p.T249T	CFP_ENST00000247153.3_Silent_p.T249T|CFP_ENST00000377005.2_Silent_p.T249T|CFP_ENST00000480317.1_5'Flank	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	249	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GTGGCAGGCCGGTGCACCTCC	0.612																																																	0													32.0	35.0	34.0					X																	47486559		2203	4298	6501	SO:0001819	synonymous_variant	5199			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.747C>T	X.37:g.47486559G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O15134|O15135|O15136|O75826	Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.T249	ENST00000396992.3	37	c.747	CCDS14282.1	X																																																																																			CFP	-	pfam_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.612	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2	G	NM_002621		47486559	-1	no_errors	ENST00000247153	ensembl	human	known	70_37	silent	SNP	0.025	A
COLEC11	78989	genome.wustl.edu	37	2	3691438	3691438	+	Silent	SNP	C	C	T	rs150837001		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:3691438C>T	ENST00000349077.4	+	7	649	c.546C>T	c.(544-546)gaC>gaT	p.D182D	COLEC11_ENST00000418971.2_Silent_p.D196D|COLEC11_ENST00000382062.2_Silent_p.D158D|COLEC11_ENST00000403096.3_Silent_p.D156D|COLEC11_ENST00000402794.1_Silent_p.D132D|COLEC11_ENST00000236693.7_Silent_p.D179D|COLEC11_ENST00000404205.1_Silent_p.D108D|COLEC11_ENST00000402922.1_Silent_p.D132D|COLEC11_ENST00000487365.1_3'UTR	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	182	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		TGCCCAAGGACGAGGCTGCCA	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		16291	0.0		0.0	False		,,,				2504	0.001																0								C	,	0,4406		0,0,2203	32.0	34.0	34.0		546,537	0.2	1.0	2	dbSNP_134	34	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	COLEC11	NM_024027.3,NM_199235.1	,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,	182/272,179/269	3691438	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	78989			BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.546C>T	2.37:g.3691438C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Silent	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D196	ENST00000349077.4	37	c.588	CCDS1649.1	2																																																																																			COLEC11	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.662	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC11	HGNC	protein_coding	OTTHUMT00000206666.1	C	NM_024027		3691438	+1	no_errors	ENST00000418971	ensembl	human	known	70_37	silent	SNP	0.997	T
DHPS	1725	genome.wustl.edu	37	19	12788010	12788010	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr19:12788010T>C	ENST00000210060.7	-	7	935	c.800A>G	c.(799-801)aAc>aGc	p.N267S	DHPS_ENST00000599481.1_5'Flank|DHPS_ENST00000351660.5_Intron|DHPS_ENST00000594424.1_Missense_Mutation_p.N225S	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	267					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						GGCCTGTGTGTTGATGAGCCT	0.607																																																	0													109.0	90.0	97.0					19																	12788010		2203	4300	6503	SO:0001583	missense	1725			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.800A>G	19.37:g.12788010T>C	ENSP00000210060:p.Asn267Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	p.N267S	ENST00000210060.7	37	c.800	CCDS12276.1	19	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065924	0.55539	.	.	ENSG00000095059	ENST00000210060	T	0.45668	0.89	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.64735	0.2625	M	0.81942	2.565	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.70234	-0.4928	10	0.87932	D	0	-29.8789	13.1023	0.59226	0.0:0.0:0.0:1.0	.	267	P49366	DHYS_HUMAN	S	267	ENSP00000210060:N267S	ENSP00000210060:N267S	N	-	2	0	DHPS	12649010	1.000000	0.71417	0.997000	0.53966	0.414000	0.31173	6.642000	0.74329	2.040000	0.60383	0.379000	0.24179	AAC	DHPS	-	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase		0.607	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHPS	HGNC	protein_coding	OTTHUMT00000462708.1	T	NM_001930		12788010	-1	no_errors	ENST00000210060	ensembl	human	known	70_37	missense	SNP	0.999	C
DLGAP3	58512	genome.wustl.edu	37	1	35370768	35370768	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:35370768G>A	ENST00000373347.1	-	3	485	c.217C>T	c.(217-219)Cct>Tct	p.P73S	DLGAP3_ENST00000495979.1_5'UTR|DLGAP3_ENST00000235180.4_Missense_Mutation_p.P73S			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	73					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCTCCCTCAGGGCCTACCGAC	0.687																																																	0													5.0	6.0	5.0					1																	35370768		2097	4152	6249	SO:0001583	missense	58512			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.217C>T	1.37:g.35370768G>A	ENSP00000362444:p.Pro73Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	pfam_GKAP	p.P73S	ENST00000373347.1	37	c.217	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719455	0.68844	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.26223	1.75;1.75	4.48	4.48	0.54585	.	0.428537	0.17201	N	0.183120	T	0.36358	0.0964	N	0.22421	0.69	0.51012	D	0.999906	D	0.76494	0.999	D	0.63957	0.92	T	0.27773	-1.0064	10	0.52906	T	0.07	-5.0872	17.1638	0.86810	0.0:0.0:1.0:0.0	.	73	O95886	DLGP3_HUMAN	S	73	ENSP00000362444:P73S;ENSP00000235180:P73S	ENSP00000235180:P73S	P	-	1	0	DLGAP3	35143355	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	2.948000	0.49066	2.048000	0.60808	0.448000	0.29417	CCT	DLGAP3	-	NULL		0.687	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	G	NM_021234		35370768	-1	no_errors	ENST00000235180	ensembl	human	known	70_37	missense	SNP	1.000	A
DOPEY2	9980	genome.wustl.edu	37	21	37602874	37602874	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr21:37602874C>G	ENST00000399151.3	+	14	1877	c.1792C>G	c.(1792-1794)Ccg>Gcg	p.P598A		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	598					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TGCCTCGTCACCGGAGCTCTC	0.532																																																	0													94.0	87.0	90.0					21																	37602874		2203	4300	6503	SO:0001583	missense	9980			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.1792C>G	21.37:g.37602874C>G	ENSP00000382104:p.Pro598Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.P598A	ENST00000399151.3	37	c.1792	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467112	0.63625	.	.	ENSG00000142197	ENST00000399151	T	0.11712	2.75	5.43	5.43	0.79202	.	0.054017	0.85682	D	0.000000	T	0.29223	0.0727	M	0.63843	1.955	0.51482	D	0.99992	D;D	0.67145	0.996;0.994	P;P	0.59643	0.861;0.729	T	0.00321	-1.1819	10	0.54805	T	0.06	.	19.589	0.95499	0.0:1.0:0.0:0.0	.	598;598	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	A	598	ENSP00000382104:P598A	ENSP00000382104:P598A	P	+	1	0	DOPEY2	36524744	1.000000	0.71417	0.087000	0.20705	0.596000	0.36781	5.586000	0.67503	2.709000	0.92574	0.491000	0.48974	CCG	DOPEY2	-	NULL		0.532	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	C	NM_005128		37602874	+1	no_errors	ENST00000399151	ensembl	human	known	70_37	missense	SNP	0.982	G
DPY19L1	23333	genome.wustl.edu	37	7	34979922	34979922	+	Silent	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr7:34979922A>G	ENST00000310974.4	-	19	1632	c.1488T>C	c.(1486-1488)ttT>ttC	p.F496F	MIR548N_ENST00000408742.1_RNA	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	496						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GTACTTTGCAAAAGAGCCATC	0.368																																																	0													73.0	62.0	66.0					7																	34979922		1858	4090	5948	SO:0001819	synonymous_variant	23333			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1488T>C	7.37:g.34979922A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O94954|Q4G151	Silent	SNP	pfam_Dpy-19	p.F496	ENST00000310974.4	37	c.1488	CCDS43567.1	7																																																																																			DPY19L1	-	pfam_Dpy-19		0.368	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L1	HGNC	protein_coding	OTTHUMT00000337506.1	A			34979922	-1	no_errors	ENST00000310974	ensembl	human	known	70_37	silent	SNP	0.814	G
DZANK1	55184	genome.wustl.edu	37	20	18445975	18445975	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr20:18445975G>C	ENST00000358866.6	-	1	50	c.28C>G	c.(28-30)Cag>Gag	p.Q10E	DZANK1_ENST00000262547.5_Missense_Mutation_p.Q10E|DZANK1_ENST00000357236.4_5'UTR|POLR3F_ENST00000377603.4_5'Flank|DZANK1_ENST00000329494.5_Missense_Mutation_p.Q10E			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	10							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						GGTATGATCTGAGGGACACAC	0.373																																																	0													103.0	92.0	96.0					20																	18445975		1902	4119	6021	SO:0001583	missense	55184			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.28C>G	20.37:g.18445975G>C	ENSP00000351734:p.Gln10Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.Q10E	ENST00000358866.6	37	c.28	CCDS46582.1	20	.	.	.	.	.	.	.	.	.	.	G	18.13	3.554587	0.65425	.	.	ENSG00000089091	ENST00000262547;ENST00000329494	T;T	0.64260	-0.09;0.58	5.53	5.53	0.82687	.	0.342769	0.19288	U	0.117979	T	0.78020	0.4218	M	0.61703	1.905	0.80722	D	1	D;P	0.69078	0.997;0.73	D;B	0.78314	0.991;0.147	T	0.78224	-0.2287	10	0.59425	D	0.04	-10.4566	18.2359	0.89949	0.0:0.0:1.0:0.0	.	10;10	B7Z631;Q9NVP4	.;DZAN1_HUMAN	E	10	ENSP00000262547:Q10E;ENSP00000328866:Q10E	ENSP00000262547:Q10E	Q	-	1	0	C20orf12	18393975	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.509000	0.67012	2.587000	0.87381	0.655000	0.94253	CAG	DZANK1	-	NULL		0.373	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	G	NM_001099407		18445975	-1	no_errors	ENST00000262547	ensembl	human	known	70_37	missense	SNP	1.000	C
ENPP3	5169	genome.wustl.edu	37	6	131997896	131997896	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:131997896G>T	ENST00000414305.1	+	11	1221	c.893G>T	c.(892-894)aGg>aTg	p.R298M	ENPP3_ENST00000427148.2_3'UTR|ENPP3_ENST00000358229.5_Missense_Mutation_p.R298M|ENPP3_ENST00000357639.3_Missense_Mutation_p.R298M			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	298	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TTTGAAGAGAGGATTTCTACA	0.343																																																	0													85.0	83.0	84.0					6																	131997896		2203	4300	6503	SO:0001583	missense	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.893G>T	6.37:g.131997896G>T	ENSP00000406261:p.Arg298Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JTL3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.R298M	ENST00000414305.1	37	c.893	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151932	0.78001	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	T;T;T	0.74737	-0.87;-0.87;-0.87	4.84	4.84	0.62591	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.64402	D	0.000002	D	0.90356	0.6982	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93691	0.7007	10	0.87932	D	0	-9.9276	17.0968	0.86637	0.0:0.0:1.0:0.0	.	298	O14638	ENPP3_HUMAN	M	298	ENSP00000406261:R298M;ENSP00000350265:R298M;ENSP00000350964:R298M	ENSP00000350265:R298M	R	+	2	0	ENPP3	132039589	1.000000	0.71417	0.398000	0.26321	0.081000	0.17604	7.958000	0.87877	2.401000	0.81631	0.549000	0.68633	AGG	ENPP3	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.343	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	G			131997896	+1	no_errors	ENST00000357639	ensembl	human	known	70_37	missense	SNP	0.966	T
RP11-211N8.2	0	genome.wustl.edu	37	9	46844120	46844120	+	lincRNA	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:46844120C>T	ENST00000446626.2	+	0	342																											ATCCCAAACTCCCTCCTGCCA	0.602																																																	0																																												0																															9.37:g.46844120C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000446626.2	37	NULL		9																																																																																			RP11-211N8.2	-	-		0.602	RP11-211N8.2-001	KNOWN	basic	lincRNA	ENSG00000226007	Clone_based_vega_gene	lincRNA	OTTHUMT00000036978.2	C			46844120	+1	no_errors	ENST00000446626	ensembl	human	known	70_37	rna	SNP	0.009	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400475	68400475	+	lincRNA	SNP	T	T	G	rs75317582	byFrequency	TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:68400475T>G	ENST00000417843.2	-	0	1344																											CAGGCCACAGTGTGGACtgtt	0.488																																																	0																																												0																															9.37:g.68400475T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-		0.488	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	T			68400475	-1	no_errors	ENST00000417843	ensembl	human	known	70_37	rna	SNP	0.010	G
LIMS1	3987	genome.wustl.edu	37	2	109293261	109293261	+	Intron	DEL	A	A	-			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:109293261delA	ENST00000393310.1	+	7	905				LIMS1_ENST00000409441.1_Intron|LIMS1_ENST00000544547.1_Intron|AC010095.5_ENST00000411710.1_RNA|LIMS1_ENST00000338045.3_Intron|LIMS1_ENST00000410093.1_Intron|LIMS1_ENST00000332345.6_Intron|LIMS1_ENST00000542845.1_Intron	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						TTCAGTAGAGATTTGTTTTTA	0.318																																																	0																																										SO:0001627	intron_variant	0				CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.738+107A>-	2.37:g.109293261delA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	RNA	DEL	-	NULL	ENST00000393310.1	37	NULL	CCDS2078.1	2																																																																																			AC010095.5	-	-		0.318	LIMS1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000228763	Clone_based_vega_gene	protein_coding	OTTHUMT00000253596.1	A	NM_004987		109293261	-1	no_errors	ENST00000411710	ensembl	human	known	70_37	rna	DEL	0.000	-
UMAD1	729852	genome.wustl.edu	37	7	7782128	7782128	+	Intron	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr7:7782128C>T	ENST00000469183.1	+	4	417				AC007161.5_ENST00000418534.2_lincRNA																							TCTTGGCCTTCGAAGCCTTCA	0.488																																																	0																																										SO:0001627	intron_variant	0																														ENST00000469183.1:c.418-59173C>T	7.37:g.7782128C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000469183.1	37	NULL		7																																																																																			AC007161.5	-	-		0.488	RPA3-AS1-002	KNOWN	basic	processed_transcript	ENSG00000234718	Clone_based_vega_gene	protein_coding	OTTHUMT00000324787.1	C			7782128	-1	no_errors	ENST00000418534	ensembl	human	known	70_37	rna	SNP	1.000	T
RP11-67H24.2	0	genome.wustl.edu	37	16	32822155	32822155	+	lincRNA	SNP	C	C	G	rs113338613		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr16:32822155C>G	ENST00000569859.1	+	0	356																											CACACCCGCTCCACAAATCCT	0.667																																																	0																																												0																															16.37:g.32822155C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000569859.1	37	NULL		16																																																																																			RP11-67H24.2	-	-		0.667	RP11-67H24.2-001	KNOWN	basic	lincRNA	ENSG00000260158	Clone_based_vega_gene	lincRNA	OTTHUMT00000432377.1	C			32822155	+1	no_errors	ENST00000569859	ensembl	human	known	70_37	rna	SNP	0.825	G
EP300	2033	genome.wustl.edu	37	22	41556727	41556727	+	Splice_Site	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr22:41556727G>A	ENST00000263253.7	+	20	4890		c.e20+1			NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300						apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.Y1198_L1243del(1)|p.?(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AGCCTCAAACGTAAGTAACTG	0.408			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	2	Unknown(1)|Deletion - In frame(1)	breast(1)|pancreas(1)											99.0	82.0	88.0					22																	41556727		2203	4300	6503	SO:0001630	splice_region_variant	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3671+1G>A	22.37:g.41556727G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Splice_Site	SNP	-	e20+1	ENST00000263253.7	37	c.3671+1	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729661	0.89390	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4278	0.94751	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EP300	39886673	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.595000	0.87683	0.557000	0.71058	.	EP300	-	-		0.408	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	G	NM_001429	Intron	41556727	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	splice_site	SNP	1.000	A
EPCAM	4072	genome.wustl.edu	37	2	47596298	47596298	+	5'UTR	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:47596298C>G	ENST00000263735.4	+	0	12				EPCAM_ENST00000405271.1_Silent_p.A28A	NM_002354.2	NP_002345.2	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule						negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|stem cell differentiation (GO:0048863)|ureteric bud development (GO:0001657)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein complex binding (GO:0032403)	p.0?(2)|p.?(1)		endometrium(3)|large_intestine(1)|liver(2)|lung(7)|skin(1)|stomach(1)	15						ACTGCAGCGCCGGGGCTGGGG	0.731																																																	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)																																								SO:0001623	5_prime_UTR_variant	4072			M33011	CCDS1833.1	2p21	2014-09-17	2008-12-16	2008-12-16	ENSG00000119888	ENSG00000119888		"""CD molecules"""	11529	protein-coding gene	gene with protein product		185535	"""antigen identified by monoclonal antibody AUA1"", ""tumor-associated calcium signal transducer 1"""	M4S1, MIC18, TACSTD1		8382772, 11306819	Standard	NM_002354		Approved	Ly74, TROP1, GA733-2, EGP34, EGP40, EGP-2, KSA, CD326, Ep-CAM, HEA125, KS1/4, MK-1, MH99, MOC31, 323/A3, 17-1A, TACST-1, CO-17A, ESA	uc002rvx.3	P16422	OTTHUMG00000128853	ENST00000263735.4:c.-347C>G	2.37:g.47596298C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	P18180|Q6FG26|Q6FG49|Q96C47|Q9UCD0	Silent	SNP	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.A28	ENST00000263735.4	37	c.84	CCDS1833.1	2																																																																																			EPCAM	-	NULL		0.731	EPCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPCAM	HGNC	protein_coding	OTTHUMT00000250792.2	C			47596298	+1	no_errors	ENST00000456133	ensembl	human	known	70_37	silent	SNP	0.000	G
FAM122C	159091	genome.wustl.edu	37	X	133941588	133941588	+	5'UTR	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:133941588G>A	ENST00000370784.4	+	0	366				FAM122C_ENST00000370785.3_5'UTR|FAM122C_ENST00000445123.1_5'UTR|FAM122C_ENST00000414371.2_Missense_Mutation_p.R23Q|FAM122C_ENST00000475361.1_3'UTR	NM_001170779.1	NP_001164250.1	Q6P4D5	F222C_HUMAN	family with sequence similarity 122C											endometrium(2)|kidney(1)|lung(2)	5	Acute lymphoblastic leukemia(192;0.000127)					TTGTGTGGACGGGAGCCGGAA	0.517																																																	0													78.0	73.0	75.0					X																	133941588		2203	4300	6503	SO:0001623	5_prime_UTR_variant	159091			BC017868	CCDS14644.1, CCDS55500.1, CCDS55501.1, CCDS76028.1	Xq26.3	2008-02-05	2006-07-11		ENSG00000156500	ENSG00000156500			25202	protein-coding gene	gene with protein product						12477932	Standard	NM_138819		Approved	RP3-473B4.1	uc004exz.2	Q6P4D5	OTTHUMG00000022716	ENST00000370784.4:c.-41G>A	X.37:g.133941588G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F5H036|Q8WVK9	Missense_Mutation	SNP	NULL	p.R23Q	ENST00000370784.4	37	c.68	CCDS55501.1	X	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383159	0.25031	.	.	ENSG00000156500	ENST00000414371	.	.	.	4.21	1.02	0.19986	.	.	.	.	.	T	0.09862	0.0242	N	0.03608	-0.345	0.18873	N	0.999986	B	0.28584	0.216	B	0.15870	0.014	T	0.24548	-1.0157	8	0.23891	T	0.37	.	2.3916	0.04379	0.3216:0.0:0.4432:0.2352	.	23	F5H036	.	Q	23	.	ENSP00000402477:R23Q	R	+	2	0	FAM122C	133769254	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.004000	0.13106	-0.020000	0.14032	-0.213000	0.12676	CGG	FAM122C	-	NULL		0.517	FAM122C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM122C	HGNC	protein_coding		G	NM_138819		133941588	+1	no_errors	ENST00000414371	ensembl	human	known	70_37	missense	SNP	0.000	A
FANCM	57697	genome.wustl.edu	37	14	45620690	45620690	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:45620690G>T	ENST00000267430.5	+	5	1094	c.1009G>T	c.(1009-1011)Gca>Tca	p.A337S	FANCM_ENST00000542564.2_Missense_Mutation_p.A311S|FANCM_ENST00000556036.1_Missense_Mutation_p.A337S	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	337					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GATAATTCTGGCAAGAGATCA	0.318								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													74.0	76.0	76.0					14																	45620690		2203	4299	6502	SO:0001583	missense	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1009G>T	14.37:g.45620690G>T	ENSP00000267430:p.Ala337Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A337S	ENST00000267430.5	37	c.1009	CCDS32070.1	14	.	.	.	.	.	.	.	.	.	.	G	15.94	2.982268	0.53827	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.14266	2.58;2.54;2.52	5.41	5.41	0.78517	.	0.163440	0.53938	D	0.000049	T	0.13713	0.0332	L	0.33093	0.98	0.44439	D	0.997361	B;B;B	0.33212	0.23;0.402;0.314	B;B;B	0.38458	0.253;0.168;0.274	T	0.11108	-1.0601	10	0.28530	T	0.3	.	13.724	0.62748	0.0:0.0:0.8458:0.1542	.	311;337;337	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	S	337;337;311	ENSP00000450596:A337S;ENSP00000267430:A337S;ENSP00000442493:A311S	ENSP00000267430:A337S	A	+	1	0	FANCM	44690440	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.388000	0.73195	2.524000	0.85096	0.655000	0.94253	GCA	FANCM	-	NULL		0.318	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	G	XM_048128		45620690	+1	no_errors	ENST00000267430	ensembl	human	known	70_37	missense	SNP	1.000	T
FAT2	2196	genome.wustl.edu	37	5	150947427	150947427	+	Missense_Mutation	SNP	T	T	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr5:150947427T>G	ENST00000261800.5	-	1	1078	c.1066A>C	c.(1066-1068)Aaa>Caa	p.K356Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	356					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGACAGTTTGGAAGGTGGT	0.542																																																	0													85.0	93.0	90.0					5																	150947427		2203	4300	6503	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1066A>C	5.37:g.150947427T>G	ENSP00000261800:p.Lys356Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.K356Q	ENST00000261800.5	37	c.1066	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	T	6.872	0.530213	0.13127	.	.	ENSG00000086570	ENST00000261800	T	0.71341	-0.56	5.49	-0.393	0.12438	.	0.813662	0.10975	N	0.613367	T	0.58278	0.2111	L	0.46614	1.455	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.47911	-0.9080	10	0.49607	T	0.09	.	5.113	0.14819	0.0:0.1897:0.2638:0.5465	.	356	Q9NYQ8	FAT2_HUMAN	Q	356	ENSP00000261800:K356Q	ENSP00000261800:K356Q	K	-	1	0	FAT2	150927620	0.003000	0.15002	0.001000	0.08648	0.446000	0.32137	0.756000	0.26419	-0.296000	0.08947	0.459000	0.35465	AAA	FAT2	-	NULL		0.542	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	T	NM_001447		150947427	-1	no_errors	ENST00000261800	ensembl	human	known	70_37	missense	SNP	0.003	G
FLJ33534	285150	genome.wustl.edu	37	2	11268861	11268861	+	lincRNA	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:11268861A>G	ENST00000396164.1	-	0	428					NR_040080.1																						GCACTGTGAGAGCAACACAGC	0.522																																																	0													169.0	144.0	152.0					2																	11268861		692	1591	2283			285150																															2.37:g.11268861A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000396164.1	37	NULL		2																																																																																			AC062028.1	-	-		0.522	AC062028.1-202	KNOWN	basic	lincRNA	FLJ33534	Clone_based_vega_gene	lincRNA		A			11268861	-1	no_errors	ENST00000396164	ensembl	human	known	70_37	rna	SNP	0.000	G
H6PD	9563	genome.wustl.edu	37	1	9324266	9324266	+	Missense_Mutation	SNP	G	G	A	rs565031451		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:9324266G>A	ENST00000377403.2	+	5	2016	c.1714G>A	c.(1714-1716)Gag>Aag	p.E572K	H6PD_ENST00000602477.1_Missense_Mutation_p.E583K	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	572	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		TAATGACATCGAGGCCACCGC	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		15611	0.0		0.0	False		,,,				2504	0.001																0													14.0	17.0	16.0					1																	9324266		2202	4294	6496	SO:0001583	missense	9563			AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1714G>A	1.37:g.9324266G>A	ENSP00000366620:p.Glu572Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,prints_G6P_DH,tigrfam_6-phosphogluconolactonase_DevB	p.E572K	ENST00000377403.2	37	c.1714	CCDS101.1	1	.	.	.	.	.	.	.	.	.	.	G	5.304	0.241386	0.10077	.	.	ENSG00000049239	ENST00000377403	T	0.42131	0.98	5.67	5.67	0.87782	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.105093	0.64402	D	0.000003	T	0.22126	0.0533	N	0.16307	0.4	0.41520	D	0.988396	P	0.45240	0.854	B	0.32149	0.141	T	0.09640	-1.0665	10	0.15066	T	0.55	-32.0135	14.387	0.66953	0.0:0.1474:0.8526:0.0	.	572	O95479	G6PE_HUMAN	K	572	ENSP00000366620:E572K	ENSP00000366620:E572K	E	+	1	0	H6PD	9246853	1.000000	0.71417	0.952000	0.39060	0.038000	0.13279	5.038000	0.64177	2.677000	0.91161	0.561000	0.74099	GAG	H6PD	-	tigrfam_6-phosphogluconolactonase_DevB		0.662	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H6PD	HGNC	protein_coding	OTTHUMT00000004928.2	G	NM_004285		9324266	+1	no_errors	ENST00000377403	ensembl	human	known	70_37	missense	SNP	0.996	A
HIST1H4F	8361	genome.wustl.edu	37	6	26240698	26240698	+	Silent	SNP	C	C	T	rs201737573		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:26240698C>T	ENST00000377745.2	+	1	138	c.45C>T	c.(43-45)ggC>ggT	p.G15G		NM_003540.3	NP_003531.1	P62805	H4_HUMAN	histone cluster 1, H4f	15					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GAAAGGGAGGCGCCAAGCGCC	0.542																																																	0													46.0	46.0	46.0					6																	26240698		2203	4300	6503	SO:0001819	synonymous_variant	8361			M60749	CCDS4598.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198327			"""Histones / Replication-dependent"""	4783	protein-coding gene	gene with protein product		602824	"""H4 histone family, member C"", ""histone 1, H4f"""	H4FC		1916825, 9119399, 12408966	Standard	NM_003540		Approved	H4/c, H4	uc003nhe.1	P62805	OTTHUMG00000014443	ENST00000377745.2:c.45C>T	6.37:g.26240698C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.G15	ENST00000377745.2	37	c.45	CCDS4598.1	6																																																																																			HIST1H4F	-	superfamily_Histone-fold,prints_Histone_H4		0.542	HIST1H4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4F	HGNC	protein_coding	OTTHUMT00000040106.1	C	NM_003540		26240698	+1	no_errors	ENST00000377745	ensembl	human	known	70_37	silent	SNP	0.999	T
HLA-B	3106	genome.wustl.edu	37	6	31323001	31323001	+	Splice_Site	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:31323001C>G	ENST00000412585.2	-	5	924		c.e5-1			NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GAAGACGGCTCTGGGAAAGGA	0.602									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0													60.0	61.0	61.0					6																	31323001		1511	2709	4220	SO:0001630	splice_region_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.896-1G>C	6.37:g.31323001C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q29764	Splice_Site	SNP	-	e5-1	ENST00000412585.2	37	c.896-1	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	.	13.39	2.224133	0.39300	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	.	.	.	3.69	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3839	0.49773	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HLA-B	31430980	1.000000	0.71417	0.512000	0.27736	0.299000	0.27559	3.086000	0.50159	1.804000	0.52760	0.442000	0.29010	.	HLA-B	-	-		0.602	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	C	NM_005514	Intron	31323001	-1	no_errors	ENST00000412585	ensembl	human	known	70_37	splice_site	SNP	0.931	G
KRT6A	3853	genome.wustl.edu	37	12	52881697	52881697	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr12:52881697C>T	ENST00000330722.6	-	9	1570	c.1502G>A	c.(1501-1503)aGt>aAt	p.S501N		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	501	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCGACACCACTGGCACCGCC	0.607																																																	0													59.0	64.0	62.0					12																	52881697		2203	4300	6503	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1502G>A	12.37:g.52881697C>T	ENSP00000369317:p.Ser501Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S501N	ENST00000330722.6	37	c.1502	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	c	6.670	0.492181	0.12702	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.87334	-2.24	4.94	4.03	0.46877	.	0.624751	0.14268	N	0.330377	D	0.85703	0.5758	M	0.78637	2.42	0.09310	N	1	B	0.23058	0.079	B	0.21546	0.035	T	0.73814	-0.3864	10	0.26408	T	0.33	.	9.9245	0.41483	0.0:0.7826:0.1407:0.0766	.	501	P02538	K2C6A_HUMAN	N	501;457	ENSP00000369317:S501N	ENSP00000369317:S501N	S	-	2	0	KRT6A	51167964	0.002000	0.14202	0.002000	0.10522	0.008000	0.06430	1.150000	0.31639	1.171000	0.42768	0.586000	0.80456	AGT	KRT6A	-	NULL		0.607	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	HGNC	protein_coding	OTTHUMT00000404978.2	C	NM_005554		52881697	-1	no_errors	ENST00000330722	ensembl	human	known	70_37	missense	SNP	0.007	T
LDOC1	23641	genome.wustl.edu	37	X	140270994	140270994	+	Silent	SNP	C	C	T	rs377490828		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:140270994C>T	ENST00000370526.2	-	1	316	c.213G>A	c.(211-213)acG>acA	p.T71T	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	71					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					TGTAAGACGCCGTCTGCACGA	0.622																																																	0								C		0,3835		0,0,1632,571	85.0	71.0	76.0		213	0.7	0.1	X		76	1,6727		0,1,2427,1872	no	coding-synonymous	LDOC1	NM_012317.2		0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095		71/147	140270994	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	23641			AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.213G>A	X.37:g.140270994C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IAR6	Silent	SNP	NULL	p.T71	ENST00000370526.2	37	c.213	CCDS14672.1	X																																																																																			LDOC1	-	NULL		0.622	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDOC1	HGNC	protein_coding	OTTHUMT00000058592.1	C	NM_012317		140270994	-1	no_errors	ENST00000370526	ensembl	human	known	70_37	silent	SNP	0.077	T
LFNG	3955	genome.wustl.edu	37	7	2564882	2564882	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr7:2564882G>T	ENST00000222725.5	+	3	531	c.511G>T	c.(511-513)Gcc>Tcc	p.A171S	LFNG_ENST00000338732.3_Missense_Mutation_p.A42S|MIR4648_ENST00000580107.1_RNA|LFNG_ENST00000402045.1_Missense_Mutation_p.A42S|LFNG_ENST00000359574.3_Missense_Mutation_p.A171S|LFNG_ENST00000402506.1_Missense_Mutation_p.A100S	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	171					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		CTGCTCGGCCGCCCACAGCCG	0.677																																																	0													33.0	36.0	35.0					7																	2564882		2202	4299	6501	SO:0001583	missense	3955			BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.511G>T	7.37:g.2564882G>T	ENSP00000222725:p.Ala171Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	SNP	pfam_Fringe-like,pirsf_Fringe	p.A171S	ENST00000222725.5	37	c.511	CCDS34587.1	7	.	.	.	.	.	.	.	.	.	.	G	17.21	3.330542	0.60743	.	.	ENSG00000106003	ENST00000402506;ENST00000402045;ENST00000338732;ENST00000222725;ENST00000359574	T;T;T;T;T	0.62105	0.99;0.05;0.05;0.05;0.05	5.18	5.18	0.71444	.	0.102259	0.64402	D	0.000003	T	0.51193	0.1660	L	0.33753	1.03	0.80722	D	1	B;B	0.27264	0.173;0.14	B;B	0.29785	0.073;0.107	T	0.48990	-0.8985	10	0.06099	T	0.92	-28.616	18.6871	0.91568	0.0:0.0:1.0:0.0	.	171;171	Q8NES3-3;Q8NES3	.;LFNG_HUMAN	S	100;42;42;171;171	ENSP00000385764:A100S;ENSP00000384786:A42S;ENSP00000343095:A42S;ENSP00000222725:A171S;ENSP00000352579:A171S	ENSP00000222725:A171S	A	+	1	0	LFNG	2531408	1.000000	0.71417	0.948000	0.38648	0.549000	0.35272	7.393000	0.79851	2.422000	0.82143	0.561000	0.74099	GCC	LFNG	-	pfam_Fringe-like,pirsf_Fringe		0.677	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LFNG	HGNC	protein_coding	OTTHUMT00000325021.1	G	NM_002304		2564882	+1	no_errors	ENST00000222725	ensembl	human	known	70_37	missense	SNP	1.000	T
RP11-146E13.4	0	genome.wustl.edu	37	14	19856617	19856617	+	lincRNA	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:19856617A>G	ENST00000548109.1	+	0	72																											TAAAATTTAGAAAACAACATT	0.239																																																	0																																												101060483																															14.37:g.19856617A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-		0.239	RP11-146E13.4-001	KNOWN	basic	lincRNA	LOC101060483	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	A			19856617	-1	no_errors	ENST00000551334	ensembl	human	known	70_37	rna	SNP	0.011	G
LOC645513	645513	genome.wustl.edu	37	4	120382926	120382926	+	IGR	SNP	A	A	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr4:120382926A>C								RP11-33B1.3 (4494 upstream) : RP11-33B1.1 (26871 downstream)																							ACCTAAATGCAGAATCGCGAG	0.378																																																	0																																										SO:0001628	intergenic_variant	645513																															4.37:g.120382926A>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		4																																																																																			RP11-33B1.1	-	-	0	0.378					LOC645513	Clone_based_vega_gene			A			120382926	+1	no_errors	ENST00000508519	ensembl	human	known	70_37	rna	SNP	1.000	C
MAGEC3	139081	genome.wustl.edu	37	X	140967150	140967150	+	Missense_Mutation	SNP	A	A	G	rs376372353		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:140967150A>G	ENST00000298296.1	+	3	448	c.448A>G	c.(448-450)Aca>Gca	p.T150A	MAGEC3_ENST00000536088.1_5'Flank|MAGEC3_ENST00000448920.1_5'Flank|MAGEC3_ENST00000443323.2_5'Flank	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	150										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GAGGAGAGGCACAGGCTACAC	0.567																																																	0													45.0	38.0	41.0					X																	140967150		2202	4300	6502	SO:0001583	missense	139081			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.448A>G	X.37:g.140967150A>G	ENSP00000298296:p.Thr150Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.T150A	ENST00000298296.1	37	c.448	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	A	0	-2.790648	0.00077	.	.	ENSG00000165509	ENST00000298296	T	0.06371	3.31	1.09	-2.18	0.07037	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41752	-0.9491	9	0.05436	T	0.98	.	0.5825	0.00714	0.4408:0.2132:0.1622:0.1838	.	150	Q8TD91	MAGC3_HUMAN	A	150	ENSP00000298296:T150A	ENSP00000298296:T150A	T	+	1	0	MAGEC3	140794816	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.464000	0.00996	-4.427000	0.00050	-2.474000	0.00201	ACA	MAGEC3	-	NULL		0.567	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	A	NM_138702		140967150	+1	no_errors	ENST00000298296	ensembl	human	known	70_37	missense	SNP	0.000	G
MAPK1	5594	genome.wustl.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr22:22127164C>T	ENST00000215832.6	-	7	1152	c.964G>A	c.(964-966)Gag>Aag	p.E322K	MAPK1_ENST00000544786.1_Missense_Mutation_p.E278K|MAPK1_ENST00000398822.3_Missense_Mutation_p.E322K	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.E322K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	GCTCTTACCTCGTCACTCGGG	0.478																																																	1	Substitution - Missense(1)	cervix(1)											165.0	132.0	143.0					22																	22127164		2203	4300	6503	SO:0001583	missense	5594			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.964G>A	22.37:g.22127164C>T	ENSP00000215832:p.Glu322Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8CZ64	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.E322K	ENST00000215832.6	37	c.964	CCDS13795.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.567659	0.96540	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.46063	0.88;0.88;0.88	4.9	4.9	0.64082	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.83275	0.905;0.996	D	0.87609	0.2502	10	0.87932	D	0	-8.3311	18.6384	0.91386	0.0:1.0:0.0:0.0	.	278;322	A8CZ64;P28482	.;MK01_HUMAN	K	322;310;322;278	ENSP00000215832:E322K;ENSP00000381803:E322K;ENSP00000440842:E278K	ENSP00000215832:E322K	E	-	1	0	MAPK1	20457164	1.000000	0.71417	0.999000	0.59377	0.862000	0.49288	7.564000	0.82326	2.706000	0.92434	0.655000	0.94253	GAG	MAPK1	-	superfamily_Kinase-like_dom,prints_MAPK_ERK1/2		0.478	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MAPK1	HGNC	protein_coding	OTTHUMT00000075396.2	C			22127164	-1	no_errors	ENST00000215832	ensembl	human	known	70_37	missense	SNP	1.000	T
MED12	9968	genome.wustl.edu	37	X	70344125	70344125	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:70344125C>T	ENST00000374080.3	+	13	1893	c.1861C>T	c.(1861-1863)Cga>Tga	p.R621*	MED12_ENST00000374102.1_Nonsense_Mutation_p.R621*|MED12_ENST00000333646.6_Nonsense_Mutation_p.R621*			Q93074	MED12_HUMAN	mediator complex subunit 12	621					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TCTCATCTCCCGAGGGGACCT	0.537			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													79.0	71.0	74.0					X																	70344125		1959	4138	6097	SO:0001587	stop_gained	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1861C>T	X.37:g.70344125C>T	ENSP00000363193:p.Arg621*	Somatic		WXS	Illumina HiSeq	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Nonsense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.R621*	ENST00000374080.3	37	c.1861	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	41	8.731290	0.98933	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7506	17.0137	0.86413	0.0:1.0:0.0:0.0	.	.	.	.	X	621;621;621;621;589	.	ENSP00000333125:R621X	R	+	1	2	MED12	70260850	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.103000	0.77014	2.194000	0.70268	0.544000	0.68410	CGA	MED12	-	pfam_Mediator_Med12_LCEWAV		0.537	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	C	NM_005120		70344125	+1	no_errors	ENST00000333646	ensembl	human	known	70_37	nonsense	SNP	1.000	T
MIOS	54468	genome.wustl.edu	37	7	7634623	7634623	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr7:7634623G>A	ENST00000340080.4	+	10	2477	c.2056G>A	c.(2056-2058)Gat>Aat	p.D686N	MIOS_ENST00000405785.1_Missense_Mutation_p.D686N	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	686						lysosomal membrane (GO:0005765)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTCACCTTTAGATGTTCTTAA	0.353																																																	0													110.0	104.0	106.0					7																	7634623		1797	4069	5866	SO:0001583	missense	54468				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.2056G>A	7.37:g.7634623G>A	ENSP00000339881:p.Asp686Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTV6|O75216|Q7L551|Q9H092	Missense_Mutation	SNP	smart_WD40_repeat	p.D686N	ENST00000340080.4	37	c.2056	CCDS43554.1	7	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994197	0.74703	.	.	ENSG00000164654	ENST00000340080;ENST00000405785	T;T	0.41065	1.01;1.01	5.58	5.58	0.84498	.	0.171422	0.64402	D	0.000006	T	0.38480	0.1042	L	0.38175	1.15	0.80722	D	1	B;B	0.17667	0.023;0.023	B;B	0.17722	0.019;0.019	T	0.08046	-1.0741	10	0.33940	T	0.23	-28.0674	19.9573	0.97224	0.0:0.0:1.0:0.0	.	686;686	B4DGE7;Q9NXC5	.;MIO_HUMAN	N	686	ENSP00000339881:D686N;ENSP00000384088:D686N	ENSP00000339881:D686N	D	+	1	0	MIOS	7601148	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.413000	0.97351	2.794000	0.96219	0.655000	0.94253	GAT	MIOS	-	NULL		0.353	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOS	HGNC	protein_coding	OTTHUMT00000326218.1	G	NM_019005		7634623	+1	no_errors	ENST00000340080	ensembl	human	known	70_37	missense	SNP	1.000	A
MIS18BP1	55320	genome.wustl.edu	37	14	45693777	45693777	+	Silent	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:45693777G>A	ENST00000310806.4	-	11	2471	c.2013C>T	c.(2011-2013)tcC>tcT	p.S671S		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	671					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TGGTGCCAGCGGACAGATTAT	0.363																																																	0													138.0	138.0	138.0					14																	45693777		2203	4300	6503	SO:0001819	synonymous_variant	55320			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2013C>T	14.37:g.45693777G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Silent	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S671	ENST00000310806.4	37	c.2013	CCDS9684.1	14																																																																																			MIS18BP1	-	NULL		0.363	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	G			45693777	-1	no_errors	ENST00000310806	ensembl	human	known	70_37	silent	SNP	0.001	A
MTHFD2L	441024	genome.wustl.edu	37	4	75067078	75067078	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr4:75067078C>T	ENST00000395759.2	+	5	730	c.703C>T	c.(703-705)Cgg>Tgg	p.R235W	MTHFD2L_ENST00000325278.6_Missense_Mutation_p.R177W|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.R177W|MTHFD2L_ENST00000433372.1_Missense_Mutation_p.R100W	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	235					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			AGAGCATGAACGGCCAGGAGG	0.408																																																	0													101.0	95.0	97.0					4																	75067078		2203	4300	6503	SO:0001583	missense	441024			BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.703C>T	4.37:g.75067078C>T	ENSP00000379108:p.Arg235Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P079|Q8N560	Missense_Mutation	SNP	pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.R235W	ENST00000395759.2	37	c.703	CCDS47075.1	4	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003313	0.54254	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.32515	1.45;1.88;1.46;1.48;1.89	5.97	1.77	0.24775	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.101168	0.64402	D	0.000003	T	0.52789	0.1756	M	0.82323	2.585	0.44508	D	0.997459	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.968	T	0.52837	-0.8522	10	0.66056	D	0.02	-15.9329	8.5829	0.33640	0.4573:0.4661:0.0:0.0766	.	235;177	Q9H903;Q9H903-3	MTD2L_HUMAN;.	W	100;235;177;177;177	ENSP00000405692:R100W;ENSP00000379108:R235W;ENSP00000330982:R177W;ENSP00000352012:R177W;ENSP00000321984:R177W	ENSP00000321984:R177W	R	+	1	2	MTHFD2L	75285942	0.996000	0.38824	0.964000	0.40570	0.801000	0.45260	1.069000	0.30641	0.382000	0.24878	0.585000	0.79938	CGG	MTHFD2L	-	pfam_THF_DH/CycHdrlase_NAD-bd_dom		0.408	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding		C	NM_001004346		75067078	+1	no_errors	ENST00000395759	ensembl	human	known	70_37	missense	SNP	0.931	T
MYH7	4625	genome.wustl.edu	37	14	23884925	23884925	+	Silent	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:23884925G>A	ENST00000355349.3	-	35	5232	c.5070C>T	c.(5068-5070)gcC>gcT	p.A1690A	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1690					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCTCCACCACGGCACGCAACT	0.632																																																	0													73.0	65.0	68.0					14																	23884925		2203	4300	6503	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5070C>T	14.37:g.23884925G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1690	ENST00000355349.3	37	c.5070	CCDS9601.1	14																																																																																			MYH7	-	pfam_Myosin_tail		0.632	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	G	NM_000257		23884925	-1	no_errors	ENST00000355349	ensembl	human	known	70_37	silent	SNP	0.085	A
NBL1	4681	genome.wustl.edu	37	1	19981847	19981847	+	Silent	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:19981847C>T	ENST00000375136.3	+	3	504	c.201C>T	c.(199-201)agC>agT	p.S67S	NBL1_ENST00000289749.2_Silent_p.S102S|MINOS1-NBL1_ENST00000602662.1_Silent_p.S67S|NBL1_ENST00000548815.1_Silent_p.S66S	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	67	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGCTACAGCGTCCCCAACA	0.607																																																	0													215.0	151.0	172.0					1																	19981847		2203	4300	6503	SO:0001819	synonymous_variant	4681				CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.201C>T	1.37:g.19981847C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Silent	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C	p.S102	ENST00000375136.3	37	c.306	CCDS196.2	1																																																																																			NBL1	-	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C		0.607	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBL1	HGNC	protein_coding	OTTHUMT00000007681.4	C	NM_005380		19981847	+1	no_errors	ENST00000289749	ensembl	human	known	70_37	silent	SNP	1.000	T
NEGR1	257194	genome.wustl.edu	37	1	72400779	72400779	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:72400779A>G	ENST00000357731.5	-	2	631	c.392T>C	c.(391-393)gTg>gCg	p.V131A	NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.V129A|NEGR1_ENST00000306821.3_Missense_Mutation_p.V3A	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	131	Ig-like C2-type 1.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AGTTAGATGCACCTGCATTGT	0.388																																																	0													105.0	95.0	98.0					1																	72400779		2203	4300	6503	SO:0001583	missense	257194			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.392T>C	1.37:g.72400779A>G	ENSP00000350364:p.Val131Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V131A	ENST00000357731.5	37	c.392	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.778226	0.90195	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.64803	-0.12;1.56;-0.12	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.129525	0.52532	D	0.000068	T	0.69967	0.3170	M	0.69248	2.105	0.52099	D	0.999946	D;D	0.65815	0.989;0.995	D;D	0.72338	0.977;0.969	T	0.67906	-0.5549	10	0.27785	T	0.31	-9.0848	15.9686	0.79995	1.0:0.0:0.0:0.0	.	129;131	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	A	131;3;129	ENSP00000350364:V131A;ENSP00000305938:V3A;ENSP00000413294:V129A	ENSP00000305938:V3A	V	-	2	0	NEGR1	72173367	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.339000	0.96797	2.179000	0.69175	0.533000	0.62120	GTG	NEGR1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like		0.388	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	A	NM_173808		72400779	-1	no_errors	ENST00000357731	ensembl	human	known	70_37	missense	SNP	1.000	G
NBPF9	400818	genome.wustl.edu	37	1	144814603	144814603	+	Intron	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:144814603A>G	ENST00000468645.1	+	3	313				NBPF9_ENST00000440491.2_Intron|NBPF9_ENST00000338347.4_Intron|NBPF9_ENST00000281815.8_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						ACACTGTTTCAGAAATCTCTG	0.423																																																	0																																										SO:0001627	intron_variant	400818				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.314-77A>G	1.37:g.144814603A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			NBPF9	-	-		0.423	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	A	NM_001037675		144814603	+1	no_errors	ENST00000465793	ensembl	human	known	70_37	rna	SNP	0.027	G
NR0B1	190	genome.wustl.edu	37	X	30326793	30326793	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:30326793G>A	ENST00000378970.4	-	1	922	c.688C>T	c.(688-690)Cgg>Tgg	p.R230W	NR0B1_ENST00000453287.1_Missense_Mutation_p.R230W|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	230	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GCCCTCGGCCGCTCCTCCGGA	0.687											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													6.0	7.0	6.0					X																	30326793		2125	4077	6202	SO:0001583	missense	190			S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.688C>T	X.37:g.30326793G>A	ENSP00000368253:p.Arg230Trp	Somatic	816	WXS	Illumina HiSeq	Phase_IV	Q96F69	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.R230W	ENST00000378970.4	37	c.688	CCDS14223.1	X	.	.	.	.	.	.	.	.	.	.	G	12.13	1.846494	0.32606	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.98732	-5.1;-5.1	4.41	3.47	0.39725	Nuclear hormone receptor, ligand-binding (2);	0.757438	0.12180	N	0.492168	D	0.96852	0.8972	L	0.29908	0.895	0.20403	N	0.999903	D	0.65815	0.995	P	0.48227	0.571	D	0.92686	0.6162	10	0.72032	D	0.01	-12.3651	11.1017	0.48179	0.0:0.1856:0.8144:0.0	.	230	P51843	NR0B1_HUMAN	W	230	ENSP00000368253:R230W;ENSP00000396403:R230W	ENSP00000368253:R230W	R	-	1	2	NR0B1	30236714	0.041000	0.20044	0.120000	0.21714	0.080000	0.17528	2.298000	0.43602	2.177000	0.69029	0.466000	0.42574	CGG	NR0B1	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.687	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B1	HGNC	protein_coding	OTTHUMT00000056161.1	G	NM_000475		30326793	-1	no_errors	ENST00000378970	ensembl	human	known	70_37	missense	SNP	0.411	A
NR3C2	4306	genome.wustl.edu	37	4	149035254	149035254	+	Splice_Site	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr4:149035254C>T	ENST00000358102.3	-	8	3162		c.e8+1		NR3C2_ENST00000355292.3_Splice_Site|NR3C2_ENST00000344721.4_Splice_Site|NR3C2_ENST00000511528.1_Splice_Site|NR3C2_ENST00000512865.1_Splice_Site	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2						gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GCTCTACTCACGTCATGCATG	0.498																																					Melanoma(27;428 957 40335 51025 51111)												0			GRCh37	CS070397	NR3C2	S							120.0	102.0	108.0					4																	149035254		2203	4300	6503	SO:0001630	splice_region_variant	4306			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2799+1G>A	4.37:g.149035254C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Splice_Site	SNP	-	e7+1	ENST00000358102.3	37	c.2811+1	CCDS3772.1	4	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011609	0.93346	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000511528	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8441	0.96702	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NR3C2	149254704	1.000000	0.71417	0.989000	0.46669	0.915000	0.54546	7.736000	0.84948	2.681000	0.91329	0.650000	0.86243	.	NR3C2	-	-		0.498	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	HGNC	protein_coding	OTTHUMT00000364986.1	C		Intron	149035254	-1	no_errors	ENST00000355292	ensembl	human	known	70_37	splice_site	SNP	1.000	T
OR11H12	440153	genome.wustl.edu	37	14	19377748	19377748	+	Missense_Mutation	SNP	T	T	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:19377748T>G	ENST00000550708.1	+	1	227	c.155T>G	c.(154-156)cTg>cGg	p.L52R		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACATATGCACTGACTATAACA	0.413																																																	0													62.0	69.0	66.0					14																	19377748		2086	4166	6252	SO:0001583	missense	440153				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.155T>G	14.37:g.19377748T>G	ENSP00000449002:p.Leu52Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L52R	ENST00000550708.1	37	c.155	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	t	9.464	1.093949	0.20471	.	.	ENSG00000257115	ENST00000550708	T	0.00453	7.33	.	.	.	.	0.240128	0.20954	N	0.082684	T	0.00936	0.0031	M	0.94142	3.5	0.26746	N	0.970297	D	0.58268	0.982	P	0.53450	0.726	T	0.21449	-1.0245	8	0.87932	D	0	.	5.0207	0.14360	0.0:2.0E-4:0.0:0.9998	.	52	B2RN74	O11HC_HUMAN	R	52	ENSP00000449002:L52R	ENSP00000449002:L52R	L	+	2	0	CR383656.1	18447748	0.002000	0.14202	0.796000	0.32109	0.045000	0.14185	0.725000	0.25970	0.348000	0.23949	0.055000	0.15244	CTG	OR11H12	-	prints_GPCR_Rhodpsn		0.413	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	T	NM_001013354		19377748	+1	no_errors	ENST00000550708	ensembl	human	known	70_37	missense	SNP	0.014	G
OR51A4	401666	genome.wustl.edu	37	11	4967395	4967395	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr11:4967395C>A	ENST00000380373.2	-	1	961	c.936G>T	c.(934-936)aaG>aaT	p.K312N	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTGTTAAATCTTCCGTTGAC	0.338																																																	0													115.0	116.0	116.0					11																	4967395		2199	4298	6497	SO:0001583	missense	401666			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.936G>T	11.37:g.4967395C>A	ENSP00000369731:p.Lys312Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K312N	ENST00000380373.2	37	c.936	CCDS31367.1	11	.	.	.	.	.	.	.	.	.	.	C	7.083	0.570623	0.13560	.	.	ENSG00000205497	ENST00000380373	T	0.39787	1.06	2.47	-1.2	0.09554	.	.	.	.	.	T	0.25457	0.0619	L	0.34521	1.04	0.09310	N	1	B	0.33413	0.411	B	0.24155	0.051	T	0.10636	-1.0621	9	0.56958	D	0.05	.	6.6927	0.23181	0.0:0.5214:0.0:0.4786	.	312	Q8NGJ6	O51A4_HUMAN	N	312	ENSP00000369731:K312N	ENSP00000369731:K312N	K	-	3	2	OR51A4	4923971	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.009000	0.13219	-0.256000	0.09473	0.549000	0.68633	AAG	OR51A4	-	NULL		0.338	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A4	HGNC	protein_coding	OTTHUMT00000142821.1	C	NM_001005329		4967395	-1	no_errors	ENST00000380373	ensembl	human	known	70_37	missense	SNP	0.000	A
PCDHA7	56141	genome.wustl.edu	37	5	140216124	140216124	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr5:140216124C>T	ENST00000525929.1	+	1	2156	c.2156C>T	c.(2155-2157)aCg>aTg	p.T719M	PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.T719M|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	719					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTGTACACGGCGTTGCGG	0.607																																					NSCLC(160;258 2013 5070 22440 28951)												0													106.0	88.0	94.0					5																	140216124		2203	4300	6503	SO:0001583	missense	56141			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2156C>T	5.37:g.140216124C>T	ENSP00000436426:p.Thr719Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T719M	ENST00000525929.1	37	c.2156	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298369	0.23650	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.15718	2.4;2.4	3.57	0.749	0.18381	.	0.739382	0.10174	U	0.706779	T	0.21718	0.0523	M	0.85462	2.755	0.09310	N	1	P;P	0.41710	0.76;0.647	B;B	0.35413	0.202;0.1	T	0.16129	-1.0413	10	0.54805	T	0.06	.	8.4633	0.32940	0.0:0.6311:0.0:0.3689	.	719;719	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	M	719	ENSP00000436426:T719M;ENSP00000367365:T719M	ENSP00000367365:T719M	T	+	2	0	PCDHA7	140196308	0.000000	0.05858	0.469000	0.27204	0.694000	0.40290	-1.159000	0.03150	0.304000	0.22809	0.462000	0.41574	ACG	PCDHA7	-	NULL		0.607	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	C	NM_018910		140216124	+1	no_errors	ENST00000525929	ensembl	human	known	70_37	missense	SNP	0.000	T
PCDHB1	29930	genome.wustl.edu	37	5	140431083	140431083	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr5:140431083C>G	ENST00000306549.3	+	1	105	c.28C>G	c.(28-30)Caa>Gaa	p.Q10E		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	10					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAAATCTTTGCAAAACAGGCA	0.493																																																	0													69.0	72.0	71.0					5																	140431083		2203	4300	6503	SO:0001583	missense	29930			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.28C>G	5.37:g.140431083C>G	ENSP00000307234:p.Gln10Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q10E	ENST00000306549.3	37	c.28	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349317	0.61183	.	.	ENSG00000171815	ENST00000306549	T	0.47528	0.84	5.96	5.08	0.68730	Cadherin (1);	1.068980	0.07393	N	0.889429	T	0.40670	0.1126	L	0.29908	0.895	0.09310	N	1	B	0.16603	0.018	B	0.19391	0.025	T	0.30446	-0.9978	10	0.28530	T	0.3	.	12.5	0.55950	0.167:0.833:0.0:0.0	.	10	Q9Y5F3	PCDB1_HUMAN	E	10	ENSP00000307234:Q10E	ENSP00000307234:Q10E	Q	+	1	0	PCDHB1	140411267	0.043000	0.20138	0.852000	0.33557	0.861000	0.49209	2.159000	0.42339	1.503000	0.48686	0.655000	0.94253	CAA	PCDHB1	-	pfscan_Cadherin		0.493	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	C	NM_013340		140431083	+1	no_errors	ENST00000306549	ensembl	human	known	70_37	missense	SNP	0.185	G
PDE1C	5137	genome.wustl.edu	37	7	31864488	31864488	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr7:31864488G>A	ENST00000396191.1	-	13	1854	c.1399C>T	c.(1399-1401)Cgt>Tgt	p.R467C	PDE1C_ENST00000321453.7_Missense_Mutation_p.R467C|PDE1C_ENST00000396184.3_Missense_Mutation_p.R467C|PDE1C_ENST00000396182.2_Missense_Mutation_p.R467C|PDE1C_ENST00000396193.1_Missense_Mutation_p.R527C	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	467	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GACCTCGAACGCCTCTGTCCT	0.507																																																	0													170.0	143.0	152.0					7																	31864488		2203	4300	6503	SO:0001583	missense	5137			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1399C>T	7.37:g.31864488G>A	ENSP00000379494:p.Arg467Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R467C	ENST00000396191.1	37	c.1399	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	G	15.68	2.903749	0.52333	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.75;-0.75	5.82	4.93	0.64822	.	0.139348	0.47852	D	0.000219	T	0.78685	0.4322	L	0.27053	0.805	0.80722	D	1	B;B;D	0.89917	0.38;0.238;1.0	B;B;D	0.71656	0.082;0.042;0.974	T	0.81221	-0.1031	10	0.59425	D	0.04	.	16.1663	0.81759	0.0:0.0:0.8659:0.1341	.	467;527;467	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	C	527;467;467;467;467	ENSP00000379496:R527C;ENSP00000379494:R467C;ENSP00000318105:R467C;ENSP00000379487:R467C;ENSP00000379485:R467C	ENSP00000318105:R467C	R	-	1	0	PDE1C	31831013	1.000000	0.71417	0.999000	0.59377	0.499000	0.33736	7.258000	0.78371	1.445000	0.47624	0.655000	0.94253	CGT	PDE1C	-	NULL		0.507	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	G			31864488	-1	no_errors	ENST00000321453	ensembl	human	known	70_37	missense	SNP	1.000	A
GATB	5188	genome.wustl.edu	37	4	152622537	152622537	+	Nonsense_Mutation	SNP	G	G	A	rs371263176		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr4:152622537G>A	ENST00000515812.1	-	8	1034	c.1018C>T	c.(1018-1020)Cga>Tga	p.R340*	PET112_ENST00000263985.6_Nonsense_Mutation_p.R381*																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						AGCTTCTCTCGGGTCACACTG	0.562																																																	0								G	stop/ARG	0,4406		0,0,2203	73.0	67.0	69.0		1141	3.7	1.0	4		69	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	PET112	NM_004564.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		381/558	152622537	1,13005	2203	4300	6503	SO:0001587	stop_gained	5188																														ENST00000515812.1:c.1018C>T	4.37:g.152622537G>A	ENSP00000426859:p.Arg340*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Asn/Gln-tRNA_Trfase_suB/E_cat,pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu	p.R381*	ENST00000515812.1	37	c.1141		4	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307096	0.81247	0.0	1.16E-4	ENSG00000059691	ENST00000263985;ENST00000515812	.	.	.	5.7	3.73	0.42828	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6346	13.3439	0.60561	0.0:0.0:0.5629:0.4371	.	.	.	.	X	381;340	.	ENSP00000263985:R381X	R	-	1	2	PET112	152841987	1.000000	0.71417	0.981000	0.43875	0.376000	0.30014	2.854000	0.48325	1.342000	0.45619	0.650000	0.86243	CGA	PET112	-	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,tigrfam_Apn/Gln-ADT_bsu		0.562	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PET112	HGNC	protein_coding	OTTHUMT00000365672.1	G			152622537	-1	no_errors	ENST00000263985	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PRSS41	360226	genome.wustl.edu	37	16	2854483	2854483	+	RNA	SNP	G	G	A	rs368414755		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr16:2854483G>A	ENST00000399677.1	+	0	674							Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										CCCTCTAGCCGTAGTATGATC	0.527													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20241	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	2,1382		0,2,690	192.0	168.0	175.0		674	-5.5	0.0	16		175	0,3182		0,0,1591	no	missense	PRSS41	NM_001135086.1	29	0,2,2281	AA,AG,GG		0.0,0.1445,0.0438	possibly-damaging	225/319	2854483	2,4564	692	1591	2283			360226					16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2854483G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000399677.1	37	NULL		16																																																																																			PRSS41	-	-		0.527	PRSS41-002	KNOWN	basic	processed_transcript	PRSS41	HGNC	pseudogene	OTTHUMT00000436450.1	G	NM_183379		2854483	+1	no_errors	ENST00000399677	ensembl	human	known	70_37	rna	SNP	0.000	A
PTCHD3	374308	genome.wustl.edu	37	10	27702694	27702694	+	Silent	SNP	G	G	A	rs140783092		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr10:27702694G>A	ENST00000438700.3	-	1	603	c.486C>T	c.(484-486)gaC>gaT	p.D162D		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	162					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						CTTCCTCTTCGTCCTTGGGTA	0.662																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	86.0	95.0	92.0		486	-7.2	0.0	10	dbSNP_134	92	0,8600		0,0,4300	no	coding-synonymous	PTCHD3	NM_001034842.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		162/768	27702694	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	374308			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.486C>T	10.37:g.27702694G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	I3L499|Q6ZU28	Silent	SNP	pfam_Patched,pfscan_SSD	p.D162	ENST00000438700.3	37	c.486	CCDS31173.1	10																																																																																			PTCHD3	-	NULL		0.662	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3	G	XM_370541		27702694	-1	no_errors	ENST00000438700	ensembl	human	known	70_37	silent	SNP	0.000	A
PTEN	5728	genome.wustl.edu	37	10	89624269	89624269	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr10:89624269A>T	ENST00000371953.3	+	1	1400	c.43A>T	c.(43-45)Aga>Tga	p.R15*	KLLN_ENST00000445946.3_5'Flank	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	15	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		R -> S (in glioma). {ECO:0000269|PubMed:9090379}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(13)|p.N12fs*6(1)|p.R14fs*26(1)|p.R14_D22del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAACAAAAGGAGATATCAAGA	0.478		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	53	Whole gene deletion(37)|Unknown(13)|Deletion - Frameshift(2)|Deletion - In frame(1)	prostate(14)|central_nervous_system(11)|skin(7)|lung(6)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|breast(2)|biliary_tract(1)|stomach(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|kidney(1)											183.0	175.0	178.0					10																	89624269		2203	4300	6503	SO:0001587	stop_gained	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.43A>T	10.37:g.89624269A>T	ENSP00000361021:p.Arg15*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R15*	ENST00000371953.3	37	c.43	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	A	49	15.367130	0.99831	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.05	5.05	0.67936	.	0.105614	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.232	9.6456	0.39865	0.6992:0.3008:0.0:0.0	.	.	.	.	X	15	.	.	R	+	1	2	PTEN	89614249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.222000	0.51223	1.891000	0.54761	0.459000	0.35465	AGA	PTEN	-	pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ		0.478	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	A	NM_000314		89624269	+1	no_errors	ENST00000371953	ensembl	human	known	70_37	nonsense	SNP	1.000	T
RRBP1	6238	genome.wustl.edu	37	20	17640441	17640441	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr20:17640441G>A	ENST00000377813.1	-	3	1015	c.712C>T	c.(712-714)Caa>Taa	p.Q238*	RRBP1_ENST00000246043.4_Nonsense_Mutation_p.Q238*|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000377807.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	238	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TTTTTCCCTTGGTTTGGGGTT	0.532																																																	0																																										SO:0001587	stop_gained	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.712C>T	20.37:g.17640441G>A	ENSP00000367044:p.Gln238*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Nonsense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.Q238*	ENST00000377813.1	37	c.712		20	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020262	0.54576	.	.	ENSG00000125844	ENST00000377813;ENST00000246043;ENST00000398782	.	.	.	3.28	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-17.5641	12.8255	0.57716	0.0:0.0:1.0:0.0	.	.	.	.	X	238	.	ENSP00000246043:Q238X	Q	-	1	0	RRBP1	17588441	0.848000	0.29623	0.065000	0.19835	0.014000	0.08584	1.900000	0.39828	2.132000	0.65825	0.609000	0.83330	CAA	RRBP1	-	NULL		0.532	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	G	NM_001042576		17640441	-1	no_errors	ENST00000246043	ensembl	human	known	70_37	nonsense	SNP	0.872	A
RUNX1	861	genome.wustl.edu	37	21	36164595	36164595	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr21:36164595C>T	ENST00000344691.4	-	6	2776	c.1199G>A	c.(1198-1200)cGc>cAc	p.R400H	RUNX1_ENST00000399240.1_Missense_Mutation_p.R336H|RUNX1_ENST00000325074.5_Missense_Mutation_p.R415H|RUNX1_ENST00000437180.1_Missense_Mutation_p.R427H|RUNX1_ENST00000300305.3_Missense_Mutation_p.R427H	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	400	Interaction with KAT6B. {ECO:0000250}.|Pro/Ser/Thr-rich.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CGGCAGGATGCGCGGCGGCGA	0.721			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																			Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0													9.0	11.0	10.0					21																	36164595		2041	4015	6056	SO:0001583	missense	861			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.1199G>A	21.37:g.36164595C>T	ENSP00000340690:p.Arg400His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.R427H	ENST00000344691.4	37	c.1280	CCDS42922.1	21	.	.	.	.	.	.	.	.	.	.	C	33	5.287693	0.95517	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000399245	T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21	5.01	5.01	0.66863	Runx inhibition (1);	0.000000	0.85682	D	0.000000	T	0.62853	0.2462	M	0.77313	2.365	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.79784	0.926;0.993;0.98	T	0.68447	-0.5406	10	0.87932	D	0	-20.495	17.9043	0.88914	0.0:1.0:0.0:0.0	.	427;415;400	Q01196-8;Q01196-10;Q01196	.;.;RUNX1_HUMAN	H	400;427;427;415;336;403	ENSP00000340690:R400H;ENSP00000300305:R427H;ENSP00000409227:R427H;ENSP00000319459:R415H;ENSP00000382184:R336H	ENSP00000300305:R427H	R	-	2	0	RUNX1	35086465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.234000	0.78134	2.320000	0.78422	0.557000	0.71058	CGC	RUNX1	-	pfam_RunxI,pirsf_TF_Runt-rel_RUNX,prints_AML1_Runt		0.721	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	C			36164595	-1	no_errors	ENST00000300305	ensembl	human	known	70_37	missense	SNP	1.000	T
S100A4	6275	genome.wustl.edu	37	1	153516163	153516163	+	3'UTR	DEL	A	A	-	rs71820511	byFrequency	TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:153516163delA	ENST00000368716.4	-	0	525				S100A5_ENST00000368718.1_5'Flank|S100A4_ENST00000481009.1_5'UTR|S100A5_ENST00000359215.1_5'Flank|S100A4_ENST00000368714.1_3'UTR|S100A4_ENST00000354332.4_3'UTR|S100A5_ENST00000368717.2_5'Flank|S100A4_ENST00000368715.1_3'UTR	NM_002961.2	NP_002952.1	P26447	S10A4_HUMAN	S100 calcium binding protein A4						epithelial to mesenchymal transition (GO:0001837)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)			large_intestine(2)|lung(1)|prostate(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Trifluoperazine(DB00831)	GCCAGGGTGGAAAAAAAAAAG	0.527													|||unknown(HR)	155	0.0309505	0.1021	0.0072	5008	,	,		16324	0.001		0.002	False		,,,				2504	0.0123																0																																										SO:0001624	3_prime_UTR_variant	6275			BC016300	CCDS1042.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000196154	ENSG00000196154		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10494	protein-coding gene	gene with protein product	"""fibroblast-specific protein-1"""	114210	"""S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"", ""S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"""	MTS1, CAPL		3155863	Standard	NM_019554		Approved	P9KA, 18A2, PEL98, 42A, FSP1	uc001fbz.3	P26447	OTTHUMG00000013546	ENST00000368716.4:c.*72T>-	1.37:g.153516163delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7R8|D3DV46|Q6ICP8	RNA	DEL	-	NULL	ENST00000368716.4	37	NULL	CCDS1042.1	1																																																																																			S100A4	-	-		0.527	S100A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A4	HGNC	protein_coding	OTTHUMT00000037714.1	A	NM_002961		153516163	-1	no_errors	ENST00000468373	ensembl	human	known	70_37	rna	DEL	0.000	-
SET	6418	genome.wustl.edu	37	9	131454136	131454136	+	Splice_Site	SNP	G	G	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:131454136G>C	ENST00000372692.4	+	3	411		c.e3-1		SET_ENST00000322030.8_Splice_Site|SET_ENST00000372688.4_Splice_Site|SET_ENST00000477806.1_Splice_Site|SET_ENST00000409104.3_Splice_Site	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene						DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		ATTTGCTTCAGACTTAATGAA	0.333			T	NUP214	AML																																			Dom	yes		9	9q34	6418	SET translocation		L	0													18.0	18.0	18.0					9																	131454136		2192	4291	6483	SO:0001630	splice_region_variant	6418			M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.171-1G>C	9.37:g.131454136G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	Splice_Site	SNP	-	e3-1	ENST00000372692.4	37	c.171-1	CCDS48037.1	9	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838598	0.71373	.	.	ENSG00000119335	ENST00000372692;ENST00000409104;ENST00000322030;ENST00000372688;ENST00000372686	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3156	0.87222	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SET	130493957	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.075000	0.94004	2.312000	0.78011	0.555000	0.69702	.	SET	-	-		0.333	SET-001	KNOWN	basic|CCDS	protein_coding	SET	HGNC	protein_coding	OTTHUMT00000054476.2	G	NM_001122821	Intron	131454136	+1	no_errors	ENST00000372692	ensembl	human	known	70_37	splice_site	SNP	1.000	C
SIPA1L3	23094	genome.wustl.edu	37	19	38655260	38655260	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr19:38655260G>T	ENST00000222345.6	+	15	4431	c.3922G>T	c.(3922-3924)Gac>Tac	p.D1308Y		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1308					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TGGCTCTAGTGACAGCGGCAT	0.652																																																	0													72.0	62.0	66.0					19																	38655260		2203	4300	6503	SO:0001583	missense	23094			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3922G>T	19.37:g.38655260G>T	ENSP00000222345:p.Asp1308Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TV87	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.D1308Y	ENST00000222345.6	37	c.3922	CCDS33007.1	19	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798097	0.70567	.	.	ENSG00000105738	ENST00000222345	T	0.59224	0.28	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.74527	0.3728	M	0.69523	2.12	0.58432	D	0.999998	D	0.89917	1.0	D	0.76071	0.987	T	0.77887	-0.2420	10	0.59425	D	0.04	-34.2742	16.0588	0.80822	0.0:0.0:1.0:0.0	.	1308	O60292	SI1L3_HUMAN	Y	1308	ENSP00000222345:D1308Y	ENSP00000222345:D1308Y	D	+	1	0	SIPA1L3	43347100	1.000000	0.71417	0.998000	0.56505	0.472000	0.32918	7.627000	0.83176	2.055000	0.61198	0.650000	0.86243	GAC	SIPA1L3	-	NULL		0.652	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	G	XM_032278		38655260	+1	no_errors	ENST00000222345	ensembl	human	known	70_37	missense	SNP	1.000	T
SLAMF9	89886	genome.wustl.edu	37	1	159922138	159922138	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:159922138T>C	ENST00000368093.3	-	3	694	c.578A>G	c.(577-579)gAc>gGc	p.D193G	SLAMF9_ENST00000368092.3_Intron|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	193	Ig-like C2-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGGGCACTGTCCCCCGGCCT	0.582																																																	0													134.0	127.0	129.0					1																	159922138		2203	4300	6503	SO:0001583	missense	89886			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.578A>G	1.37:g.159922138T>C	ENSP00000357072:p.Asp193Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.D193G	ENST00000368093.3	37	c.578	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983062	0.34942	.	.	ENSG00000162723	ENST00000368093	T	0.03358	3.96	5.0	5.0	0.66597	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.447842	0.23819	N	0.044242	T	0.11836	0.0288	M	0.87097	2.86	0.48571	D	0.999674	D	0.76494	0.999	D	0.68943	0.961	T	0.00603	-1.1649	9	.	.	.	-7.5606	11.103	0.48186	0.0:0.0:0.0:1.0	.	193	Q96A28	SLAF9_HUMAN	G	193	ENSP00000357072:D193G	.	D	-	2	0	SLAMF9	158188762	0.085000	0.21516	0.012000	0.15200	0.025000	0.11179	2.397000	0.44477	1.878000	0.54408	0.528000	0.53228	GAC	SLAMF9	-	pfscan_Ig-like		0.582	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	HGNC	protein_coding	OTTHUMT00000060630.1	T	NM_033438		159922138	-1	no_errors	ENST00000368093	ensembl	human	known	70_37	missense	SNP	0.055	C
SLC16A5	9121	genome.wustl.edu	37	17	73100198	73100198	+	Silent	SNP	C	C	T	rs535752297		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr17:73100198C>T	ENST00000450736.2	+	5	1702	c.1287C>T	c.(1285-1287)gtC>gtT	p.V429V	SLC16A5_ENST00000329783.4_Silent_p.V429V|SLC16A5_ENST00000538213.2_Silent_p.V469V|SLC16A5_ENST00000580123.1_Silent_p.V429V			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	429					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	AGCAGGCTGTCGCGGCGGATG	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19694	0.0		0.0	False		,,,				2504	0.0																0													80.0	75.0	77.0					17																	73100198		2203	4300	6503	SO:0001819	synonymous_variant	9121			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.1287C>T	17.37:g.73100198C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E288	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.V429	ENST00000450736.2	37	c.1287	CCDS11713.1	17																																																																																			SLC16A5	-	pfam_MFS,tigrfam_Monocarb_transpt		0.552	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	C	NM_004695		73100198	+1	no_errors	ENST00000329783	ensembl	human	known	70_37	silent	SNP	0.000	T
SLC17A3	10786	genome.wustl.edu	37	6	25855375	25855375	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:25855375A>G	ENST00000360657.3	-	5	760	c.475T>C	c.(475-477)Ttt>Ctt	p.F159L	SLC17A3_ENST00000361703.6_Missense_Mutation_p.F159L|SLC17A3_ENST00000397060.4_Missense_Mutation_p.F237L			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	159					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						AGCTTACCAAAGATATAGAAG	0.403																																																	0													66.0	62.0	64.0					6																	25855375		2203	4300	6503	SO:0001583	missense	10786			U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.475T>C	6.37:g.25855375A>G	ENSP00000353873:p.Phe159Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F237L	ENST00000360657.3	37	c.709	CCDS4566.2	6	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198562	0.58126	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	T;T;T	0.56776	0.44;0.44;0.44	4.05	2.83	0.33086	Major facilitator superfamily domain, general substrate transporter (1);	0.301676	0.24033	N	0.042173	T	0.44808	0.1311	M	0.65677	2.01	0.44927	D	0.997943	P;B;B;P	0.40834	0.73;0.222;0.01;0.701	P;B;B;P	0.49637	0.599;0.159;0.072;0.617	T	0.47497	-0.9113	10	0.62326	D	0.03	.	6.9637	0.24611	0.7957:0.0:0.0:0.2042	.	159;218;237;159	B7Z531;B7Z3L7;B7Z511;O00476	.;.;.;NPT4_HUMAN	L	237;159;159	ENSP00000380250:F237L;ENSP00000353873:F159L;ENSP00000355307:F159L	ENSP00000353873:F159L	F	-	1	0	SLC17A3	25963354	1.000000	0.71417	0.835000	0.33067	0.614000	0.37383	3.839000	0.55835	0.613000	0.30089	0.528000	0.53228	TTT	SLC17A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.403	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	SLC17A3	HGNC	protein_coding	OTTHUMT00000040070.2	A			25855375	-1	no_errors	ENST00000397060	ensembl	human	known	70_37	missense	SNP	0.998	G
SLC45A3	85414	genome.wustl.edu	37	1	205628400	205628400	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:205628400C>T	ENST00000367145.3	-	5	1919	c.1624G>A	c.(1624-1626)Gta>Ata	p.V542I	SLC45A3_ENST00000460934.1_5'UTR	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	542					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			TTGTCAAATACTACCTGTGTA	0.552			T	"""ETV1, ETV5, ELK4, ERG"""	prostate						OREG0014161	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													70.0	70.0	70.0					1																	205628400		2203	4300	6503	SO:0001583	missense	85414			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.1624G>A	1.37:g.205628400C>T	ENSP00000356113:p.Val542Ile	Somatic	2153	WXS	Illumina HiSeq	Phase_IV	A8K2U9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V542I	ENST00000367145.3	37	c.1624	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583568	0.65992	.	.	ENSG00000158715	ENST00000367145	T	0.49720	0.77	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.35770	0.0943	N	0.20986	0.625	0.40696	D	0.982447	B	0.32653	0.379	B	0.33196	0.159	T	0.26395	-1.0104	10	0.45353	T	0.12	-12.2981	13.633	0.62206	0.0:0.925:0.0:0.075	.	542	Q96JT2	S45A3_HUMAN	I	542	ENSP00000356113:V542I	ENSP00000356113:V542I	V	-	1	0	SLC45A3	203895023	0.997000	0.39634	0.954000	0.39281	0.988000	0.76386	3.389000	0.52516	2.677000	0.91161	0.591000	0.81541	GTA	SLC45A3	-	NULL		0.552	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1	C	NM_033102		205628400	-1	no_errors	ENST00000367145	ensembl	human	known	70_37	missense	SNP	0.999	T
SPAG16	79582	genome.wustl.edu	37	2	214794778	214794778	+	Missense_Mutation	SNP	C	C	T	rs142357329	byFrequency	TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:214794778C>T	ENST00000331683.5	+	12	1404	c.1309C>T	c.(1309-1311)Cgc>Tgc	p.R437C	SPAG16_ENST00000374309.3_Missense_Mutation_p.R343C	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	437					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.R437C(2)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		AGGACACAGCCGCGCAGTGTG	0.438																																																	2	Substitution - Missense(2)	prostate(2)						C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	113.0	112.0	113.0		1309	5.5	0.8	2	dbSNP_134	113	0,8600		0,0,4300	no	missense	SPAG16	NM_024532.3	180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging	437/632	214794778	2,13004	2203	4300	6503	SO:0001583	missense	79582			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1309C>T	2.37:g.214794778C>T	ENSP00000332592:p.Arg437Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R437C	ENST00000331683.5	37	c.1309	CCDS2396.1	2	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923469	0.52653	4.54E-4	0.0	ENSG00000144451	ENST00000331683;ENST00000374309	D;D	0.81499	-1.5;-1.5	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.332871	0.28376	N	0.015577	D	0.82674	0.5088	L	0.43923	1.385	0.40789	D	0.983242	D;D;D;D	0.58620	0.983;0.979;0.967;0.983	B;B;P;B	0.53062	0.417;0.409;0.717;0.417	D	0.83392	0.0018	10	0.46703	T	0.11	.	17.8902	0.88870	0.0:1.0:0.0:0.0	.	343;288;377;437	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	C	437;343	ENSP00000332592:R437C;ENSP00000363428:R343C	ENSP00000332592:R437C	R	+	1	0	SPAG16	214503023	0.565000	0.26610	0.839000	0.33178	0.039000	0.13416	3.522000	0.53480	2.550000	0.86006	0.655000	0.94253	CGC	SPAG16	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.438	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG16	HGNC	protein_coding	OTTHUMT00000256601.2	C	NM_024532		214794778	+1	no_errors	ENST00000331683	ensembl	human	known	70_37	missense	SNP	0.998	T
SPATA31E1	286234	genome.wustl.edu	37	9	90499541	90499541	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:90499541C>T	ENST00000325643.5	+	3	466	c.400C>T	c.(400-402)Cgg>Tgg	p.R134W		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	134					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGAGGAGACTCGGGACCTGAA	0.592																																																	0													89.0	90.0	90.0					9																	90499541		2203	4300	6503	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.400C>T	9.37:g.90499541C>T	ENSP00000322640:p.Arg134Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.R134W	ENST00000325643.5	37	c.400	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	10.10	1.256502	0.22965	.	.	ENSG00000177992	ENST00000325643	T	0.03831	3.79	2.05	-0.0221	0.13948	.	2.472990	0.01851	N	0.035927	T	0.03263	0.0095	N	0.17800	0.525	0.09310	N	1	P	0.36647	0.563	B	0.30495	0.116	T	0.30794	-0.9966	10	0.38643	T	0.18	.	2.565	0.04781	0.2829:0.5369:0.0:0.1802	.	134	Q6ZUB1	CI079_HUMAN	W	134	ENSP00000322640:R134W	ENSP00000322640:R134W	R	+	1	2	C9orf79	89689361	0.000000	0.05858	0.000000	0.03702	0.307000	0.27823	-0.800000	0.04555	-0.006000	0.14370	0.508000	0.49915	CGG	SPATA31E1	-	NULL		0.592	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	C	NM_178828		90499541	+1	no_errors	ENST00000325643	ensembl	human	known	70_37	missense	SNP	0.001	T
SRSF9	8683	genome.wustl.edu	37	12	120899902	120899902	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr12:120899902G>A	ENST00000229390.3	-	4	769	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W		NM_003769.2	NP_003760.1	Q13242	SRSF9_HUMAN	serine/arginine-rich splicing factor 9	196	Arg/Ser-rich (RS domain).|Interacts with SAFB1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	9						GACCCAGACCGAGACCGTGAG	0.488																																																	0													52.0	47.0	49.0					12																	120899902		2203	4300	6503	SO:0001583	missense	8683			U30825	CCDS9199.1	12q24.31	2013-02-12	2010-06-22	2010-06-22	ENSG00000111786	ENSG00000111786		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10791	protein-coding gene	gene with protein product	"""SR splicing factor 9"""	601943	"""splicing factor, arginine/serine-rich 9"""	SFRS9		7556075, 20516191	Standard	NM_003769		Approved	SRp30c	uc001tyi.3	Q13242	OTTHUMG00000047790	ENST00000229390.3:c.586C>T	12.37:g.120899902G>A	ENSP00000229390:p.Arg196Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LD1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R196W	ENST00000229390.3	37	c.586	CCDS9199.1	12	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726829	0.69074	.	.	ENSG00000111786	ENST00000229390	T	0.11495	2.77	5.87	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	M	0.62088	1.915	0.80722	D	1	B	0.18310	0.027	B	0.09377	0.004	T	0.03545	-1.1026	10	0.87932	D	0	.	8.1415	0.31086	0.0728:0.0:0.6465:0.2807	.	196	Q13242	SRSF9_HUMAN	W	196	ENSP00000229390:R196W	ENSP00000229390:R196W	R	-	1	2	SRSF9	119384285	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.218000	0.58554	0.897000	0.36392	-0.136000	0.14681	CGG	SRSF9	-	NULL		0.488	SRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF9	HGNC	protein_coding	OTTHUMT00000108983.2	G	NM_003769		120899902	-1	no_errors	ENST00000229390	ensembl	human	known	70_37	missense	SNP	1.000	A
SSX4B	548313	genome.wustl.edu	37	X	48269517	48269517	+	Splice_Site	SNP	C	C	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:48269517C>A	ENST00000376884.2	-	4	242		c.e4-1		SSX4B_ENST00000396928.1_Splice_Site	NM_001034832.3	NP_001030004.1	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			lung(1)	1						ACCTTGAAACCTAGAAAGGAG	0.512																																																	0													6.0	5.0	5.0					X																	48269517		1496	2620	4116	SO:0001630	splice_region_variant	548313				CCDS35241.1, CCDS43935.1	Xp11.23	2008-02-05			ENSG00000198946	ENSG00000269791			16880	protein-coding gene	gene with protein product							Standard	NM_001034832		Approved	OTTHUMT00000056510	uc004djf.2	O60224	OTTHUMG00000021497	ENST00000376884.2:c.185-1G>T	X.37:g.48269517C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYD4|B2RPE3|Q3SYD4|Q5JQZ0|Q9UJU9	Splice_Site	SNP	-	e3-1	ENST00000376884.2	37	c.185-1	CCDS35241.1	X	.	.	.	.	.	.	.	.	.	.	c	2.612	-0.290604	0.05568	.	.	ENSG00000198946	ENST00000376884;ENST00000396928	.	.	.	1.31	1.31	0.21738	.	.	.	.	.	.	.	.	.	.	.	0.22620	N	0.99893	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.678	0.17759	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SSX4B	48154461	0.998000	0.40836	0.008000	0.14137	0.015000	0.08874	2.317000	0.43770	0.969000	0.38237	0.110000	0.15639	.	SSX4B	-	-		0.512	SSX4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX4B	HGNC	protein_coding	OTTHUMT00000056510.2	C		Intron	48269517	-1	no_errors	ENST00000376884	ensembl	human	known	70_37	splice_site	SNP	0.008	A
STAC	6769	genome.wustl.edu	37	3	36534667	36534667	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr3:36534667G>A	ENST00000273183.3	+	6	1012	c.712G>A	c.(712-714)Gag>Aag	p.E238K	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Missense_Mutation_p.E177K	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	238					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						GGAGGTTCCTGAGGAAGCCAA	0.483																																																	0													100.0	102.0	101.0					3																	36534667		2203	4300	6503	SO:0001583	missense	6769			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.712G>A	3.37:g.36534667G>A	ENSP00000273183:p.Glu238Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8S8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.E238K	ENST00000273183.3	37	c.712	CCDS2662.1	3	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885487	0.91814	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687;ENST00000434649	T;T;T	0.76316	-1.01;1.01;0.81	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.86213	0.5879	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.989;0.994	D	0.83863	0.0269	10	0.31617	T	0.26	.	16.5657	0.84588	0.0:0.0:1.0:0.0	.	177;238	E9PEA7;Q99469	.;STAC_HUMAN	K	238;177;170;166	ENSP00000273183:E238K;ENSP00000393713:E177K;ENSP00000398403:E166K	ENSP00000273183:E238K	E	+	1	0	STAC	36509671	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.111000	0.71541	2.723000	0.93209	0.655000	0.94253	GAG	STAC	-	NULL		0.483	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC	HGNC	protein_coding	OTTHUMT00000253338.2	G	NM_003149		36534667	+1	no_errors	ENST00000273183	ensembl	human	known	70_37	missense	SNP	1.000	A
TAS2R14	50840	genome.wustl.edu	37	12	11230560	11230560	+	Intron	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr12:11230560G>A	ENST00000381852.4	-	2	152				TAS2R64P_ENST00000534866.1_RNA|PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						GCCAGATGCTGAAATGGTTGA	0.353																																																	0																																										SO:0001627	intron_variant	338412			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1511-30773C>T	12.37:g.11230560G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q645X3	RNA	SNP	-	NULL	ENST00000381852.4	37	NULL		12																																																																																			TAS2R64P	-	-		0.353	TAS2R14-002	KNOWN	basic	processed_transcript	TAS2R64P	HGNC	protein_coding	OTTHUMT00000402305.1	G	NM_023922		11230560	-1	no_errors	ENST00000534866	ensembl	human	known	70_37	rna	SNP	0.000	A
TBC1D12	23232	genome.wustl.edu	37	10	96234261	96234262	+	Intron	INS	-	-	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr10:96234261_96234262insA	ENST00000225235.4	+	3	1205					NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12								Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				CCTCCACCTCCAAAAAAAAAAC	0.386																																																	0																																										SO:0001627	intron_variant	23232			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1096-163->A	10.37:g.96234271_96234271dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	RNA	INS	-	NULL	ENST00000225235.4	37	NULL	CCDS41553.1	10																																																																																			TBC1D12	-	-		0.386	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D12	HGNC	protein_coding	OTTHUMT00000049482.2	-			96234262	+1	no_errors	ENST00000482498	ensembl	human	known	70_37	rna	INS	0.005:0.000	A
TBC1D2B	23102	genome.wustl.edu	37	15	78316871	78316871	+	Missense_Mutation	SNP	C	C	T	rs201555902		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr15:78316871C>T	ENST00000300584.3	-	6	1096	c.1097G>A	c.(1096-1098)cGa>cAa	p.R366Q	TBC1D2B_ENST00000409931.3_Missense_Mutation_p.R366Q	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	366							Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						CTGGAGCAGTCGAACAAGCTC	0.517																																																	0													40.0	44.0	43.0					15																	78316871		2196	4293	6489	SO:0001583	missense	23102			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.1097G>A	15.37:g.78316871C>T	ENSP00000300584:p.Arg366Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Prefoldin,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.R366Q	ENST00000300584.3	37	c.1097	CCDS45314.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.02|18.02	3.531057|3.531057	0.64972|0.64972	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000418039|ENST00000409931;ENST00000300584;ENST00000435468	.|T;T	.|0.08458	.|3.09;3.09	5.55|5.55	4.63|4.63	0.57726|0.57726	.|.	.|0.055106	.|0.64402	.|N	.|0.000002	T|T	0.08223|0.08223	0.0205|0.0205	L|L	0.41710|0.41710	1.295|1.295	0.54753|0.54753	D|D	0.999985|0.999985	.|B;B	.|0.30033	.|0.266;0.174	.|B;B	.|0.19946	.|0.027;0.007	T|T	0.14476|0.14476	-1.0471|-1.0471	5|10	.|0.44086	.|T	.|0.13	.|.	13.8686|13.8686	0.63603|0.63603	0.0:0.9256:0.0:0.0744|0.0:0.9256:0.0:0.0744	.|.	.|366;366	.|Q9UPU7-2;Q9UPU7	.|.;TBD2B_HUMAN	N|Q	248|366;366;254	.|ENSP00000387165:R366Q;ENSP00000300584:R366Q	.|ENSP00000300584:R366Q	D|R	-|-	1|2	0|0	TBC1D2B|TBC1D2B	76103926|76103926	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.989000|0.989000	0.77384|0.77384	4.527000|4.527000	0.60573|0.60573	1.308000|1.308000	0.44962|0.44962	0.491000|0.491000	0.48974|0.48974	GAC|CGA	TBC1D2B	-	NULL		0.517	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	HGNC	protein_coding	OTTHUMT00000328369.3	C	NM_015079		78316871	-1	no_errors	ENST00000300584	ensembl	human	known	70_37	missense	SNP	0.978	T
TBL1X	6907	genome.wustl.edu	37	X	9660204	9660204	+	Silent	SNP	G	G	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chrX:9660204G>A	ENST00000217964.7	+	9	1441	c.801G>A	c.(799-801)ggG>ggA	p.G267G	TBL1X_ENST00000407597.2_Silent_p.G267G|TBL1X_ENST00000380961.1_Silent_p.G216G|TBL1X_ENST00000536365.1_Silent_p.G216G|TBL1X_ENST00000424279.1_Silent_p.G216G	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	267					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				ATAGCAACGGGGGCTCCACCC	0.498																																																	0													114.0	112.0	113.0					X																	9660204		2203	4300	6503	SO:0001819	synonymous_variant	6907			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.801G>A	X.37:g.9660204G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K044|A8K4J7|Q86UY2	Silent	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G267	ENST00000217964.7	37	c.801	CCDS14133.1	X																																																																																			TBL1X	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.498	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TBL1X	HGNC	protein_coding	OTTHUMT00000055709.1	G	NM_005647		9660204	+1	no_errors	ENST00000217964	ensembl	human	known	70_37	silent	SNP	0.879	A
TINAGL1	64129	genome.wustl.edu	37	1	32050317	32050317	+	Silent	SNP	C	C	T	rs138221549		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:32050317C>T	ENST00000271064.7	+	6	697	c.621C>T	c.(619-621)ttC>ttT	p.F207F	TINAGL1_ENST00000537531.1_3'UTR|TINAGL1_ENST00000457433.2_Silent_p.F176F|TINAGL1_ENST00000481165.1_3'UTR	NM_001204415.1|NM_022164.2	NP_001191344.1|NP_071447.1	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	207					endosomal transport (GO:0016197)|immune response (GO:0006955)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type peptidase activity (GO:0008234)|extracellular matrix structural constituent (GO:0005201)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			breast(2)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		CCACAGCCTTCGAGGCCTCTG	0.607																																																	0								C	,,	1,4405		0,1,2202	92.0	88.0	90.0		528,306,621	-4.6	0.8	1	dbSNP_134	90	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	TINAGL1	NM_001204414.1,NM_001204415.1,NM_022164.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	176/437,102/363,207/468	32050317	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64129			AB050716	CCDS343.1, CCDS55586.1, CCDS72745.1	1p34.3	2014-04-22	2005-08-18	2005-08-18	ENSG00000142910	ENSG00000142910			19168	protein-coding gene	gene with protein product			"""lipocalin 7"", ""TINAG-like 1"""	LCN7		11170462	Standard	NM_022164		Approved	P3ECSL, LIECG3, ARG1, TINAGRP	uc001bta.3	Q9GZM7	OTTHUMG00000003884	ENST00000271064.7:c.621C>T	1.37:g.32050317C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9Q5|B4DPK6|D3DPN8|Q8TEJ9|Q8WZ23|Q96GZ4|Q96JW3	Silent	SNP	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,pfscan_Somatomedin_B_dom	p.F207	ENST00000271064.7	37	c.621	CCDS343.1	1																																																																																			TINAGL1	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C		0.607	TINAGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAGL1	HGNC	protein_coding	OTTHUMT00000011072.1	C	NM_022164		32050317	+1	no_errors	ENST00000271064	ensembl	human	known	70_37	silent	SNP	0.933	T
TLN1	7094	genome.wustl.edu	37	9	35717356	35717356	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr9:35717356C>T	ENST00000314888.9	-	19	2598	c.2245G>A	c.(2245-2247)Ggc>Agc	p.G749S	TLN1_ENST00000540444.1_Missense_Mutation_p.G749S	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	749					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GACACACAGCCCTCCACGGCT	0.582																																																	0													71.0	67.0	68.0					9																	35717356		2203	4300	6503	SO:0001583	missense	7094			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.2245G>A	9.37:g.35717356C>T	ENSP00000316029:p.Gly749Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.G749S	ENST00000314888.9	37	c.2245	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030264	0.35797	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.67865	-0.28;-0.29	5.6	3.77	0.43336	.	0.158151	0.56097	N	0.000026	T	0.52468	0.1736	L	0.42245	1.32	0.58432	D	0.999997	B	0.13145	0.007	B	0.08055	0.003	T	0.38308	-0.9667	10	0.10111	T	0.7	-13.9638	9.7318	0.40366	0.0:0.7888:0.0:0.2112	.	749	Q9Y490	TLN1_HUMAN	S	749	ENSP00000316029:G749S;ENSP00000442981:G749S	ENSP00000316029:G749S	G	-	1	0	TLN1	35707356	0.988000	0.35896	1.000000	0.80357	0.960000	0.62799	1.784000	0.38674	0.749000	0.32854	-0.224000	0.12420	GGC	TLN1	-	NULL		0.582	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	C	NM_006289		35717356	-1	no_errors	ENST00000314888	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM156	80008	genome.wustl.edu	37	4	39000444	39000444	+	Silent	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr4:39000444C>T	ENST00000381938.3	-	2	281	c.174G>A	c.(172-174)gtG>gtA	p.V58V	TMEM156_ENST00000372489.2_5'UTR	NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	58						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						GCAGAAAAGTCACAAAAGAAA	0.363																																																	0													53.0	54.0	54.0					4																	39000444		2203	4300	6503	SO:0001819	synonymous_variant	80008			AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.174G>A	4.37:g.39000444C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H5N9	Silent	SNP	NULL	p.V58	ENST00000381938.3	37	c.174	CCDS3448.1	4																																																																																			TMEM156	-	NULL		0.363	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM156	HGNC	protein_coding	OTTHUMT00000250435.3	C	NM_024943		39000444	-1	no_errors	ENST00000381938	ensembl	human	known	70_37	silent	SNP	0.938	T
TTN	7273	genome.wustl.edu	37	2	179590682	179590682	+	Silent	SNP	C	C	T	rs368422028		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr2:179590682C>T	ENST00000591111.1	-	68	19640	c.19416G>A	c.(19414-19416)ccG>ccA	p.P6472P	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.P6789P|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Silent_p.P5545P|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12074	Ig-like 46.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACCTCAAACGGTGGTGTTC	0.418																																																	0								C	,,,	0,3786		0,0,1893	92.0	88.0	89.0		,16635,,	-5.1	1.0	2		89	1,8261		0,1,4130	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,6023	TT,TC,CC		0.0121,0.0,0.0083	,,,	,5545/33424,,	179590682	1,12047	1893	4131	6024	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19416G>A	2.37:g.179590682C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P5545	ENST00000591111.1	37	c.16635		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179590682	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.558	T
UIMC1	51720	genome.wustl.edu	37	5	176395779	176395779	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr5:176395779G>C	ENST00000377227.4	-	6	1109	c.977C>G	c.(976-978)cCt>cGt	p.P326R	UIMC1_ENST00000511320.1_Missense_Mutation_p.P326R|UIMC1_ENST00000377219.2_Missense_Mutation_p.P326R|UIMC1_ENST00000503273.1_5'UTR|UIMC1_ENST00000506128.1_Intron			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	326	AIR.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)			NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGAGGTCTAGGTAACACTGG	0.443																																																	0													99.0	94.0	96.0					5																	176395779		2203	4300	6503	SO:0001583	missense	51720			AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.977C>G	5.37:g.176395779G>C	ENSP00000366434:p.Pro326Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	p.P326R	ENST00000377227.4	37	c.977	CCDS4408.1	5	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271578	0.59649	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000377220	T;T;T	0.24723	1.85;1.84;1.85	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000003	T	0.47303	0.1438	L	0.59436	1.845	0.52501	D	0.999952	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.36359	-0.9751	10	0.72032	D	0.01	.	13.648	0.62292	0.0704:0.0:0.9296:0.0	.	326;248	Q96RL1;Q96RL1-3	UIMC1_HUMAN;.	R	326;326;326;248	ENSP00000366434:P326R;ENSP00000366425:P326R;ENSP00000421926:P326R	ENSP00000366425:P326R	P	-	2	0	UIMC1	176328385	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.780000	0.68956	2.844000	0.97970	0.650000	0.86243	CCT	UIMC1	-	NULL		0.443	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UIMC1	HGNC	protein_coding	OTTHUMT00000253422.1	G	NM_016290		176395779	-1	no_errors	ENST00000377219	ensembl	human	known	70_37	missense	SNP	0.998	C
XYLB	9942	genome.wustl.edu	37	3	38408351	38408351	+	Missense_Mutation	SNP	A	A	T	rs552902718		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr3:38408351A>T	ENST00000207870.3	+	7	650	c.560A>T	c.(559-561)tAc>tTc	p.Y187F	XYLB_ENST00000542835.1_Missense_Mutation_p.Y50F	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	187					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		CCCGAGGCCTACTCACATACG	0.378																																																	0													83.0	84.0	84.0					3																	38408351		2203	4300	6503	SO:0001583	missense	9942			AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.560A>T	3.37:g.38408351A>T	ENSP00000207870:p.Tyr187Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_C,pfam_Carb_kinase_FGGY_N	p.Y187F	ENST00000207870.3	37	c.560	CCDS2678.1	3	.	.	.	.	.	.	.	.	.	.	a	18.94	3.729377	0.69074	.	.	ENSG00000093217	ENST00000207870;ENST00000542835	T;T	0.16597	2.33;2.33	5.43	4.25	0.50352	Carbohydrate kinase, FGGY, N-terminal (1);	0.190005	0.47093	D	0.000259	T	0.30070	0.0753	M	0.72479	2.2	0.34134	D	0.665541	P;B	0.41848	0.763;0.21	P;P	0.51016	0.656;0.582	T	0.43621	-0.9380	10	0.52906	T	0.07	.	10.0788	0.42377	0.9156:0.0:0.0844:0.0	.	50;187	B4DDT2;O75191	.;XYLB_HUMAN	F	187;50	ENSP00000207870:Y187F;ENSP00000443659:Y50F	ENSP00000207870:Y187F	Y	+	2	0	XYLB	38383355	0.997000	0.39634	0.997000	0.53966	0.982000	0.71751	3.185000	0.50934	2.202000	0.70862	0.449000	0.29647	TAC	XYLB	-	pfam_Carb_kinase_FGGY_N		0.378	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	HGNC	protein_coding	OTTHUMT00000254062.2	A	NM_005108		38408351	+1	no_errors	ENST00000207870	ensembl	human	known	70_37	missense	SNP	0.946	T
ZC3H18	124245	genome.wustl.edu	37	16	88666329	88666329	+	Missense_Mutation	SNP	G	G	A	rs267604676		TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr16:88666329G>A	ENST00000301011.5	+	6	1261	c.1061G>A	c.(1060-1062)cGg>cAg	p.R354Q	ZC3H18_ENST00000452588.2_Missense_Mutation_p.R378Q	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	354						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R354L(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TGGAATTCTCGGATCCCGAGA	0.512																																					Ovarian(121;375 2276 20373 38669)												1	Substitution - Missense(1)	lung(1)											100.0	110.0	107.0					16																	88666329		2198	4300	6498	SO:0001583	missense	124245			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1061G>A	16.37:g.88666329G>A	ENSP00000301011:p.Arg354Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DG4|Q96MP7	Missense_Mutation	SNP	smart_Znf_CCCH	p.R354Q	ENST00000301011.5	37	c.1061	CCDS10967.1	16	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734093	0.69189	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	T;T	0.35048	1.33;1.35	5.16	4.2	0.49525	.	0.054916	0.85682	N	0.000000	T	0.49474	0.1559	M	0.63843	1.955	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.996	P;P;P	0.60345	0.67;0.873;0.67	T	0.42224	-0.9464	10	0.28530	T	0.3	-17.6934	11.6242	0.51136	0.0825:0.0:0.9175:0.0	.	378;378;354	E7ERS3;B4DTK7;Q86VM9	.;.;ZCH18_HUMAN	Q	354;378;378;237	ENSP00000301011:R354Q;ENSP00000416951:R378Q	ENSP00000289509:R378Q	R	+	2	0	ZC3H18	87193830	1.000000	0.71417	0.135000	0.22099	0.813000	0.45954	9.201000	0.95017	1.162000	0.42619	0.561000	0.74099	CGG	ZC3H18	-	NULL		0.512	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1	G	NM_144604		88666329	+1	no_errors	ENST00000301011	ensembl	human	known	70_37	missense	SNP	1.000	A
ZFYVE26	23503	genome.wustl.edu	37	14	68244947	68244947	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr14:68244947C>G	ENST00000347230.4	-	24	4831	c.4693G>C	c.(4693-4695)Gag>Cag	p.E1565Q	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.E1565Q	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1565					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CAGCCCCACTCTTCACACAGT	0.463																																																	0													142.0	137.0	139.0					14																	68244947		2203	4300	6503	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.4693G>C	14.37:g.68244947C>G	ENSP00000251119:p.Glu1565Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E1565Q	ENST00000347230.4	37	c.4693	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349298	0.41599	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.28666	1.74;1.6	6.03	6.03	0.97812	.	0.310631	0.34777	N	0.003690	T	0.32704	0.0838	L	0.46157	1.445	0.47862	D	0.999539	B;B	0.22003	0.063;0.027	B;B	0.21151	0.033;0.012	T	0.03306	-1.1050	10	0.30078	T	0.28	-14.9887	20.5666	0.99351	0.0:1.0:0.0:0.0	.	1565;1565	G3V2D8;Q68DK2	.;ZFY26_HUMAN	Q	1565;1544;1565	ENSP00000251119:E1565Q;ENSP00000450603:E1565Q	ENSP00000251119:E1565Q	E	-	1	0	ZFYVE26	67314700	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.703000	0.37846	2.854000	0.98071	0.655000	0.94253	GAG	ZFYVE26	-	NULL		0.463	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2	C	NM_015346		68244947	-1	no_errors	ENST00000347230	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF318	24149	genome.wustl.edu	37	6	43316363	43316363	+	Splice_Site	SNP	C	C	A			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:43316363C>A	ENST00000361428.2	-	6	2848	c.2771G>T	c.(2770-2772)gGa>gTa	p.G924V	ZNF318_ENST00000318149.3_Splice_Site_p.G924V	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	924					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CAGCATTTCTCCTGAGCAATC	0.418																																																	0													58.0	54.0	56.0					6																	43316363		2203	4300	6503	SO:0001630	splice_region_variant	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2771-1G>T	6.37:g.43316363C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	smart_Znf_U1	p.G924V	ENST00000361428.2	37	c.2771	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233106	0.79688	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.48201	0.82;2.32	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56920	-0.7899	10	0.72032	D	0.01	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	924	Q5VUA4	ZN318_HUMAN	V	924	ENSP00000323032:G924V;ENSP00000354964:G924V	ENSP00000323032:G924V	G	-	2	0	ZNF318	43424341	1.000000	0.71417	0.998000	0.56505	0.463000	0.32649	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	GGA	ZNF318	-	NULL		0.418	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	C	NM_014345	Missense_Mutation	43316363	-1	no_errors	ENST00000361428	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF593	51042	genome.wustl.edu	37	1	26497013	26497013	+	Intron	SNP	C	C	G			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr1:26497013C>G	ENST00000374266.5	+	2	376				RP11-96L14.7_ENST00000433939.1_RNA|RP11-96L14.7_ENST00000414762.1_RNA|RP11-96L14.7_ENST00000407889.2_RNA|ZNF593_ENST00000270812.5_Missense_Mutation_p.A102G|RP11-96L14.7_ENST00000444682.1_RNA|RP11-96L14.7_ENST00000448923.1_RNA	NM_015871.4	NP_056955.2	O00488	ZN593_HUMAN	zinc finger protein 593						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			large_intestine(4)|prostate(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GGGTGCTCAGCAGATAGGGCT	0.522																																																	0													145.0	147.0	147.0					1																	26497013		2203	4300	6503	SO:0001627	intron_variant	51042			D45213	CCDS275.2	1p35.3	2012-10-05			ENSG00000142684	ENSG00000142684			30943	protein-coding gene	gene with protein product						9115366	Standard	NM_015871		Approved	ZT86	uc001bll.4	O00488	OTTHUMG00000007538	ENST00000374266.5:c.263+42C>G	1.37:g.26497013C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4S0|Q5T2H7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,pfscan_Znf_C2H2	p.A102G	ENST00000374266.5	37	c.305	CCDS275.2	1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887416	0.33348	.	.	ENSG00000142684	ENST00000270812	T	0.53206	0.63	4.54	3.63	0.41609	.	.	.	.	.	T	0.40347	0.1113	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24941	-1.0146	5	.	.	.	.	7.8848	0.29644	0.0:0.749:0.161:0.09	.	.	.	.	G	102	ENSP00000270812:A102G	.	A	+	2	0	ZNF593	26369600	0.000000	0.05858	0.005000	0.12908	0.143000	0.21401	0.528000	0.23002	1.037000	0.40024	0.655000	0.94253	GCA	ZNF593	-	NULL		0.522	ZNF593-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF593	HGNC	protein_coding	OTTHUMT00000019842.2	C	NM_015871		26497013	+1	no_errors	ENST00000270812	ensembl	human	putative	70_37	missense	SNP	0.001	G
ZNF750	79755	genome.wustl.edu	37	17	80789577	80789578	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr17:80789577_80789578insC	ENST00000269394.3	-	2	1586_1587	c.753_754insG	c.(751-756)gggctgfs	p.L252fs	TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	252					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATGGTGGCCAGCCCGTGCTCTG	0.564																																																	0																																										SO:0001589	frameshift_variant	79755			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.754dupG	17.37:g.80789580_80789580dupC	ENSP00000269394:p.Leu252fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H899	Frame_Shift_Ins	INS	NULL	p.L251fs	ENST00000269394.3	37	c.754_753	CCDS11819.1	17																																																																																			ZNF750	-	NULL		0.564	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	NM_024702		80789578	-1	no_errors	ENST00000269394	ensembl	human	known	70_37	frame_shift_ins	INS	0.984:0.292	C
ZNF76	7629	genome.wustl.edu	37	6	35260671	35260671	+	Silent	SNP	C	C	T			TCGA-FU-A3TQ-01A-11D-A22X-09	TCGA-FU-A3TQ-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f3d51719-25b7-4d5c-807b-89baeb60773b	3367b5e8-cebb-4e94-baae-17116774c04e	g.chr6:35260671C>T	ENST00000373953.3	+	11	1445	c.1179C>T	c.(1177-1179)gcC>gcT	p.A393A	ZNF76_ENST00000440666.2_Silent_p.A367A|ZNF76_ENST00000339411.5_Silent_p.A393A	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	393					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCTCTGCAGCCGAGGAGAGTC	0.617																																					Esophageal Squamous(52;92 1039 20612 23956 34676)												0													61.0	67.0	65.0					6																	35260671		2203	4300	6503	SO:0001819	synonymous_variant	7629			M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1179C>T	6.37:g.35260671C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQB2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A393	ENST00000373953.3	37	c.1179	CCDS4801.1	6																																																																																			ZNF76	-	NULL		0.617	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	HGNC	protein_coding	OTTHUMT00000040279.2	C	NM_003427		35260671	+1	no_errors	ENST00000373953	ensembl	human	known	70_37	silent	SNP	0.003	T
