#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AOX2P	344454	genome.wustl.edu	37	2	201629486	201629486	+	RNA	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:201629486G>T	ENST00000467645.1	+	0	93					NR_001557.4				aldehyde oxidase 2 pseudogene																		ATTATTGGAAGAAGAAAGGCA	0.388																																																	0																																												344454			AI187776		2q33.2	2013-09-26	2008-05-22	2008-05-22	ENSG00000243478	ENSG00000243478			18450	pseudogene	pseudogene			"""aldehyde oxidase 2"""	AOX2		11562361	Standard	NR_001557		Approved	AOH2	uc031rqn.1		OTTHUMG00000154538		2.37:g.201629486G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000467645.1	37	NULL		2																																																																																			AOX2P	-	-		0.388	AOX2P-001	KNOWN	basic	processed_transcript	AOX2P	HGNC	pseudogene	OTTHUMT00000335853.4	G	NR_001557		201629486	+1	no_errors	ENST00000467645	ensembl	human	known	70_37	rna	SNP	1.000	T
APBB1IP	54518	genome.wustl.edu	37	10	26790038	26790038	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr10:26790038C>A	ENST00000376236.4	+	5	906	c.451C>A	c.(451-453)Cag>Aag	p.Q151K	APBB1IP_ENST00000356785.4_Missense_Mutation_p.Q151K	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	151					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						ACCTCTCTCTCAGGTAAGTAT	0.498																																																	0													150.0	136.0	141.0					10																	26790038		2203	4300	6503	SO:0001583	missense	54518			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.451C>A	10.37:g.26790038C>A	ENSP00000365411:p.Gln151Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.Q151K	ENST00000376236.4	37	c.451	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	C	4.117	0.019860	0.08006	.	.	ENSG00000077420	ENST00000445780;ENST00000376236;ENST00000356785	T	0.28454	1.61	5.84	1.46	0.22682	.	0.476977	0.25994	N	0.026998	T	0.15219	0.0367	N	0.05574	-0.02	0.21740	N	0.999567	B;B;B	0.14438	0.0;0.001;0.01	B;B;B	0.09377	0.0;0.002;0.004	T	0.23119	-1.0197	10	0.87932	D	0	.	9.9821	0.41819	0.4029:0.4722:0.1249:0.0	.	151;151;151	B4E100;Q7Z5R6;Q8IYL7	.;AB1IP_HUMAN;.	K	151	ENSP00000365411:Q151K	ENSP00000349237:Q151K	Q	+	1	0	APBB1IP	26830044	1.000000	0.71417	0.960000	0.40013	0.663000	0.39108	1.332000	0.33805	0.306000	0.22856	0.563000	0.77884	CAG	APBB1IP	-	NULL		0.498	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	C	NM_019043		26790038	+1	no_errors	ENST00000376236	ensembl	human	known	70_37	missense	SNP	0.996	A
APOL5	80831	genome.wustl.edu	37	22	36122624	36122624	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr22:36122624C>T	ENST00000249044.2	+	3	509	c.509C>T	c.(508-510)tCa>tTa	p.S170L		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	170					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						CTCATGCTCTCAGCAACTGGG	0.542																																																	0													68.0	73.0	71.0					22																	36122624		2203	4299	6502	SO:0001583	missense	80831			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.509C>T	22.37:g.36122624C>T	ENSP00000249044:p.Ser170Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TFL9|Q9UGW5	Missense_Mutation	SNP	pfam_ApoL	p.S170L	ENST00000249044.2	37	c.509	CCDS13920.1	22	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657171	0.29425	.	.	ENSG00000128313	ENST00000249044	T	0.03635	3.86	3.6	3.6	0.41247	.	0.106321	0.40222	U	0.001146	T	0.09730	0.0239	L	0.37466	1.105	0.21762	N	0.999559	D	0.89917	1.0	D	0.91635	0.999	T	0.16808	-1.0390	10	0.30078	T	0.28	.	12.1741	0.54176	0.0:1.0:0.0:0.0	.	170	Q9BWW9	APOL5_HUMAN	L	170	ENSP00000249044:S170L	ENSP00000249044:S170L	S	+	2	0	APOL5	34452570	0.003000	0.15002	0.026000	0.17262	0.009000	0.06853	1.549000	0.36212	1.582000	0.49881	0.655000	0.94253	TCA	APOL5	-	pfam_ApoL		0.542	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL5	HGNC	protein_coding	OTTHUMT00000318979.1	C	NM_030642		36122624	+1	no_errors	ENST00000249044	ensembl	human	known	70_37	missense	SNP	0.580	T
ARMC5	79798	genome.wustl.edu	37	16	31476046	31476046	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr16:31476046C>T	ENST00000563544.1	+	5	2248	c.1702C>T	c.(1702-1704)Cgc>Tgc	p.R568C	ARMC5_ENST00000412665.2_Missense_Mutation_p.R212C|ARMC5_ENST00000268314.4_Missense_Mutation_p.R568C|ARMC5_ENST00000408912.3_Missense_Mutation_p.R663C|ARMC5_ENST00000457010.2_Missense_Mutation_p.R568C|ARMC5_ENST00000538189.1_Missense_Mutation_p.R600C			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	568										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						ACGTGCACTGCGCATTCTGTC	0.721																																																	0													13.0	15.0	15.0					16																	31476046		2133	4238	6371	SO:0001583	missense	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1702C>T	16.37:g.31476046C>T	ENSP00000456877:p.Arg568Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_BTB/POZ_fold,smart_Armadillo,pfscan_Armadillo,pfscan_BTB/POZ-like	p.R663C	ENST00000563544.1	37	c.1987	CCDS45472.1	16	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341428	0.41498	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010;ENST00000412665	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	5.97	3.94	0.45596	Armadillo-like helical (1);Armadillo-type fold (1);	0.106718	0.64402	D	0.000007	T	0.23171	0.0560	L	0.38175	1.15	0.51012	D	0.999908	D;D;D;P;P	0.54397	0.966;0.966;0.966;0.869;0.869	P;B;B;B;B	0.46825	0.528;0.378;0.378;0.378;0.259	T	0.00436	-1.1740	10	0.59425	D	0.04	-16.6216	8.8273	0.35063	0.1517:0.7694:0.0:0.079	.	600;600;663;568;568	B4DH27;F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;.;ARMC5_HUMAN;.	C	663;600;568;568;212	ENSP00000386125:R663C;ENSP00000443995:R600C;ENSP00000268314:R568C;ENSP00000399561:R568C;ENSP00000400183:R212C	ENSP00000268314:R568C	R	+	1	0	ARMC5	31383547	0.996000	0.38824	0.969000	0.41365	0.088000	0.18126	3.028000	0.49705	2.837000	0.97791	0.655000	0.94253	CGC	ARMC5	-	superfamily_ARM-type_fold		0.721	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	HGNC	protein_coding	OTTHUMT00000432847.1	C	NM_024742		31476046	+1	no_errors	ENST00000408912	ensembl	human	known	70_37	missense	SNP	0.984	T
ARMCX5	64860	genome.wustl.edu	37	X	101858743	101858743	+	Silent	SNP	C	C	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chrX:101858743C>G	ENST00000604957.1	+	1	4296	c.1674C>G	c.(1672-1674)ctC>ctG	p.L558L	ARMCX5_ENST00000536530.1_Silent_p.L558L|ARMCX5_ENST00000246174.2_Silent_p.L558L|ARMCX5_ENST00000372742.1_Silent_p.L558L|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000537008.1_Silent_p.L558L|ARMCX5_ENST00000541409.1_Silent_p.L558L|RP4-769N13.7_ENST00000602441.1_RNA	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	558										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TACTAAAACTCTGAATACCCC	0.353																																																	0													69.0	71.0	70.0					X																	101858743		2199	4293	6492	SO:0001819	synonymous_variant	64860				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1674C>G	X.37:g.101858743C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.L558	ENST00000604957.1	37	c.1674	CCDS14500.1	X																																																																																			ARMCX5	-	superfamily_ARM-type_fold		0.353	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX5	HGNC	protein_coding	OTTHUMT00000469659.1	C	NM_022838		101858743	+1	no_errors	ENST00000246174	ensembl	human	known	70_37	silent	SNP	0.997	G
ASB3	51130	genome.wustl.edu	37	2	53831950	53831950	+	IGR	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:53831950G>C								RNU6-997P (34333 upstream) : AC008064.1 (46587 downstream)																							CAGCTTCTTAGAGCTGTAACA	0.448																																																	0																																										SO:0001628	intergenic_variant	51130																															2.37:g.53831950G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		2																																																																																			ASB3	-	-	0	0.448					ASB3	HGNC			G			53831950	-1	no_errors	ENST00000482339	ensembl	human	known	70_37	rna	SNP	0.000	C
ATP11B	23200	genome.wustl.edu	37	3	182597360	182597360	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:182597360G>A	ENST00000323116.5	+	20	2589	c.2329G>A	c.(2329-2331)Gaa>Aaa	p.E777K		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	777					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CAGGGAGCATGAAAAACTATT	0.368																																																	0													103.0	103.0	103.0					3																	182597360		2203	4300	6503	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.2329G>A	3.37:g.182597360G>A	ENSP00000321195:p.Glu777Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96FN1|Q9UKK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.E777K	ENST00000323116.5	37	c.2329	CCDS33896.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.897008|3.897008	0.72639|0.72639	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000323116;ENST00000482070|ENST00000498086	D;D|.	0.83992|.	-1.79;-1.79|.	4.78|4.78	4.78|4.78	0.61160|0.61160	HAD-like domain (1);|.	0.103621|.	0.64402|.	D|.	0.000003|.	T|T	0.58892|0.58892	0.2154|0.2154	L|L	0.35487|0.35487	1.065|1.065	0.80722|0.80722	D|D	1|1	P;B|.	0.52170|.	0.951;0.001|.	P;B|.	0.56216|.	0.794;0.003|.	T|T	0.54827|0.54827	-0.8235|-0.8235	10|5	0.13108|.	T|.	0.6|.	.|.	17.9966|17.9966	0.89185|0.89185	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	351;777|.	B3KSJ2;Q9Y2G3|.	.;AT11B_HUMAN|.	K|I	777;12|577	ENSP00000321195:E777K;ENSP00000417124:E12K|.	ENSP00000321195:E777K|.	E|M	+|+	1|3	0|0	ATP11B|ATP11B	184080054|184080054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	9.197000|9.197000	0.94985|0.94985	2.475000|2.475000	0.83589|0.83589	0.585000|0.585000	0.79938|0.79938	GAA|ATG	ATP11B	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl		0.368	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	HGNC	protein_coding	OTTHUMT00000350598.1	G	NM_014616		182597360	+1	no_errors	ENST00000323116	ensembl	human	known	70_37	missense	SNP	1.000	A
ATP8B3	148229	genome.wustl.edu	37	19	1785271	1785271	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:1785271G>C	ENST00000310127.6	-	27	3657	c.3419C>G	c.(3418-3420)aCc>aGc	p.T1140S	ATP8B3_ENST00000539485.1_Missense_Mutation_p.T1150S|ATP8B3_ENST00000525591.1_Missense_Mutation_p.T1103S	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1140					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACAGGGCGGTCCAGTACTT	0.607																																																	0													40.0	50.0	46.0					19																	1785271		2192	4289	6481	SO:0001583	missense	148229			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3419C>G	19.37:g.1785271G>C	ENSP00000311336:p.Thr1140Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.T1150S	ENST00000310127.6	37	c.3449	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304095	0.40795	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.61859	0.07;0.07;0.07	4.49	2.26	0.28386	.	0.055995	0.64402	D	0.000001	T	0.73513	0.3596	M	0.84585	2.705	0.30883	N	0.731167	P;D	0.63880	0.911;0.993	P;P	0.59487	0.727;0.858	T	0.77705	-0.2488	10	0.87932	D	0	.	13.4614	0.61229	0.0:0.3004:0.6996:0.0	.	1140;1103	O60423;Q7Z485	AT8B3_HUMAN;.	S	1140;1150;1103	ENSP00000311336:T1140S;ENSP00000443574:T1150S;ENSP00000437115:T1103S	ENSP00000311336:T1140S	T	-	2	0	ATP8B3	1736271	1.000000	0.71417	0.866000	0.34008	0.086000	0.17979	5.074000	0.64401	0.308000	0.22923	-0.150000	0.13652	ACC	ATP8B3	-	NULL		0.607	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	G	NM_138813		1785271	-1	no_errors	ENST00000539485	ensembl	human	known	70_37	missense	SNP	0.986	C
C2orf16	84226	genome.wustl.edu	37	2	27803001	27803001	+	Missense_Mutation	SNP	G	G	A	rs199693170		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:27803001G>A	ENST00000408964.2	+	1	3613	c.3562G>A	c.(3562-3564)Gtc>Atc	p.V1188I	ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1188						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AGATAGACCCGTCATACGGAG	0.453																																																	0													93.0	92.0	92.0					2																	27803001		1931	4134	6065	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3562G>A	2.37:g.27803001G>A	ENSP00000386190:p.Val1188Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.V1188I	ENST00000408964.2	37	c.3562	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	0	-2.744380	0.00087	.	.	ENSG00000221843	ENST00000408964	T	0.05025	3.51	5.19	-10.4	0.00318	.	.	.	.	.	T	0.01905	0.0060	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46978	-0.9152	9	0.05959	T	0.93	.	15.1402	0.72604	0.0999:0.0:0.7229:0.1772	.	1188	Q68DN1	CB016_HUMAN	I	1188	ENSP00000386190:V1188I	ENSP00000386190:V1188I	V	+	1	0	C2orf16	27656505	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.289000	0.01149	-2.544000	0.00483	-1.832000	0.00591	GTC	C2orf16	-	NULL		0.453	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	G	NM_032266		27803001	+1	no_errors	ENST00000408964	ensembl	human	known	70_37	missense	SNP	0.000	A
CDC25B	994	genome.wustl.edu	37	20	3782721	3782721	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr20:3782721G>A	ENST00000245960.5	+	10	1769	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	CDC25B_ENST00000439880.2_Missense_Mutation_p.E344K|CDC25B_ENST00000379598.5_Missense_Mutation_p.E267K|CDC25B_ENST00000344256.6_Missense_Mutation_p.E294K|CDC25B_ENST00000340833.4_Missense_Mutation_p.E317K|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	358					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GACCCCTCCTGAGGAGCAGCA	0.647																																																	0													31.0	27.0	28.0					20																	3782721		2184	4268	6452	SO:0001583	missense	994				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1072G>A	20.37:g.3782721G>A	ENSP00000245960:p.Glu358Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.E358K	ENST00000245960.5	37	c.1072	CCDS13067.1	20	.	.	.	.	.	.	.	.	.	.	G	11.02	1.515924	0.27123	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	4.62	3.65	0.41850	.	0.314966	0.30329	N	0.009867	T	0.24928	0.0605	L	0.44542	1.39	0.26074	N	0.981172	P;P;P;B;P;P	0.46512	0.772;0.879;0.772;0.218;0.604;0.772	B;P;B;B;B;B	0.46796	0.428;0.527;0.428;0.047;0.22;0.403	T	0.06991	-1.0796	10	0.18710	T	0.47	.	11.369	0.49690	0.0976:0.0:0.9024:0.0	.	267;280;294;317;344;358	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	K	294;267;358;344;317	ENSP00000339125:E294K;ENSP00000368918:E267K;ENSP00000245960:E358K;ENSP00000405972:E344K;ENSP00000339170:E317K	ENSP00000245960:E358K	E	+	1	0	CDC25B	3730721	.	.	0.401000	0.26359	0.485000	0.33311	.	.	2.288000	0.76882	0.591000	0.81541	GAG	CDC25B	-	pfam_MPI_Phosphatase		0.647	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	HGNC	protein_coding	OTTHUMT00000077779.2	G	NM_021874		3782721	+1	no_errors	ENST00000245960	ensembl	human	known	70_37	missense	SNP	0.426	A
COL6A5	256076	genome.wustl.edu	37	3	130095415	130095415	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:130095415C>G	ENST00000432398.2	+	3	897	c.403C>G	c.(403-405)Ccc>Gcc	p.P135A	COL6A5_ENST00000265379.6_Missense_Mutation_p.P135A	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	135	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GAAACAGTTTCCCCCAATTTT	0.522																																																	0													55.0	58.0	57.0					3																	130095415		692	1591	2283	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.403C>G	3.37:g.130095415C>G	ENSP00000390895:p.Pro135Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.P135A	ENST00000432398.2	37	c.403		3	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385450	0.25031	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.84442	-1.85;-1.85	5.14	5.14	0.70334	.	.	.	.	.	D	0.91895	0.7434	M	0.81239	2.535	0.31225	N	0.69696	D	0.89917	1.0	D	0.97110	1.0	D	0.90601	0.4544	9	0.72032	D	0.01	.	11.9715	0.53065	0.0:0.915:0.0:0.085	.	135	A8TX70-2	.	A	135	ENSP00000390895:P135A;ENSP00000265379:P135A	ENSP00000265379:P135A	P	+	1	0	COL6A5	131578105	0.998000	0.40836	0.995000	0.50966	0.157000	0.22087	3.802000	0.55553	2.552000	0.86080	0.557000	0.71058	CCC	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.522	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		C	NM_153264		130095415	+1	no_errors	ENST00000265379	ensembl	human	known	70_37	missense	SNP	1.000	G
CRK	1398	genome.wustl.edu	37	17	1326754	1326755	+	3'UTR	INS	-	-	A	rs76288901		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr17:1326754_1326755insA	ENST00000300574.2	-	0	1107_1108				CRK_ENST00000574295.1_Intron|RP11-818O24.3_ENST00000570924.1_RNA|RP11-818O24.3_ENST00000576825.1_RNA|CRK_ENST00000572145.1_5'UTR|CRK_ENST00000398970.5_3'UTR	NM_016823.3	NP_058431.2	P46108	CRK_HUMAN	v-crk avian sarcoma virus CT10 oncogene homolog						activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|ephrin receptor signaling pathway (GO:0048013)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Rho GTPase activity (GO:0032319)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|SH2 domain binding (GO:0042169)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)	9				UCEC - Uterine corpus endometrioid carcinoma (25;0.083)		ATGGCAGTTGGAAAAAAAAAAA	0.366																																																	0																																										SO:0001624	3_prime_UTR_variant	1398			D10656	CCDS11002.1, CCDS45561.1	17p13	2013-07-09	2013-07-09		ENSG00000167193	ENSG00000167193		"""SH2 domain containing"""	2362	protein-coding gene	gene with protein product		164762				1690891	Standard	NM_005206		Approved		uc002fsl.3	P46108	OTTHUMG00000090317	ENST00000300574.2:c.*53->T	17.37:g.1326765_1326765dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWE8|B0LPE8|D3DTH6|Q96GA9|Q96HJ0	RNA	INS	-	NULL	ENST00000300574.2	37	NULL	CCDS11002.1	17																																																																																			CRK	-	-		0.366	CRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRK	HGNC	protein_coding	OTTHUMT00000206679.1	-	NM_016823		1326755	-1	no_errors	ENST00000572145	ensembl	human	known	70_37	rna	INS	0.637:0.352	A
CROCC	9696	genome.wustl.edu	37	1	17280578	17280578	+	Intron	SNP	T	T	C	rs147342078	byFrequency	TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr1:17280578T>C	ENST00000375541.5	+	22	3255				CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGGGCTGCATGTCTGCCCTG	0.597													C|||	3394	0.677716	0.5787	0.7435	5008	,	,		36770	0.748		0.675	False		,,,				2504	0.6953																0																																										SO:0001627	intron_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3187-140T>C	1.37:g.17280578T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000375541.5	37	NULL	CCDS30616.1	1																																																																																			CROCC	-	-		0.597	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	T	NM_014675		17280578	+1	no_errors	ENST00000494191	ensembl	human	known	70_37	rna	SNP	0.000	C
RTP5	285093	genome.wustl.edu	37	2	242812025	242812025	+	Silent	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:242812025G>A	ENST00000343216.3	+	1	145	c.117G>A	c.(115-117)ctG>ctA	p.L39L		NM_173821.2	NP_776182.2																					CGGGATGCCTGGACGGCGGTG	0.667																																																	0													27.0	36.0	33.0					2																	242812025		2041	4194	6235	SO:0001819	synonymous_variant	0																														ENST00000343216.3:c.117G>A	2.37:g.242812025G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.L39	ENST00000343216.3	37	c.117	CCDS42843.1	2																																																																																			CXXC11	-	NULL		0.667	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	G			242812025	+1	no_errors	ENST00000343216	ensembl	human	known	70_37	silent	SNP	0.036	A
EFHB	151651	genome.wustl.edu	37	3	19974996	19974996	+	Missense_Mutation	SNP	T	T	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:19974996T>G	ENST00000295824.9	-	1	676	c.515A>C	c.(514-516)gAa>gCa	p.E172A	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Intron	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	172							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						AGACTCTTTTTCCATTTCCTG	0.502																																																	0													107.0	110.0	109.0					3																	19974996		2203	4300	6503	SO:0001583	missense	151651			AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.515A>C	3.37:g.19974996T>G	ENSP00000295824:p.Glu172Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E172A	ENST00000295824.9	37	c.515	CCDS33715.2	3	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651956	0.29336	.	.	ENSG00000163576	ENST00000295824;ENST00000389256	T;T	0.35605	1.3;1.54	3.75	1.4	0.22301	.	.	.	.	.	T	0.24084	0.0583	L	0.42245	1.32	0.26072	N	0.981206	P	0.37061	0.58	B	0.32211	0.142	T	0.11372	-1.0590	8	.	.	.	-14.3375	5.1413	0.14961	0.0:0.243:0.0:0.757	.	172	Q8N7U6	EFHB_HUMAN	A	172	ENSP00000295824:E172A;ENSP00000373908:E172A	.	E	-	2	0	EFHB	19950000	0.000000	0.05858	0.268000	0.24571	0.084000	0.17831	-0.174000	0.09839	0.312000	0.23038	0.459000	0.35465	GAA	EFHB	-	NULL		0.502	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHB	HGNC	protein_coding	OTTHUMT00000318673.2	T	NM_144715		19974996	-1	no_errors	ENST00000295824	ensembl	human	known	70_37	missense	SNP	0.382	G
FBXL12	54850	genome.wustl.edu	37	19	9931255	9931255	+	5'Flank	SNP	T	T	C	rs71188840|rs368108275		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:9931255T>C	ENST00000247977.4	-	0	0				FBXL12_ENST00000589626.1_5'Flank|FBXL12_ENST00000586073.1_5'Flank|FBXL12_ENST00000592067.1_5'Flank|FBXL12_ENST00000586651.1_5'Flank|SNORA70_ENST00000363367.1_RNA|FBXL12_ENST00000586469.1_5'Flank|FBXL12_ENST00000588922.1_5'Flank|AC008752.1_ENST00000401283.1_RNA|FBXL12_ENST00000585379.1_Intron	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						tatatatatatataCACACAC	0.448																																																	0																																										SO:0001631	upstream_gene_variant	0			AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8			19.37:g.9931255T>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSJ8|Q9H5K4	RNA	SNP	-	NULL	ENST00000247977.4	37	NULL	CCDS12218.1	19																																																																																			AC008752.1	-	-		0.448	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216102	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000450265.1	T	NM_017703		9931255	+1	no_errors	ENST00000401283	ensembl	human	novel	70_37	rna	SNP	0.000	C
RP11-782C8.2	0	genome.wustl.edu	37	1	143209751	143209751	+	lincRNA	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr1:143209751G>T	ENST00000412204.2	-	0	1319				RP11-782C8.1_ENST00000438000.1_lincRNA																							GCTGTGTTTGGCTTAGGTCGT	0.358																																																	0																																												0																															1.37:g.143209751G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			BX571672.2	-	-		0.358	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	G			143209751	-1	no_errors	ENST00000412204	ensembl	human	known	70_37	rna	SNP	0.023	T
EPHA4	2043	genome.wustl.edu	37	2	222291250	222291250	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:222291250C>T	ENST00000281821.2	-	16	2821	c.2780G>A	c.(2779-2781)cGg>cAg	p.R927Q	EPHA4_ENST00000409854.1_Missense_Mutation_p.R927Q|EPHA4_ENST00000469354.1_5'Flank|EPHA4_ENST00000409938.1_Missense_Mutation_p.R927Q|EPHA4_ENST00000392071.4_Missense_Mutation_p.R876Q	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	927	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.R927L(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ATCCTTATACCGGTCCATTTT	0.478																																																	2	Substitution - Missense(2)	lung(2)											82.0	73.0	76.0					2																	222291250		2203	4300	6503	SO:0001583	missense	2043			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2780G>A	2.37:g.222291250C>T	ENSP00000281821:p.Arg927Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R927Q	ENST00000281821.2	37	c.2780	CCDS2447.1	2	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364804	0.24684	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.77	5.77	0.91146	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	N	0.21508	0.67	0.80722	D	1	B	0.27068	0.167	B	0.17722	0.019	T	0.68640	-0.5355	10	0.10902	T	0.67	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	927	P54764	EPHA4_HUMAN	Q	927;927;927;876	ENSP00000281821:R927Q;ENSP00000386276:R927Q;ENSP00000386829:R927Q;ENSP00000375923:R876Q	ENSP00000281821:R927Q	R	-	2	0	EPHA4	221999494	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.947000	0.63583	2.723000	0.93209	0.655000	0.94253	CGG	EPHA4	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_SAM		0.478	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	C			222291250	-1	no_errors	ENST00000281821	ensembl	human	known	70_37	missense	SNP	1.000	T
EXOC3L4	91828	genome.wustl.edu	37	14	103566619	103566619	+	Silent	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr14:103566619G>A	ENST00000380069.3	+	1	139	c.63G>A	c.(61-63)gaG>gaA	p.E21E	RP11-736N17.8_ENST00000559843.1_RNA	NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	21					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						AGGCTGAGGAGCCACAGACTC	0.647																																																	0													20.0	21.0	21.0					14																	103566619		2202	4294	6496	SO:0001819	synonymous_variant	91828			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.63G>A	14.37:g.103566619G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CR2	Silent	SNP	pfam_Sec6	p.E21	ENST00000380069.3	37	c.63	CCDS32163.1	14																																																																																			EXOC3L4	-	NULL		0.647	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	HGNC	protein_coding	OTTHUMT00000415663.1	G	XM_941093		103566619	+1	no_errors	ENST00000380069	ensembl	human	known	70_37	silent	SNP	0.000	A
FAM3A	60343	genome.wustl.edu	37	X	153741234	153741234	+	Missense_Mutation	SNP	C	C	T	rs181188384		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chrX:153741234C>T	ENST00000447601.2	-	2	506	c.40G>A	c.(40-42)Gtc>Atc	p.V14I	FAM3A_ENST00000393572.1_Intron|FAM3A_ENST00000369641.3_Missense_Mutation_p.V14I|FAM3A_ENST00000434658.2_Missense_Mutation_p.V14I|FAM3A_ENST00000369643.1_Missense_Mutation_p.V14I|FAM3A_ENST00000359889.5_Missense_Mutation_p.V14I|FAM3A_ENST00000492763.1_5'UTR	NM_021806.2	NP_068578.2	P98173	FAM3A_HUMAN	family with sequence similarity 3, member A	14						extracellular region (GO:0005576)				kidney(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCACACTGACGACTAGGACC	0.592													c|||	1	0.000264901	0.0	0.0	3775	,	,		14778	0.0		0.001	False		,,,				2504	0.0																0													148.0	106.0	120.0					X																	153741234		2203	4300	6503	SO:0001583	missense	60343			X74610	CCDS35453.1, CCDS55542.1, CCDS55543.1, CCDS76060.1	Xq28	2008-07-29			ENSG00000071889	ENSG00000071889			13749	protein-coding gene	gene with protein product		300492				8733135, 8281148	Standard	NM_021806		Approved	DXS560S, 2-19, XAP-7	uc004fls.2	P98173	OTTHUMG00000013418	ENST00000447601.2:c.40G>A	X.37:g.153741234C>T	ENSP00000416146:p.Val14Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6QRH6|B2RBI7|B4DFI8|D3DWX4|Q5HY76|Q96H51	Missense_Mutation	SNP	NULL	p.V14I	ENST00000447601.2	37	c.40	CCDS35453.1	X	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	2.981	-0.210413	0.06140	.	.	ENSG00000071889	ENST00000434658;ENST00000359889;ENST00000369643;ENST00000447601;ENST00000369641;ENST00000426266	T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86	4.61	-4.05	0.03998	.	0.430348	0.20823	N	0.085027	T	0.06371	0.0164	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24835	-1.0149	10	0.15066	T	0.55	.	1.6439	0.02758	0.1681:0.148:0.1926:0.4913	.	14;14	B4DFI8;P98173	.;FAM3A_HUMAN	I	14	ENSP00000396243:V14I;ENSP00000352955:V14I;ENSP00000358657:V14I;ENSP00000416146:V14I;ENSP00000358655:V14I;ENSP00000396845:V14I	ENSP00000320521:V14I	V	-	1	0	FAM3A	153394428	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-1.255000	0.02872	-0.662000	0.05338	-0.430000	0.05897	GTC	FAM3A	-	NULL		0.592	FAM3A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3A	HGNC	protein_coding	OTTHUMT00000037362.2	C			153741234	-1	no_errors	ENST00000359889	ensembl	human	known	70_37	missense	SNP	0.000	T
FAM86B3P	286042	genome.wustl.edu	37	8	8095990	8095990	+	RNA	SNP	C	C	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr8:8095990C>G	ENST00000310542.3	+	0	0				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		CCAGGAGCCCCGAGACCTGCA	0.647																																																	0																																												286042					8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8095990C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000310542.3	37	NULL		8																																																																																			FAM86B3P	-	-		0.647	FAM86B3P-005	KNOWN	basic	processed_transcript	FAM86B3P	HGNC	pseudogene	OTTHUMT00000448496.1	C			8095990	+1	no_errors	ENST00000590591	ensembl	human	known	70_37	rna	SNP	0.013	G
FCGRT	2217	genome.wustl.edu	37	19	50027862	50027862	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:50027862C>T	ENST00000221466.5	+	5	1186	c.700C>T	c.(700-702)Cgg>Tgg	p.R234W	FCGRT_ENST00000596975.1_Missense_Mutation_p.R142W|FCGRT_ENST00000426395.3_Missense_Mutation_p.R234W|FCGRT_ENST00000594823.1_3'UTR|FCGRT_ENST00000599988.1_Intron	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	234	Alpha-3.|Ig-like C1-type.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		GCTGCAACTTCGGTTCCTGCG	0.637																																																	0													71.0	62.0	65.0					19																	50027862		2203	4300	6503	SO:0001583	missense	2217			U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.700C>T	19.37:g.50027862C>T	ENSP00000221466:p.Arg234Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.R234W	ENST00000221466.5	37	c.700	CCDS12770.1	19	.	.	.	.	.	.	.	.	.	.	C	11.96	1.795175	0.31777	.	.	ENSG00000104870	ENST00000221466;ENST00000426395	T;T	0.03035	4.07;4.07	4.48	-0.541	0.11858	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.355797	0.17909	N	0.157932	T	0.11324	0.0276	M	0.65677	2.01	0.09310	N	0.999999	D	0.89917	1.0	D	0.71870	0.975	T	0.03887	-1.0995	10	0.87932	D	0	.	7.0924	0.25291	0.4957:0.3429:0.1615:0.0	.	234	P55899	FCGRN_HUMAN	W	234	ENSP00000221466:R234W;ENSP00000410798:R234W	ENSP00000221466:R234W	R	+	1	2	FCGRT	54719674	0.000000	0.05858	0.005000	0.12908	0.028000	0.11728	0.357000	0.20199	0.219000	0.20840	0.462000	0.41574	CGG	FCGRT	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like		0.637	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGRT	HGNC	protein_coding	OTTHUMT00000465267.1	C			50027862	+1	no_errors	ENST00000221466	ensembl	human	known	70_37	missense	SNP	0.000	T
FERD3L	222894	genome.wustl.edu	37	7	19184752	19184752	+	Silent	SNP	C	C	T	rs73079402		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr7:19184752C>T	ENST00000275461.3	-	1	292	c.234G>A	c.(232-234)gaG>gaA	p.E78E	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	78	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						gctcctcttcctcctcctctt	0.627																																																	0													71.0	51.0	58.0					7																	19184752		2203	4300	6503	SO:0001819	synonymous_variant	222894			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.234G>A	7.37:g.19184752C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q495K0	Silent	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.E78	ENST00000275461.3	37	c.234	CCDS5368.1	7																																																																																			FERD3L	-	NULL		0.627	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	C			19184752	-1	no_errors	ENST00000275461	ensembl	human	known	70_37	silent	SNP	0.998	T
FJX1	24147	genome.wustl.edu	37	11	35641435	35641435	+	Silent	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:35641435C>T	ENST00000317811.4	+	1	1701	c.1251C>T	c.(1249-1251)ctC>ctT	p.L417L	FJX1_ENST00000532914.1_3'UTR	NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)	417					retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				AGCGCCGCCTCGACTTCCTCG	0.672																																					Melanoma(161;10 2587 27165 47356)												0													7.0	8.0	8.0					11																	35641435		1923	4087	6010	SO:0001819	synonymous_variant	24147			AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.1251C>T	11.37:g.35641435C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCA9|Q9UGK6	Silent	SNP	pfam_DUF1193	p.L417	ENST00000317811.4	37	c.1251	CCDS44570.1	11																																																																																			FJX1	-	pfam_DUF1193		0.672	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FJX1	HGNC	protein_coding	OTTHUMT00000389078.1	C	NM_014344		35641435	+1	no_errors	ENST00000317811	ensembl	human	known	70_37	silent	SNP	0.998	T
GPC5	2262	genome.wustl.edu	37	13	92797125	92797125	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr13:92797125C>T	ENST00000377067.3	+	7	1816	c.1444C>T	c.(1444-1446)Ctt>Ttt	p.L482F		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	482					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GTGGGAACTTCTTCAGCTGGG	0.443																																																	0													164.0	151.0	155.0					13																	92797125		2203	4300	6503	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1444C>T	13.37:g.92797125C>T	ENSP00000366267:p.Leu482Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.L482F	ENST00000377067.3	37	c.1444	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317400	0.23908	.	.	ENSG00000179399	ENST00000377067	T	0.44881	0.91	5.67	4.82	0.62117	.	0.550760	0.18482	N	0.139881	T	0.25644	0.0624	N	0.19112	0.55	0.19575	N	0.999965	B	0.15473	0.013	B	0.17433	0.018	T	0.11817	-1.0572	10	0.09590	T	0.72	-0.4669	11.4206	0.49978	0.0:0.9174:0.0:0.0826	.	482	P78333	GPC5_HUMAN	F	482	ENSP00000366267:L482F	ENSP00000366267:L482F	L	+	1	0	GPC5	91595126	0.000000	0.05858	0.274000	0.24659	0.814000	0.46013	0.704000	0.25661	2.673000	0.90976	0.557000	0.71058	CTT	GPC5	-	pfam_Glypican		0.443	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	C	NM_004466		92797125	+1	no_errors	ENST00000377067	ensembl	human	known	70_37	missense	SNP	0.297	T
GPLD1	2822	genome.wustl.edu	37	6	24456815	24456815	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:24456815C>T	ENST00000230036.1	-	13	1169	c.1059G>A	c.(1057-1059)atG>atA	p.M353I		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	353					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CACCTATGAACATTGTCCTTA	0.408																																																	0													209.0	205.0	206.0					6																	24456815		2203	4300	6503	SO:0001583	missense	2822			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1059G>A	6.37:g.24456815C>T	ENSP00000230036:p.Met353Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Gprt_PLipase_D	p.M353I	ENST00000230036.1	37	c.1059	CCDS4553.1	6	.	.	.	.	.	.	.	.	.	.	C	0.045	-1.269830	0.01421	.	.	ENSG00000112293	ENST00000230036	T	0.64085	-0.08	5.35	1.2	0.21068	.	0.501747	0.22043	N	0.065422	T	0.19886	0.0478	L	0.50919	1.6	0.24195	N	0.995535	B	0.14438	0.01	B	0.10450	0.005	T	0.24512	-1.0158	10	0.07175	T	0.84	-7.4765	1.6002	0.02672	0.1332:0.4148:0.1297:0.3223	.	353	P80108	PHLD_HUMAN	I	353	ENSP00000230036:M353I	ENSP00000230036:M353I	M	-	3	0	GPLD1	24564794	0.023000	0.18921	0.001000	0.08648	0.011000	0.07611	-0.109000	0.10840	-0.004000	0.14419	-0.140000	0.14226	ATG	GPLD1	-	NULL		0.408	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	HGNC	protein_coding	OTTHUMT00000043315.1	C	NM_001503		24456815	-1	no_errors	ENST00000230036	ensembl	human	known	70_37	missense	SNP	0.006	T
HECW1	23072	genome.wustl.edu	37	7	43508528	43508528	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr7:43508528C>T	ENST00000395891.2	+	16	3528	c.2923C>T	c.(2923-2925)Cga>Tga	p.R975*	HECW1_ENST00000453890.1_Nonsense_Mutation_p.R941*	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	975					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GAGTGCCTACCGAGTCTTCAC	0.512																																																	0													60.0	58.0	58.0					7																	43508528		1997	4183	6180	SO:0001587	stop_gained	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2923C>T	7.37:g.43508528C>T	ENSP00000379228:p.Arg975*	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.R975*	ENST00000395891.2	37	c.2923	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	C	44	10.908193	0.99487	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.58	3.6	0.41247	.	0.114310	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9212	0.63933	0.2847:0.7153:0.0:0.0	.	.	.	.	X	975;941;975	.	ENSP00000265522:R975X	R	+	1	2	HECW1	43475053	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.748000	0.55142	1.292000	0.44672	0.484000	0.47621	CGA	HECW1	-	NULL		0.512	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	C	NM_015052		43508528	+1	no_errors	ENST00000395891	ensembl	human	known	70_37	nonsense	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143074250	143074250	+	Silent	SNP	T	T	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:143074250T>C	ENST00000367604.1	-	9	7974	c.7335A>G	c.(7333-7335)ctA>ctG	p.L2445L	HIVEP2_ENST00000012134.2_Silent_p.L2445L|HIVEP2_ENST00000367603.2_Silent_p.L2445L|RP1-67K17.3_ENST00000437067.1_RNA			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	2445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TAGATCAATGTAGCTGACTCT	0.383																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													175.0	166.0	169.0					6																	143074250		1939	4159	6098	SO:0001819	synonymous_variant	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.7335A>G	6.37:g.143074250T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L2445	ENST00000367604.1	37	c.7335	CCDS43510.1	6																																																																																			HIVEP2	-	NULL		0.383	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	T			143074250	-1	no_errors	ENST00000012134	ensembl	human	known	70_37	silent	SNP	0.978	C
HMGXB4	10042	genome.wustl.edu	37	22	35660934	35660934	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr22:35660934C>T	ENST00000216106.5	+	5	681	c.553C>T	c.(553-555)Cgg>Tgg	p.R185W	HMGXB4_ENST00000444518.2_Missense_Mutation_p.R76W	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	185					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ACTGACCCTTCGGGAGCCTGA	0.463																																																	0													105.0	110.0	109.0					22																	35660934		2203	4300	6503	SO:0001583	missense	10042			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.553C>T	22.37:g.35660934C>T	ENSP00000216106:p.Arg185Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.R185W	ENST00000216106.5	37	c.553	CCDS33641.1	22	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842206	0.71488	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.88	5.88	0.94601	.	0.105878	0.64402	D	0.000006	T	0.60843	0.2300	L	0.29908	0.895	0.58432	D	0.999994	D	0.89917	1.0	D	0.81914	0.995	T	0.62525	-0.6836	10	0.87932	D	0	-3.2709	20.2366	0.98359	0.0:1.0:0.0:0.0	.	185	Q9UGU5	HMGX4_HUMAN	W	76;76;76;185	ENSP00000401658:R76W;ENSP00000398302:R76W;ENSP00000415500:R76W;ENSP00000216106:R185W	ENSP00000216106:R185W	R	+	1	2	HMGXB4	33990934	1.000000	0.71417	0.600000	0.28864	0.971000	0.66376	4.815000	0.62634	2.792000	0.96026	0.557000	0.71058	CGG	HMGXB4	-	NULL		0.463	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	HGNC	protein_coding	OTTHUMT00000318104.2	C	NM_005487		35660934	+1	no_errors	ENST00000216106	ensembl	human	known	70_37	missense	SNP	0.996	T
KIAA0101	9768	genome.wustl.edu	37	15	64669005	64669005	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr15:64669005G>C	ENST00000300035.4	-	3	365	c.227C>G	c.(226-228)tCt>tGt	p.S76C	KIAA0101_ENST00000380258.2_Intron|KIAA0101_ENST00000558008.1_Missense_Mutation_p.S76C|KIAA0101_ENST00000559519.1_Missense_Mutation_p.S49C	NM_014736.4	NP_055551.1	Q15004	PAF15_HUMAN	KIAA0101	76					cellular response to DNA damage stimulus (GO:0006974)|centrosome organization (GO:0051297)|DNA replication (GO:0006260)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin binding (GO:0003682)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3						CTCTTTTTCAGAATCTTTAGG	0.393																																																	0													44.0	47.0	46.0					15																	64669005		2203	4300	6503	SO:0001583	missense	9768			D14657	CCDS10193.1, CCDS32269.1	15q22	2006-06-22			ENSG00000166803	ENSG00000166803			28961	protein-coding gene	gene with protein product		610696				11313979, 16288740	Standard	NM_001029989		Approved	NS5ATP9, OEATC-1, p15(PAF)	uc002ank.3	Q15004	OTTHUMG00000133017	ENST00000300035.4:c.227C>G	15.37:g.64669005G>C	ENSP00000300035:p.Ser76Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNU5|A8K3Y3|G9G694|G9G696	Missense_Mutation	SNP	NULL	p.S76C	ENST00000300035.4	37	c.227	CCDS10193.1	15	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238453	0.58886	.	.	ENSG00000166803	ENST00000300035	T	0.52526	0.66	5.69	3.82	0.43975	.	0.582167	0.18874	N	0.128752	T	0.52354	0.1729	L	0.57536	1.79	0.80722	D	1	D	0.53885	0.963	P	0.50378	0.639	T	0.52177	-0.8610	10	0.56958	D	0.05	-28.8607	11.1409	0.48402	0.152:0.0:0.848:0.0	.	76	Q15004	PAF_HUMAN	C	76	ENSP00000300035:S76C	ENSP00000300035:S76C	S	-	2	0	KIAA0101	62456058	1.000000	0.71417	0.886000	0.34754	0.903000	0.53119	4.563000	0.60823	0.762000	0.33152	-0.237000	0.12165	TCT	KIAA0101	-	NULL		0.393	KIAA0101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0101	HGNC	protein_coding	OTTHUMT00000256603.1	G	NM_014736		64669005	-1	no_errors	ENST00000300035	ensembl	human	known	70_37	missense	SNP	0.705	C
KIAA1210	57481	genome.wustl.edu	37	X	118223458	118223458	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chrX:118223458C>T	ENST00000402510.2	-	11	1734	c.1735G>A	c.(1735-1737)Gcc>Acc	p.A579T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	579										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ACATTCCTGGCAGTCTTATTG	0.493																																																	0													129.0	122.0	124.0					X																	118223458		1980	4150	6130	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1735G>A	X.37:g.118223458C>T	ENSP00000384670:p.Ala579Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.A579T	ENST00000402510.2	37	c.1735	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	11.21	1.571626	0.28003	.	.	ENSG00000250423	ENST00000402510	T	0.26373	1.74	4.96	-0.456	0.12190	.	.	.	.	.	T	0.16385	0.0394	N	0.14661	0.345	0.09310	N	1	P	0.45126	0.851	P	0.47402	0.546	T	0.23226	-1.0194	9	0.20046	T	0.44	.	6.8799	0.24166	0.5874:0.3221:0.0:0.0905	.	579	Q9ULL0	K1210_HUMAN	T	579	ENSP00000384670:A579T	ENSP00000384670:A579T	A	-	1	0	RP13-347D8.6	118107486	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.064000	0.03461	-0.366000	0.08064	0.523000	0.50628	GCC	KIAA1210	-	NULL		0.493	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	C	NM_020721		118223458	-1	no_errors	ENST00000402510	ensembl	human	known	70_37	missense	SNP	0.000	T
KIAA1377	57562	genome.wustl.edu	37	11	101833080	101833080	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:101833080G>C	ENST00000263468.8	+	6	1584	c.1314G>C	c.(1312-1314)gaG>gaC	p.E438D	KIAA1377_ENST00000537689.1_Missense_Mutation_p.E239D	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	438										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CAGACCAAGAGAAATATTCTG	0.378																																																	0													54.0	59.0	57.0					11																	101833080		2200	4297	6497	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1314G>C	11.37:g.101833080G>C	ENSP00000263468:p.Glu438Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0U6	Missense_Mutation	SNP	NULL	p.E438D	ENST00000263468.8	37	c.1314	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	G	7.582	0.668931	0.14776	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08896	3.04;3.04	5.05	2.15	0.27550	.	0.604283	0.16408	N	0.215705	T	0.08670	0.0215	L	0.59436	1.845	0.09310	N	1	B	0.32753	0.383	B	0.32724	0.151	T	0.22417	-1.0217	10	0.42905	T	0.14	-0.4885	5.3188	0.15870	0.2443:0.0:0.6029:0.1528	.	438	Q9P2H0	K1377_HUMAN	D	438;239	ENSP00000263468:E438D;ENSP00000443184:E239D	ENSP00000263468:E438D	E	+	3	2	KIAA1377	101338290	0.011000	0.17503	0.325000	0.25375	0.909000	0.53808	0.058000	0.14301	0.636000	0.30508	-0.137000	0.14449	GAG	KIAA1377	-	NULL		0.378	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	G	NM_020802		101833080	+1	no_errors	ENST00000263468	ensembl	human	known	70_37	missense	SNP	0.063	C
KIAA1377	57562	genome.wustl.edu	37	11	101833184	101833184	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:101833184G>C	ENST00000263468.8	+	6	1688	c.1418G>C	c.(1417-1419)aGa>aCa	p.R473T	KIAA1377_ENST00000537689.1_Missense_Mutation_p.R274T	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	473										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CAGTCAGCTAGACCTTCAGCA	0.338																																																	0													53.0	54.0	54.0					11																	101833184		2203	4296	6499	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1418G>C	11.37:g.101833184G>C	ENSP00000263468:p.Arg473Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0U6	Missense_Mutation	SNP	NULL	p.R473T	ENST00000263468.8	37	c.1418	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	G	7.828	0.719261	0.15372	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08008	3.14;3.14	4.53	4.53	0.55603	.	0.395245	0.24592	N	0.037219	T	0.10766	0.0263	L	0.57536	1.79	0.09310	N	1	P	0.46784	0.884	B	0.43508	0.422	T	0.18587	-1.0332	10	0.30078	T	0.28	-5.1736	10.0299	0.42094	0.094:0.0:0.906:0.0	.	473	Q9P2H0	K1377_HUMAN	T	473;274	ENSP00000263468:R473T;ENSP00000443184:R274T	ENSP00000263468:R473T	R	+	2	0	KIAA1377	101338394	0.637000	0.27216	0.289000	0.24876	0.618000	0.37518	1.534000	0.36051	2.483000	0.83821	0.655000	0.94253	AGA	KIAA1377	-	NULL		0.338	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	G	NM_020802		101833184	+1	no_errors	ENST00000263468	ensembl	human	known	70_37	missense	SNP	0.039	C
KIAA1377	57562	genome.wustl.edu	37	11	101833426	101833426	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:101833426G>A	ENST00000263468.8	+	6	1930	c.1660G>A	c.(1660-1662)Gac>Aac	p.D554N	KIAA1377_ENST00000537689.1_Missense_Mutation_p.D355N	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	554										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TTCTAATTATGACTTTGTTGG	0.299																																																	0													38.0	41.0	40.0					11																	101833426		2201	4285	6486	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1660G>A	11.37:g.101833426G>A	ENSP00000263468:p.Asp554Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0U6	Missense_Mutation	SNP	NULL	p.D554N	ENST00000263468.8	37	c.1660	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238129	0.58886	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.14391	2.51;2.51	5.29	5.29	0.74685	.	0.079937	0.53938	D	0.000057	T	0.35970	0.0950	M	0.73598	2.24	0.32502	N	0.538724	D	0.89917	1.0	D	0.81914	0.995	T	0.46119	-0.9214	10	0.54805	T	0.06	-16.0811	12.6345	0.56675	0.076:0.0:0.924:0.0	.	554	Q9P2H0	K1377_HUMAN	N	554;355	ENSP00000263468:D554N;ENSP00000443184:D355N	ENSP00000263468:D554N	D	+	1	0	KIAA1377	101338636	0.999000	0.42202	0.962000	0.40283	0.608000	0.37181	2.384000	0.44362	2.628000	0.89032	0.655000	0.94253	GAC	KIAA1377	-	NULL		0.299	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	G	NM_020802		101833426	+1	no_errors	ENST00000263468	ensembl	human	known	70_37	missense	SNP	0.991	A
KIAA1377	57562	genome.wustl.edu	37	11	101834545	101834545	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:101834545G>A	ENST00000263468.8	+	6	3049	c.2779G>A	c.(2779-2781)Gaa>Aaa	p.E927K	KIAA1377_ENST00000537689.1_Missense_Mutation_p.E728K	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	927										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAGAACTGCTGAAGAAGAATC	0.393																																																	0													81.0	88.0	86.0					11																	101834545		2203	4299	6502	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2779G>A	11.37:g.101834545G>A	ENSP00000263468:p.Glu927Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0U6	Missense_Mutation	SNP	NULL	p.E927K	ENST00000263468.8	37	c.2779	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	G	7.915	0.737346	0.15574	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.07444	3.19;3.19	5.76	1.56	0.23342	.	1.079280	0.07138	N	0.846750	T	0.05090	0.0136	N	0.17474	0.49	0.09310	N	0.999998	B	0.09022	0.002	B	0.11329	0.006	T	0.47923	-0.9079	10	0.15066	T	0.55	-0.2796	5.051	0.14508	0.2761:0.1518:0.5721:0.0	.	927	Q9P2H0	K1377_HUMAN	K	927;728	ENSP00000263468:E927K;ENSP00000443184:E728K	ENSP00000263468:E927K	E	+	1	0	KIAA1377	101339755	0.998000	0.40836	0.013000	0.15412	0.056000	0.15407	1.220000	0.32491	0.073000	0.16731	0.643000	0.83706	GAA	KIAA1377	-	NULL		0.393	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	G	NM_020802		101834545	+1	no_errors	ENST00000263468	ensembl	human	known	70_37	missense	SNP	0.303	A
KRT6A	3853	genome.wustl.edu	37	12	52883813	52883813	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr12:52883813C>A	ENST00000330722.6	-	6	1185	c.1117G>T	c.(1117-1119)Gac>Tac	p.D373Y		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	373	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGCGCAGGTCGTCCCCATGT	0.567																																																	0													104.0	83.0	90.0					12																	52883813		2202	4278	6480	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1117G>T	12.37:g.52883813C>A	ENSP00000369317:p.Asp373Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.D373Y	ENST00000330722.6	37	c.1117	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	c	26.0	4.694489	0.88830	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.77750	-1.12	5.3	5.3	0.74995	Filament (1);	0.000000	0.64402	D	0.000005	D	0.88753	0.6522	M	0.94021	3.485	0.53005	D	0.999969	P	0.45902	0.868	P	0.55923	0.787	D	0.90833	0.4718	10	0.87932	D	0	.	12.6686	0.56855	0.0:0.924:0.0:0.0759	.	373	P02538	K2C6A_HUMAN	Y	373;329	ENSP00000369317:D373Y	ENSP00000369317:D373Y	D	-	1	0	KRT6A	51170080	0.984000	0.35163	0.992000	0.48379	0.982000	0.71751	2.668000	0.46816	2.659000	0.90383	0.561000	0.74099	GAC	KRT6A	-	pfam_F,superfamily_Prefoldin,prints_Keratin_II		0.567	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	HGNC	protein_coding	OTTHUMT00000404978.2	C	NM_005554		52883813	-1	no_errors	ENST00000330722	ensembl	human	known	70_37	missense	SNP	1.000	A
FAM230B	642633	genome.wustl.edu	37	22	21538465	21538465	+	RNA	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr22:21538465G>T	ENST00000451257.1	+	0	1451									family with sequence similarity 230, member B (non-protein coding)																		CAACGAGGACGCCGCCCACGG	0.721																																																	0																																												642633			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538465G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			KB-1183D5.11	-	-		0.721	FAM230B-002	KNOWN	basic	lincRNA	LOC642633	Clone_based_vega_gene	processed_transcript	OTTHUMT00000320063.1	G	NR_108107		21538465	+1	no_errors	ENST00000451257	ensembl	human	known	70_37	rna	SNP	0.028	T
LPIN2	9663	genome.wustl.edu	37	18	2921538	2921538	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr18:2921538C>T	ENST00000261596.4	-	18	2673	c.2435G>A	c.(2434-2436)cGt>cAt	p.R812H	RP11-737O24.5_ENST00000608032.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	812	C-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CACATTTGGACGGTTTCCAAA	0.453																																																	0													104.0	101.0	102.0					18																	2921538		2203	4300	6503	SO:0001583	missense	9663			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.2435G>A	18.37:g.2921538C>T	ENSP00000261596:p.Arg812His	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD25|D3DUH3	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.R812H	ENST00000261596.4	37	c.2435	CCDS11829.1	18	.	.	.	.	.	.	.	.	.	.	C	35	5.542485	0.96474	.	.	ENSG00000101577	ENST00000261596	T	0.78364	-1.17	5.56	5.56	0.83823	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.85682	D	0.000000	D	0.90772	0.7103	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92173	0.5745	10	0.87932	D	0	.	19.5275	0.95212	0.0:1.0:0.0:0.0	.	812	Q92539	LPIN2_HUMAN	H	812	ENSP00000261596:R812H	ENSP00000261596:R812H	R	-	2	0	LPIN2	2911538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.398000	0.79919	2.616000	0.88540	0.563000	0.77884	CGT	LPIN2	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2		0.453	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	HGNC	protein_coding	OTTHUMT00000254363.2	C	NM_014646		2921538	-1	no_errors	ENST00000261596	ensembl	human	known	70_37	missense	SNP	1.000	T
LRRC72	100506049	genome.wustl.edu	37	7	16606004	16606004	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr7:16606004G>A	ENST00000401542.2	+	6	551	c.494G>A	c.(493-495)gGa>gAa	p.G165E		NM_001195280.1	NP_001182209.1	A6NJI9	LRC72_HUMAN	leucine rich repeat containing 72	165	LRRCT.																CACCTTCCAGGAGTGGAGCTG	0.383																																																	0																																										SO:0001583	missense	100506049				CCDS56464.1	7p21.1	2011-10-07			ENSG00000205858	ENSG00000205858			42972	protein-coding gene	gene with protein product							Standard	NM_001195280		Approved		uc022aaf.1	A6NJI9	OTTHUMG00000152446	ENST00000401542.2:c.494G>A	7.37:g.16606004G>A	ENSP00000384971:p.Gly165Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.G165E	ENST00000401542.2	37	c.494	CCDS56464.1	7	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494999	0.26774	.	.	ENSG00000205858	ENST00000401542	T	0.52983	0.64	5.41	-0.14	0.13456	.	.	.	.	.	T	0.24005	0.0581	N	0.12182	0.205	0.09310	N	1	.	.	.	.	.	.	T	0.22941	-1.0202	7	0.20046	T	0.44	.	4.8682	0.13618	0.0825:0.4227:0.3502:0.1445	.	.	.	.	E	165	ENSP00000384971:G165E	ENSP00000384971:G165E	G	+	2	0	AC005014.4	16572529	0.686000	0.27661	0.099000	0.21106	0.975000	0.68041	0.551000	0.23361	0.044000	0.15775	-0.176000	0.13171	GGA	LRRC72	-	NULL		0.383	LRRC72-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC72	HGNC	protein_coding	OTTHUMT00000326249.2	G			16606004	+1	no_errors	ENST00000401542	ensembl	human	novel	70_37	missense	SNP	0.050	A
LRRTM3	347731	genome.wustl.edu	37	10	68688038	68688038	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr10:68688038G>A	ENST00000361320.4	+	2	1942	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	455					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						CTGCAGCAGCGCTCCCTCATG	0.532																																																	0													87.0	88.0	88.0					10																	68688038		2203	4300	6503	SO:0001583	missense	347731			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1364G>A	10.37:g.68688038G>A	ENSP00000355187:p.Arg455His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.R455H	ENST00000361320.4	37	c.1364	CCDS7270.1	10	.	.	.	.	.	.	.	.	.	.	G	4.941	0.174917	0.09391	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.76839	-1.05	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000001	T	0.57007	0.2024	N	0.01576	-0.805	0.44323	D	0.997202	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.54193	-0.8330	10	0.36615	T	0.2	.	19.3958	0.94607	0.0:0.0:1.0:0.0	.	455;455	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	H	455	ENSP00000355187:R455H	ENSP00000355187:R455H	R	+	2	0	LRRTM3	68358044	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.235000	0.51328	2.879000	0.98667	0.650000	0.86243	CGC	LRRTM3	-	NULL		0.532	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	G	NM_178011		68688038	+1	no_errors	ENST00000361320	ensembl	human	known	70_37	missense	SNP	1.000	A
LTBP4	8425	genome.wustl.edu	37	19	41105464	41105464	+	Splice_Site	SNP	T	T	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:41105464T>C	ENST00000602240.1	+	3	230		c.e3+2		LTBP4_ENST00000396819.3_5'Flank|LTBP4_ENST00000204005.9_Splice_Site|LTBP4_ENST00000545697.1_Splice_Site|LTBP4_ENST00000308370.7_Splice_Site			Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4						extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCACTGACGTGAGTGGGCAG	0.652																																																	0													77.0	88.0	84.0					19																	41105464		2033	4193	6226	SO:0001630	splice_region_variant	8425			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000602240.1:c.230+2T>C	19.37:g.41105464T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O00508|O75412|O75413	Splice_Site	SNP	-	e3+2	ENST00000602240.1	37	c.341+2		19	.	.	.	.	.	.	.	.	.	.	t	16.50	3.139972	0.56936	.	.	ENSG00000090006	ENST00000204005;ENST00000308370	.	.	.	4.55	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4827	0.27415	0.0:0.0:0.2203:0.7797	.	.	.	.	.	-1	.	.	.	+	.	.	LTBP4	45797304	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.163000	0.42377	1.695000	0.51148	0.454000	0.30748	.	LTBP4	-	-		0.652	LTBP4-002	KNOWN	sequence_error|basic	processed_transcript	LTBP4	HGNC	protein_coding	OTTHUMT00000462815.2	T	NM_003573	Intron	41105464	+1	no_errors	ENST00000308370	ensembl	human	known	70_37	splice_site	SNP	1.000	C
MAGEL2	54551	genome.wustl.edu	37	15	23890312	23890312	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr15:23890312C>A	ENST00000532292.1	-	1	863	c.769G>T	c.(769-771)Gct>Tct	p.A257S		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	140					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TGGGGGGCAGCTGCTGTAGCC	0.627																																																	0													39.0	47.0	45.0					15																	23890312		2145	4268	6413	SO:0001583	missense	54551			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.769G>T	15.37:g.23890312C>A	ENSP00000433433:p.Ala257Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.A257S	ENST00000532292.1	37	c.769		15	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077037	0.36662	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	T	0.32912	0.0845	N	0.24115	0.695	0.21020	N	0.999804	.	.	.	.	.	.	T	0.12915	-1.0529	5	.	.	.	.	10.3959	0.44201	0.0:0.8016:0.1984:0.0	.	.	.	.	H	288	.	.	Q	-	3	2	MAGEL2	21441405	0.001000	0.12720	0.486000	0.27416	0.955000	0.61496	-0.179000	0.09768	2.625000	0.88918	0.650000	0.86243	CAG	MAGEL2	-	NULL		0.627	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	C	NM_019066		23890312	-1	no_errors	ENST00000532292	ensembl	human	known	70_37	missense	SNP	0.577	A
MCF2L2	23101	genome.wustl.edu	37	3	183145719	183145719	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:183145719C>G	ENST00000328913.3	-	1	344	c.47G>C	c.(46-48)cGg>cCg	p.R16P	MCF2L2_ENST00000447025.2_Missense_Mutation_p.R16P|MCF2L2_ENST00000414362.2_Missense_Mutation_p.R16P|MCF2L2_ENST00000473233.1_Missense_Mutation_p.R16P	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	16	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGCCAGTCGCCGGGTGAGCTC	0.463																																																	0													95.0	100.0	98.0					3																	183145719		2203	4300	6503	SO:0001583	missense	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.47G>C	3.37:g.183145719C>G	ENSP00000328118:p.Arg16Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R16P	ENST00000328913.3	37	c.47	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857889	0.71834	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.05786	4.49;4.53;3.65;3.39	5.31	4.31	0.51392	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.430200	0.18350	N	0.143920	T	0.10508	0.0257	N	0.22421	0.69	0.28666	N	0.905891	P;D	0.76494	0.812;0.999	B;D	0.67725	0.173;0.953	T	0.06427	-1.0827	10	0.62326	D	0.03	.	5.939	0.19181	0.0:0.8368:0.0:0.1632	.	16;16	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	P	16	ENSP00000328118:R16P;ENSP00000420070:R16P;ENSP00000388190:R16P;ENSP00000414131:R16P	ENSP00000328118:R16P	R	-	2	0	MCF2L2	184628413	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.822000	0.39052	2.474000	0.83562	0.655000	0.94253	CGG	MCF2L2	-	pfscan_CRAL-TRIO_dom		0.463	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	C	NM_015078		183145719	-1	no_errors	ENST00000328913	ensembl	human	known	70_37	missense	SNP	1.000	G
METAP1D	254042	genome.wustl.edu	37	2	172943971	172943971	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:172943971G>T	ENST00000315796.4	+	8	1218	c.831G>T	c.(829-831)gaG>gaT	p.E277D	METAP1D_ENST00000488581.1_3'UTR	NM_199227.1	NP_954697.1	Q6UB28	MAP12_HUMAN	methionyl aminopeptidase type 1D (mitochondrial)	277					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|protein initiator methionine removal (GO:0070084)	mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			NS(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	8						CCATGGAGGAGGGCATGGCAT	0.507																																																	0													116.0	103.0	108.0					2																	172943971		2203	4300	6503	SO:0001583	missense	254042			AY374142, BC029123	CCDS2246.1	2q31.1	2010-09-21			ENSG00000172878	ENSG00000172878			32583	protein-coding gene	gene with protein product	"""methionine aminopeptidase 1D"""	610267				14532271, 16568094	Standard	NM_199227		Approved	MAP1D, Metap1l	uc002uhk.3	Q6UB28	OTTHUMG00000132283	ENST00000315796.4:c.831G>T	2.37:g.172943971G>T	ENSP00000315152:p.Glu277Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q1WNX3	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP1	p.E277D	ENST00000315796.4	37	c.831	CCDS2246.1	2	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550434	0.45383	.	.	ENSG00000172878	ENST00000315796	T	0.79845	-1.31	6.17	3.41	0.39046	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.84597	0.5507	M	0.71581	2.175	0.48830	D	0.999712	P	0.52316	0.952	P	0.55871	0.786	D	0.84599	0.0671	10	0.62326	D	0.03	-5.7442	10.02	0.42037	0.2081:0.0:0.7919:0.0	.	277	Q6UB28	AMP1D_HUMAN	D	277	ENSP00000315152:E277D	ENSP00000315152:E277D	E	+	3	2	METAP1D	172652217	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.738000	0.38207	0.929000	0.37192	0.655000	0.94253	GAG	METAP1D	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP1		0.507	METAP1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METAP1D	HGNC	protein_coding	OTTHUMT00000255378.2	G	NM_199227		172943971	+1	no_errors	ENST00000315796	ensembl	human	known	70_37	missense	SNP	1.000	T
MMP15	4324	genome.wustl.edu	37	16	58072243	58072243	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr16:58072243C>T	ENST00000219271.3	+	3	1170	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	129					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	GCGGCGGCGTCGGAAGCGCTA	0.652																																																	0													101.0	95.0	97.0					16																	58072243		2198	4300	6498	SO:0001583	missense	4324			Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.385C>T	16.37:g.58072243C>T	ENSP00000219271:p.Arg129Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A2U6|Q14111	Missense_Mutation	SNP	pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.R129W	ENST00000219271.3	37	c.385	CCDS10792.1	16	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026879	0.75390	.	.	ENSG00000102996	ENST00000219271	T	0.18016	2.24	4.22	3.19	0.36642	Metallopeptidase, catalytic domain (1);	0.000000	0.30969	N	0.008518	T	0.42988	0.1227	M	0.87180	2.865	0.28993	N	0.887932	D	0.89917	1.0	D	0.71184	0.972	T	0.38134	-0.9675	10	0.87932	D	0	.	11.0622	0.47955	0.3011:0.6989:0.0:0.0	.	129	P51511	MMP15_HUMAN	W	129	ENSP00000219271:R129W	ENSP00000219271:R129W	R	+	1	2	MMP15	56629744	0.107000	0.21998	1.000000	0.80357	0.944000	0.59088	-0.016000	0.12613	2.096000	0.63516	0.462000	0.41574	CGG	MMP15	-	pirsf_Pept_M10A_matrix_strom		0.652	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP15	HGNC	protein_coding	OTTHUMT00000257342.1	C	NM_002428		58072243	+1	no_errors	ENST00000219271	ensembl	human	known	70_37	missense	SNP	0.999	T
MT-CO1	4512	genome.wustl.edu	37	M	6513	6513	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chrM:6513G>A	ENST00000361624.2	+	1	610	c.610G>A	c.(610-612)Gct>Act	p.A204T	MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	204					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CAGTCCTAGCTGCTGGCATCA	0.507																																																	0																																										SO:0001583	missense	4512					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.610G>A	M.37:g.6513G>A	ENSP00000354499:p.Ala204Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.A204T	ENST00000361624.2	37	c.610		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		G	YP_003024028		6513	+1	no_errors	ENST00000361624	ensembl	human	known	70_37	missense	SNP	NULL	A
OR4N2	390429	genome.wustl.edu	37	14	20295947	20295947	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr14:20295947C>A	ENST00000315947.1	+	1	340	c.340C>A	c.(340-342)Ctc>Atc	p.L114I	OR4N2_ENST00000568211.1_Missense_Mutation_p.L114I	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGAGGGATTACTCCTTGTTGT	0.507																																																	0													122.0	133.0	129.0					14																	20295947		2203	4297	6500	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.340C>A	14.37:g.20295947C>A	ENSP00000319601:p.Leu114Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L114I	ENST00000315947.1	37	c.340	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	15.05	2.717734	0.48622	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	T;T	0.00585	6.39;6.39	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000465	T	0.01029	0.0034	L	0.39245	1.2	0.09310	N	0.999998	D	0.59357	0.985	P	0.53518	0.728	T	0.59289	-0.7482	10	0.41790	T	0.15	-19.7039	10.893	0.47006	0.0:0.8091:0.1909:0.0	.	114	Q8NGD1	OR4N2_HUMAN	I	114	ENSP00000452022:L114I;ENSP00000319601:L114I	ENSP00000319601:L114I	L	+	1	0	OR4N2	19365787	0.000000	0.05858	0.153000	0.22517	0.927000	0.56198	-0.480000	0.06559	2.488000	0.83962	0.591000	0.81541	CTC	OR4N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.507	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	C			20295947	+1	no_errors	ENST00000315947	ensembl	human	known	70_37	missense	SNP	0.290	A
OR5D13	390142	genome.wustl.edu	37	11	55540930	55540930	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:55540930G>A	ENST00000361760.1	+	1	17	c.17G>A	c.(16-18)aGa>aAa	p.R6K		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R6I(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				GCATCTGAAAGAAATCAAAGC	0.378																																																	1	Substitution - Missense(1)	pancreas(1)											90.0	92.0	92.0					11																	55540930		2200	4296	6496	SO:0001583	missense	390142			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.17G>A	11.37:g.55540930G>A	ENSP00000354800:p.Arg6Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R6K	ENST00000361760.1	37	c.17	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	G	2.449	-0.326786	0.05350	.	.	ENSG00000198877	ENST00000361760	T	0.00253	8.43	3.43	-0.99	0.10238	.	2.614400	0.02383	U	0.078988	T	0.00109	0.0003	N	0.17278	0.47	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27400	-1.0075	10	0.23302	T	0.38	2.0586	3.8268	0.08858	0.4124:0.0:0.4234:0.1642	.	6	Q8NGL4	OR5DD_HUMAN	K	6	ENSP00000354800:R6K	ENSP00000354800:R6K	R	+	2	0	OR5D13	55297506	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	0.111000	0.15458	-0.391000	0.07763	-1.549000	0.00901	AGA	OR5D13	-	NULL		0.378	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	G	NM_001001967		55540930	+1	no_errors	ENST00000361760	ensembl	human	known	70_37	missense	SNP	0.000	A
PCDHB10	56126	genome.wustl.edu	37	5	140573047	140573047	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr5:140573047G>C	ENST00000239446.4	+	1	1106	c.922G>C	c.(922-924)Gat>Cat	p.D308H		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAATTGCTTGATTATGAGTT	0.368																																																	0													54.0	59.0	58.0					5																	140573047		2202	4297	6499	SO:0001583	missense	56126			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.922G>C	5.37:g.140573047G>C	ENSP00000239446:p.Asp308His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96T99	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D308H	ENST00000239446.4	37	c.922	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591644	0.46214	.	.	ENSG00000120324	ENST00000239446	T	0.65364	-0.15	3.41	3.41	0.39046	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.85405	0.5689	H	0.99415	4.555	0.39990	D	0.975021	D	0.76494	0.999	D	0.79784	0.993	D	0.86678	0.1915	9	0.87932	D	0	.	6.222	0.20687	0.1061:0.1922:0.7017:0.0	.	308	Q9UN67	PCDBA_HUMAN	H	308	ENSP00000239446:D308H	ENSP00000239446:D308H	D	+	1	0	PCDHB10	140553231	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	7.778000	0.85637	1.930000	0.55929	0.556000	0.70494	GAT	PCDHB10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.368	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	HGNC	protein_coding	OTTHUMT00000251821.1	G	NM_018930		140573047	+1	no_errors	ENST00000239446	ensembl	human	known	70_37	missense	SNP	0.996	C
PFDN5	5204	genome.wustl.edu	37	12	53689722	53689722	+	Missense_Mutation	SNP	G	G	A	rs201325659		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr12:53689722G>A	ENST00000551018.1	+	2	449	c.172G>A	c.(172-174)Gag>Aag	p.E58K	PFDN5_ENST00000550846.1_Intron|PFDN5_ENST00000334478.4_Missense_Mutation_p.E58K|RP11-680A11.5_ENST00000550263.1_RNA|PFDN5_ENST00000351500.3_Intron	NM_002624.3	NP_002615.2	Q99471	PFD5_HUMAN	prefoldin subunit 5	58					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)	8						CAAGAGCAACGAGGGTATGGG	0.512																																																	0													95.0	76.0	82.0					12																	53689722		2203	4300	6503	SO:0001583	missense	5204			D89667	CCDS8853.1, CCDS8854.1	12q13.13	2008-05-14	2006-02-24						8869	protein-coding gene	gene with protein product		604899	"""prefoldin 5"""			9630229, 9792694	Standard	NM_002624		Approved	PFD5, MM-1	uc001scl.3	Q99471	OTTHUMG00000169675	ENST00000551018.1:c.172G>A	12.37:g.53689722G>A	ENSP00000447942:p.Glu58Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9A8|Q54AA8|Q9C083|Q9C084	Missense_Mutation	SNP	pfam_Prefoldin_subunit,superfamily_Prefoldin,tigrfam_PFD_alpha	p.E58K	ENST00000551018.1	37	c.172	CCDS8853.1	12	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422273	0.62622	.	.	ENSG00000123349	ENST00000551018;ENST00000334478	T;T	0.47869	0.83;0.83	5.73	4.83	0.62350	Prefoldin (1);Prefoldin subunit (1);	0.049153	0.85682	D	0.000000	T	0.30262	0.0759	N	0.12611	0.24	0.58432	D	0.999998	B	0.22211	0.066	B	0.17098	0.017	T	0.14090	-1.0485	10	0.87932	D	0	.	12.1111	0.53840	0.0825:0.0:0.9175:0.0	.	58	Q99471	PFD5_HUMAN	K	58	ENSP00000447942:E58K;ENSP00000334188:E58K	ENSP00000243040:E58K	E	+	1	0	PFDN5	51975989	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	5.590000	0.67530	2.882000	0.98803	0.655000	0.94253	GAG	PFDN5	-	pfam_Prefoldin_subunit,superfamily_Prefoldin,tigrfam_PFD_alpha		0.512	PFDN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFDN5	HGNC	protein_coding	OTTHUMT00000405368.2	G			53689722	+1	no_errors	ENST00000551018	ensembl	human	known	70_37	missense	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PLIN3	10226	genome.wustl.edu	37	19	4844784	4844784	+	Missense_Mutation	SNP	C	C	T	rs577339133		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:4844784C>T	ENST00000221957.4	-	7	1032	c.856G>A	c.(856-858)Gtt>Att	p.V286I	PLIN3_ENST00000592528.1_Missense_Mutation_p.V274I|PLIN3_ENST00000585479.1_Missense_Mutation_p.V286I	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	286					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	TTCTGATCAACGCCTTGCTTG	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		18513	0.0		0.0	False		,,,				2504	0.001																0													39.0	31.0	34.0					19																	4844784		2203	4299	6502	SO:0001583	missense	10226			AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.856G>A	19.37:g.4844784C>T	ENSP00000221957:p.Val286Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.V286I	ENST00000221957.4	37	c.856	CCDS12137.1	19	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572740	0.28092	.	.	ENSG00000105355	ENST00000221957	T	0.06528	3.29	4.19	1.98	0.26296	.	0.506362	0.18644	U	0.135206	T	0.07324	0.0185	L	0.51853	1.615	0.09310	N	1	B;B;B	0.16396	0.008;0.017;0.009	B;B;B	0.17722	0.007;0.019;0.013	T	0.23297	-1.0192	10	0.44086	T	0.13	-19.3695	10.3103	0.43704	0.0:0.8331:0.0:0.1669	.	286;103;286	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	I	286	ENSP00000221957:V286I	ENSP00000221957:V286I	V	-	1	0	PLIN3	4795784	0.000000	0.05858	0.003000	0.11579	0.082000	0.17680	0.275000	0.18698	0.977000	0.38444	0.561000	0.74099	GTT	PLIN3	-	pfam_Perilipin,pirsf_Perilipin		0.602	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLIN3	HGNC	protein_coding	OTTHUMT00000450436.1	C	NM_005817		4844784	-1	no_errors	ENST00000221957	ensembl	human	known	70_37	missense	SNP	0.004	T
PM20D2	135293	genome.wustl.edu	37	6	89871595	89871596	+	Frame_Shift_Ins	INS	-	-	TACT			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:89871595_89871596insTACT	ENST00000275072.4	+	6	1237_1238	c.1142_1143insTACT	c.(1141-1146)tacactfs	p.-382fs		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2							extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		ACTGAACAGTACACTGAAGCTG	0.396																																																	0																																										SO:0001589	frameshift_variant	135293			BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	Exception_encountered	6.37:g.89871595_89871596insTACT	ENSP00000275072:p.Thr382fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Frame_Shift_Ins	INS	pfam_Peptidase_M20_dimer,pfam_Peptidase_M20,superfamily_Peptidase_M20_dimer,pirsf_Pept_M20D_amidohydro_pred	p.E383fs	ENST00000275072.4	37	c.1142_1143	CCDS34499.1	6																																																																																			PM20D2	-	pirsf_Pept_M20D_amidohydro_pred		0.396	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D2	HGNC	protein_coding	OTTHUMT00000041477.1	-	NM_001010853		89871596	+1	no_errors	ENST00000275072	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:0.993	TACT
PNISR	25957	genome.wustl.edu	37	6	99849006	99849006	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:99849006G>A	ENST00000369239.5	-	12	2032	c.1828C>T	c.(1828-1830)Cgg>Tgg	p.R610W	PNISR_ENST00000438806.1_Missense_Mutation_p.R610W	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	610						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						GAAGGACTCCGATTTCGTCGT	0.433																																																	0													109.0	98.0	102.0					6																	99849006		2203	4300	6503	SO:0001583	missense	25957			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1828C>T	6.37:g.99849006G>A	ENSP00000358242:p.Arg610Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	NULL	p.R610W	ENST00000369239.5	37	c.1828	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980537	0.53827	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.49	3.61	0.41365	.	0.163889	0.53938	D	0.000051	T	0.24392	0.0591	N	0.17082	0.46	0.54753	D	0.999987	B	0.18310	0.027	B	0.12837	0.008	T	0.22487	-1.0215	9	0.66056	D	0.02	.	8.5578	0.33492	0.0737:0.0:0.6677:0.2586	.	610	Q8TF01	PNISR_HUMAN	W	610	.	ENSP00000358242:R610W	R	-	1	2	PNISR	99955727	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.795000	0.55499	2.750000	0.94351	0.579000	0.79373	CGG	PNISR	-	NULL		0.433	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1	G	NM_032870		99849006	-1	no_errors	ENST00000369239	ensembl	human	known	70_37	missense	SNP	1.000	A
POLD1	5424	genome.wustl.edu	37	19	50905324	50905324	+	Missense_Mutation	SNP	G	G	T	rs140707092		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:50905324G>T	ENST00000440232.2	+	5	585	c.532G>T	c.(532-534)Ggg>Tgg	p.G178W	POLD1_ENST00000599857.1_Missense_Mutation_p.G178W|POLD1_ENST00000595904.1_Missense_Mutation_p.G178W	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	178					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GGACAGTCGCGGGGGGAGGGA	0.672								DNA polymerases (catalytic subunits)																																									0													32.0	39.0	37.0					19																	50905324		2203	4300	6503	SO:0001583	missense	5424				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.532G>T	19.37:g.50905324G>T	ENSP00000406046:p.Gly178Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NER3|Q96H98	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.G178W	ENST00000440232.2	37	c.532	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373085	0.24857	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.31510	1.49	4.32	3.27	0.37495	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.596363	0.16445	N	0.214136	T	0.43055	0.1230	L	0.48362	1.52	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.71184	0.959;0.972	T	0.13926	-1.0491	10	0.87932	D	0	-29.9694	6.7682	0.23579	0.0947:0.0:0.731:0.1742	.	178;178	E7EVW0;P28340	.;DPOD1_HUMAN	W	178;179	ENSP00000406046:G178W	ENSP00000366129:G179W	G	+	1	0	POLD1	55597136	0.453000	0.25721	0.370000	0.25965	0.031000	0.12232	2.365000	0.44196	0.957000	0.37930	0.491000	0.48974	GGG	POLD1	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom		0.672	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	HGNC	protein_coding	OTTHUMT00000464732.1	G			50905324	+1	no_errors	ENST00000440232	ensembl	human	known	70_37	missense	SNP	0.061	T
POTEE	445582	genome.wustl.edu	37	2	132021997	132021997	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:132021997G>A	ENST00000356920.5	+	15	3063	c.2969G>A	c.(2968-2970)cGc>cAc	p.R990H	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	990	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GTGGACATCCGCAAAGACCTG	0.572																																																	0													2.0	1.0	1.0					2																	132021997		409	553	962	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2969G>A	2.37:g.132021997G>A	ENSP00000439189:p.Arg990His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.R990H	ENST00000356920.5	37	c.2969	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	14.82	2.651006	0.47362	.	.	ENSG00000188219	ENST00000356920	D	0.95885	-3.84	.	.	.	.	.	.	.	.	D	0.96892	0.8985	M	0.91249	3.19	0.80722	D	1	D	0.76494	0.999	P	0.59171	0.853	D	0.94837	0.8001	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	990	Q6S8J3	POTEE_HUMAN	H	990	ENSP00000439189:R990H	ENSP00000439189:R990H	R	+	2	0	AC131180.1	131738467	1.000000	0.71417	0.215000	0.23724	0.217000	0.24651	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	CGC	POTEE	-	pfam_Actin-like,smart_Actin-like		0.572	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Uniprot_genename	protein_coding		G	NM_001083538		132021997	+1	no_errors	ENST00000356920	ensembl	human	known	70_37	missense	SNP	1.000	A
PTPN22	26191	genome.wustl.edu	37	1	114401660	114401660	+	Silent	SNP	A	A	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr1:114401660A>G	ENST00000359785.5	-	3	372	c.237T>C	c.(235-237)gaT>gaC	p.D79D	PTPN22_ENST00000538253.1_5'UTR|PTPN22_ENST00000525799.1_Silent_p.D79D|AP4B1-AS1_ENST00000419536.1_RNA|PTPN22_ENST00000528414.1_Silent_p.D79D|PTPN22_ENST00000420377.2_Silent_p.D79D|PTPN22_ENST00000534519.1_5'UTR|PTPN22_ENST00000460620.1_Silent_p.D79D	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	79	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGAATCCTCATCAGAGGTTA	0.373																																																	0													76.0	75.0	75.0					1																	114401660		2203	4300	6503	SO:0001819	synonymous_variant	26191			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.237T>C	1.37:g.114401660A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.D79	ENST00000359785.5	37	c.237	CCDS863.1	1																																																																																			PTPN22	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pirsf_Non-rcpt_Tyr_Pase_8/22,pfscan_Tyr_Pase_rcpt/non-rcpt		0.373	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	A	NM_015967		114401660	-1	no_errors	ENST00000359785	ensembl	human	known	70_37	silent	SNP	1.000	G
RASGRP2	10235	genome.wustl.edu	37	11	64509578	64509578	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:64509578G>A	ENST00000354024.3	-	3	332	c.80C>T	c.(79-81)tCc>tTc	p.S27F	RASGRP2_ENST00000394428.1_Intron|RASGRP2_ENST00000394432.3_Missense_Mutation_p.S27F|RASGRP2_ENST00000377487.1_Missense_Mutation_p.S27F|RASGRP2_ENST00000377486.3_Missense_Mutation_p.S27F|RASGRP2_ENST00000377497.3_Missense_Mutation_p.S27F|RASGRP2_ENST00000394429.1_Intron|RASGRP2_ENST00000377494.1_Missense_Mutation_p.S27F|RASGRP2_ENST00000377489.1_Missense_Mutation_p.S27F|RASGRP2_ENST00000394430.1_Missense_Mutation_p.S27F	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	27	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CACCTTCCCGGAGTCATCTGA	0.617																																																	0													29.0	28.0	28.0					11																	64509578		2195	4297	6492	SO:0001583	missense	10235			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.80C>T	11.37:g.64509578G>A	ENSP00000338864:p.Ser27Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S27F	ENST00000354024.3	37	c.80	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	G	16.88	3.245706	0.59103	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024;ENST00000431822;ENST00000377486;ENST00000377487;ENST00000377489;ENST00000394430;ENST00000439594;ENST00000377485;ENST00000430645	T;T;T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	4.67	3.75	0.43078	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.711655	0.13120	N	0.412289	T	0.46073	0.1374	N	0.22421	0.69	0.37480	D	0.91595	D	0.53312	0.959	P	0.51974	0.686	T	0.34850	-0.9812	10	0.26408	T	0.33	-4.9418	8.5012	0.33159	0.0:0.1689:0.6567:0.1744	.	27	Q7LDG7	GRP2_HUMAN	F	27	ENSP00000366714:S27F;ENSP00000377953:S27F;ENSP00000366717:S27F;ENSP00000338864:S27F;ENSP00000399114:S27F;ENSP00000366706:S27F;ENSP00000366707:S27F;ENSP00000366709:S27F;ENSP00000377951:S27F;ENSP00000366705:S27F;ENSP00000401314:S27F	ENSP00000338864:S27F	S	-	2	0	RASGRP2	64266154	0.575000	0.26692	1.000000	0.80357	0.833000	0.47200	0.765000	0.26546	1.268000	0.44264	0.313000	0.20887	TCC	RASGRP2	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N		0.617	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	G	NM_153819		64509578	-1	no_errors	ENST00000377494	ensembl	human	known	70_37	missense	SNP	0.986	A
RPL8	6132	genome.wustl.edu	37	8	146016665	146016665	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr8:146016665C>A	ENST00000262584.3	-	4	728	c.496G>T	c.(496-498)Gtt>Ttt	p.V166F	RPL8_ENST00000394920.2_Missense_Mutation_p.V166F|RPL8_ENST00000529163.1_5'UTR|RPL8_ENST00000527914.1_Missense_Mutation_p.V57F|RPL8_ENST00000528957.1_Missense_Mutation_p.V166F	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	166					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		TACTCACCAACCACAGCTCTG	0.562																																																	0													65.0	58.0	60.0					8																	146016665		2200	4297	6497	SO:0001583	missense	6132			Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.496G>T	8.37:g.146016665C>A	ENSP00000262584:p.Val166Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like,pirsf_Ribosomal_L2	p.V166F	ENST00000262584.3	37	c.496	CCDS6433.1	8	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995010	0.93167	.	.	ENSG00000161016	ENST00000394920;ENST00000527914;ENST00000262584;ENST00000528957;ENST00000534813;ENST00000533397;ENST00000532702	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	5.21	5.21	0.72293	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);Ribosomal protein L2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76828	0.4042	M	0.93594	3.435	0.80722	D	1	D;D	0.63880	0.993;0.979	D;D	0.75484	0.986;0.931	T	0.83216	-0.0071	10	0.87932	D	0	.	16.6841	0.85300	0.0:1.0:0.0:0.0	.	166;130	P62917;E9PIZ3	RL8_HUMAN;.	F	166;57;166;166;130;145;166	ENSP00000378378:V166F;ENSP00000436460:V57F;ENSP00000262584:V166F;ENSP00000433464:V166F;ENSP00000435313:V145F;ENSP00000434535:V166F	ENSP00000262584:V166F	V	-	1	0	RPL8	145987469	1.000000	0.71417	0.967000	0.41034	0.646000	0.38490	6.610000	0.74178	2.602000	0.87976	0.558000	0.71614	GTT	RPL8	-	pfam_Ribosomal_L2_C,superfamily_Translation_prot_SH3-like,pirsf_Ribosomal_L2		0.562	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL8	HGNC	protein_coding	OTTHUMT00000382948.1	C	NM_000973		146016665	-1	no_errors	ENST00000262584	ensembl	human	known	70_37	missense	SNP	1.000	A
RTL1	388015	genome.wustl.edu	37	14	101348185	101348185	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr14:101348185C>T	ENST00000534062.1	-	1	2999	c.2941G>A	c.(2941-2943)Gtc>Atc	p.V981I	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR432_ENST00000606207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	981					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						AGCTCCATGACGTCAAAGTTG	0.562																																																	0													74.0	77.0	76.0					14																	101348185		1568	3582	5150	SO:0001583	missense	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2941G>A	14.37:g.101348185C>T	ENSP00000435342:p.Val981Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.V981I	ENST00000534062.1	37	c.2941	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	5.188	0.220181	0.09863	.	.	ENSG00000254656	ENST00000534062	T	0.37411	1.2	3.39	1.58	0.23477	.	0.000000	0.31495	N	0.007546	T	0.18087	0.0434	L	0.29908	0.895	0.20307	N	0.999914	B	0.15719	0.014	B	0.08055	0.003	T	0.27088	-1.0084	10	0.06236	T	0.91	.	5.4796	0.16717	0.0:0.6408:0.0:0.3592	.	981	E9PKS8	.	I	981	ENSP00000435342:V981I	ENSP00000435342:V981I	V	-	1	0	RTL1	100417938	0.097000	0.21791	0.518000	0.27811	0.522000	0.34438	0.177000	0.16801	0.455000	0.26910	-0.263000	0.10527	GTC	RTL1	-	NULL		0.562	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	C	NM_001134888		101348185	-1	no_errors	ENST00000534062	ensembl	human	known	70_37	missense	SNP	0.414	T
RTTN	25914	genome.wustl.edu	37	18	67727191	67727191	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr18:67727191G>A	ENST00000255674.6	-	36	5121	c.4835C>T	c.(4834-4836)tCt>tTt	p.S1612F	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1612					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TGAAAGAAGAGATGGAGTAAC	0.458																																																	0													120.0	125.0	123.0					18																	67727191		1959	4142	6101	SO:0001583	missense	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4835C>T	18.37:g.67727191G>A	ENSP00000255674:p.Ser1612Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1612F	ENST00000255674.6	37	c.4835	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417926	0.42918	.	.	ENSG00000176225	ENST00000255674	T	0.54675	0.56	5.92	5.04	0.67666	Armadillo-like helical (1);	0.537903	0.21891	N	0.067589	T	0.37348	0.1000	N	0.22421	0.69	0.46478	D	0.999068	P	0.47409	0.895	B	0.40101	0.319	T	0.28459	-1.0043	10	0.54805	T	0.06	.	9.8193	0.40871	0.0:0.1523:0.6897:0.158	.	1612	Q86VV8	RTTN_HUMAN	F	1612	ENSP00000255674:S1612F	ENSP00000255674:S1612F	S	-	2	0	RTTN	65878171	0.076000	0.21285	0.115000	0.21578	0.126000	0.20510	2.878000	0.48515	1.485000	0.48380	0.650000	0.86243	TCT	RTTN	-	NULL		0.458	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	G	NM_173630		67727191	-1	no_errors	ENST00000255674	ensembl	human	known	70_37	missense	SNP	0.650	A
SERPINH1	871	genome.wustl.edu	37	11	75278009	75278009	+	Silent	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:75278009C>T	ENST00000524558.1	+	2	2050	c.615C>T	c.(613-615)ttC>ttT	p.F205F	SERPINH1_ENST00000530284.1_Silent_p.F205F|SERPINH1_ENST00000533603.1_Silent_p.F205F|SERPINH1_ENST00000358171.3_Silent_p.F205F|SERPINH1_ENST00000525876.1_5'Flank			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	205					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					ACGCCATGTTCTTCAAGCGTG	0.647																																																	0													24.0	24.0	24.0					11																	75278009		2193	4272	6465	SO:0001819	synonymous_variant	871			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.615C>T	11.37:g.75278009C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.F205	ENST00000524558.1	37	c.615	CCDS8239.1	11																																																																																			SERPINH1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.647	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINH1	HGNC	protein_coding	OTTHUMT00000383610.1	C	NM_004353		75278009	+1	no_errors	ENST00000358171	ensembl	human	known	70_37	silent	SNP	1.000	T
SIRPA	140885	genome.wustl.edu	37	20	1896052	1896052	+	Silent	SNP	C	C	T	rs139878822|rs202172737	byFrequency	TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr20:1896052C>T	ENST00000358771.4	+	2	539	c.387C>T	c.(385-387)ccC>ccT	p.P129P	SIRPA_ENST00000400068.3_Silent_p.P129P|SIRPA_ENST00000356025.3_Silent_p.P129P	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	129	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D131delD(2)|p.P129P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		AAGGGAGCCCCGATGACGTGG	0.532																																					GBM(155;1668 1920 5945 42733 48121)												3	Deletion - In frame(2)|Substitution - coding silent(1)	upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)											114.0	98.0	103.0					20																	1896052		2120	4008	6128	SO:0001819	synonymous_variant	140885			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.387C>T	20.37:g.1896052C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.P129	ENST00000358771.4	37	c.387	CCDS13022.1	20																																																																																			SIRPA	-	pfam_Ig_V-set,smart_Ig_sub		0.532	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPA	HGNC	protein_coding	OTTHUMT00000077568.2	C	NM_080792		1896052	+1	no_errors	ENST00000400068	ensembl	human	known	70_37	silent	SNP	0.000	T
SLC26A4	5172	genome.wustl.edu	37	7	107338524	107338524	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr7:107338524G>T	ENST00000265715.3	+	14	1806	c.1582G>T	c.(1582-1584)Gat>Tat	p.D528Y	SLC26A4_ENST00000480841.1_3'UTR|SLC26A4_ENST00000541474.1_Missense_Mutation_p.D89Y|SLC26A4_ENST00000544569.1_Missense_Mutation_p.D115Y|SLC26A4_ENST00000543100.1_Missense_Mutation_p.D97Y	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	528					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CCCTAGCACAGATATCTACAA	0.373									Pendred syndrome																																								0													107.0	100.0	103.0					7																	107338524		2203	4300	6503	SO:0001583	missense	5172	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1582G>T	7.37:g.107338524G>T	ENSP00000265715:p.Asp528Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z266|O43170	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D528Y	ENST00000265715.3	37	c.1582	CCDS5746.1	7	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789274	0.90367	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.95622	-3.39;-3.7;-3.76;-3.75	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	M	0.82716	2.605	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.992;0.984	D	0.98164	1.0448	10	0.87932	D	0	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	89;115;528	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	Y	528;89;115;97	ENSP00000265715:D528Y;ENSP00000439743:D89Y;ENSP00000437427:D115Y;ENSP00000441209:D97Y	ENSP00000265715:D528Y	D	+	1	0	SLC26A4	107125760	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.850000	0.92190	2.826000	0.97356	0.655000	0.94253	GAT	SLC26A4	-	tigrfam_SulP_transpt		0.373	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	G	NM_000441		107338524	+1	no_errors	ENST00000265715	ensembl	human	known	70_37	missense	SNP	1.000	T
SLCO5A1	81796	genome.wustl.edu	37	8	70744526	70744526	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr8:70744526C>T	ENST00000260126.4	-	2	1089	c.383G>A	c.(382-384)cGt>cAt	p.R128H	RP11-159H10.3_ENST00000501104.2_RNA|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.R128H|RP11-159H10.3_ENST00000528800.2_RNA|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.R128H|SLCO5A1_ENST00000528658.1_5'UTR|RP11-159H10.3_ENST00000533300.1_RNA	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CAGGAAGCAACGGGAATCCGT	0.547											OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													119.0	111.0	114.0					8																	70744526		2203	4300	6503	SO:0001583	missense	81796			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.383G>A	8.37:g.70744526C>T	ENSP00000260126:p.Arg128His	Somatic	1124	WXS	Illumina HiSeq	Phase_IV	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.R128H	ENST00000260126.4	37	c.383	CCDS6205.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.127577	0.94473	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.38401	1.14;1.14;1.14	5.71	5.71	0.89125	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	L	0.49513	1.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.99;0.991;0.984	T	0.55945	-0.8060	10	0.62326	D	0.03	.	19.8632	0.96793	0.0:1.0:0.0:0.0	.	128;128;128;128	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	H	128	ENSP00000260126:R128H;ENSP00000434422:R128H;ENSP00000431611:R128H	ENSP00000260126:R128H	R	-	2	0	SLCO5A1	70907080	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.955000	0.63638	2.704000	0.92352	0.561000	0.74099	CGT	SLCO5A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter		0.547	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	C	NM_030958		70744526	-1	no_errors	ENST00000260126	ensembl	human	known	70_37	missense	SNP	1.000	T
SMARCA1	6594	genome.wustl.edu	37	X	128582408	128582408	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chrX:128582408G>A	ENST00000371122.4	-	24	3172	c.3043C>T	c.(3043-3045)Cgc>Tgc	p.R1015C	SMARCA1_ENST00000371123.1_Missense_Mutation_p.R1003C|SMARCA1_ENST00000371121.3_Missense_Mutation_p.R1003C	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	1015	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GTGTTACAGCGTCTCTGGAAT	0.333																																																	0													109.0	103.0	105.0					X																	128582408		2203	4299	6502	SO:0001583	missense	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.3043C>T	X.37:g.128582408G>A	ENSP00000360163:p.Arg1015Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JV41|Q5JV42	Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ATPase_nucl-remodel_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Homeodomain-like,superfamily_ATPase_nucl-remodel_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1015C	ENST00000371122.4	37	c.3043	CCDS14612.1	X	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488735	0.64074	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.95949	-3.85;-3.85;-3.86;-3.78	5.87	5.87	0.94306	SANT domain, DNA binding (1);SLIDE (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000006	D	0.98513	0.9504	H	0.95004	3.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99285	1.0897	10	0.87932	D	0	-4.1744	19.3889	0.94570	0.0:0.0:1.0:0.0	.	994;1015;1003;1015	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	C	1003;1003;1015;994	ENSP00000360162:R1003C;ENSP00000360164:R1003C;ENSP00000360163:R1015C;ENSP00000404275:R994C	ENSP00000360162:R1003C	R	-	1	0	SMARCA1	128410089	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.756000	0.85195	2.618000	0.88619	0.600000	0.82982	CGC	SMARCA1	-	pfam_SLIDE,superfamily_Homeodomain-like,smart_SANT/Myb		0.333	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	HGNC	protein_coding	OTTHUMT00000058206.1	G	NM_003069		128582408	-1	no_errors	ENST00000371122	ensembl	human	known	70_37	missense	SNP	1.000	A
SMC1B	27127	genome.wustl.edu	37	22	45802378	45802378	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr22:45802378G>A	ENST00000357450.4	-	4	577	c.578C>T	c.(577-579)gCg>gTg	p.A193V	SMC1B_ENST00000404354.3_Missense_Mutation_p.A193V	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	193					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GCGCTCTGCCGCTATATTTTT	0.338																																																	0													84.0	79.0	81.0					22																	45802378		1814	4076	5890	SO:0001583	missense	27127			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.578C>T	22.37:g.45802378G>A	ENSP00000350036:p.Ala193Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.A193V	ENST00000357450.4	37	c.578	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	G	33	5.264921	0.95399	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.78707	-1.2;3.26	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000011	T	0.76716	0.4026	L	0.45285	1.41	0.80722	D	1	P;P	0.50819	0.87;0.939	B;P	0.46253	0.41;0.509	T	0.73717	-0.3895	10	0.28530	T	0.3	.	19.918	0.97070	0.0:0.0:1.0:0.0	.	193;193	Q8NDV3-2;Q8NDV3-3	.;.	V	193	ENSP00000350036:A193V;ENSP00000385902:A193V	ENSP00000350036:A193V	A	-	2	0	SMC1B	44181042	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.297000	0.72757	2.716000	0.92895	0.561000	0.74099	GCG	SMC1B	-	pfam_RecF/RecN/SMC		0.338	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2	G	NM_148674		45802378	-1	no_errors	ENST00000357450	ensembl	human	known	70_37	missense	SNP	1.000	A
SMCHD1	23347	genome.wustl.edu	37	18	2656258	2656258	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr18:2656258C>T	ENST00000320876.6	+	1	522	c.184C>T	c.(184-186)Cag>Tag	p.Q62*	CBX3P2_ENST00000579647.1_RNA|SMCHD1_ENST00000261598.8_Nonsense_Mutation_p.Q62*	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	62					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GTGTGTGTGTCAGGTACGCGA	0.612																																																	0													26.0	33.0	31.0					18																	2656258		1994	4163	6157	SO:0001587	stop_gained	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.184C>T	18.37:g.2656258C>T	ENSP00000326603:p.Gln62*	Somatic		WXS	Illumina HiSeq	Phase_IV	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Nonsense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.Q62*	ENST00000320876.6	37	c.184	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	C	37	6.052201	0.97236	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	.	.	.	4.24	4.24	0.50183	.	0.099710	0.41097	D	0.000947	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	12.4789	0.55831	0.0:1.0:0.0:0.0	.	.	.	.	X	62	.	ENSP00000261598:Q62X	Q	+	1	0	SMCHD1	2646258	1.000000	0.71417	1.000000	0.80357	0.341000	0.28922	2.000000	0.40816	2.081000	0.62600	0.561000	0.74099	CAG	SMCHD1	-	NULL		0.612	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	C			2656258	+1	no_errors	ENST00000320876	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SNAI3	333929	genome.wustl.edu	37	16	88744885	88744885	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr16:88744885C>T	ENST00000332281.5	-	3	936	c.850G>A	c.(850-852)Gag>Aag	p.E284K	SNAI3-AS1_ENST00000568633.1_RNA|SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	284					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		CCAGACTCCTCATGCCGCGCC	0.677																																					Colon(27;366 710 19748 23199 27567)												0													38.0	34.0	35.0					16																	88744885		2198	4299	6497	SO:0001583	missense	333929			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.850G>A	16.37:g.88744885C>T	ENSP00000327968:p.Glu284Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SU5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E284K	ENST00000332281.5	37	c.850	CCDS32505.1	16	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950682	0.34377	.	.	ENSG00000185669	ENST00000332281	T	0.50277	0.75	5.09	-0.386	0.12466	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.753768	0.12300	N	0.481233	T	0.23094	0.0558	N	0.11131	0.1	0.30139	N	0.804106	B	0.21071	0.051	B	0.17433	0.018	T	0.20042	-1.0287	10	0.27785	T	0.31	-5.8833	5.6499	0.17610	0.0:0.4586:0.2446:0.2969	.	284	Q3KNW1	SNAI3_HUMAN	K	284	ENSP00000327968:E284K	ENSP00000327968:E284K	E	-	1	0	SNAI3	87272386	0.511000	0.26179	0.000000	0.03702	0.072000	0.16883	0.684000	0.25364	0.012000	0.14892	0.561000	0.74099	GAG	SNAI3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.677	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	HGNC	protein_coding	OTTHUMT00000422582.1	C			88744885	-1	no_errors	ENST00000332281	ensembl	human	known	70_37	missense	SNP	0.514	T
C11orf58	10944	genome.wustl.edu	37	11	16760010	16760010	+	5'UTR	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:16760010G>A	ENST00000228136.4	+	0	63				C11orf58_ENST00000422258.2_5'Flank|C11orf58_ENST00000527893.1_Intron|C11orf58_ENST00000525684.1_5'Flank			O00193	SMAP_HUMAN	chromosome 11 open reading frame 58											NS(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)	7						TCCACCAGCCGAAGGCGGGGC	0.577																																																	0																																										SO:0001623	5_prime_UTR_variant	55553			BC007103	CCDS7822.1	11p15.1	2012-05-30			ENSG00000110696	ENSG00000110696			16990	protein-coding gene	gene with protein product	"""small acidic protein"""					9263035	Standard	NM_014267		Approved	SMAP	uc001mmk.2	O00193	OTTHUMG00000165910	ENST00000228136.4:c.-316G>A	11.37:g.16760010G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD28	RNA	SNP	-	NULL	ENST00000228136.4	37	NULL	CCDS7822.1	11																																																																																			SOX6	-	-		0.577	C11orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX6	HGNC	protein_coding	OTTHUMT00000387023.2	G	NM_014267		16760010	-1	no_errors	ENST00000524520	ensembl	human	known	70_37	rna	SNP	0.007	A
TBC1D30	23329	genome.wustl.edu	37	12	65264530	65264530	+	Silent	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr12:65264530G>A	ENST00000229088.6	+	12	1929	c.1929G>A	c.(1927-1929)caG>caA	p.Q643Q	TBC1D30_ENST00000542120.1_Silent_p.Q366Q|TBC1D30_ENST00000539867.1_Silent_p.Q480Q			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	643					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						TGAAGCGGCAGTACTCTCGAA	0.423																																																	0																																										SO:0001819	synonymous_variant	23329			AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.1929G>A	12.37:g.65264530G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP01|B9A6M9|E7EMW4|F5GYJ9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q643	ENST00000229088.6	37	c.1929		12																																																																																			TBC1D30	-	NULL		0.423	TBC1D30-201	KNOWN	basic	protein_coding	TBC1D30	HGNC	protein_coding		G	XM_037557		65264530	+1	no_errors	ENST00000229088	ensembl	human	known	70_37	silent	SNP	0.991	A
THSD7B	80731	genome.wustl.edu	37	2	137814044	137814044	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:137814044C>A	ENST00000409968.1	+	3	372	c.194C>A	c.(193-195)gCa>gAa	p.A65E	THSD7B_ENST00000543459.1_5'Flank|THSD7B_ENST00000413152.2_Missense_Mutation_p.A34E|THSD7B_ENST00000272643.3_Missense_Mutation_p.A65E			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	65	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAGAGTCGGGCAGTGTGGTGT	0.498																																																	0													69.0	74.0	73.0					2																	137814044		2014	4188	6202	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.194C>A	2.37:g.137814044C>A	ENSP00000387145:p.Ala65Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.A65E	ENST00000409968.1	37	c.194		2	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432963	0.62844	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60548	0.18;0.18;0.18	5.89	4.97	0.65823	.	0.195079	0.31188	U	0.008096	T	0.38161	0.1030	L	0.33189	0.99	0.24012	N	0.996173	P	0.44627	0.839	B	0.35550	0.205	T	0.37549	-0.9701	10	0.07325	T	0.83	.	12.6768	0.56899	0.0:0.7983:0.1299:0.0718	.	34	C9JKN6	.	E	65;65;34	ENSP00000387145:A65E;ENSP00000272643:A65E;ENSP00000413841:A34E	ENSP00000272643:A65E	A	+	2	0	THSD7B	137530514	0.966000	0.33281	0.166000	0.22797	0.998000	0.95712	3.216000	0.51176	2.788000	0.95919	0.585000	0.79938	GCA	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.498	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9		137814044	+1	no_errors	ENST00000272643	ensembl	human	known	70_37	missense	SNP	0.046	A
TLX3	30012	genome.wustl.edu	37	5	170738602	170738602	+	Nonstop_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr5:170738602G>C	ENST00000296921.5	+	3	957	c.875G>C	c.(874-876)tGa>tCa	p.*292S		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	0					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCCCTGGTGTGAGCCCACCAG	0.706			T	BCL11B	T-ALL																																Esophageal Squamous(33;43 807 3116 3348 30094)			Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	0													39.0	30.0	33.0					5																	170738602		2203	4300	6503	SO:0001578	stop_lost	30012			AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.875G>C	5.37:g.170738602G>C	ENSP00000296921:p.*292Serext*80	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AD3	Nonstop_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.*292S	ENST00000296921.5	37	c.875	CCDS34288.1	5	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335969	0.41398	.	.	ENSG00000164438	ENST00000296921	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1357	0.42706	0.0953:0.0:0.9047:0.0	.	.	.	.	S	292	.	.	X	+	2	2	TLX3	170671207	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	0.741000	0.26202	1.986000	0.57962	0.491000	0.48974	TGA	TLX3	-	NULL		0.706	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TLX3	HGNC	protein_coding	OTTHUMT00000372076.3	G			170738602	+1	no_errors	ENST00000296921	ensembl	human	known	70_37	nonstop	SNP	1.000	C
TMPRSS11D	9407	genome.wustl.edu	37	4	68692991	68692991	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr4:68692991G>A	ENST00000283916.6	-	8	1038	c.940C>T	c.(940-942)Caa>Taa	p.Q314*	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000545541.1_Nonsense_Mutation_p.Q197*	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	314	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GCATATTCTTGAGCGCCCCAT	0.378																																																	0													106.0	105.0	105.0					4																	68692991		2203	4299	6502	SO:0001587	stop_gained	9407			AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.940C>T	4.37:g.68692991G>A	ENSP00000283916:p.Gln314*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AF6	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_SEA,smart_Peptidase_S1_S6,pirsf_Pept_S1A_HAT/DESC1,pfscan_SEA,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q314*	ENST00000283916.6	37	c.940	CCDS3518.1	4	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858762	0.71834	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	.	.	.	5.38	-0.146	0.13432	.	1.851080	0.02892	N	0.134339	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	8.916	0.35581	0.0:0.2428:0.3972:0.3599	.	.	.	.	X	314;197	.	ENSP00000283916:Q314X	Q	-	1	0	TMPRSS11D	68375586	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.033000	0.13754	0.003000	0.14656	0.655000	0.94253	CAA	TMPRSS11D	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1_S6		0.378	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11D	HGNC	protein_coding	OTTHUMT00000251430.3	G	NM_004262		68692991	-1	no_errors	ENST00000283916	ensembl	human	known	70_37	nonsense	SNP	0.000	A
TOMM7	54543	genome.wustl.edu	37	7	22857031	22857031	+	Intron	DEL	T	T	-			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr7:22857031delT	ENST00000358435.4	-	2	224				TOMM7_ENST00000372879.4_Splice_Site_p.T97fs|TOMM7_ENST00000463284.1_Intron|TOMM7_ENST00000405021.3_Intron	NM_019059.2	NP_061932.1	Q9P0U1	TOM7_HUMAN	translocase of outer mitochondrial membrane 7 homolog (yeast)						cellular protein metabolic process (GO:0044267)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			skin(1)	1						AATTATTTACttttttttttt	0.378																																																	0																																										SO:0001627	intron_variant	54543			AF150733	CCDS5376.1	7p15.3	2003-07-21			ENSG00000196683	ENSG00000196683			21648	protein-coding gene	gene with protein product		607980				10647823, 12198123	Standard	NM_019059		Approved		uc003svk.4	Q9P0U1	OTTHUMG00000094805	ENST00000358435.4:c.152+587A>-	7.37:g.22857031delT		Somatic		WXS	Illumina HiSeq	Phase_IV	O95939	Frame_Shift_Del	DEL	pfam_Tom7	p.T97fs	ENST00000358435.4	37	c.289	CCDS5376.1	7																																																																																			TOMM7	-	NULL		0.378	TOMM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM7	HGNC	protein_coding	OTTHUMT00000211623.1	T	NM_019059		22857031	-1	no_errors	ENST00000372879	ensembl	human	putative	70_37	frame_shift_del	DEL	0.100	-
TRAF3IP2	10758	genome.wustl.edu	37	6	111913050	111913050	+	Silent	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:111913050G>C	ENST00000340026.6	-	3	861	c.267C>G	c.(265-267)gtC>gtG	p.V89V	TRAF3IP2_ENST00000359831.4_Silent_p.V80V|TRAF3IP2_ENST00000368761.5_Silent_p.V80V|TRAF3IP2_ENST00000392556.4_5'UTR|TRAF3IP2-AS1_ENST00000532353.1_RNA			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	89	Mediates interaction with TRAF6.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		GCAGGCAGGTGACCTGCCGGG	0.547																																																	0													76.0	78.0	77.0					6																	111913050		2203	4300	6503	SO:0001819	synonymous_variant	10758			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.267C>G	6.37:g.111913050G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Silent	SNP	pfam_SEFIR	p.V89	ENST00000340026.6	37	c.267		6																																																																																			TRAF3IP2	-	NULL		0.547	TRAF3IP2-001	KNOWN	basic	protein_coding	TRAF3IP2	HGNC	protein_coding	OTTHUMT00000041841.2	G			111913050	-1	no_errors	ENST00000340026	ensembl	human	known	70_37	silent	SNP	0.991	C
TRANK1	9881	genome.wustl.edu	37	3	36872496	36872496	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:36872496C>T	ENST00000429976.2	-	21	8693	c.8446G>A	c.(8446-8448)Gag>Aag	p.E2816K	TRANK1_ENST00000301807.6_Missense_Mutation_p.E2266K|TRANK1_ENST00000428977.2_Missense_Mutation_p.E2266K	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2816							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						ACACTTTGCTCGATGTCCTGC	0.542																																																	0													246.0	241.0	243.0					3																	36872496		2111	4225	6336	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8446G>A	3.37:g.36872496C>T	ENSP00000416168:p.Glu2816Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.E2816K	ENST00000429976.2	37	c.8446	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513262	0.27123	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.30448	1.53;1.94;1.53	4.96	2.12	0.27331	.	0.241922	0.29087	N	0.013196	T	0.13114	0.0318	L	0.29908	0.895	0.18873	N	0.999986	P	0.36144	0.539	B	0.19148	0.024	T	0.18840	-1.0324	10	0.16896	T	0.51	.	4.5315	0.12008	0.1484:0.5352:0.0:0.3163	.	2816	O15050	TRNK1_HUMAN	K	2266;2816;2266	ENSP00000416826:E2266K;ENSP00000416168:E2816K;ENSP00000301807:E2266K	ENSP00000301807:E2266K	E	-	1	0	TRANK1	36847500	0.987000	0.35691	0.381000	0.26106	0.551000	0.35334	2.721000	0.47260	0.349000	0.23975	0.555000	0.69702	GAG	TRANK1	-	NULL		0.542	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		C	NM_014831		36872496	-1	no_errors	ENST00000429976	ensembl	human	known	70_37	missense	SNP	0.198	T
TRIM10	10107	genome.wustl.edu	37	6	30128238	30128238	+	Missense_Mutation	SNP	C	C	T	rs376088104		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:30128238C>T	ENST00000449742.2	-	1	473	c.398G>A	c.(397-399)cGc>cAc	p.R133H	TRIM15_ENST00000376694.4_5'Flank|TRIM10_ENST00000376704.3_Missense_Mutation_p.R133H	NM_006778.3	NP_006769.2	Q9UDY6	TRI10_HUMAN	tripartite motif containing 10	133					erythrocyte differentiation (GO:0030218)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			ovary(1)	1						CTCCAGGAAGCGCATGGTGTG	0.572																																																	0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	66.0	57.0	60.0		398,398	3.2	1.0	6		60	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	TRIM10	NM_006778.3,NM_052828.2	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	133/482,133/396	30128238	2,13004	2203	4300	6503	SO:0001583	missense	10107			Y07829	CCDS4676.1, CCDS34375.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000204613	ENSG00000204613		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10072	protein-coding gene	gene with protein product		605701	"""tripartite motif-containing 10"""	RNF9		9271628, 10207104	Standard	NM_052828		Approved	RFB30, HERF1	uc003npo.3	Q9UDY6	OTTHUMG00000031295	ENST00000449742.2:c.398G>A	6.37:g.30128238C>T	ENSP00000397073:p.Arg133His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF84|Q5SRJ5|Q5SRK8|Q86Z08|Q96QB6|Q9C023|Q9C024	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R133H	ENST00000449742.2	37	c.398	CCDS34375.1	6	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474099	0.43942	0.0	2.33E-4	ENSG00000204613	ENST00000449742;ENST00000376704;ENST00000376706	T;T	0.57107	0.42;0.42	5.11	3.19	0.36642	Zinc finger, B-box (2);	0.374032	0.23402	N	0.048579	T	0.48926	0.1527	M	0.78285	2.405	0.09310	N	1	D;D	0.89917	1.0;0.999	D;P	0.69824	0.966;0.87	T	0.35599	-0.9782	10	0.20519	T	0.43	.	3.708	0.08408	0.1672:0.579:0.1622:0.0916	.	133;133	Q9UDY6;Q9UDY6-2	TRI10_HUMAN;.	H	133	ENSP00000397073:R133H;ENSP00000365894:R133H	ENSP00000365894:R133H	R	-	2	0	TRIM10	30236217	0.000000	0.05858	0.965000	0.40720	0.099000	0.18886	-0.106000	0.10890	1.301000	0.44836	0.549000	0.68633	CGC	TRIM10	-	smart_Znf_B-box,pfscan_Znf_B-box		0.572	TRIM10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM10	HGNC	protein_coding	OTTHUMT00000076634.1	C			30128238	-1	no_errors	ENST00000449742	ensembl	human	known	70_37	missense	SNP	0.001	T
TTR	7276	genome.wustl.edu	37	18	29175194	29175194	+	Silent	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr18:29175194C>T	ENST00000237014.3	+	3	489	c.312C>T	c.(310-312)atC>atT	p.I104I		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	104			I -> N (in AMYL-TTR; vitrous amyloid). {ECO:0000269|PubMed:17503405}.|I -> S (in AMYL-TTR; amyloid polyneuropathy; almost no RBP binding). {ECO:0000269|PubMed:17503405, ECO:0000269|PubMed:3722385, ECO:0000269|PubMed:8089102}.|I -> T (in AMYL-TTR). {ECO:0000269|PubMed:17503405}.		extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CACTTGGCATCTCCCCATTCC	0.448																																																	0													136.0	110.0	119.0					18																	29175194		2203	4300	6503	SO:0001819	synonymous_variant	7276			M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.312C>T	18.37:g.29175194C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Silent	SNP	pfam_Transthyretin/HIU_hydrolase_SF,superfamily_Transthyretin/HIU_hydrolase_SF,smart_Transthyretin/HIU_hydrolase_SF,prints_Transthyretin/HIU_hydrolase	p.I104	ENST00000237014.3	37	c.312	CCDS11899.1	18																																																																																			TTR	-	pfam_Transthyretin/HIU_hydrolase_SF,superfamily_Transthyretin/HIU_hydrolase_SF,smart_Transthyretin/HIU_hydrolase_SF,prints_Transthyretin/HIU_hydrolase		0.448	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTR	HGNC	protein_coding	OTTHUMT00000254948.1	C	NM_000371		29175194	+1	no_errors	ENST00000237014	ensembl	human	known	70_37	silent	SNP	0.624	T
UBE2B	7320	genome.wustl.edu	37	5	133707248	133707248	+	5'UTR	DEL	T	T	-	rs35950497|rs397796739		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr5:133707248delT	ENST00000265339.2	+	0	379				CDKL3_ENST00000609654.1_5'Flank|CDKL3_ENST00000522501.1_5'Flank|CDKL3_ENST00000521755.1_5'Flank|CDKL3_ENST00000536186.1_5'Flank|CDKL3_ENST00000609383.1_5'Flank|CTD-2410N18.4_ENST00000518409.1_RNA|UBE2B_ENST00000511807.1_3'UTR|CDKL3_ENST00000435240.2_5'Flank|CDKL3_ENST00000523054.1_5'Flank	NM_003337.2	NP_003328.1	P63146	UBE2B_HUMAN	ubiquitin-conjugating enzyme E2B						canonical Wnt signaling pathway (GO:0060070)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to insulin stimulus (GO:0032869)|chiasma assembly (GO:0051026)|DNA repair (GO:0006281)|histone H2A ubiquitination (GO:0033522)|histone lysine demethylation (GO:0070076)|in utero embryonic development (GO:0001701)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of histone phosphorylation (GO:0033128)|positive regulation of reciprocal meiotic recombination (GO:0010845)|postreplication repair (GO:0006301)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|sperm axoneme assembly (GO:0007288)|spermatogenesis (GO:0007283)|synaptonemal complex organization (GO:0070193)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|HULC complex (GO:0033503)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|replication fork (GO:0005657)|XY body (GO:0001741)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(2)|lung(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tgcgcgggACTTTTTTTTTTT	0.697								Rad6 pathway																																									0													9.0	12.0	11.0					5																	133707248		2178	4280	6458	SO:0001623	5_prime_UTR_variant	7320			M74525	CCDS4174.1	5q31.1	2011-05-19	2011-05-19		ENSG00000119048	ENSG00000119048		"""Ubiquitin-conjugating enzymes E2"""	12473	protein-coding gene	gene with protein product		179095	"""ubiquitin-conjugating enzyme E2B (RAD6 homolog)"""			1559696	Standard	NM_003337		Approved	UBC2, HHR6B, RAD6B	uc003kzh.3	P63146	OTTHUMG00000129120	ENST00000265339.2:c.-39T>-	5.37:g.133707248delT		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R503|D3DQA2|P23567|Q4PJ15|Q9D0J6	RNA	DEL	-	NULL	ENST00000265339.2	37	NULL	CCDS4174.1	5																																																																																			UBE2B	-	-		0.697	UBE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2B	HGNC	protein_coding	OTTHUMT00000251166.2	T	NM_003337		133707248	+1	no_errors	ENST00000511807	ensembl	human	known	70_37	rna	DEL	1.000	-
USP34	9736	genome.wustl.edu	37	2	61505365	61505365	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr2:61505365G>T	ENST00000398571.2	-	41	5444	c.5368C>A	c.(5368-5370)Ctc>Atc	p.L1790I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1790					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AGCCTTAGGAGTCCTGTAAGC	0.353																																																	0													103.0	89.0	93.0					2																	61505365		1868	4100	5968	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5368C>A	2.37:g.61505365G>T	ENSP00000381577:p.Leu1790Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.L1790I	ENST00000398571.2	37	c.5368	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	18.01	3.526981	0.64860	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.04551	3.64;3.6	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.07638	0.0192	L	0.49126	1.545	0.46901	D	0.999247	B	0.16802	0.019	B	0.16289	0.015	T	0.18840	-1.0324	10	0.37606	T	0.19	.	17.5316	0.87816	0.0:0.0:1.0:0.0	.	1790	Q70CQ2	UBP34_HUMAN	I	1638;1638;1790;68	ENSP00000381577:L1790I;ENSP00000410559:L68I	ENSP00000263989:L1638I	L	-	1	0	USP34	61358869	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.566000	0.67372	2.582000	0.87167	0.563000	0.77884	CTC	USP34	-	NULL		0.353	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	G			61505365	-1	no_errors	ENST00000398571	ensembl	human	known	70_37	missense	SNP	1.000	T
WNK1	65125	genome.wustl.edu	37	12	977110	977110	+	Intron	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr12:977110C>T	ENST00000315939.6	+	9	2782				WNK1_ENST00000340908.4_Intron|WNK1_ENST00000574564.1_Missense_Mutation_p.R39C|WNK1_ENST00000530271.2_Missense_Mutation_p.R825C|WNK1_ENST00000537687.1_Missense_Mutation_p.R740C|WNK1_ENST00000535572.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TATTCATGAACGTCCAGTTTC	0.507																																					Colon(19;451 567 6672 12618 28860)												0													82.0	85.0	84.0					12																	977110		1925	4128	6053	SO:0001627	intron_variant	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-3321C>T	12.37:g.977110C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R825C	ENST00000315939.6	37	c.2473	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	C	16.12	3.031737	0.54790	.	.	ENSG00000060237	ENST00000537687;ENST00000530271	T;T	0.16196	2.36;2.36	5.8	5.8	0.92144	.	.	.	.	.	T	0.44286	0.1286	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.07158	-1.0787	8	0.38643	T	0.18	.	20.0522	0.97631	0.0:1.0:0.0:0.0	.	825	F5H2M7	.	C	740;825	ENSP00000444465:R740C;ENSP00000433548:R825C	ENSP00000433548:R825C	R	+	1	0	WNK1	847371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.446000	0.60014	2.737000	0.93849	0.563000	0.77884	CGT	WNK1	-	NULL		0.507	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	C	NM_018979		977110	+1	no_errors	ENST00000530271	ensembl	human	known	70_37	missense	SNP	1.000	T
ZBTB16	7704	genome.wustl.edu	37	11	114113003	114113003	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr11:114113003G>C	ENST00000335953.4	+	5	1948	c.1568G>C	c.(1567-1569)tGc>tCc	p.C523S	RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000535379.1_3'UTR|ZBTB16_ENST00000392996.2_Missense_Mutation_p.C523S	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	523					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TGCAGTGAGTGCAACCGCACC	0.627																																																	0													59.0	47.0	51.0					11																	114113003		2201	4296	6497	SO:0001583	missense	7704			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1568G>C	11.37:g.114113003G>C	ENSP00000338157:p.Cys523Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C523S	ENST00000335953.4	37	c.1568	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.167054	0.94768	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.39787	1.06;1.06	5.65	5.65	0.86999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	H	0.98111	4.15	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86612	0.1873	10	0.87932	D	0	-12.1385	20.0965	0.97849	0.0:0.0:1.0:0.0	.	523	Q05516	ZBT16_HUMAN	S	523;523;400	ENSP00000338157:C523S;ENSP00000376721:C523S	ENSP00000309507:C400S	C	+	2	0	ZBTB16	113618213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.762000	0.98944	2.824000	0.97209	0.655000	0.94253	TGC	ZBTB16	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.627	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	G	NM_006006		114113003	+1	no_errors	ENST00000335953	ensembl	human	known	70_37	missense	SNP	1.000	C
ZBTB20	26137	genome.wustl.edu	37	3	114069161	114069161	+	Silent	SNP	G	G	A	rs142230895		TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr3:114069161G>A	ENST00000474710.1	-	4	1942	c.1764C>T	c.(1762-1764)acC>acT	p.T588T	ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000357258.3_Silent_p.T515T|ZBTB20_ENST00000464560.1_Silent_p.T515T|ZBTB20_ENST00000471418.1_Silent_p.T515T|ZBTB20_ENST00000393785.2_Silent_p.T515T|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000481632.1_Silent_p.T515T|ZBTB20_ENST00000462705.1_Silent_p.T515T	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	588						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TCTGTTTGGCGGTGAAAGTCT	0.592																																					NSCLC(69;748 1344 9802 11203 30933)												0								G	,,,,,,	1,4405	2.1+/-5.4	0,1,2202	180.0	177.0	178.0		1764,1545,1545,1545,1545,1545,1545	3.1	1.0	3	dbSNP_134	178	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZBTB20	NM_001164342.1,NM_001164343.1,NM_001164344.1,NM_001164345.1,NM_001164346.1,NM_001164347.1,NM_015642.4	,,,,,,	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,,,,,,	588/742,515/669,515/669,515/669,515/669,515/669,515/669	114069161	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1764C>T	3.37:g.114069161G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T588	ENST00000474710.1	37	c.1764	CCDS54626.1	3																																																																																			ZBTB20	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.592	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	G	NM_015642		114069161	-1	no_errors	ENST00000474710	ensembl	human	known	70_37	silent	SNP	1.000	A
ZFR2	23217	genome.wustl.edu	37	19	3827625	3827625	+	Silent	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr19:3827625C>T	ENST00000262961.4	-	6	889	c.879G>A	c.(877-879)caG>caA	p.Q293Q		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	293							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TTCTGTGCTTCTGCCCTCCCA	0.692																																																	0													20.0	21.0	21.0					19																	3827625		1978	4138	6116	SO:0001819	synonymous_variant	23217			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.879G>A	19.37:g.3827625C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.Q293	ENST00000262961.4	37	c.879	CCDS45921.1	19																																																																																			ZFR2	-	smart_Znf_U1,smart_Znf_C2H2-like		0.692	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	C	NM_015174		3827625	-1	no_errors	ENST00000262961	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF311	282890	genome.wustl.edu	37	6	28971356	28971356	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr6:28971356C>T	ENST00000377179.3	-	3	537	c.25G>A	c.(25-27)Gag>Aag	p.E9K	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						CCTGAACTCTCATCCAACAGC	0.483																																																	0													151.0	160.0	156.0					6																	28971356		1511	2709	4220	SO:0001583	missense	282890			AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.25G>A	6.37:g.28971356C>T	ENSP00000366384:p.Glu9Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E9K	ENST00000377179.3	37	c.25	CCDS34357.1	6	.	.	.	.	.	.	.	.	.	.	C	11.88	1.770128	0.31320	.	.	ENSG00000197935	ENST00000377179	T	0.04862	3.54	2.55	2.55	0.30701	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.17098	0.017	T	0.48547	-0.9026	9	0.49607	T	0.09	.	8.7337	0.34514	0.0:1.0:0.0:0.0	.	9	Q5JNZ3	ZN311_HUMAN	K	9	ENSP00000366384:E9K	ENSP00000366384:E9K	E	-	1	0	ZNF311	29079335	0.000000	0.05858	0.003000	0.11579	0.122000	0.20287	0.569000	0.23638	1.703000	0.51240	0.591000	0.81541	GAG	ZNF311	-	NULL		0.483	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	HGNC	protein_coding	OTTHUMT00000076631.3	C	XM_212581		28971356	-1	no_errors	ENST00000377179	ensembl	human	known	70_37	missense	SNP	0.003	T
ZNF720	124411	genome.wustl.edu	37	16	31766154	31766154	+	Intron	SNP	C	C	G			TCGA-FU-A3WB-01A-11D-A22X-09	TCGA-FU-A3WB-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	08d5bef0-b055-4479-b56c-cd716d6b6a95	b096c6ae-e4ed-41a0-a02f-1a1913ef0f31	g.chr16:31766154C>G	ENST00000316491.9	+	4	560				ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000399681.3_Nonsense_Mutation_p.S181*|ZNF720_ENST00000398696.3_3'UTR|ZNF720_ENST00000539915.1_Intron|ZNF720_ENST00000534369.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						AACCATCGTTCACACCTTACT	0.313																																																	0																																										SO:0001627	intron_variant	124411			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+933C>G	16.37:g.31766154C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQX1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S181*	ENST00000316491.9	37	c.542	CCDS45473.1	16	.	.	.	.	.	.	.	.	.	.	c	15.69	2.907257	0.52333	.	.	ENSG00000197302	ENST00000399681	.	.	.	0.965	0.965	0.19661	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	7.7881	0.29103	0.0:1.0:0.0:0.0	.	.	.	.	X	181	.	ENSP00000440701:S181X	S	+	2	0	ZNF720	31673655	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.807000	0.04520	0.847000	0.35167	0.561000	0.74099	TCA	ZNF720	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.313	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	C	NM_001004300		31766154	+1	no_errors	ENST00000399681	ensembl	human	known	70_37	nonsense	SNP	0.000	G
