#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC10	89845	genome.wustl.edu	37	6	43395875	43395875	+	Silent	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:43395875G>C	ENST00000372530.4	+	2	374	c.159G>C	c.(157-159)ccG>ccC	p.P53P	ABCC10_ENST00000443426.2_Intron	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	53					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TGGGCACCCCGAGGTGGGTAG	0.652																																																	0													3.0	3.0	3.0					6																	43395875		822	1869	2691	SO:0001819	synonymous_variant	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.159G>C	6.37:g.43395875G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P53	ENST00000372530.4	37	c.159	CCDS56430.1	6																																																																																			ABCC10	-	NULL		0.652	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	HGNC	protein_coding	OTTHUMT00000040603.2	G	NM_033450		43395875	+1	no_errors	ENST00000372530	ensembl	human	known	70_37	silent	SNP	0.738	C
ABCC12	94160	genome.wustl.edu	37	16	48162555	48162555	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:48162555C>T	ENST00000311303.3	-	9	1675	c.1330G>A	c.(1330-1332)Gag>Aag	p.E444K	ABCC12_ENST00000416054.1_Missense_Mutation_p.E444K|ABCC12_ENST00000448542.1_Missense_Mutation_p.E444K	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	444						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GCTTCATGCTCCCATGTCAAG	0.443																																																	0													151.0	134.0	140.0					16																	48162555		2201	4300	6501	SO:0001583	missense	94160			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1330G>A	16.37:g.48162555C>T	ENSP00000311030:p.Glu444Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.E444K	ENST00000311303.3	37	c.1330	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	C	16.54	3.150734	0.57151	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.93247	-2.89;-3.1;-3.19	5.45	5.45	0.79879	.	0.297322	0.32081	N	0.006606	D	0.89989	0.6875	L	0.37850	1.14	0.37093	D	0.899544	B;B	0.12630	0.006;0.002	B;B	0.16289	0.015;0.004	D	0.87949	0.2722	10	0.49607	T	0.09	.	16.2065	0.82133	0.0:1.0:0.0:0.0	.	444;444	Q96J65-2;Q96J65	.;MRP9_HUMAN	K	444;444;386;444	ENSP00000311030:E444K;ENSP00000401855:E444K;ENSP00000413046:E444K	ENSP00000311030:E444K	E	-	1	0	ABCC12	46720056	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.956000	0.49129	2.543000	0.85770	0.561000	0.74099	GAG	ABCC12	-	NULL		0.443	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	C	NM_033226		48162555	-1	no_errors	ENST00000311303	ensembl	human	known	70_37	missense	SNP	1.000	T
ACADSB	36	genome.wustl.edu	37	10	124800817	124800817	+	Silent	SNP	C	C	T	rs368834489		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr10:124800817C>T	ENST00000358776.4	+	5	617	c.603C>T	c.(601-603)ctC>ctT	p.L201L	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_Silent_p.L99L	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	201					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	ATTATGTCCTCAATGGATCAA	0.438																																																	0													144.0	139.0	141.0					10																	124800817		2203	4300	6503	SO:0001819	synonymous_variant	36			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.603C>T	10.37:g.124800817C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.L201	ENST00000358776.4	37	c.603	CCDS7634.1	10																																																																																			ACADSB	-	pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase		0.438	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	HGNC	protein_coding	OTTHUMT00000050843.1	C	NM_001609		124800817	+1	no_errors	ENST00000358776	ensembl	human	known	70_37	silent	SNP	1.000	T
ADAM12	8038	genome.wustl.edu	37	10	127724832	127724832	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr10:127724832C>T	ENST00000368679.4	-	21	2730	c.2421G>A	c.(2419-2421)ctG>ctA	p.L807L		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	807					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GAGGGACATTCAGGCCGTTGA	0.577																																																	0													107.0	104.0	105.0					10																	127724832		2203	4300	6503	SO:0001819	synonymous_variant	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2421G>A	10.37:g.127724832C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.L807	ENST00000368679.4	37	c.2421	CCDS7653.1	10																																																																																			ADAM12	-	NULL		0.577	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	C			127724832	-1	no_errors	ENST00000368679	ensembl	human	known	70_37	silent	SNP	0.000	T
AFF4	27125	genome.wustl.edu	37	5	132272780	132272780	+	Silent	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:132272780G>C	ENST00000265343.5	-	2	481	c.102C>G	c.(100-102)ctC>ctG	p.L34L	AFF4_ENST00000491831.1_5'UTR|AFF4_ENST00000378595.3_Silent_p.L34L	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	34					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTCTGCAAAGAGAGGAGAGC	0.438																																					Ovarian(126;889 1733 2942 10745 11605)												0													108.0	92.0	97.0					5																	132272780		2203	4300	6503	SO:0001819	synonymous_variant	27125			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.102C>G	5.37:g.132272780G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Silent	SNP	pfam_TF_AF4/FMR2	p.L34	ENST00000265343.5	37	c.102	CCDS4164.1	5																																																																																			AFF4	-	pfam_TF_AF4/FMR2		0.438	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	HGNC	protein_coding	OTTHUMT00000133049.1	G	NM_014423		132272780	-1	no_errors	ENST00000265343	ensembl	human	known	70_37	silent	SNP	1.000	C
CEMP1	752014	genome.wustl.edu	37	16	2581197	2581197	+	5'UTR	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:2581197C>T	ENST00000567119.1	-	0	212				CEMP1_ENST00000565480.1_5'UTR|AMDHD2_ENST00000302956.4_3'UTR|MIR3178_ENST00000581887.1_RNA|CEMP1_ENST00000382350.1_5'UTR|AMDHD2_ENST00000565570.1_3'UTR	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1							cytoplasm (GO:0005737)				lung(1)|skin(1)	2						CGGCCAGCGCCCCACCTCCCT	0.697																																																	0																																										SO:0001623	5_prime_UTR_variant	51005			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.-123G>A	16.37:g.2581197C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUY1	RNA	SNP	-	NULL	ENST00000567119.1	37	NULL	CCDS42108.1	16																																																																																			AMDHD2	-	-		0.697	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMDHD2	HGNC	protein_coding	OTTHUMT00000435686.1	C	NM_001048212		2581197	+1	no_errors	ENST00000565570	ensembl	human	known	70_37	rna	SNP	0.000	T
ANGPTL3	27329	genome.wustl.edu	37	1	63066839	63066839	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:63066839G>C	ENST00000371129.3	+	3	773	c.693G>C	c.(691-693)ttG>ttC	p.L231F	DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	231					acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						TTCTTCAGTTGAATGAAATAA	0.358																																																	0													78.0	76.0	76.0					1																	63066839		2203	4297	6500	SO:0001583	missense	27329			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.693G>C	1.37:g.63066839G>C	ENSP00000360170:p.Leu231Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A0JLS0|B1ALJ0|B2RCW1	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L231F	ENST00000371129.3	37	c.693	CCDS622.1	1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.395429	0.01175	.	.	ENSG00000132855	ENST00000371129	T	0.54866	0.55	5.46	-1.32	0.09201	.	1.390710	0.04957	N	0.461375	T	0.12178	0.0296	N	0.17082	0.46	0.09310	N	1	B	0.20887	0.049	B	0.11329	0.006	T	0.12993	-1.0526	10	0.37606	T	0.19	.	0.9947	0.01464	0.1736:0.2886:0.27:0.2678	.	231	Q9Y5C1	ANGL3_HUMAN	F	231	ENSP00000360170:L231F	ENSP00000360170:L231F	L	+	3	2	ANGPTL3	62839427	0.068000	0.21057	0.005000	0.12908	0.092000	0.18411	0.004000	0.13106	0.012000	0.14892	0.591000	0.81541	TTG	ANGPTL3	-	NULL		0.358	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	G	NM_014495		63066839	+1	no_errors	ENST00000371129	ensembl	human	known	70_37	missense	SNP	0.000	C
ANKRD30BL	554226	genome.wustl.edu	37	2	132919260	132919260	+	Missense_Mutation	SNP	C	C	T	rs573267303	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:132919260C>T	ENST00000409867.1	-	1	268	c.19G>A	c.(19-21)Gcc>Acc	p.A7T	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	7										endometrium(1)|kidney(3)	4						TTGACAGGGGCGGCAGAGAGC	0.662																																																	0																																										SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.19G>A	2.37:g.132919260C>T	ENSP00000386398:p.Ala7Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZL7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A7T	ENST00000409867.1	37	c.19		2	.	.	.	.	.	.	.	.	.	.	.	5.754	0.323455	0.10900	.	.	ENSG00000163046	ENST00000409867	T	0.37058	1.22	0.109	0.109	0.14578	.	.	.	.	.	T	0.11879	0.0289	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33904	-0.9850	5	0.02654	T	1	.	.	.	.	.	.	.	.	T	7	ENSP00000386398:A7T	ENSP00000295181:A7T	A	-	1	0	ANKRD30BL	132635730	0.000000	0.05858	0.021000	0.16686	0.021000	0.10359	-0.292000	0.08332	0.181000	0.19994	0.184000	0.17185	GCC	ANKRD30BL	-	NULL		0.662	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331353.2	C	NR_027019		132919260	-1	no_errors	ENST00000295181	ensembl	human	known	70_37	missense	SNP	0.407	T
APOBEC3H	164668	genome.wustl.edu	37	22	39497356	39497356	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:39497356G>T	ENST00000401756.1	+	3	341	c.265G>T	c.(265-267)Gcc>Tcc	p.A89S	APOBEC3H_ENST00000348946.4_Missense_Mutation_p.A89S|APOBEC3H_ENST00000442487.3_Missense_Mutation_p.A89S|APOBEC3H_ENST00000421988.2_Missense_Mutation_p.A89S	NM_001166003.1	NP_001159475.1	Q6NTF7	ABC3H_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H	89					cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral process (GO:0048525)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(8)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15	Melanoma(58;0.04)					CTCCTCCTGTGCCTGGGAGCT	0.552																																																	0													121.0	90.0	101.0					22																	39497356		2203	4300	6503	SO:0001583	missense	164668			BC069023	CCDS13985.1, CCDS54530.1, CCDS54531.1, CCDS54532.1	22q13.1	2007-02-01			ENSG00000100298	ENSG00000100298		"""Apolipoprotein B mRNA editing enzymes"""	24100	protein-coding gene	gene with protein product		610976				16571802	Standard	NM_001166003		Approved	ARP10	uc021wpt.1	Q6NTF7	OTTHUMG00000151082	ENST00000401756.1:c.265G>T	22.37:g.39497356G>T	ENSP00000385741:p.Ala89Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYP0|B0QYP1|B7TQM5|E9PF38|Q5JYL9|Q6IC87	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like	p.A89S	ENST00000401756.1	37	c.265	CCDS54530.1	22	.	.	.	.	.	.	.	.	.	.	.	16.54	3.152584	0.57259	.	.	ENSG00000100298	ENST00000348946;ENST00000442487;ENST00000421988;ENST00000401756	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	3.33	3.33	0.38152	.	.	.	.	.	D	0.84005	0.5377	M	0.94021	3.485	0.09310	N	1	D	0.60160	0.987	D	0.68039	0.955	T	0.73681	-0.3906	9	0.87932	D	0	-18.9292	10.4718	0.44642	0.0:0.0:1.0:0.0	.	89	B7TQM3	.	S	89	ENSP00000216123:A89S;ENSP00000411754:A89S;ENSP00000393520:A89S;ENSP00000385741:A89S	ENSP00000216123:A89S	A	+	1	0	APOBEC3H	37827302	0.359000	0.24955	0.179000	0.23059	0.026000	0.11368	2.151000	0.42263	2.179000	0.69175	0.460000	0.39030	GCC	APOBEC3H	-	pfam_APOBEC_N,pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like		0.552	APOBEC3H-002	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	APOBEC3H	HGNC	protein_coding	OTTHUMT00000321230.1	G	NM_181773		39497356	+1	no_errors	ENST00000442487	ensembl	human	known	70_37	missense	SNP	0.200	T
ARAF	369	genome.wustl.edu	37	X	47426651	47426651	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:47426651C>G	ENST00000377045.4	+	10	1090	c.896C>G	c.(895-897)tCa>tGa	p.S299*	ARAF_ENST00000290277.6_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	299					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	TACCGGGACTCAGGCTATTAC	0.612																																																	0													71.0	51.0	58.0					X																	47426651		2203	4299	6502	SO:0001587	stop_gained	369			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.896C>G	X.37:g.47426651C>G	ENSP00000366244:p.Ser299*	Somatic		WXS	Illumina HiSeq	Phase_IV	P07557|Q5H9B2|Q5H9B3	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.S299*	ENST00000377045.4	37	c.896	CCDS35232.1	X	.	.	.	.	.	.	.	.	.	.	C	39	7.489453	0.98316	.	.	ENSG00000078061	ENST00000377045	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.4784	0.84144	0.0:1.0:0.0:0.0	.	.	.	.	X	299	.	ENSP00000366244:S299X	S	+	2	0	ARAF	47311595	1.000000	0.71417	0.937000	0.37676	0.970000	0.65996	7.489000	0.81451	2.499000	0.84300	0.422000	0.28245	TCA	ARAF	-	superfamily_Kinase-like_dom		0.612	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ARAF	HGNC	protein_coding	OTTHUMT00000056418.1	C			47426651	+1	no_errors	ENST00000377045	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ARAP3	64411	genome.wustl.edu	37	5	141052872	141052872	+	Intron	SNP	C	C	A	rs537182603	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:141052872C>A	ENST00000239440.4	-	6	1038				ARAP3_ENST00000513878.1_5'Flank|ARAP3_ENST00000508305.1_Intron	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3						cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						ACTGCCCCGCCCACACACACA	0.517													c|||	6	0.00119808	0.0008	0.0	5008	,	,		17131	0.0		0.005	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.972+95G>T	5.37:g.141052872C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIT1|D3DQE3	RNA	SNP	-	NULL	ENST00000239440.4	37	NULL	CCDS4266.1	5																																																																																			ARAP3	-	-		0.517	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	C	NM_022481		141052872	-1	no_errors	ENST00000524066	ensembl	human	putative	70_37	rna	SNP	0.000	A
ARGFX	503582	genome.wustl.edu	37	3	121303884	121303884	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:121303884G>A	ENST00000334384.3	+	3	351	c.341G>A	c.(340-342)aGa>aAa	p.R114K		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		CTAGCTTTGAGACTCGACCTA	0.493																																																	0													99.0	99.0	99.0					3																	121303884		2203	4300	6503	SO:0001583	missense	503582				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.341G>A	3.37:g.121303884G>A	ENSP00000335578:p.Arg114Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R114K	ENST00000334384.3	37	c.341	CCDS33834.1	3	.	.	.	.	.	.	.	.	.	.	G	0.528	-0.859125	0.02610	.	.	ENSG00000186103	ENST00000334384	D	0.95622	-3.76	2.92	0.485	0.16830	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.705338	0.12267	N	0.484218	T	0.80560	0.4646	N	0.01649	-0.78	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.72616	-0.4239	10	0.02654	T	1	-3.9831	4.6514	0.12596	0.7049:0.0:0.2951:0.0	.	114	A6NJG6	ARGFX_HUMAN	K	114	ENSP00000335578:R114K	ENSP00000335578:R114K	R	+	2	0	ARGFX	122786574	0.839000	0.29477	0.025000	0.17156	0.328000	0.28507	1.544000	0.36158	0.109000	0.17891	-0.351000	0.07748	AGA	ARGFX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.493	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGFX	HGNC	protein_coding	OTTHUMT00000355096.2	G	NM_001012659		121303884	+1	no_errors	ENST00000334384	ensembl	human	known	70_37	missense	SNP	0.037	A
ARHGAP6	395	genome.wustl.edu	37	X	11162183	11162183	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:11162183C>G	ENST00000337414.4	-	11	2965	c.2093G>C	c.(2092-2094)aGa>aCa	p.R698T	ARHGAP6_ENST00000380736.1_Missense_Mutation_p.R495T|ARHGAP6_ENST00000413512.3_3'UTR|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.R495T|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.R523T|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.R698T	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	698					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CCCTGGCACTCTGTAAAGCTT	0.587											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													93.0	89.0	90.0					X																	11162183		2203	4300	6503	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2093G>C	X.37:g.11162183C>G	ENSP00000338967:p.Arg698Thr	Somatic	670	WXS	Illumina HiSeq	Phase_IV	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R698T	ENST00000337414.4	37	c.2093	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	T	11.05	1.525264	0.27299	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718	T;T;T;T;T;T	0.23348	1.99;2.05;2.05;2.06;1.91;1.95	5.51	3.11	0.35812	.	0.108806	0.40144	N	0.001170	T	0.13286	0.0322	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.29341	0.034;0.034;0.242;0.242	B;B;B;B	0.26416	0.022;0.022;0.069;0.069	T	0.15407	-1.0438	10	0.23302	T	0.38	.	9.4428	0.38679	0.0:0.2846:0.0:0.7154	.	495;698;698;698	O43182-5;O43182-2;O43182;A8KAL3	.;.;RHG06_HUMAN;.	T	523;495;495;698;534;698	ENSP00000438135:R523T;ENSP00000370112:R495T;ENSP00000302312:R495T;ENSP00000338967:R698T;ENSP00000370093:R534T;ENSP00000370094:R698T	ENSP00000302312:R495T	R	-	2	0	ARHGAP6	11072104	0.995000	0.38212	0.992000	0.48379	0.652000	0.38707	0.789000	0.26886	-0.018000	0.14079	-0.452000	0.05504	AGA	ARHGAP6	-	NULL		0.587	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	C	NM_013427		11162183	-1	no_errors	ENST00000337414	ensembl	human	known	70_37	missense	SNP	0.953	G
ARRDC2	27106	genome.wustl.edu	37	19	18121164	18121164	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:18121164G>C	ENST00000222250.4	+	6	1152	c.1009G>C	c.(1009-1011)Gag>Cag	p.E337Q	ARRDC2_ENST00000379656.3_Missense_Mutation_p.E332Q	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	337					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)		p.E337Q(1)|p.E332Q(1)		endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						GGAGCGGCCTGAGGGTAAGCT	0.647																																																	2	Substitution - Missense(2)	lung(2)											26.0	29.0	28.0					19																	18121164		2203	4297	6500	SO:0001583	missense	27106				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.1009G>C	19.37:g.18121164G>C	ENSP00000222250:p.Glu337Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.E337Q	ENST00000222250.4	37	c.1009	CCDS12370.1	19	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554132	0.86231	.	.	ENSG00000105643	ENST00000379656;ENST00000222250	T;T	0.06849	3.25;3.25	4.78	4.78	0.61160	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.06250	-1.0837	10	0.72032	D	0.01	-20.3615	17.1659	0.86816	0.0:0.0:1.0:0.0	.	337;332	Q8TBH0;Q8TBH0-2	ARRD2_HUMAN;.	Q	332;337	ENSP00000368977:E332Q;ENSP00000222250:E337Q	ENSP00000222250:E337Q	E	+	1	0	ARRDC2	17982164	1.000000	0.71417	0.982000	0.44146	0.614000	0.37383	9.620000	0.98373	2.397000	0.81536	0.491000	0.48974	GAG	ARRDC2	-	superfamily_Ig_E-set		0.647	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	G	NM_015683		18121164	+1	no_errors	ENST00000222250	ensembl	human	known	70_37	missense	SNP	1.000	C
ARRDC2	27106	genome.wustl.edu	37	19	18121476	18121476	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:18121476G>A	ENST00000222250.4	+	7	1251	c.1108G>A	c.(1108-1110)Gaa>Aaa	p.E370K	ARRDC2_ENST00000379656.3_Missense_Mutation_p.E365K	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	370					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						CATGAGCCTTGAAGGCCCGTT	0.632																																																	0													63.0	61.0	62.0					19																	18121476		2203	4300	6503	SO:0001583	missense	27106				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.1108G>A	19.37:g.18121476G>A	ENSP00000222250:p.Glu370Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBG9|O95895|Q6ZRV9|Q8WYG6	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.E370K	ENST00000222250.4	37	c.1108	CCDS12370.1	19	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593740	0.46214	.	.	ENSG00000105643	ENST00000379656;ENST00000222250	T;T	0.18657	2.2;2.2	4.25	4.25	0.50352	.	0.162693	0.53938	D	0.000059	T	0.36248	0.0960	M	0.61703	1.905	0.53005	D	0.999968	D;D	0.57571	0.966;0.98	P;P	0.54664	0.577;0.758	T	0.14671	-1.0464	10	0.42905	T	0.14	-23.2221	16.0249	0.80536	0.0:0.0:1.0:0.0	.	370;365	Q8TBH0;Q8TBH0-2	ARRD2_HUMAN;.	K	365;370	ENSP00000368977:E365K;ENSP00000222250:E370K	ENSP00000222250:E370K	E	+	1	0	ARRDC2	17982476	1.000000	0.71417	0.819000	0.32651	0.016000	0.09150	5.157000	0.64911	2.110000	0.64415	0.491000	0.48974	GAA	ARRDC2	-	NULL		0.632	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	G	NM_015683		18121476	+1	no_errors	ENST00000222250	ensembl	human	known	70_37	missense	SNP	0.995	A
ASB18	401036	genome.wustl.edu	37	2	237172927	237172927	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:237172927T>C	ENST00000409749.3	-	1	61	c.62A>G	c.(61-63)aAg>aGg	p.K21R	AC079135.1_ENST00000415226.1_RNA	NM_212556.2	NP_997721.2	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box containing 18	21					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					large_intestine(1)|lung(3)|ovary(1)|prostate(1)	6		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		CAGGGCAGACTTTAATCTCTT	0.478																																																	0													124.0	119.0	121.0					2																	237172927		1972	4176	6148	SO:0001583	missense	401036			AK123854	CCDS46548.1	2q37.2	2013-01-10	2011-01-25		ENSG00000182177	ENSG00000182177		"""Ankyrin repeat domain containing"""	19770	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 18"""			12076535	Standard	NM_212556		Approved		uc010znh.2	Q6ZVZ8	OTTHUMG00000153086	ENST00000409749.3:c.62A>G	2.37:g.237172927T>C	ENSP00000386532:p.Lys21Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B6ZDL7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.K21R	ENST00000409749.3	37	c.62	CCDS46548.1	2	.	.	.	.	.	.	.	.	.	.	T	19.45	3.829458	0.71258	.	.	ENSG00000182177	ENST00000409749;ENST00000430053	T;T	0.51071	0.72;0.74	5.14	3.99	0.46301	.	.	.	.	.	T	0.59609	0.2206	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59215	-0.7496	9	0.09338	T	0.73	.	9.8096	0.40815	0.0:0.0827:0.0:0.9173	.	21	Q6ZVZ8	ASB18_HUMAN	R	21	ENSP00000386532:K21R;ENSP00000410021:K21R	ENSP00000386532:K21R	K	-	2	0	ASB18	236837666	1.000000	0.71417	0.109000	0.21407	0.936000	0.57629	4.761000	0.62243	0.812000	0.34326	0.482000	0.46254	AAG	ASB18	-	NULL		0.478	ASB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB18	HGNC	protein_coding	OTTHUMT00000329436.1	T	NM_212556		237172927	-1	no_errors	ENST00000409749	ensembl	human	known	70_37	missense	SNP	0.882	C
ASPM	259266	genome.wustl.edu	37	1	197071695	197071695	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:197071695C>G	ENST00000367409.4	-	18	6942	c.6686G>C	c.(6685-6687)aGa>aCa	p.R2229T	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2229					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTGTATGTTTCTTTCTTTCAT	0.303																																																	0													97.0	98.0	98.0					1																	197071695		2203	4296	6499	SO:0001583	missense	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6686G>C	1.37:g.197071695C>G	ENSP00000356379:p.Arg2229Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.R2229T	ENST00000367409.4	37	c.6686	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	c	12.93	2.083981	0.36758	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.58940	0.3	5.17	5.17	0.71159	.	0.149903	0.45867	D	0.000329	T	0.74696	0.3750	M	0.78637	2.42	0.80722	D	1	B;D	0.69078	0.369;0.997	B;D	0.66196	0.101;0.942	T	0.70769	-0.4782	10	0.20046	T	0.44	.	19.0334	0.92967	0.0:1.0:0.0:0.0	.	215;2229	E7EQ84;Q8IZT6	.;ASPM_HUMAN	T	2229;215	ENSP00000356379:R2229T	ENSP00000356376:R215T	R	-	2	0	ASPM	195338318	0.009000	0.17119	0.543000	0.28128	0.133000	0.20885	1.691000	0.37721	2.576000	0.86940	0.639000	0.83563	AGA	ASPM	-	superfamily_ARM-type_fold		0.303	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	C	NM_018136		197071695	-1	no_errors	ENST00000367409	ensembl	human	known	70_37	missense	SNP	0.798	G
ATRX	546	genome.wustl.edu	37	X	76856127	76856127	+	Intron	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:76856127C>A	ENST00000373344.5	-	23	5781				ATRX_ENST00000480283.1_Intron|ATRX_ENST00000395603.3_Intron	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						gacataaacacttttggcagt	0.299			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001627	intron_variant	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5567-94G>T	X.37:g.76856127C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			ATRX	-	-		0.299	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	C	NM_000489		76856127	-1	no_errors	ENST00000479487	ensembl	human	known	70_37	rna	SNP	0.000	A
BACH1	571	genome.wustl.edu	37	21	30699443	30699443	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr21:30699443C>G	ENST00000399921.1	+	3	1541	c.1298C>G	c.(1297-1299)tCt>tGt	p.S433C	BACH1_ENST00000286800.3_Missense_Mutation_p.S433C	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						CAGAAACGGTCTGAGTGTCCG	0.473																																																	0													82.0	76.0	78.0					21																	30699443		2203	4300	6503	SO:0001583	missense	571			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.1298C>G	21.37:g.30699443C>G	ENSP00000382805:p.Ser433Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.S433C	ENST00000399921.1	37	c.1298	CCDS13585.1	21	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651709	0.67472	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.75050	-0.9;-0.9	5.79	3.89	0.44902	.	0.348206	0.28754	N	0.014244	T	0.71367	0.3331	L	0.34521	1.04	0.38841	D	0.956053	D	0.61697	0.99	P	0.54401	0.751	T	0.72795	-0.4185	10	0.72032	D	0.01	-8.2787	7.8632	0.29522	0.2842:0.6408:0.0:0.075	.	433	O14867	BACH1_HUMAN	C	433	ENSP00000286800:S433C;ENSP00000382805:S433C	ENSP00000286800:S433C	S	+	2	0	BACH1	29621314	0.962000	0.33011	0.989000	0.46669	0.996000	0.88848	3.022000	0.49659	0.709000	0.31976	0.655000	0.94253	TCT	BACH1	-	NULL		0.473	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	C	NM_206866		30699443	+1	no_errors	ENST00000286800	ensembl	human	known	70_37	missense	SNP	0.810	G
BCORL1	63035	genome.wustl.edu	37	X	129148261	129148261	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:129148261G>A	ENST00000218147.7	+	4	1710	c.1513G>A	c.(1513-1515)Gca>Aca	p.A505T	BCORL1_ENST00000359304.2_Missense_Mutation_p.A505T|BCORL1_ENST00000540052.1_Missense_Mutation_p.A505T|BCORL1_ENST00000303743.5_Missense_Mutation_p.A505T			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	505	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TTACCCGTATGCATTTTCTGT	0.607																																																	0													122.0	135.0	131.0					X																	129148261		2203	4300	6503	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1513G>A	X.37:g.129148261G>A	ENSP00000218147:p.Ala505Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A505T	ENST00000218147.7	37	c.1513	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	G	3.365	-0.129714	0.06753	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.40225	1.04;1.41;1.04;1.04;1.48	5.8	4.93	0.64822	.	0.000000	0.36519	N	0.002547	T	0.17195	0.0413	N	0.03608	-0.345	0.28167	N	0.928724	B;B	0.29136	0.234;0.15	B;B	0.28465	0.09;0.012	T	0.16335	-1.0406	10	0.13853	T	0.58	-8.378	7.5853	0.27989	0.2403:0.0:0.7597:0.0	.	505;505	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	T	505;505;505;505;105	ENSP00000218147:A505T;ENSP00000307541:A505T;ENSP00000352253:A505T;ENSP00000437775:A505T;ENSP00000399483:A105T	ENSP00000218147:A505T	A	+	1	0	BCORL1	128975942	0.734000	0.28142	0.981000	0.43875	0.692000	0.40212	1.218000	0.32467	2.453000	0.82957	0.529000	0.55759	GCA	BCORL1	-	NULL		0.607	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	G	NM_021946		129148261	+1	no_errors	ENST00000303743	ensembl	human	known	70_37	missense	SNP	0.976	A
BCORL1	63035	genome.wustl.edu	37	X	129148724	129148724	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:129148724C>A	ENST00000218147.7	+	4	2173	c.1976C>A	c.(1975-1977)tCc>tAc	p.S659Y	BCORL1_ENST00000359304.2_Missense_Mutation_p.S659Y|BCORL1_ENST00000540052.1_Missense_Mutation_p.S659Y|BCORL1_ENST00000303743.5_Missense_Mutation_p.S659Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	659					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCCCTCCTCTCCACAGTCCTG	0.617																																																	0													94.0	78.0	84.0					X																	129148724		2203	4300	6503	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1976C>A	X.37:g.129148724C>A	ENSP00000218147:p.Ser659Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S659Y	ENST00000218147.7	37	c.1976	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478004	0.44044	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.48201	0.84;1.2;0.82;0.84;1.27	5.38	5.38	0.77491	.	0.000000	0.36338	N	0.002658	T	0.53802	0.1819	N	0.14661	0.345	0.37416	D	0.913456	D;D	0.71674	0.998;0.996	D;P	0.70016	0.967;0.804	T	0.66035	-0.6023	10	0.87932	D	0	-16.6098	18.3045	0.90176	0.0:1.0:0.0:0.0	.	659;659	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	Y	659;659;659;659;259	ENSP00000218147:S659Y;ENSP00000307541:S659Y;ENSP00000352253:S659Y;ENSP00000437775:S659Y;ENSP00000399483:S259Y	ENSP00000218147:S659Y	S	+	2	0	BCORL1	128976405	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.548000	0.53670	2.262000	0.75019	0.436000	0.28706	TCC	BCORL1	-	NULL		0.617	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	C	NM_021946		129148724	+1	no_errors	ENST00000303743	ensembl	human	known	70_37	missense	SNP	1.000	A
BEST2	54831	genome.wustl.edu	37	19	12868679	12868679	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:12868679G>A	ENST00000549706.1	+	10	1642	c.1318G>A	c.(1318-1320)Gaa>Aaa	p.E440K	BEST2_ENST00000553030.1_Missense_Mutation_p.E440K|BEST2_ENST00000042931.1_Missense_Mutation_p.E440K			Q8NFU1	BEST2_HUMAN	bestrophin 2	440					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						GGTTGTCCCCGAAGGCGCGGC	0.741																																																	0													5.0	7.0	6.0					19																	12868679		1456	3259	4715	SO:0001583	missense	54831			AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.1318G>A	19.37:g.12868679G>A	ENSP00000448310:p.Glu440Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53YQ8|Q9NXP0	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.E440K	ENST00000549706.1	37	c.1318	CCDS42506.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.798321	0.96960	.	.	ENSG00000039987	ENST00000549706;ENST00000553030;ENST00000042931	D;D;D	0.97959	-4.63;-4.63;-4.63	5.14	5.14	0.70334	.	0.685592	0.13213	N	0.405019	D	0.91978	0.7459	N	0.08118	0	0.34974	D	0.753454	B	0.31519	0.327	B	0.22601	0.04	D	0.91300	0.5066	10	0.10377	T	0.69	-17.9894	15.5066	0.75745	0.0:0.0:1.0:0.0	.	440	Q8NFU1	BEST2_HUMAN	K	440	ENSP00000448310:E440K;ENSP00000447203:E440K;ENSP00000042931:E440K	ENSP00000042931:E440K	E	+	1	0	BEST2	12729679	0.990000	0.36364	0.215000	0.23724	0.837000	0.47467	3.985000	0.56930	2.399000	0.81585	0.491000	0.48974	GAA	BEST2	-	NULL		0.741	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	BEST2	HGNC	protein_coding	OTTHUMT00000403343.1	G	NM_017682		12868679	+1	no_errors	ENST00000042931	ensembl	human	known	70_37	missense	SNP	0.890	A
BRF1	2972	genome.wustl.edu	37	14	105685528	105685528	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:105685528C>T	ENST00000546474.1	-	13	16378	c.1419G>A	c.(1417-1419)ctG>ctA	p.L473L	BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000379937.2_Silent_p.L446L|BRF1_ENST00000392557.4_Silent_p.L269L|BRF1_ENST00000440513.3_Silent_p.L380L|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000547530.1_De_novo_Start_OutOfFrame|BRF1_ENST00000327359.3_Silent_p.L358L|BRF1_ENST00000379932.4_Intron|BRF1_ENST00000446501.2_Silent_p.L235L	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	473					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CCCTCATCCACAGCTCGGCCT	0.647																																																	0													121.0	108.0	112.0					14																	105685528		2203	4300	6503	SO:0001819	synonymous_variant	2972			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1419G>A	14.37:g.105685528C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	pfam_TFIIB_cyclin,pfam_BRF1_TBP-bd,pfam_Znf_TFIIB,superfamily_Cyclin-like,smart_Cyclin-like,pfscan_Znf_TFIIB,prints_TFIIB	p.L473	ENST00000546474.1	37	c.1419	CCDS10001.1	14																																																																																			BRF1	-	pfam_BRF1_TBP-bd		0.647	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	HGNC	protein_coding	OTTHUMT00000074548.4	C	NM_001519		105685528	-1	no_errors	ENST00000546474	ensembl	human	known	70_37	silent	SNP	1.000	T
C12orf57	113246	genome.wustl.edu	37	12	7052786	7052786	+	5'Flank	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:7052786G>A	ENST00000229281.5	+	0	0				U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000544681.1_5'Flank|RNU7-1_ENST00000458811.1_RNA|PTPN6_ENST00000399448.1_5'Flank|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000542222.1_3'UTR|C12orf57_ENST00000540506.2_5'Flank|C12orf57_ENST00000537087.1_5'Flank	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57							cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						TGCATGGGCTGAGAACAAATG	0.433																																																	0																																										SO:0001631	upstream_gene_variant	113246			U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017		12.37:g.7052786G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4Q6	RNA	SNP	-	NULL	ENST00000229281.5	37	NULL	CCDS8571.1	12																																																																																			C12orf57	-	-		0.433	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf57	HGNC	protein_coding	OTTHUMT00000401959.1	G	NM_138425		7052786	+1	no_errors	ENST00000542222	ensembl	human	putative	70_37	rna	SNP	0.000	A
C12orf10	60314	genome.wustl.edu	37	12	53694044	53694044	+	Missense_Mutation	SNP	G	G	C	rs113495940	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:53694044G>C	ENST00000267103.5	+	2	379	c.327G>C	c.(325-327)caG>caC	p.Q109H	RP11-680A11.5_ENST00000550263.1_RNA|C12orf10_ENST00000549488.1_5'UTR|C12orf10_ENST00000548632.1_Missense_Mutation_p.Q85H	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	109					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						ACCATCACCAGAGGTAGGTTC	0.542											OREG0021864	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													73.0	57.0	62.0					12																	53694044		2203	4300	6503	SO:0001583	missense	60314			AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.327G>C	12.37:g.53694044G>C	ENSP00000267103:p.Gln109His	Somatic	994	WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Met-dep_prot_hydro	p.Q109H	ENST00000267103.5	37	c.327	CCDS31810.1	12	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803703	0.70682	.	.	ENSG00000139637	ENST00000267103;ENST00000545214;ENST00000548632	T;T	0.55413	0.52;0.52	4.06	3.16	0.36331	.	0.000000	0.85682	D	0.000000	T	0.77075	0.4077	H	0.94734	3.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.995;0.996;0.99	T	0.80823	-0.1210	10	0.87932	D	0	-20.8503	9.7637	0.40548	0.1042:0.0:0.8958:0.0	.	109;109;109	B4DE37;F5H641;Q9HB07	.;.;MYG1_HUMAN	H	109;109;85	ENSP00000267103:Q109H;ENSP00000450270:Q85H	ENSP00000267103:Q109H	Q	+	3	2	C12orf10	51980311	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.002000	0.49496	1.079000	0.41038	0.561000	0.74099	CAG	C12orf10	-	pfam_Met-dep_prot_hydro		0.542	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C12orf10	HGNC	protein_coding	OTTHUMT00000406906.1	G	NM_021640		53694044	+1	no_errors	ENST00000267103	ensembl	human	novel	70_37	missense	SNP	1.000	C
BTBD11	121551	genome.wustl.edu	37	12	107914403	107914403	+	Silent	SNP	C	C	T	rs373812031		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:107914403C>T	ENST00000280758.5	+	2	1803	c.1275C>T	c.(1273-1275)atC>atT	p.I425I	BTBD11_ENST00000420571.2_Silent_p.I425I|BTBD11_ENST00000490090.2_Silent_p.I425I	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	425						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TAGGCAGCATCGCCGAATTGA	0.557																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	122.0	109.0	113.0		1275	-2.6	0.7	12		113	0,8600		0,0,4300	no	coding-synonymous	BTBD11	NM_001018072.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		425/1105	107914403	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	121551			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1275C>T	12.37:g.107914403C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.I425	ENST00000280758.5	37	c.1275	CCDS31893.1	12																																																																																			BTBD11	-	NULL		0.557	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	C	NM_152322		107914403	+1	no_errors	ENST00000280758	ensembl	human	known	70_37	silent	SNP	0.979	T
C14orf183	196913	genome.wustl.edu	37	14	50550713	50550713	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:50550713C>T	ENST00000305273.1	-	5	630	c.631G>A	c.(631-633)Gag>Aag	p.E211K	RP11-58E21.5_ENST00000603228.1_lincRNA|RP11-58E21.7_ENST00000556019.2_lincRNA|Y_RNA_ENST00000515983.1_RNA	NM_001014830.1	NP_001014830.1	Q8WXQ3	CN183_HUMAN	chromosome 14 open reading frame 183	211										endometrium(2)|large_intestine(2)|lung(3)	7						AGGAGTGACTCAGTCTGGTGC	0.642																																																	0													6.0	7.0	7.0					14																	50550713		1828	3995	5823	SO:0001583	missense	196913			AF390030	CCDS45101.1	14q21.3	2012-09-26			ENSG00000168260	ENSG00000168260			27285	protein-coding gene	gene with protein product							Standard	NM_001014830		Approved		uc010tqk.2	Q8WXQ3	OTTHUMG00000170858	ENST00000305273.1:c.631G>A	14.37:g.50550713C>T	ENSP00000303234:p.Glu211Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E211K	ENST00000305273.1	37	c.631	CCDS45101.1	14	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307064	0.23821	.	.	ENSG00000168260	ENST00000305273	.	.	.	3.61	-7.22	0.01485	.	.	.	.	.	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.26538	-1.0100	8	0.87932	D	0	.	2.56	0.04770	0.2295:0.1294:0.1049:0.5363	.	211	Q8WXQ3	CN183_HUMAN	K	211	.	ENSP00000303234:E211K	E	-	1	0	C14orf183	49620463	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.419000	0.02460	-2.499000	0.00511	0.455000	0.32223	GAG	C14orf183	-	NULL		0.642	C14orf183-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C14orf183	HGNC	protein_coding	OTTHUMT00000410705.1	C	NM_001014830		50550713	-1	no_errors	ENST00000305273	ensembl	human	novel	70_37	missense	SNP	0.000	T
C19orf73	55150	genome.wustl.edu	37	19	49621985	49621985	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:49621985G>A	ENST00000408991.2	-	1	412	c.295C>T	c.(295-297)Cag>Tag	p.Q99*	PPFIA3_ENST00000334186.4_5'Flank	NM_018111.2	NP_060581.2	Q9NVV2	CS073_HUMAN	chromosome 19 open reading frame 73	99										large_intestine(1)|lung(2)	3						AAGAGCGTCTGAGGGCGAAGG	0.652																																																	0													62.0	73.0	70.0					19																	49621985		2132	4229	6361	SO:0001587	stop_gained	55150			AK001352	CCDS42589.1	19q13.33	2013-06-17			ENSG00000221916	ENSG00000221916			25534	protein-coding gene	gene with protein product						12477932	Standard	NM_018111		Approved	FLJ10490	uc002pmq.4	Q9NVV2	OTTHUMG00000183345	ENST00000408991.2:c.295C>T	19.37:g.49621985G>A	ENSP00000386230:p.Gln99*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NSX4	Nonsense_Mutation	SNP	NULL	p.Q99*	ENST00000408991.2	37	c.295	CCDS42589.1	19	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573055	0.86542	.	.	ENSG00000221916	ENST00000408991	.	.	.	3.3	-0.419	0.12340	.	.	.	.	.	.	.	.	.	.	.	0.24335	N	0.994986	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.3285	0.21257	0.0:0.3906:0.4093:0.2001	.	.	.	.	X	99	.	ENSP00000386230:Q99X	Q	-	1	0	C19orf73	54313797	0.434000	0.25570	0.000000	0.03702	0.709000	0.40893	2.281000	0.43452	0.028000	0.15324	-0.310000	0.09108	CAG	C19orf73	-	NULL		0.652	C19orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf73	HGNC	protein_coding	OTTHUMT00000466275.1	G	NM_018111		49621985	-1	no_errors	ENST00000408991	ensembl	human	known	70_37	nonsense	SNP	0.002	A
C22orf23	84645	genome.wustl.edu	37	22	38343409	38343409	+	Missense_Mutation	SNP	C	C	A	rs536199238		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:38343409C>A	ENST00000249079.2	-	4	484	c.228G>T	c.(226-228)aaG>aaT	p.K76N	C22orf23_ENST00000403026.1_Missense_Mutation_p.K76N|C22orf23_ENST00000403305.1_Missense_Mutation_p.K76N			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	76										endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					AGGCTATTTGCTTGGAAGGTA	0.617																																																	0													133.0	115.0	121.0					22																	38343409		2203	4300	6503	SO:0001583	missense	84645			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.228G>T	22.37:g.38343409C>A	ENSP00000249079:p.Lys76Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYU9|Q96M68	Missense_Mutation	SNP	pfam_UPF0193	p.K76N	ENST00000249079.2	37	c.228	CCDS13962.1	22	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196042	0.38806	.	.	ENSG00000128346	ENST00000403305;ENST00000249079;ENST00000403026;ENST00000418863;ENST00000422191	T;T;T;T	0.52057	0.7;0.7;0.7;0.68	5.38	1.96	0.26148	.	0.532223	0.18430	N	0.141462	T	0.48447	0.1500	M	0.72894	2.215	0.09310	N	0.999998	P	0.51147	0.942	P	0.49999	0.628	T	0.37454	-0.9705	10	0.41790	T	0.15	-13.1409	3.1692	0.06546	0.1374:0.5655:0.1337:0.1635	.	76	Q9BZE7	EVG1_HUMAN	N	76	ENSP00000384667:K76N;ENSP00000249079:K76N;ENSP00000384618:K76N;ENSP00000395077:K76N	ENSP00000249079:K76N	K	-	3	2	C22orf23	36673355	0.173000	0.23056	0.687000	0.30102	0.301000	0.27625	-0.021000	0.12504	0.570000	0.29347	0.555000	0.69702	AAG	C22orf23	-	pfam_UPF0193		0.617	C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf23	HGNC	protein_coding	OTTHUMT00000319564.1	C	NM_032561		38343409	-1	no_errors	ENST00000249079	ensembl	human	known	70_37	missense	SNP	0.076	A
C6orf89	221477	genome.wustl.edu	37	6	36870110	36870110	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:36870110C>T	ENST00000480824.2	+	4	597	c.303C>T	c.(301-303)atC>atT	p.I101I	C6orf89_ENST00000355190.3_Silent_p.I108I|C6orf89_ENST00000359359.2_5'UTR|C6orf89_ENST00000373685.1_Silent_p.I101I|C6orf89_ENST00000510325.2_5'UTR			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	101					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						GCTCACTCATCCATCACATTA	0.493																																																	0													149.0	133.0	138.0					6																	36870110		2203	4300	6503	SO:0001819	synonymous_variant	221477			AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.303C>T	6.37:g.36870110C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	NULL	p.I108	ENST00000480824.2	37	c.324		6																																																																																			C6orf89	-	NULL		0.493	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	HGNC	protein_coding	OTTHUMT00000040387.2	C	NM_152734		36870110	+1	no_errors	ENST00000355190	ensembl	human	known	70_37	silent	SNP	0.992	T
CCDC180	100499483	genome.wustl.edu	37	9	100071801	100071801	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:100071801G>A	ENST00000357054.1	+	17	1659	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	CCDC180_ENST00000395220.1_Missense_Mutation_p.E242K|CCDC180_ENST00000411667.2_Missense_Mutation_p.E103K|CCDC180_ENST00000529487.1_Missense_Mutation_p.E103K|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000375202.2_Missense_Mutation_p.E103K			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	242						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GGAGACTCCTGAAGGGGAGGT	0.587																																																	0													90.0	76.0	81.0					9																	100071801		2203	4300	6503	SO:0001583	missense	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.724G>A	9.37:g.100071801G>A	ENSP00000349562:p.Glu242Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.E103K	ENST00000357054.1	37	c.307		9	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520367	0.27211	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.19394	2.98;2.15;2.99;2.62;2.99	4.71	1.65	0.23941	.	0.386006	0.19087	N	0.123067	T	0.27134	0.0665	M	0.65975	2.015	0.09310	N	1	D;P;D;P	0.54207	0.965;0.884;0.965;0.884	P;P;P;P	0.58077	0.832;0.482;0.832;0.482	T	0.17992	-1.0351	10	0.07482	T	0.82	-4.6043	4.0123	0.09627	0.215:0.1986:0.5864:0.0	.	103;242;103;242	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	K	242;242;103;103;126;103	ENSP00000349562:E242K;ENSP00000378646:E242K;ENSP00000364348:E103K;ENSP00000414000:E103K;ENSP00000434727:E103K	ENSP00000349562:E242K	E	+	1	0	C9orf174	99111622	0.049000	0.20398	0.401000	0.26359	0.065000	0.16274	0.405000	0.21015	1.128000	0.42052	-0.258000	0.10820	GAA	C9orf174	-	NULL		0.587	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		G	NM_020893		100071801	+1	no_errors	ENST00000375202	ensembl	human	known	70_37	missense	SNP	0.090	A
CACNA1B	774	genome.wustl.edu	37	9	140852116	140852116	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:140852116G>T	ENST00000371372.1	+	10	1455	c.1310G>T	c.(1309-1311)cGg>cTg	p.R437L	CACNA1B_ENST00000371355.4_Missense_Mutation_p.R438L|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R437L|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R438L|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Missense_Mutation_p.R437L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	437					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGAGAGGACCGGTTTGCAGAT	0.567																																																	0													82.0	104.0	97.0					9																	140852116		2146	4250	6396	SO:0001583	missense	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1310G>T	9.37:g.140852116G>T	ENSP00000360423:p.Arg437Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R438L	ENST00000371372.1	37	c.1313	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	g	13.09	2.133054	0.37630	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.96265	-3.95;-3.96;-3.95;-3.93;-3.93	4.93	3.08	0.35506	.	1.149610	0.06455	N	0.728365	D	0.90390	0.6992	L	0.27053	0.805	0.80722	D	1	P	0.34724	0.465	B	0.26416	0.069	D	0.84729	0.0744	10	0.28530	T	0.3	.	3.3286	0.07076	0.3073:0.2077:0.485:0.0	.	437	B1AQK6	.	L	437;437;437;438;438	ENSP00000360423:R437L;ENSP00000277551:R437L;ENSP00000360414:R437L;ENSP00000360408:R438L;ENSP00000360406:R438L	ENSP00000277551:R437L	R	+	2	0	CACNA1B	139971937	0.998000	0.40836	0.832000	0.32986	0.944000	0.59088	3.308000	0.51896	1.101000	0.41535	0.299000	0.19835	CGG	CACNA1B	-	NULL		0.567	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	G	NM_000718		140852116	+1	no_errors	ENST00000371355	ensembl	human	known	70_37	missense	SNP	0.580	T
CACNA1D	776	genome.wustl.edu	37	3	53707786	53707786	+	Intron	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:53707786G>C	ENST00000350061.5	+	8	1731				CACNA1D_ENST00000422281.2_Intron|CACNA1D_ENST00000288139.4_Missense_Mutation_p.S388T|CACNA1D_ENST00000498251.1_Intron	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TATTTTGTTAGTCTGATCATC	0.448																																																	0													381.0	285.0	317.0					3																	53707786		2203	4300	6503	SO:0001627	intron_variant	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.1220+633G>C	3.37:g.53707786G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.S388T	ENST00000350061.5	37	c.1163	CCDS46848.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.41|13.41	2.227781|2.227781	0.39399|0.39399	.|.	.|.	ENSG00000157388|ENSG00000157388	ENST00000288139|ENST00000481085	D|.	0.98567|.	-5.0|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.114744|.	0.56097|.	D|.	0.000023|.	T|T	0.49660|0.49660	0.1570|0.1570	N|N	0.12663|0.12663	0.25|0.25	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.43750|0.43750	-0.9372|-0.9372	10|5	0.13853|.	T|.	0.58|.	.|.	18.9117|18.9117	0.92489|0.92489	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	388|.	Q01668-2|.	.|.	T|L	388|74	ENSP00000288139:S388T|.	ENSP00000288139:S388T|.	S|V	+|+	2|1	0|0	CACNA1D|CACNA1D	53682826|53682826	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.709000|7.709000	0.84645|0.84645	2.696000|2.696000	0.92011|0.92011	0.650000|0.650000	0.86243|0.86243	AGT|GTC	CACNA1D	-	pfam_Ion_trans_dom		0.448	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	G	NM_000720		53707786	+1	no_errors	ENST00000288139	ensembl	human	known	70_37	missense	SNP	1.000	C
CACNA1D	776	genome.wustl.edu	37	3	53844063	53844063	+	Missense_Mutation	SNP	C	C	T	rs202077075		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:53844063C>T	ENST00000350061.5	+	47	6441	c.5930C>T	c.(5929-5931)tCg>tTg	p.S1977L	CACNA1D_ENST00000544977.1_3'UTR|CACNA1D_ENST00000422281.2_Missense_Mutation_p.S1953L|CACNA1D_ENST00000288139.4_Missense_Mutation_p.S1997L	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1977					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCGAGTCACTCGACCCGGTCG	0.602																																																	0								C	LEU/SER,LEU/SER,LEU/SER	2,4404	4.2+/-10.8	0,2,2201	60.0	63.0	62.0		5990,5858,5930	5.2	1.0	3		62	0,8600		0,0,4300	yes	missense,missense,missense	CACNA1D	NM_000720.2,NM_001128839.1,NM_001128840.1	145,145,145	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging,probably-damaging	1997/2182,1953/2138,1977/2162	53844063	2,13004	2203	4300	6503	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5930C>T	3.37:g.53844063C>T	ENSP00000288133:p.Ser1977Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.S1997L	ENST00000350061.5	37	c.5990	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125601	0.37533	4.54E-4	0.0	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.21	5.21	0.72293	.	0.193548	0.33553	N	0.004788	T	0.78515	0.4295	M	0.68593	2.085	0.80722	D	1	D;B;B;D	0.89917	1.0;0.063;0.027;1.0	D;B;B;D	0.87578	0.994;0.009;0.009;0.998	T	0.72743	-0.4201	10	0.11182	T	0.66	.	17.3269	0.87251	0.0:1.0:0.0:0.0	.	1953;1670;1977;1997	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	L	1977;1997;1953;1670	ENSP00000288133:S1977L;ENSP00000288139:S1997L;ENSP00000409174:S1953L;ENSP00000418014:S1670L	ENSP00000288139:S1997L	S	+	2	0	CACNA1D	53819103	1.000000	0.71417	0.969000	0.41365	0.952000	0.60782	7.757000	0.85209	2.608000	0.88229	0.460000	0.39030	TCG	CACNA1D	-	NULL		0.602	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	C	NM_000720		53844063	+1	no_errors	ENST00000288139	ensembl	human	known	70_37	missense	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27466321	27466321	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:27466321C>T	ENST00000403525.1	+	43	6568	c.6424C>T	c.(6424-6426)Cgc>Tgc	p.R2142C	CAD_ENST00000264705.4_Missense_Mutation_p.R2205C			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCTACTTCCGCCAGGCTGA	0.542																																																	0													39.0	38.0	38.0					2																	27466321		2203	4300	6503	SO:0001583	missense	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.6424C>T	2.37:g.27466321C>T	ENSP00000384510:p.Arg2142Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE_1,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.R2205C	ENST00000403525.1	37	c.6613		2	.	.	.	.	.	.	.	.	.	.	C	32	5.113229	0.94339	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.99098	-5.42;-5.42	5.13	5.13	0.70059	Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99539	0.9835	H	0.95850	3.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.991	D	0.98063	1.0394	10	0.87932	D	0	-2.294	17.3083	0.87201	0.0:1.0:0.0:0.0	.	2142;2205	F8VPD4;P27708	.;PYR1_HUMAN	C	2205;2142	ENSP00000264705:R2205C;ENSP00000384510:R2142C	ENSP00000264705:R2205C	R	+	1	0	CAD	27319825	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.885000	0.63142	2.659000	0.90383	0.561000	0.74099	CGC	CAD	-	pfam_Asp_carbamoyltransf_Asp/Orn-bd,superfamily_Asp/Orn_carbamoylTrfase,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_Asp_carbamoyltransf		0.542	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	C			27466321	+1	no_errors	ENST00000264705	ensembl	human	known	70_37	missense	SNP	1.000	T
CCDC114	93233	genome.wustl.edu	37	19	48801323	48801323	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:48801323A>G	ENST00000315396.7	-	12	2007	c.1325T>C	c.(1324-1326)cTa>cCa	p.L442P		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	442					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GCCCAGCACTAGGAGGGCAGC	0.692																																																	0													42.0	43.0	43.0					19																	48801323		2203	4300	6503	SO:0001583	missense	93233			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1325T>C	19.37:g.48801323A>G	ENSP00000318429:p.Leu442Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	NULL	p.L442P	ENST00000315396.7	37	c.1325	CCDS12714.2	19	.	.	.	.	.	.	.	.	.	.	A	13.91	2.376966	0.42105	.	.	ENSG00000105479	ENST00000315396	T	0.21734	1.99	3.39	3.39	0.38822	.	.	.	.	.	T	0.28699	0.0711	L	0.32530	0.975	0.26234	N	0.978966	D;D	0.69078	0.997;0.99	P;P	0.62184	0.899;0.836	T	0.04242	-1.0966	9	0.44086	T	0.13	-7.1742	8.4895	0.33091	1.0:0.0:0.0:0.0	.	442;442	Q96M63;Q96M63-5	CC114_HUMAN;.	P	442	ENSP00000318429:L442P	ENSP00000318429:L442P	L	-	2	0	CCDC114	53493135	0.003000	0.15002	0.028000	0.17463	0.007000	0.05969	1.147000	0.31602	1.774000	0.52232	0.533000	0.62120	CTA	CCDC114	-	NULL		0.692	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	HGNC	protein_coding	OTTHUMT00000343207.1	A	NM_144577		48801323	-1	no_errors	ENST00000315396	ensembl	human	known	70_37	missense	SNP	0.290	G
CCDC115	84317	genome.wustl.edu	37	2	131099622	131099622	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:131099622C>T	ENST00000259229.2	-	1	300	c.77G>A	c.(76-78)gGg>gAg	p.G26E	CCDC115_ENST00000437688.2_Intron|IMP4_ENST00000259239.3_5'Flank|CCDC115_ENST00000409127.1_Intron|IMP4_ENST00000409935.1_5'Flank	NM_032357.2	NP_115733.2	Q96NT0	CC115_HUMAN	coiled-coil domain containing 115	26						endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	7	Colorectal(110;0.1)					CGTTCGTTTCCCCTCCAGCTC	0.652																																																	0													79.0	82.0	81.0					2																	131099622		2203	4300	6503	SO:0001583	missense	84317			AK054693	CCDS2159.1	2q21.1	2010-12-24			ENSG00000136710	ENSG00000136710			28178	protein-coding gene	gene with protein product		613734				21118521	Standard	XM_005263825		Approved	MGC12981, FLJ30131, ccp1	uc002tqy.1	Q96NT0	OTTHUMG00000131631	ENST00000259229.2:c.77G>A	2.37:g.131099622C>T	ENSP00000259229:p.Gly26Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJ47|Q9BR88	Missense_Mutation	SNP	NULL	p.G26E	ENST00000259229.2	37	c.77	CCDS2159.1	2	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.481671	0.01027	.	.	ENSG00000136710	ENST00000259229	D	0.93659	-3.26	4.54	0.314	0.15847	.	0.664961	0.14690	N	0.304186	T	0.81489	0.4833	N	0.16790	0.44	0.47183	D	0.999347	B;B	0.32160	0.358;0.144	B;B	0.28139	0.086;0.083	T	0.73553	-0.3946	10	0.02654	T	1	.	7.7309	0.28786	0.0994:0.5254:0.3752:0.0	.	26;26	F8WCZ3;Q96NT0	.;CC115_HUMAN	E	26	ENSP00000259229:G26E	ENSP00000259229:G26E	G	-	2	0	CCDC115	130816092	0.406000	0.25344	0.809000	0.32408	0.021000	0.10359	0.466000	0.22019	0.239000	0.21243	-0.165000	0.13383	GGG	CCDC115	-	NULL		0.652	CCDC115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC115	HGNC	protein_coding	OTTHUMT00000254524.2	C	NM_032357		131099622	-1	no_errors	ENST00000442217	ensembl	human	known	70_37	missense	SNP	0.727	T
CCP110	9738	genome.wustl.edu	37	16	19548708	19548708	+	Missense_Mutation	SNP	A	A	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:19548708A>T	ENST00000381396.5	+	4	1964	c.1717A>T	c.(1717-1719)Aat>Tat	p.N573Y	CCP110_ENST00000396212.2_Missense_Mutation_p.N573Y|CCP110_ENST00000396208.2_Missense_Mutation_p.N573Y	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	573					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GTCCTGTGGAAATGAACAATT	0.353																																																	0													103.0	107.0	106.0					16																	19548708		2197	4300	6497	SO:0001583	missense	9738			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.1717A>T	16.37:g.19548708A>T	ENSP00000370803:p.Asn573Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	NULL	p.N573Y	ENST00000381396.5	37	c.1717	CCDS55992.1	16	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312160	0.40895	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.17370	2.28;2.29;2.28	5.54	3.24	0.37175	.	0.433730	0.25801	N	0.028204	T	0.28067	0.0692	L	0.50333	1.59	0.25420	N	0.988276	D;D	0.61697	0.99;0.99	P;P	0.62740	0.906;0.906	T	0.06899	-1.0801	10	0.87932	D	0	.	6.1418	0.20263	0.7198:0.1374:0.1428:0.0	.	573;573	O43303;O43303-2	CP110_HUMAN;.	Y	573	ENSP00000379515:N573Y;ENSP00000370803:N573Y;ENSP00000379511:N573Y	ENSP00000370803:N573Y	N	+	1	0	CCP110	19456209	0.905000	0.30787	0.071000	0.20095	0.836000	0.47400	2.864000	0.48404	0.358000	0.24211	0.460000	0.39030	AAT	CCP110	-	NULL		0.353	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	A	NM_014711		19548708	+1	no_errors	ENST00000381396	ensembl	human	known	70_37	missense	SNP	0.566	T
CELF5	60680	genome.wustl.edu	37	19	3282169	3282169	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:3282169C>G	ENST00000292672.2	+	7	833	c.796C>G	c.(796-798)Ctg>Gtg	p.L266V	CELF5_ENST00000541430.2_Missense_Mutation_p.L266V	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	266					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						GGGCAGCTACCTGAGTCCCGG	0.602																																																	0													148.0	126.0	133.0					19																	3282169		2203	4300	6503	SO:0001583	missense	60680			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.796C>G	19.37:g.3282169C>G	ENSP00000292672:p.Leu266Val	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L266V	ENST00000292672.2	37	c.796	CCDS12106.1	19	.	.	.	.	.	.	.	.	.	.	C	14.31	2.495793	0.44352	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.30448	2.22;1.63;1.53	4.59	3.54	0.40534	.	0.421858	0.23309	N	0.049598	T	0.38825	0.1055	M	0.72894	2.215	0.43334	D	0.995372	P;P;B	0.48503	0.693;0.911;0.209	B;P;B	0.50617	0.275;0.646;0.056	T	0.13683	-1.0500	10	0.32370	T	0.25	-21.6513	7.5558	0.27822	0.0:0.7404:0.1691:0.0905	.	152;266;266	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	V	266;266;152	ENSP00000292672:L266V;ENSP00000443498:L266V;ENSP00000335182:L152V	ENSP00000292672:L266V	L	+	1	2	CELF5	3233169	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.176000	0.42500	1.042000	0.40150	0.555000	0.69702	CTG	CELF5	-	NULL		0.602	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELF5	HGNC	protein_coding	OTTHUMT00000452574.1	C	NM_021938		3282169	+1	no_errors	ENST00000292672	ensembl	human	known	70_37	missense	SNP	1.000	G
CELSR1	9620	genome.wustl.edu	37	22	46780440	46780440	+	Splice_Site	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:46780440C>G	ENST00000262738.3	-	20	6882	c.6883G>C	c.(6883-6885)Gaa>Caa	p.E2295Q		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2295					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCGGTTTTACCTTTTTCTTCA	0.612																																																	0													36.0	38.0	37.0					22																	46780440		2203	4300	6503	SO:0001630	splice_region_variant	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6883+1G>C	22.37:g.46780440C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2295Q	ENST00000262738.3	37	c.6883	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	C	9.935	1.215999	0.22373	.	.	ENSG00000075275	ENST00000262738	T	0.67865	-0.29	5.15	5.15	0.70609	Domain of unknown function DUF3497 (1);	0.341025	0.23969	U	0.042781	T	0.68476	0.3005	L	0.44542	1.39	0.80722	D	1	P;B	0.44627	0.839;0.034	P;B	0.48738	0.588;0.038	T	0.66316	-0.5954	9	.	.	.	.	18.2421	0.89970	0.0:1.0:0.0:0.0	.	616;2295	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	Q	2295	ENSP00000262738:E2295Q	.	E	-	1	0	CELSR1	45159104	1.000000	0.71417	0.765000	0.31456	0.094000	0.18550	3.712000	0.54875	2.409000	0.81822	0.655000	0.94253	GAA	CELSR1	-	pfam_DUF3497		0.612	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	C	NM_014246	Missense_Mutation	46780440	-1	no_errors	ENST00000262738	ensembl	human	known	70_37	missense	SNP	1.000	G
CELSR1	9620	genome.wustl.edu	37	22	46787540	46787540	+	Silent	SNP	G	G	A	rs370545626		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:46787540G>A	ENST00000262738.3	-	15	6137	c.6138C>T	c.(6136-6138)ctC>ctT	p.L2046L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2046	Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CTTCACAGCCGAGCGTGGTGA	0.672																																																	0								A		0,4406		0,0,2203	31.0	29.0	30.0		6138	-8.9	0.0	22		30	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	CELSR1	NM_014246.1		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		2046/3015	46787540	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6138C>T	22.37:g.46787540G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.L2046	ENST00000262738.3	37	c.6138	CCDS14076.1	22																																																																																			CELSR1	-	smart_EGF_laminin,pfscan_EGF_laminin,pfscan_GPCR_2_extracellular_dom		0.672	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	G	NM_014246		46787540	-1	no_errors	ENST00000262738	ensembl	human	known	70_37	silent	SNP	0.000	A
CEPT1	10390	genome.wustl.edu	37	1	111703575	111703576	+	Intron	INS	-	-	A	rs71096395|rs397808502|rs571497696	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:111703575_111703576insA	ENST00000545121.1	+	4	695				CEPT1_ENST00000357172.4_Intron	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	AGTGATTTGGTAAAAAAAAAAA	0.297																																																	0																																										SO:0001627	intron_variant	10390			AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.488-201->A	1.37:g.111703586_111703586dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q69YJ9|Q9P0Y8	RNA	INS	-	NULL	ENST00000545121.1	37	NULL	CCDS830.1	1																																																																																			CEPT1	-	-		0.297	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEPT1	HGNC	protein_coding	OTTHUMT00000034462.2	-	NM_006090		111703576	+1	no_errors	ENST00000480324	ensembl	human	known	70_37	rna	INS	0.073:0.207	A
CHRDL2	25884	genome.wustl.edu	37	11	74413902	74413902	+	Missense_Mutation	SNP	G	G	A	rs141944340		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:74413902G>A	ENST00000376332.3	-	9	1553	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	CHRDL2_ENST00000534159.1_5'UTR|CHRDL2_ENST00000263671.5_Missense_Mutation_p.R353C	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	353					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.R353C(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					AGGGCAAAGCGACGCAGGTTG	0.607											OREG0021223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	endometrium(1)						G	CYS/ARG	0,4400		0,0,2200	131.0	124.0	126.0		1057	5.1	1.0	11	dbSNP_134	126	1,8585	1.2+/-3.3	0,1,4292	no	missense	CHRDL2	NM_015424.3	180	0,1,6492	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	353/452	74413902	1,12985	2200	4293	6493	SO:0001583	missense	25884			AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.1057C>T	11.37:g.74413902G>A	ENSP00000365510:p.Arg353Cys	Somatic	1152	WXS	Illumina HiSeq	Phase_IV	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Missense_Mutation	SNP	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.R353C	ENST00000376332.3	37	c.1057		11	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853701	0.71719	0.0	1.16E-4	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000376323;ENST00000393519;ENST00000528789	T;T;T	0.66638	-0.22;-0.22;-0.22	5.09	5.09	0.68999	.	0.425981	0.24991	N	0.033984	T	0.76442	0.3988	L	0.50333	1.59	0.44136	D	0.996923	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.69307	0.963;0.818;0.931	T	0.78349	-0.2238	10	0.87932	D	0	-35.9185	14.339	0.66611	0.0:0.0:1.0:0.0	.	288;353;353	E9PCG7;Q6WN34;Q6WN34-2	.;CRDL2_HUMAN;.	C	353;353;239;237;288	ENSP00000263671:R353C;ENSP00000365510:R353C;ENSP00000431380:R288C	ENSP00000263671:R353C	R	-	1	0	CHRDL2	74091550	0.998000	0.40836	0.979000	0.43373	0.663000	0.39108	3.948000	0.56660	2.517000	0.84864	0.561000	0.74099	CGC	CHRDL2	-	NULL		0.607	CHRDL2-002	KNOWN	basic	protein_coding	CHRDL2	HGNC	protein_coding	OTTHUMT00000385391.1	G			74413902	-1	no_errors	ENST00000263671	ensembl	human	known	70_37	missense	SNP	0.978	A
CLK3	1198	genome.wustl.edu	37	15	74912445	74912445	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr15:74912445A>G	ENST00000395066.3	+	3	1153	c.692A>G	c.(691-693)tAc>tGc	p.Y231C	CLK3_ENST00000345005.4_Missense_Mutation_p.Y83C|CLK3_ENST00000352989.5_Missense_Mutation_p.Y83C|CLK3_ENST00000348245.3_Missense_Mutation_p.Y83C	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	231	Arg-rich.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						GGAGAGGACTACTATGGACCT	0.637																																					Ovarian(133;694 1754 28950 29027 31859)												0													208.0	193.0	198.0					15																	74912445		2197	4296	6493	SO:0001583	missense	1198			L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.692A>G	15.37:g.74912445A>G	ENSP00000378505:p.Tyr231Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y231C	ENST00000395066.3	37	c.692	CCDS45304.1	15	.	.	.	.	.	.	.	.	.	.	A	13.83	2.353564	0.41700	.	.	ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830;ENST00000352989;ENST00000348245	T;T	0.52526	0.66;0.72	5.95	0.828	0.18841	.	0.531595	0.19941	N	0.102648	T	0.37489	0.1005	L	0.52011	1.625	0.35444	D	0.795117	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.34428	-0.9829	10	0.45353	T	0.12	.	8.1034	0.30870	0.6955:0.0:0.3045:0.0	.	231;231;83	P49761;B3KRI8;G5E959	CLK3_HUMAN;.;.	C	83;83;231;83;83	ENSP00000344112:Y83C;ENSP00000323106:Y83C	ENSP00000344112:Y83C	Y	+	2	0	CLK3	72699498	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.045000	0.41250	0.243000	0.21327	-0.408000	0.06270	TAC	CLK3	-	NULL		0.637	CLK3-003	KNOWN	basic|CCDS	protein_coding	CLK3	HGNC	protein_coding	OTTHUMT00000390442.3	A			74912445	+1	no_errors	ENST00000395066	ensembl	human	known	70_37	missense	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	4277554	4277554	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:4277554C>T	ENST00000520002.1	-	3	891	c.336G>A	c.(334-336)gtG>gtA	p.V112V	CSMD1_ENST00000539096.1_Silent_p.V112V|CSMD1_ENST00000542608.1_Silent_p.V112V|CSMD1_ENST00000602723.1_Silent_p.V112V|CSMD1_ENST00000602557.1_Silent_p.V112V|CSMD1_ENST00000400186.3_Silent_p.V112V|CSMD1_ENST00000537824.1_Silent_p.V112V			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	112	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATCCTGTACTCACTATAGAGG	0.383																																																	0													64.0	61.0	62.0					8																	4277554		1877	4106	5983	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.336G>A	8.37:g.4277554C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.V112	ENST00000520002.1	37	c.336		8																																																																																			CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.383	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	C	NM_033225		4277554	-1	no_errors	ENST00000520002	ensembl	human	known	70_37	silent	SNP	0.997	T
CSNK1G3	1456	genome.wustl.edu	37	5	122927040	122927040	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:122927040G>A	ENST00000361991.2	+	9	1048	c.1018G>A	c.(1018-1020)Gat>Aat	p.D340N	CSNK1G3_ENST00000395411.1_Missense_Mutation_p.D340N|CSNK1G3_ENST00000360683.2_Missense_Mutation_p.D340N|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.D340N|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.D340N|CSNK1G3_ENST00000521364.1_Missense_Mutation_p.D340N|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.D341N|CSNK1G3_ENST00000512718.3_Missense_Mutation_p.D265N|CSNK1G3_ENST00000511130.2_Missense_Mutation_p.D228N			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	340					cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		AGTTCAGCAAGATCCTGCTCT	0.363																																					Pancreas(187;2868 2964 4353 6297)												0													95.0	83.0	87.0					5																	122927040		2203	4300	6503	SO:0001583	missense	1456			AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.1018G>A	5.37:g.122927040G>A	ENSP00000354942:p.Asp340Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Casein_kinase-1_gamma_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D340N	ENST00000361991.2	37	c.1018	CCDS4135.1	5	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908736	0.52439	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000511130;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	T;T;T;T;T;T;T;T;T	0.51817	0.7;0.69;0.75;1.24;1.1;0.75;0.72;0.69;0.7	4.24	4.24	0.50183	Casein kinase 1 gamma C-terminal (1);	0.397752	0.22978	N	0.053348	T	0.49047	0.1534	L	0.34521	1.04	0.43457	D	0.995655	B;B;B;B;B;P	0.36789	0.001;0.001;0.14;0.226;0.005;0.57	B;B;B;B;B;P	0.47299	0.021;0.02;0.297;0.255;0.033;0.543	T	0.42015	-0.9476	10	0.32370	T	0.25	.	17.5407	0.87846	0.0:0.0:1.0:0.0	.	265;341;228;340;340;340	B4DSH2;A8K040;E7EVD0;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.;.;.;.;KC1G3_HUMAN;.	N	340;340;340;228;265;340;341;340;340	ENSP00000378807:D340N;ENSP00000378806:D340N;ENSP00000334735:D340N;ENSP00000421385:D228N;ENSP00000421998:D265N;ENSP00000429412:D340N;ENSP00000423838:D341N;ENSP00000354942:D340N;ENSP00000353904:D340N	ENSP00000334735:D340N	D	+	1	0	CSNK1G3	122954939	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.575000	0.53870	2.637000	0.89404	0.650000	0.86243	GAT	CSNK1G3	-	pfam_Casein_kinase-1_gamma_C		0.363	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSNK1G3	HGNC	protein_coding	OTTHUMT00000250900.1	G	NM_004384		122927040	+1	no_errors	ENST00000360683	ensembl	human	known	70_37	missense	SNP	1.000	A
CST9L	128821	genome.wustl.edu	37	20	23545643	23545643	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:23545643C>G	ENST00000376979.3	-	3	684	c.386G>C	c.(385-387)aGg>aCg	p.R129T		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	129						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					CATCCAGGGCCTGGTGCTGAT	0.547																																																	0													156.0	137.0	143.0					20																	23545643		2203	4300	6503	SO:0001583	missense	128821				CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.386G>C	20.37:g.23545643C>G	ENSP00000366178:p.Arg129Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5A1	Missense_Mutation	SNP	pfam_Prot_inh_cystat	p.R129T	ENST00000376979.3	37	c.386	CCDS13157.1	20	.	.	.	.	.	.	.	.	.	.	C	1.577	-0.532507	0.04112	.	.	ENSG00000101435	ENST00000376979	T	0.26660	1.72	1.09	-2.19	0.07015	Proteinase inhibitor I25, cystatin (2);	2.217160	0.02388	N	0.079438	T	0.19685	0.0473	L	0.49778	1.585	0.09310	N	1	B	0.31769	0.339	B	0.33042	0.157	T	0.07558	-1.0766	10	0.14656	T	0.56	.	0.0796	0.00030	0.248:0.225:0.249:0.278	.	129	Q9H4G1	CST9L_HUMAN	T	129	ENSP00000366178:R129T	ENSP00000366178:R129T	R	-	2	0	CST9L	23493643	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.535000	0.06142	-1.552000	0.01704	-0.680000	0.03767	AGG	CST9L	-	pfam_Prot_inh_cystat		0.547	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST9L	HGNC	protein_coding	OTTHUMT00000078338.1	C	NM_080610		23545643	-1	no_errors	ENST00000376979	ensembl	human	known	70_37	missense	SNP	0.001	G
CST1	1469	genome.wustl.edu	37	20	23729716	23729716	+	Silent	SNP	T	T	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:23729716T>A	ENST00000304749.2	-	2	349	c.279A>T	c.(277-279)atA>atT	p.I93I	CST1_ENST00000398402.1_Silent_p.I93I	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	93					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					ACTTGGTACATATGGTGCGGC	0.567																																																	0													203.0	165.0	178.0					20																	23729716		2203	4298	6501	SO:0001819	synonymous_variant	1469			M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.279A>T	20.37:g.23729716T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LE6|Q9UCQ6	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.I93	ENST00000304749.2	37	c.279	CCDS13160.1	20																																																																																			CST1	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat		0.567	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST1	HGNC	protein_coding	OTTHUMT00000078351.2	T	NM_001898		23729716	-1	no_errors	ENST00000304749	ensembl	human	known	70_37	silent	SNP	0.844	A
CTCF	10664	genome.wustl.edu	37	16	67660614	67660614	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:67660614G>C	ENST00000264010.4	+	8	1958	c.1514G>C	c.(1513-1515)aGa>aCa	p.R505T	CTCF_ENST00000401394.1_Missense_Mutation_p.R177T	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	505					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TACGCTTGTAGACAGGTAGGA	0.433																																					Colon(175;1200 1966 6945 23069 27405)												0													112.0	97.0	102.0					16																	67660614		2198	4300	6498	SO:0001583	missense	10664			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1514G>C	16.37:g.67660614G>C	ENSP00000264010:p.Arg505Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R505T	ENST00000264010.4	37	c.1514	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774120	0.69992	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.59906	0.23;0.23	5.38	5.38	0.77491	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.48874	0.1524	N	0.04373	-0.215	0.80722	D	1	P	0.51791	0.948	P	0.51918	0.684	T	0.55198	-0.8178	10	0.34782	T	0.22	-3.7163	19.4985	0.95083	0.0:0.0:1.0:0.0	.	505	P49711	CTCF_HUMAN	T	505;177	ENSP00000264010:R505T;ENSP00000384707:R177T	ENSP00000264010:R505T	R	+	2	0	CTCF	66218115	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.009000	0.88606	2.698000	0.92095	0.561000	0.74099	AGA	CTCF	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	G	NM_006565		67660614	+1	no_errors	ENST00000264010	ensembl	human	known	70_37	missense	SNP	1.000	C
CYP4Z2P	163720	genome.wustl.edu	37	1	47348924	47348924	+	RNA	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:47348924G>A	ENST00000505841.1	-	0	539					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										CATGTTGAAAGAGCTCCAGAC	0.493																																																	0																																												163720			AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47348924G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q66ZJ5	RNA	SNP	-	NULL	ENST00000505841.1	37	NULL		1																																																																																			CYP4Z2P	-	-		0.493	CYP4Z2P-002	KNOWN	basic	processed_transcript	CYP4Z2P	HGNC	pseudogene	OTTHUMT00000361094.1	G	NR_002788		47348924	-1	no_errors	ENST00000505841	ensembl	human	known	70_37	rna	SNP	0.953	A
DAB1	1600	genome.wustl.edu	37	1	57481088	57481088	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:57481088G>A	ENST00000371231.1	-	13	1045	c.1011C>T	c.(1009-1011)ggC>ggT	p.G337G	DAB1_ENST00000414851.2_Silent_p.G286G|DAB1_ENST00000420954.2_Silent_p.G302G|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Silent_p.G304G|DAB1_ENST00000371236.2_Silent_p.G304G|DAB1_ENST00000439789.2_Silent_p.G218G			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	337					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.G304G(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGAGGACAGCGCCCATTGCAA	0.572																																																	1	Substitution - coding silent(1)	ovary(1)											24.0	26.0	25.0					1																	57481088		2199	4289	6488	SO:0001819	synonymous_variant	1600			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1011C>T	1.37:g.57481088G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.G337	ENST00000371231.1	37	c.1011		1																																																																																			DAB1	-	NULL		0.572	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	G	NM_021080		57481088	-1	no_errors	ENST00000371231	ensembl	human	known	70_37	silent	SNP	1.000	A
DBN1	1627	genome.wustl.edu	37	5	176886203	176886203	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:176886203G>A	ENST00000309007.5	-	11	1241	c.1022C>T	c.(1021-1023)tCc>tTc	p.S341F	DBN1_ENST00000393565.1_Missense_Mutation_p.S387F|DBN1_ENST00000292385.5_Missense_Mutation_p.S343F|DBN1_ENST00000512501.1_Missense_Mutation_p.S73F|DBN1_ENST00000393563.4_Missense_Mutation_p.S73F	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	341					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCGGTGCTGGAGTCAGACGG	0.692																																																	0													81.0	82.0	81.0					5																	176886203		2203	4300	6503	SO:0001583	missense	1627				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1022C>T	5.37:g.176886203G>A	ENSP00000308532:p.Ser341Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.S343F	ENST00000309007.5	37	c.1028	CCDS4420.1	5	.	.	.	.	.	.	.	.	.	.	G	15.09	2.728784	0.48833	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563	T;T;T;T;T	0.46451	1.24;1.27;1.26;0.87;1.0	4.58	4.58	0.56647	.	0.833984	0.10586	N	0.657281	T	0.53610	0.1807	L	0.27053	0.805	0.41206	D	0.986403	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	D;D;D;D	0.79784	0.961;0.993;0.915;0.961	T	0.53975	-0.8362	10	0.87932	D	0	-15.1764	14.6573	0.68844	0.0:0.0:1.0:0.0	.	291;387;341;343	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	F	341;343;387;73;73	ENSP00000308532:S341F;ENSP00000292385:S343F;ENSP00000377195:S387F;ENSP00000423208:S73F;ENSP00000377193:S73F	ENSP00000292385:S343F	S	-	2	0	DBN1	176818809	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	2.181000	0.42547	2.260000	0.74910	0.462000	0.41574	TCC	DBN1	-	NULL		0.692	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	G	NM_080881		176886203	-1	no_errors	ENST00000292385	ensembl	human	known	70_37	missense	SNP	1.000	A
DCAF8L2	347442	genome.wustl.edu	37	X	27765682	27765682	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:27765682C>T	ENST00000451261.2	+	5	1069	c.670C>T	c.(670-672)Ctt>Ttt	p.L224F		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	224										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GCAATATCGTCTTGCAGACCA	0.557																																																	0													62.0	51.0	54.0					X																	27765682		692	1591	2283	SO:0001583	missense	347442				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.670C>T	X.37:g.27765682C>T	ENSP00000462745:p.Leu224Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RXH9|J3KT06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L224F	ENST00000451261.2	37	c.670	CCDS59162.1	X																																																																																			DCAF8L2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.557	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	C	XM_293354		27765682	+1	no_errors	ENST00000451261	ensembl	human	known	70_37	missense	SNP	0.904	T
DCST1	149095	genome.wustl.edu	37	1	155014220	155014220	+	Missense_Mutation	SNP	G	G	T	rs373581735		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:155014220G>T	ENST00000295542.1	+	8	875	c.779G>T	c.(778-780)cGt>cTt	p.R260L	DCST1_ENST00000423025.2_Missense_Mutation_p.R235L|DCST1_ENST00000368419.2_Missense_Mutation_p.R260L|DCST1_ENST00000392480.1_Missense_Mutation_p.R260L	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	260						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CTCAGCTGCCGTCGTTGGTTT	0.547																																																	0													167.0	130.0	143.0					1																	155014220		2203	4300	6503	SO:0001583	missense	149095			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.779G>T	1.37:g.155014220G>T	ENSP00000295542:p.Arg260Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.R260L	ENST00000295542.1	37	c.779	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227333	0.39399	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	4.73	-0.169	0.13339	.	1.087950	0.07251	N	0.865872	T	0.19846	0.0477	L	0.47716	1.5	0.09310	N	0.999995	B;P;B	0.36944	0.304;0.574;0.304	B;B;B	0.29353	0.048;0.101;0.048	T	0.11542	-1.0583	10	0.10377	T	0.69	-1.1913	8.2315	0.31601	0.5628:0.0:0.4372:0.0	.	235;285;260	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	L	260;260;235;260	ENSP00000295542:R260L;ENSP00000376271:R260L;ENSP00000387369:R235L;ENSP00000357404:R260L	ENSP00000295542:R260L	R	+	2	0	DCST1	153280844	0.000000	0.05858	0.390000	0.26220	0.990000	0.78478	-1.024000	0.03603	-0.062000	0.13088	0.563000	0.77884	CGT	DCST1	-	NULL		0.547	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	G	NM_152494		155014220	+1	no_errors	ENST00000295542	ensembl	human	known	70_37	missense	SNP	0.065	T
DESI1	27351	genome.wustl.edu	37	22	42016793	42016793	+	Silent	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:42016793G>C	ENST00000263256.6	-	1	307	c.51C>G	c.(49-51)tcC>tcG	p.S17S	XRCC6_ENST00000402580.3_5'Flank|XRCC6_ENST00000405506.1_5'Flank|XRCC6_ENST00000428575.2_5'Flank|XRCC6_ENST00000405878.1_5'Flank|XRCC6_ENST00000359308.4_5'Flank|XRCC6_ENST00000360079.3_5'Flank	NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	17	PPPDE peptidase.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)										CCAGGCCTTTGGACAGGTCGT	0.721																																																	0													29.0	28.0	28.0					22																	42016793		2202	4300	6502	SO:0001819	synonymous_variant	27351			AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.51C>G	22.37:g.42016793G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DUF862_euk	p.S17	ENST00000263256.6	37	c.51	CCDS33652.1	22																																																																																			DESI1	-	pfam_DUF862_euk		0.721	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	DESI1	HGNC	protein_coding	OTTHUMT00000104124.3	G	NM_015704		42016793	-1	no_errors	ENST00000263256	ensembl	human	novel	70_37	silent	SNP	1.000	C
DHX8	1659	genome.wustl.edu	37	17	41582013	41582013	+	Splice_Site	SNP	G	G	A	rs145241921	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:41582013G>A	ENST00000262415.3	+	12	1620	c.1548G>A	c.(1546-1548)gcG>gcA	p.A516A	DHX8_ENST00000540306.1_Splice_Site_p.A516A	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	516					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CCTTTCCAGCGGAAGGCAGAC	0.478																																					NSCLC(56;1548 1661 49258 49987)												0								G		0,4406		0,0,2203	205.0	208.0	207.0		1548	3.8	1.0	17	dbSNP_134	207	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous-near-splice	DHX8	NM_004941.1		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		516/1221	41582013	4,13002	2203	4300	6503	SO:0001630	splice_region_variant	1659			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1547-1G>A	17.37:g.41582013G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A516	ENST00000262415.3	37	c.1548	CCDS11464.1	17																																																																																			DHX8	-	NULL		0.478	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	G		Silent	41582013	+1	no_errors	ENST00000262415	ensembl	human	known	70_37	silent	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32383310	32383310	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:32383310G>A	ENST00000357033.4	-	35	5058	c.4852C>T	c.(4852-4854)Caa>Taa	p.Q1618*	DMD_ENST00000378677.2_Nonsense_Mutation_p.Q1614*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1618	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATCTCTTTTTGAGTAGCCTGT	0.408																																																	0			GRCh37	CM022951	DMD	M							105.0	85.0	92.0					X																	32383310		2202	4300	6502	SO:0001587	stop_gained	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4852C>T	X.37:g.32383310G>A	ENSP00000354923:p.Gln1618*	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1618*	ENST00000357033.4	37	c.4852	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	46	12.294022	0.99654	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000420596	.	.	.	5.78	5.78	0.91487	.	0.242590	0.20851	U	0.084533	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	18.9267	0.92548	0.0:0.0:1.0:0.0	.	.	.	.	X	1610;277;274;1614;1618;1618;1495;34	.	ENSP00000354923:Q1618X	Q	-	1	0	DMD	32293231	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.717000	0.84732	2.417000	0.82017	0.600000	0.82982	CAA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	G	NM_004006		32383310	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	nonsense	SNP	0.981	A
DNAH1	25981	genome.wustl.edu	37	3	52433158	52433158	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:52433158C>G	ENST00000420323.2	+	76	12643	c.12382C>G	c.(12382-12384)Ctg>Gtg	p.L4128V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	4193					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AACAGGCACTCTGCAGAATTT	0.532																																																	0													322.0	323.0	323.0					3																	52433158		1921	4122	6043	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.12382C>G	3.37:g.52433158C>G	ENSP00000401514:p.Leu4128Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.L4128V	ENST00000420323.2	37	c.12382	CCDS46842.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797965|2.797965	0.50208|0.50208	.|.	.|.	ENSG00000114841|ENSG00000114841	ENST00000420323|ENST00000273600	T|.	0.08370|.	3.1|.	4.5|4.5	3.62|3.62	0.41486|0.41486	.|.	0.000000|.	0.50627|.	D|.	0.000107|.	T|T	0.68531|0.68531	0.3011|0.3011	M|M	0.76838|0.76838	2.35|2.35	0.39391|0.39391	D|D	0.966426|0.966426	D;D|.	0.71674|.	0.998;0.986|.	D;P|.	0.67382|.	0.951;0.64|.	T|T	0.72818|0.72818	-0.4178|-0.4178	10|6	0.66056|0.66056	D|D	0.02|0.02	.|.	9.789|9.789	0.40695|0.40695	0.0:0.8382:0.0:0.1618|0.0:0.8382:0.0:0.1618	.|.	4128;4193|.	C9JXH6;Q9P2D7-2|.	.;.|.	V|C	4128|880	ENSP00000401514:L4128V|.	ENSP00000401514:L4128V|ENSP00000273600:S880C	L|S	+|+	1|2	2|0	DNAH1|DNAH1	52408198|52408198	0.147000|0.147000	0.22687|0.22687	0.995000|0.995000	0.50966|0.50966	0.996000|0.996000	0.88848|0.88848	0.699000|0.699000	0.25586|0.25586	2.506000|2.506000	0.84524|0.84524	0.655000|0.655000	0.94253|0.94253	CTG|TCT	DNAH1	-	pfam_Dynein_heavy_dom		0.532	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	C	NM_015512		52433158	+1	no_errors	ENST00000420323	ensembl	human	known	70_37	missense	SNP	0.495	G
DNAH7	56171	genome.wustl.edu	37	2	196722277	196722277	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:196722277C>T	ENST00000312428.6	-	44	8338	c.8238G>A	c.(8236-8238)atG>atA	p.M2746I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2746	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.M2746I(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GCAGAAACCTCATGTCACCAA	0.378																																																	1	Substitution - Missense(1)	lung(1)											87.0	84.0	85.0					2																	196722277		1824	4075	5899	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8238G>A	2.37:g.196722277C>T	ENSP00000311273:p.Met2746Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.M2746I	ENST00000312428.6	37	c.8238	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311598	0.23821	.	.	ENSG00000118997	ENST00000312428	T	0.72394	-0.65	5.27	-3.59	0.04583	Dynein heavy chain, coiled coil stalk (1);	0.111229	0.64402	N	0.000012	T	0.51176	0.1659	L	0.52011	1.625	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.09509	-1.0671	10	0.31617	T	0.26	.	1.0033	0.01482	0.1889:0.2886:0.2824:0.2402	.	2746	Q8WXX0	DYH7_HUMAN	I	2746	ENSP00000311273:M2746I	ENSP00000311273:M2746I	M	-	3	0	DNAH7	196430522	0.409000	0.25368	0.203000	0.23512	0.934000	0.57294	-0.230000	0.09083	-0.842000	0.04195	-1.075000	0.02238	ATG	DNAH7	-	superfamily_Signal_recog_particle_SRP9/14		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	C	NM_018897		196722277	-1	no_errors	ENST00000312428	ensembl	human	known	70_37	missense	SNP	0.953	T
DPP6	1804	genome.wustl.edu	37	7	154379779	154379779	+	Intron	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr7:154379779G>C	ENST00000377770.3	+	6	768				DPP6_ENST00000332007.3_Intron|DPP6_ENST00000404039.1_Intron|DPP6_ENST00000427557.1_Intron|DPP6_ENST00000406326.1_Missense_Mutation_p.Q349H			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6						cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TTTCGGGCCAGAGAGCAACCG	0.567																																					NSCLC(125;1384 1783 2490 7422 34254)												0													117.0	107.0	110.0					7																	154379779		876	1991	2867	SO:0001627	intron_variant	1804			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.628-49752G>C	7.37:g.154379779G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.Q349H	ENST00000377770.3	37	c.1047		7	.	.	.	.	.	.	.	.	.	.	G	3.363	-0.130037	0.06753	.	.	ENSG00000130226	ENST00000406326	.	.	.	3.16	0.157	0.14915	.	.	.	.	.	T	0.32941	0.0846	.	.	.	0.09310	N	1	B	0.31351	0.32	B	0.34931	0.192	T	0.33420	-0.9869	7	0.87932	D	0	.	6.3146	0.21184	0.0:0.3921:0.4068:0.2011	.	349	Q8IYG9	.	H	349	.	ENSP00000384393:Q349H	Q	+	3	2	DPP6	154010712	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.462000	0.06704	0.008000	0.14787	-0.463000	0.05309	CAG	DPP6	-	NULL		0.567	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	G	NM_130797		154379779	+1	no_errors	ENST00000406326	ensembl	human	putative	70_37	missense	SNP	0.000	C
DPP9	91039	genome.wustl.edu	37	19	4719937	4719937	+	5'UTR	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:4719937C>T	ENST00000598800.1	-	0	202				DPP9_ENST00000597849.1_5'UTR|DPP9_ENST00000262960.9_5'UTR			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		CAGCTGACCTCAGGAGGGCAG	0.632																																																	0													55.0	53.0	54.0					19																	4719937		692	1591	2283	SO:0001623	5_prime_UTR_variant	91039			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.-304G>A	19.37:g.4719937C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	RNA	SNP	-	NULL	ENST00000598800.1	37	NULL		19																																																																																			DPP9	-	-		0.632	DPP9-026	NOVEL	basic	protein_coding	DPP9	HGNC	protein_coding	OTTHUMT00000459343.2	C			4719937	-1	no_errors	ENST00000595940	ensembl	human	known	70_37	rna	SNP	0.641	T
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875157	+	3'UTR	DEL	A	A	-			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:221875157delA	ENST00000366899.3	-	0	2284				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	11221			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597T>-	1.37:g.221875157delA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-		0.353	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	A	NM_007207		221875157	-1	no_errors	ENST00000468085	ensembl	human	known	70_37	rna	DEL	0.000	-
EHBP1	23301	genome.wustl.edu	37	2	63101602	63101602	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:63101602C>T	ENST00000263991.5	+	11	1707	c.1225C>T	c.(1225-1227)Cca>Tca	p.P409S	EHBP1_ENST00000405289.1_Missense_Mutation_p.P374S|EHBP1_ENST00000431489.1_Missense_Mutation_p.P374S|EHBP1_ENST00000354487.3_Missense_Mutation_p.P374S|EHBP1_ENST00000405015.3_Missense_Mutation_p.P374S	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	409						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AGTCCTCTCACCAAAAACAGG	0.373																																																	0													98.0	110.0	106.0					2																	63101602		2203	4300	6503	SO:0001583	missense	23301			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.1225C>T	2.37:g.63101602C>T	ENSP00000263991:p.Pro409Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P409S	ENST00000263991.5	37	c.1225	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721356	0.48728	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.76578	-1.03;-1.03;-0.98;-1.02;-1.02	5.14	4.25	0.50352	.	0.058293	0.64402	N	0.000003	T	0.74741	0.3756	M	0.63843	1.955	0.52501	D	0.999959	B;B;B	0.10296	0.003;0.0;0.001	B;B;B	0.18263	0.021;0.007;0.003	T	0.70630	-0.4819	10	0.34782	T	0.22	.	14.2136	0.65779	0.0:0.9263:0.0:0.0737	.	374;374;409	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	S	374;374;409;374;374	ENSP00000384143:P374S;ENSP00000403783:P374S;ENSP00000263991:P409S;ENSP00000346482:P374S;ENSP00000385524:P374S	ENSP00000263991:P409S	P	+	1	0	EHBP1	62955106	0.998000	0.40836	1.000000	0.80357	0.969000	0.65631	1.322000	0.33689	1.279000	0.44446	0.655000	0.94253	CCA	EHBP1	-	NULL		0.373	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	C	NM_015252		63101602	+1	no_errors	ENST00000263991	ensembl	human	known	70_37	missense	SNP	1.000	T
EFHD1	80303	genome.wustl.edu	37	2	233527528	233527528	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:233527528G>A	ENST00000264059.3	+	2	796	c.319G>A	c.(319-321)Gat>Aat	p.D107N	EFHD1_ENST00000409708.1_De_novo_Start_OutOfFrame|EFHD1_ENST00000409613.1_Missense_Mutation_p.D11N|EFHD1_ENST00000410095.1_De_novo_Start_OutOfFrame	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	107	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		CGCTGGGCGGGATGGCTTCAT	0.542																																																	0													84.0	81.0	82.0					2																	233527528		2203	4300	6503	SO:0001583	missense	80303				CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.319G>A	2.37:g.233527528G>A	ENSP00000264059:p.Asp107Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D107N	ENST00000264059.3	37	c.319	CCDS2497.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.306230	0.97458	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187	T;T	0.74421	-0.84;-0.84	4.98	4.98	0.66077	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81479	0.4831	L	0.41415	1.275	0.80722	D	1	D;D	0.76494	0.999;0.988	D;P	0.85130	0.997;0.893	T	0.81376	-0.0961	10	0.46703	T	0.11	-27.942	17.4183	0.87507	0.0:0.0:1.0:0.0	.	11;107	E9PFH3;Q9BUP0	.;EFHD1_HUMAN	N	11;107;10	ENSP00000386556:D11N;ENSP00000264059:D107N	ENSP00000264059:D107N	D	+	1	0	EFHD1	233235772	1.000000	0.71417	0.388000	0.26195	0.973000	0.67179	9.460000	0.97641	2.585000	0.87301	0.462000	0.41574	GAT	EFHD1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.542	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHD1	HGNC	protein_coding	OTTHUMT00000257040.2	G	NM_025202		233527528	+1	no_errors	ENST00000264059	ensembl	human	known	70_37	missense	SNP	1.000	A
ENOSF1	55556	genome.wustl.edu	37	18	677389	677389	+	Silent	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr18:677389C>G	ENST00000251101.7	-	14	1192	c.1104G>C	c.(1102-1104)ctG>ctC	p.L368L	ENOSF1_ENST00000383578.3_Silent_p.L286L|ENOSF1_ENST00000319815.6_Silent_p.L138L|ENOSF1_ENST00000583973.1_5'UTR|ENOSF1_ENST00000340116.7_Silent_p.L375L|ENOSF1_ENST00000580982.1_Silent_p.L292L	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	368					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CAAATATAATCAGGTGCTGCA	0.438																																																	0													83.0	86.0	85.0					18																	677389		2203	4300	6503	SO:0001819	synonymous_variant	55556			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.1104G>C	18.37:g.677389C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Silent	SNP	pfam_Mandelate_racemase_C,pfam_Mandelate_racemase_N,smart_Mandelate_racemase_C	p.L375	ENST00000251101.7	37	c.1125	CCDS11822.1	18																																																																																			ENOSF1	-	NULL		0.438	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	HGNC	protein_coding	OTTHUMT00000254312.2	C	NM_017512		677389	-1	no_errors	ENST00000340116	ensembl	human	known	70_37	silent	SNP	1.000	G
BBS1	582	genome.wustl.edu	37	11	66291252	66291252	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:66291252G>A	ENST00000318312.7	+	11	1060	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K	CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.E374K|BBS1_ENST00000529766.1_3'UTR|ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000455748.2_Missense_Mutation_p.E240K|BBS1_ENST00000393994.2_Intron	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	337					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GAACCTCCTGGAGCAGCATTC	0.622									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0													53.0	46.0	48.0					11																	66291252		2200	4295	6495	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1009G>A	11.37:g.66291252G>A	ENSP00000317469:p.Glu337Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.E374K	ENST00000318312.7	37	c.1120	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737276	0.89482	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748	T;T;T	0.56611	0.45;0.45;0.45	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	.	.	.	.	T	0.55673	0.1935	L	0.59436	1.845	0.80722	D	1	B;P;P;P;P	0.51351	0.002;0.944;0.839;0.804;0.804	B;P;B;B;B	0.47402	0.004;0.546;0.393;0.21;0.318	T	0.51348	-0.8717	9	0.21014	T	0.42	.	16.6873	0.85312	0.0:0.0:1.0:0.0	.	12;240;225;337;374	B4DH75;E7EQH1;Q4G0L2;Q8NFJ9;Q8NFJ9-2	.;.;.;BBS1_HUMAN;.	K	374;337;240	ENSP00000398526:E374K;ENSP00000317469:E337K;ENSP00000405764:E240K	ENSP00000317469:E337K	E	+	1	0	BBS1;CTD-3074O7.11	66047828	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.042000	0.93793	2.536000	0.85505	0.561000	0.74099	GAG	BBS1	-	superfamily_Quinonprotein_ADH-like		0.622	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256349	Uniprot_genename	protein_coding	OTTHUMT00000393235.2	G			66291252	+1	no_errors	ENST00000419755	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD42	338699	genome.wustl.edu	37	11	82921097	82921097	+	Intron	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:82921097C>T	ENST00000393392.2	+	4	408				ANKRD42_ENST00000260047.6_Intron|ANKRD42_ENST00000533342.1_Intron|ANKRD42_ENST00000528722.1_Intron|ANKRD42_ENST00000531895.1_Intron|RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000526731.1_Intron|ANKRD42_ENST00000393389.3_Intron	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42						positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						CCATTTTATTCAAGAAATCTG	0.303																																																	0																																										SO:0001627	intron_variant	0			AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.247-245C>T	11.37:g.82921097C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A49	RNA	SNP	-	NULL	ENST00000393392.2	37	NULL	CCDS8265.1	11																																																																																			RP11-727A23.7	-	-		0.303	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ENSG00000254551	Clone_based_vega_gene	protein_coding	OTTHUMT00000392934.1	C	NM_182603		82921097	-1	no_errors	ENST00000531869	ensembl	human	known	70_37	rna	SNP	0.960	T
HDAC7	51564	genome.wustl.edu	37	12	48179194	48179194	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:48179194G>A	ENST00000427332.2	-	24	2806	c.2650C>T	c.(2650-2652)Ctg>Ttg	p.L884L	HDAC7_ENST00000380610.4_Silent_p.L940L|AC004466.1_ENST00000599515.1_Missense_Mutation_p.R93K|HDAC7_ENST00000354334.3_Silent_p.L886L|HDAC7_ENST00000552960.1_Silent_p.L906L|HDAC7_ENST00000080059.7_Silent_p.L923L			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	884	Interaction with SIN3A. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		ACGGCCTCCAGAGAGCGGATG	0.552																																																	0													195.0	186.0	189.0					12																	48179194		2203	4300	6503	SO:0001819	synonymous_variant	0			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2650C>T	12.37:g.48179194G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	NULL	p.R93K	ENST00000427332.2	37	c.278		12																																																																																			AC004466.1	-	NULL		0.552	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	ENSG00000268069	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000328804.2	G			48179194	+1	no_errors	ENST00000599515	ensembl	human	known	70_37	missense	SNP	0.961	A
ELMOD1	55531	genome.wustl.edu	37	11	107462600	107462600	+	Intron	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:107462600G>A	ENST00000265840.7	+	1	180				ELMOD1_ENST00000443271.2_Intron|AP000889.3_ENST00000600612.1_Silent_p.G39G|ELMOD1_ENST00000531234.1_Intron|ELMOD1_ENST00000529675.1_3'UTR	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		GGGCTGCGGGGCCGCCGGACT	0.716																																																	0													10.0	13.0	12.0					11																	107462600		1865	4063	5928	SO:0001627	intron_variant	0			AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+465G>A	11.37:g.107462600G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E167|G5E9S5|Q9NPW3	Silent	SNP	NULL	p.G39	ENST00000265840.7	37	c.117	CCDS44723.1	11																																																																																			AP000889.3	-	NULL		0.716	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000268467	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000389406.1	G	NM_018712		107462600	+1	no_errors	ENST00000600612	ensembl	human	known	70_37	silent	SNP	0.000	A
ENTHD1	150350	genome.wustl.edu	37	22	40161572	40161572	+	Missense_Mutation	SNP	C	C	T	rs111738363	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:40161572C>T	ENST00000325157.6	-	6	1125	c.875G>A	c.(874-876)aGa>aAa	p.R292K		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	292										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					ACTCACATCTCTCTGCCCAGA	0.358																																																	0													102.0	107.0	105.0					22																	40161572		2201	4298	6499	SO:0001583	missense	150350			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.875G>A	22.37:g.40161572C>T	ENSP00000317431:p.Arg292Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.R292K	ENST00000325157.6	37	c.875	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	G	15.16	2.749537	0.49257	.	.	ENSG00000176177	ENST00000325157	T	0.41400	1.0	5.79	3.61	0.41365	.	0.344271	0.23879	N	0.043672	T	0.19725	0.0474	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17868	-1.0355	10	0.19590	T	0.45	-0.6508	7.5507	0.27796	0.0845:0.3206:0.5949:0.0	.	292	Q8IYW4	ENTD1_HUMAN	K	292	ENSP00000317431:R292K	ENSP00000317431:R292K	R	-	2	0	ENTHD1	38491518	0.007000	0.16637	0.005000	0.12908	0.080000	0.17528	0.547000	0.23299	0.815000	0.34398	-0.120000	0.15030	AGA	ENTHD1	-	NULL		0.358	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	C	NM_152512		40161572	-1	no_errors	ENST00000325157	ensembl	human	known	70_37	missense	SNP	0.003	T
EPB41L1	2036	genome.wustl.edu	37	20	34763472	34763472	+	Splice_Site	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:34763472G>C	ENST00000338074.2	+	3	338		c.e3-1		EPB41L1_ENST00000373941.1_Splice_Site|EPB41L1_ENST00000202028.5_Splice_Site|EPB41L1_ENST00000441639.1_Splice_Site|EPB41L1_ENST00000373950.2_Splice_Site|EPB41L1_ENST00000373946.3_Splice_Site	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TGGTCCTGCAGAGCCTAGACA	0.517																																																	0													82.0	76.0	78.0					20																	34763472		2203	4300	6503	SO:0001630	splice_region_variant	2036			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.178-1G>C	20.37:g.34763472G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Splice_Site	SNP	-	e2-1	ENST00000338074.2	37	c.178-1	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141042	0.77775	.	.	ENSG00000088367	ENST00000406771;ENST00000397315;ENST00000452261;ENST00000447825;ENST00000373946;ENST00000338074;ENST00000373941	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6269	0.91344	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EPB41L1	34226886	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.507000	0.66999	2.735000	0.93741	0.655000	0.94253	.	EPB41L1	-	-		0.517	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	G	NM_012156	Intron	34763472	+1	no_errors	ENST00000338074	ensembl	human	known	70_37	splice_site	SNP	1.000	C
ERBB2	2064	genome.wustl.edu	37	17	37880261	37880261	+	Missense_Mutation	SNP	G	G	C	rs121913468		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:37880261G>C	ENST00000269571.5	+	19	2464	c.2305G>C	c.(2305-2307)Gac>Cac	p.D769H	ERBB2_ENST00000445658.2_Missense_Mutation_p.D493H|ERBB2_ENST00000584450.1_Missense_Mutation_p.D769H|ERBB2_ENST00000584601.1_Missense_Mutation_p.D739H|ERBB2_ENST00000540147.1_Missense_Mutation_p.D739H|ERBB2_ENST00000406381.2_Missense_Mutation_p.D739H|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.D754H			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.D769H(2)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AGAAATCTTAGACGTAAGCCC	0.532		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																														Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	2	Substitution - Missense(2)	stomach(1)|lung(1)											95.0	82.0	86.0					17																	37880261		2203	4300	6503	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2305G>C	17.37:g.37880261G>C	ENSP00000269571:p.Asp769His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D769H	ENST00000269571.5	37	c.2305	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.182232	0.94885	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.02	5.02	0.67125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83198	0.5202	N	0.05441	-0.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.87787	0.2616	9	0.87932	D	0	.	17.957	0.89072	0.0:0.0:1.0:0.0	.	493;754;769	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	H	739;754;493;769;739	ENSP00000385185:D739H;ENSP00000446466:D754H;ENSP00000404047:D493H;ENSP00000269571:D769H;ENSP00000443562:D739H	ENSP00000269571:D769H	D	+	1	0	ERBB2	35133787	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	9.869000	0.99810	2.329000	0.79093	0.462000	0.41574	GAC	ERBB2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfscan_Prot_kinase_cat_dom		0.532	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	G			37880261	+1	no_errors	ENST00000269571	ensembl	human	known	70_37	missense	SNP	1.000	C
ETV5	2119	genome.wustl.edu	37	3	185766533	185766533	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:185766533G>A	ENST00000306376.5	-	13	1674	c.1428C>T	c.(1426-1428)agC>agT	p.S476S	ETV5_ENST00000434744.1_Silent_p.S476S|ETV5_ENST00000537818.1_Silent_p.S518S|ETV5_ENST00000480706.1_5'UTR	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	476					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGTCCTCCTCGCTGAGGTGGC	0.587			T	"""TMPRSS2, SCL45A3"""	Prostate																																			Dom	yes		3	3q28	2119	ets variant gene 5		E	0													76.0	68.0	71.0					3																	185766533		2203	4300	6503	SO:0001819	synonymous_variant	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1428C>T	3.37:g.185766533G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH46|B7Z7D7|Q6IBN5	Silent	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.S518	ENST00000306376.5	37	c.1554	CCDS33906.1	3																																																																																			ETV5	-	NULL		0.587	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	HGNC	protein_coding	OTTHUMT00000344947.1	G	NM_004454		185766533	-1	no_errors	ENST00000537818	ensembl	human	known	70_37	silent	SNP	0.002	A
EYA1	2138	genome.wustl.edu	37	8	72128979	72128979	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:72128979G>A	ENST00000340726.3	-	14	1947	c.1308C>T	c.(1306-1308)ttC>ttT	p.F436F	EYA1_ENST00000388741.2_Silent_p.F402F|EYA1_ENST00000388743.2_Silent_p.F435F|EYA1_ENST00000303824.7_Silent_p.F430F|EYA1_ENST00000419131.1_Silent_p.F401F|EYA1_ENST00000388742.4_Silent_p.F436F|EYA1_ENST00000388740.3_Silent_p.F403F	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	436					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GTCTGTAGCGGAAGGCCAACT	0.473																																																	0													192.0	167.0	176.0					8																	72128979		2203	4300	6503	SO:0001819	synonymous_variant	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1308C>T	8.37:g.72128979G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.F436	ENST00000340726.3	37	c.1308	CCDS34906.1	8																																																																																			EYA1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA		0.473	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	HGNC	protein_coding	OTTHUMT00000313788.2	G	NM_000503, NM_172060		72128979	-1	no_errors	ENST00000340726	ensembl	human	known	70_37	silent	SNP	1.000	A
FAM122B	159090	genome.wustl.edu	37	X	133922794	133922794	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:133922794G>A	ENST00000370790.1	-	5	1272	c.344C>T	c.(343-345)tCt>tTt	p.S115F	FAM122B_ENST00000493333.1_5'UTR|FAM122B_ENST00000343004.5_Missense_Mutation_p.S134F|FAM122B_ENST00000486347.1_Missense_Mutation_p.S115F|FAM122B_ENST00000298090.6_Missense_Mutation_p.S134F	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	115										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					AGGTGCTGGAGAAACTGGAGT	0.388																																																	0													90.0	80.0	83.0					X																	133922794		2203	4300	6503	SO:0001583	missense	159090			BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.344C>T	X.37:g.133922794G>A	ENSP00000359826:p.Ser115Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.S134F	ENST00000370790.1	37	c.401	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531063	0.85706	.	.	ENSG00000156504	ENST00000370790;ENST00000298090;ENST00000343004;ENST00000486347	.	.	.	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000003	D	0.84433	0.5471	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;0.998;0.999;0.999;1.0	D;D;D;D;D;D	0.91635	0.999;0.997;0.992;0.997;0.997;0.999	D	0.86851	0.2023	9	0.62326	D	0.03	.	17.4014	0.87460	0.0:0.0:1.0:0.0	.	81;134;62;115;115;134	B4DN12;G1UD80;Q7Z309-5;Q7Z309-2;Q7Z309;Q7Z309-3	.;.;.;.;F122B_HUMAN;.	F	115;134;134;115	.	ENSP00000298090:S134F	S	-	2	0	FAM122B	133750460	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.048000	0.93830	2.322000	0.78497	0.523000	0.50628	TCT	FAM122B	-	NULL		0.388	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1	G	NM_145284		133922794	-1	no_errors	ENST00000343004	ensembl	human	known	70_37	missense	SNP	1.000	A
SUPT20H	55578	genome.wustl.edu	37	13	37605926	37605926	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr13:37605926C>G	ENST00000350612.6	-	11	1034	c.814G>C	c.(814-816)Gaa>Caa	p.E272Q	SUPT20H_ENST00000542180.1_Missense_Mutation_p.E260Q|SUPT20H_ENST00000360252.4_Missense_Mutation_p.E273Q|SUPT20H_ENST00000356185.3_Missense_Mutation_p.E273Q|SUPT20H_ENST00000475892.1_Missense_Mutation_p.E272Q|AL138706.1_ENST00000408173.1_RNA|SUPT20H_ENST00000464744.1_Missense_Mutation_p.E273Q	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	272					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GCTTTTCTTTCCTTTCTTTTT	0.378																																																	0													62.0	68.0	66.0					13																	37605926		2203	4300	6503	SO:0001583	missense	55578			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.814G>C	13.37:g.37605926C>G	ENSP00000218894:p.Glu272Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.E272Q	ENST00000350612.6	37	c.814	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	C	18.64	3.666424	0.67814	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180	T;T;T;T;T;T	0.49139	0.81;0.79;1.38;0.81;0.81;0.89	5.92	5.92	0.95590	.	0.158661	0.56097	D	0.000035	T	0.54902	0.1887	M	0.66939	2.045	0.80722	D	1	B;P;P;B;B;B	0.42010	0.085;0.701;0.768;0.413;0.346;0.235	B;B;B;B;B;B	0.43386	0.081;0.285;0.418;0.175;0.272;0.14	T	0.50625	-0.8806	10	0.33940	T	0.23	-23.7916	20.3328	0.98725	0.0:1.0:0.0:0.0	.	260;272;272;273;273;272	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	Q	273;272;272;273;272;273;260	ENSP00000353388:E273Q;ENSP00000417510:E272Q;ENSP00000218894:E272Q;ENSP00000348512:E273Q;ENSP00000419754:E273Q;ENSP00000439000:E260Q	ENSP00000218894:E272Q	E	-	1	0	FAM48A	36503926	1.000000	0.71417	0.996000	0.52242	0.814000	0.46013	7.426000	0.80270	2.811000	0.96726	0.637000	0.83480	GAA	FAM48A	-	NULL		0.378	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM48A	HGNC	protein_coding	OTTHUMT00000354766.1	C	NM_017569		37605926	-1	no_errors	ENST00000350612	ensembl	human	known	70_37	missense	SNP	1.000	G
FBN2	2201	genome.wustl.edu	37	5	127641308	127641308	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:127641308C>T	ENST00000508053.1	-	50	6543	c.5569G>A	c.(5569-5571)Ggt>Agt	p.G1857S	FBN2_ENST00000262464.4_Missense_Mutation_p.G1857S			P35556	FBN2_HUMAN	fibrillin 2	1857	EGF-like 30; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGATTATCACCATTGCTGCAC	0.428																																																	0													99.0	99.0	99.0					5																	127641308		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5569G>A	5.37:g.127641308C>T	ENSP00000424571:p.Gly1857Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.G1857S	ENST00000508053.1	37	c.5569	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861189	0.91433	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92911	-3.13;-3.13	5.34	5.34	0.76211	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000005	D	0.94768	0.8311	L	0.56124	1.755	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.91888	0.5521	10	0.21540	T	0.41	.	19.5946	0.95530	0.0:1.0:0.0:0.0	.	1857	P35556	FBN2_HUMAN	S	1857	ENSP00000262464:G1857S;ENSP00000424571:G1857S	ENSP00000262464:G1857S	G	-	1	0	FBN2	127669207	1.000000	0.71417	0.862000	0.33874	0.930000	0.56654	5.445000	0.66594	2.937000	0.99478	0.650000	0.86243	GGT	FBN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	C	NM_001999		127641308	-1	no_errors	ENST00000262464	ensembl	human	known	70_37	missense	SNP	1.000	T
FBXO31	79791	genome.wustl.edu	37	16	87364921	87364921	+	Silent	SNP	G	G	A	rs147242075		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:87364921G>A	ENST00000311635.7	-	9	1605	c.1593C>T	c.(1591-1593)ctC>ctT	p.L531L	RP11-178L8.4_ENST00000568879.1_Intron	NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	531					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		GAATGTTCTTGAGCATCTCAT	0.602																																																	0													100.0	73.0	82.0					16																	87364921		2198	4300	6498	SO:0001819	synonymous_variant	79791			BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.1593C>T	16.37:g.87364921G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5K680|Q8WYV1|Q96D73|Q9UFV4	Silent	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.L531	ENST00000311635.7	37	c.1593	CCDS32501.1	16																																																																																			FBXO31	-	NULL		0.602	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO31	HGNC	protein_coding	OTTHUMT00000430799.2	G	NM_024735		87364921	-1	no_errors	ENST00000311635	ensembl	human	known	70_37	silent	SNP	1.000	A
FCRL5	83416	genome.wustl.edu	37	1	157494309	157494309	+	Missense_Mutation	SNP	T	T	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:157494309T>A	ENST00000361835.3	-	10	2156	c.1999A>T	c.(1999-2001)Agg>Tgg	p.R667W	FCRL5_ENST00000368191.3_Missense_Mutation_p.R582W|FCRL5_ENST00000356953.4_Missense_Mutation_p.R667W|FCRL5_ENST00000461387.1_5'Flank|FCRL5_ENST00000368190.3_Missense_Mutation_p.R667W	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	667	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GCCTGGGCCCTGGGAGCCCTG	0.517																																																	0													47.0	52.0	50.0					1																	157494309		2203	4300	6503	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1999A>T	1.37:g.157494309T>A	ENSP00000354691:p.Arg667Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R667W	ENST00000361835.3	37	c.1999	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436310	0.62955	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03152	4.03;4.03;4.03;4.03	4.69	-8.86	0.00795	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07638	0.0192	M	0.89534	3.04	0.09310	N	1	D;D;D;D	0.76494	0.999;0.999;0.985;0.991	D;D;D;D	0.76071	0.987;0.987;0.945;0.965	T	0.00936	-1.1508	9	0.48119	T	0.1	.	9.6755	0.40039	0.0:0.4774:0.3697:0.1529	.	582;667;667;667	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	W	667;667;667;582	ENSP00000354691:R667W;ENSP00000349434:R667W;ENSP00000357173:R667W;ENSP00000357174:R582W	ENSP00000349434:R667W	R	-	1	2	FCRL5	155760933	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-1.426000	0.02443	-1.436000	0.01970	-0.406000	0.06334	AGG	FCRL5	-	smart_Ig_sub,pfscan_Ig-like		0.517	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	T	NM_031281		157494309	-1	no_errors	ENST00000356953	ensembl	human	known	70_37	missense	SNP	0.000	A
GABRB2	2561	genome.wustl.edu	37	5	160886733	160886733	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:160886733C>G	ENST00000393959.1	-	4	354	c.355G>C	c.(355-357)Gat>Cat	p.D119H	GABRB2_ENST00000517901.1_Missense_Mutation_p.D56H|GABRB2_ENST00000517547.1_Intron|GABRB2_ENST00000274547.2_Missense_Mutation_p.D119H|GABRB2_ENST00000520240.1_Missense_Mutation_p.D119H|GABRB2_ENST00000353437.6_Missense_Mutation_p.D119H			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	119	Agonist binding. {ECO:0000250}.				cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAATAGGTATCAGGCACCCAG	0.463																																																	0													99.0	89.0	92.0					5																	160886733		2203	4300	6503	SO:0001583	missense	2561				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.355G>C	5.37:g.160886733C>G	ENSP00000377531:p.Asp119His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,prints_GABAAa_rcpt,tigrfam_Neur_channel	p.D119H	ENST00000393959.1	37	c.355	CCDS4355.1	5	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811564	0.90707	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901	D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84	4.97	4.97	0.65823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.95303	0.8476	H	0.96748	3.875	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96940	0.9687	10	0.87932	D	0	.	18.6117	0.91288	0.0:1.0:0.0:0.0	.	119;56;119;119	B7Z4P0;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	H	119;119;119;119;56	ENSP00000377531:D119H;ENSP00000274547:D119H;ENSP00000274546:D119H;ENSP00000429320:D119H;ENSP00000430532:D56H	ENSP00000274547:D119H	D	-	1	0	GABRB2	160819311	1.000000	0.71417	0.910000	0.35882	0.976000	0.68499	7.650000	0.83521	2.455000	0.83008	0.655000	0.94253	GAT	GABRB2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.463	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB2	HGNC	protein_coding	OTTHUMT00000252704.1	C			160886733	-1	no_errors	ENST00000274547	ensembl	human	known	70_37	missense	SNP	1.000	G
GGA3	23163	genome.wustl.edu	37	17	73239158	73239158	+	Missense_Mutation	SNP	C	C	T	rs372068946		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:73239158C>T	ENST00000245541.6	-	6	730	c.514G>A	c.(514-516)Gag>Aag	p.E172K	GGA3_ENST00000582717.1_Missense_Mutation_p.E100K|GGA3_ENST00000538886.1_Missense_Mutation_p.E50K|GGA3_ENST00000578348.1_Missense_Mutation_p.E50K|GGA3_ENST00000537686.1_Intron|GGA3_ENST00000579743.1_5'Flank|GGA3_ENST00000351904.7_Missense_Mutation_p.E139K|GGA3_ENST00000582486.1_Missense_Mutation_p.E100K	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	172	Binds to ARF1 (in long isoform).|GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			GACTTCTCCTCATCATCAAAA	0.552																																																	0								C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	153.0	141.0	145.0		298,148,415,514	4.8	1.0	17		145	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	GGA3	NM_001172703.1,NM_001172704.1,NM_014001.3,NM_138619.2	56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	100/652,50/593,139/691,172/724	73239158	1,13005	2203	4300	6503	SO:0001583	missense	23163			AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.514G>A	17.37:g.73239158C>T	ENSP00000245541:p.Glu172Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.E172K	ENST00000245541.6	37	c.514	CCDS11717.1	17	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877987	0.51801	0.0	1.16E-4	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T;T	0.53640	0.61;0.61;0.61	4.85	4.85	0.62838	GAT (1);	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	0.998;0.995;1.0	D;D;D	0.85130	0.973;0.99;0.997	T	0.77678	-0.2498	10	0.52906	T	0.07	-25.219	18.153	0.89682	0.0:1.0:0.0:0.0	.	50;139;172	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	K	172;139;100;50	ENSP00000245541:E172K;ENSP00000326575:E139K;ENSP00000446421:E50K	ENSP00000245541:E172K	E	-	1	0	GGA3	70750753	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.538000	0.82048	2.505000	0.84491	0.563000	0.77884	GAG	GGA3	-	pfscan_GAT		0.552	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA3	HGNC	protein_coding	OTTHUMT00000446645.1	C	NM_138619		73239158	-1	no_errors	ENST00000245541	ensembl	human	known	70_37	missense	SNP	1.000	T
GMNN	51053	genome.wustl.edu	37	6	24784710	24784710	+	Silent	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:24784710C>G	ENST00000230056.3	+	6	728	c.396C>G	c.(394-396)gcC>gcG	p.A132A	GMNN_ENST00000356509.3_Silent_p.A132A	NM_015895.4	NP_056979.1	O75496	GEMI_HUMAN	geminin, DNA replication inhibitor	132	Necessary and sufficient for interaction with IDAS and CDT1.				mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	10						ATGAAATTGCCCGCCTGAAAA	0.323																																																	0													78.0	88.0	85.0					6																	24784710		2203	4299	6502	SO:0001819	synonymous_variant	51053			AF067855	CCDS4560.1	6p21.32	2008-10-31			ENSG00000112312	ENSG00000112312			17493	protein-coding gene	gene with protein product		602842				9635433	Standard	NM_001251989		Approved	Gem	uc003nem.3	O75496	OTTHUMG00000014363	ENST00000230056.3:c.396C>G	6.37:g.24784710C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMM8|Q9H1Z1	Silent	SNP	pfam_Geminin_fam	p.A132	ENST00000230056.3	37	c.396	CCDS4560.1	6																																																																																			GMNN	-	pfam_Geminin_fam		0.323	GMNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMNN	HGNC	protein_coding	OTTHUMT00000040021.2	C	NM_015895		24784710	+1	no_errors	ENST00000230056	ensembl	human	known	70_37	silent	SNP	0.999	G
GNAQ	2776	genome.wustl.edu	37	9	80409438	80409438	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:80409438T>C	ENST00000286548.4	-	5	898	c.676A>G	c.(676-678)Atc>Gtc	p.I226V	GNAQ_ENST00000397476.3_Missense_Mutation_p.I24V	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	226					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						AGAAACATGATAGAGGTGACA	0.373			Mis		uveal melanoma																																			Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	0													139.0	130.0	133.0					9																	80409438		2203	4300	6503	SO:0001583	missense	2776				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.676A>G	9.37:g.80409438T>C	ENSP00000286548:p.Ile226Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q,prints_Fungi_GproteinA	p.I226V	ENST00000286548.4	37	c.676	CCDS6658.1	9	.	.	.	.	.	.	.	.	.	.	T	18.74	3.689323	0.68271	.	.	ENSG00000156052	ENST00000286548;ENST00000397476	D;D	0.90504	-2.68;-2.68	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.88581	0.6475	L	0.41079	1.255	0.80722	D	1	B	0.20988	0.05	B	0.31686	0.134	D	0.86144	0.1583	10	0.87932	D	0	.	15.6935	0.77473	0.0:0.0:0.0:1.0	.	226	P50148	GNAQ_HUMAN	V	226;24	ENSP00000286548:I226V;ENSP00000443197:I24V	ENSP00000286548:I226V	I	-	1	0	GNAQ	79599258	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.098000	0.63641	0.460000	0.39030	ATC	GNAQ	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su		0.373	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAQ	HGNC	protein_coding	OTTHUMT00000052761.1	T	NM_002072		80409438	-1	no_errors	ENST00000286548	ensembl	human	known	70_37	missense	SNP	1.000	C
GPKOW	27238	genome.wustl.edu	37	X	48972640	48972640	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:48972640G>A	ENST00000156109.5	-	7	1029	c.951C>T	c.(949-951)ctC>ctT	p.L317L		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	317				L -> F (in Ref. 3; BAD93043). {ECO:0000305}.		nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						CTTGATTCCAGAGGGTCTTCC	0.542																																																	0													266.0	199.0	222.0					X																	48972640		2203	4300	6503	SO:0001819	synonymous_variant	27238			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.951C>T	X.37:g.48972640G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q59EK5|Q9BQA8	Silent	SNP	pfam_KOW,pfam_G_patch_dom,superfamily_Translation_prot_SH3-like,smart_G_patch_dom,smart_KOW,pfscan_G_patch_dom	p.L317	ENST00000156109.5	37	c.951	CCDS35251.1	X																																																																																			GPKOW	-	NULL		0.542	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPKOW	HGNC	protein_coding	OTTHUMT00000056535.2	G	NM_015698		48972640	-1	no_errors	ENST00000156109	ensembl	human	known	70_37	silent	SNP	0.000	A
GPKOW	27238	genome.wustl.edu	37	X	48973411	48973411	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:48973411C>A	ENST00000156109.5	-	6	964	c.886G>T	c.(886-888)Gag>Tag	p.E296*		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	296						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						TTGTCAAACTCCTGCTGGGAG	0.577																																																	0													93.0	76.0	82.0					X																	48973411		2203	4300	6503	SO:0001587	stop_gained	27238			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.886G>T	X.37:g.48973411C>A	ENSP00000156109:p.Glu296*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59EK5|Q9BQA8	Nonsense_Mutation	SNP	pfam_KOW,pfam_G_patch_dom,superfamily_Translation_prot_SH3-like,smart_G_patch_dom,smart_KOW,pfscan_G_patch_dom	p.E296*	ENST00000156109.5	37	c.886	CCDS35251.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.587720	0.96590	.	.	ENSG00000068394	ENST00000156109	.	.	.	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-0.2382	10.0577	0.42255	0.0:0.9023:0.0:0.0977	.	.	.	.	X	296	.	ENSP00000156109:E296X	E	-	1	0	GPKOW	48860355	1.000000	0.71417	0.959000	0.39883	0.753000	0.42808	5.455000	0.66658	2.176000	0.68965	0.591000	0.81541	GAG	GPKOW	-	NULL		0.577	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPKOW	HGNC	protein_coding	OTTHUMT00000056535.2	C	NM_015698		48973411	-1	no_errors	ENST00000156109	ensembl	human	known	70_37	nonsense	SNP	1.000	A
GPR124	25960	genome.wustl.edu	37	8	37696479	37696479	+	Silent	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:37696479G>C	ENST00000412232.2	+	15	2278	c.2265G>C	c.(2263-2265)ctG>ctC	p.L755L	GPR124_ENST00000315215.7_Silent_p.L538L	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	755	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CCCAGGAGCTGAGCGCCTTTC	0.677																																																	0													35.0	38.0	37.0					8																	37696479		2203	4300	6503	SO:0001819	synonymous_variant	25960			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2265G>C	8.37:g.37696479G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like	p.L755	ENST00000412232.2	37	c.2265	CCDS6097.2	8																																																																																			GPR124	-	pfscan_GPS_dom		0.677	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	HGNC	protein_coding	OTTHUMT00000343331.2	G			37696479	+1	no_errors	ENST00000412232	ensembl	human	known	70_37	silent	SNP	1.000	C
GPR133	283383	genome.wustl.edu	37	12	131623878	131623878	+	3'UTR	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:131623878C>A	ENST00000261654.5	+	0	3254				GPR133_ENST00000376682.4_3'UTR|GPR133_ENST00000540207.1_3'UTR	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AAATGCCCCACCTTTGCCCAT	0.637																																																	0																																										SO:0001624	3_prime_UTR_variant	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.*70C>A	12.37:g.131623878C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	RNA	SNP	-	NULL	ENST00000261654.5	37	NULL	CCDS9272.1	12																																																																																			GPR133	-	-		0.637	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	HGNC	protein_coding	OTTHUMT00000399356.1	C	NM_198827		131623878	+1	no_errors	ENST00000540207	ensembl	human	known	70_37	rna	SNP	0.002	A
GPR98	84059	genome.wustl.edu	37	5	90006807	90006807	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:90006807G>A	ENST00000405460.2	+	40	8930	c.8834G>A	c.(8833-8835)gGt>gAt	p.G2945D		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2945					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GATTCAGAAGGTTTGACTGCA	0.348																																																	0													58.0	53.0	55.0					5																	90006807		1811	4066	5877	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8834G>A	5.37:g.90006807G>A	ENSP00000384582:p.Gly2945Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.G2945D	ENST00000405460.2	37	c.8834	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.753525|4.753525	0.89753|0.89753	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.34275|.	1.37|.	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	0.044564|.	0.85682|.	D|.	0.000000|.	D|D	0.82435|0.82435	0.5036|0.5036	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.76071|.	0.987;0.94|.	T|T	0.81491|0.81491	-0.0909|-0.0909	10|5	0.33141|.	T|.	0.24|.	.|.	20.5141|20.5141	0.99211|0.99211	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2945;2945|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	D|I	2945|511	ENSP00000384582:G2945D|.	ENSP00000296619:G2945D|.	G|V	+|+	2|1	0|0	GPR98|GPR98	90042563|90042563	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.784000|0.784000	0.44337|0.44337	7.540000|7.540000	0.82074|0.82074	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	GGT|GTT	GPR98	-	NULL		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	G	NM_032119		90006807	+1	no_errors	ENST00000405460	ensembl	human	known	70_37	missense	SNP	1.000	A
GRID2IP	392862	genome.wustl.edu	37	7	6537475	6537475	+	Splice_Site	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr7:6537475C>T	ENST00000457091.2	-	22	3565	c.3566G>A	c.(3565-3567)cGa>cAa	p.R1189Q	GRID2IP_ENST00000452113.1_Splice_Site_p.R998Q|GRID2IP_ENST00000435185.1_Splice_Site_p.R1005Q	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1189	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						ACTCAGCGCTCGCTGGGGAGG	0.662																																																	0													5.0	8.0	7.0					7																	6537475		673	1565	2238	SO:0001630	splice_region_variant	392862				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3565-1G>A	7.37:g.6537475C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_PDZ,superfamily_FH2_actin-bd,superfamily_PDZ,smart_PDZ,smart_Actin-bd_FH2/DRF_autoreg,pfscan_PDZ	p.R1189Q	ENST00000457091.2	37	c.3566	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141149	0.56936	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.63417	-0.04;-0.04;-0.04	3.71	3.71	0.42584	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.434149	0.18953	U	0.126621	T	0.66867	0.2833	L	0.35723	1.085	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.62338	-0.6875	10	0.32370	T	0.25	.	11.2723	0.49147	0.0:1.0:0.0:0.0	.	1189	A4D2P6	GRD2I_HUMAN	Q	998;1005;1189	ENSP00000397887:R998Q;ENSP00000408364:R1005Q;ENSP00000397351:R1189Q	ENSP00000408364:R1005Q	R	-	2	0	GRID2IP	6504000	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	3.213000	0.51153	2.370000	0.80446	0.561000	0.74099	CGA	GRID2IP	-	superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg		0.662	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	C	XM_294249	Missense_Mutation	6537475	-1	no_errors	ENST00000457091	ensembl	human	putative	70_37	missense	SNP	1.000	T
GSDMA	284110	genome.wustl.edu	37	17	38121988	38121988	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:38121988C>A	ENST00000301659.4	+	2	166	c.48C>A	c.(46-48)aaC>aaA	p.N16K		NM_178171.4	NP_835465.2	Q96QA5	GSDMA_HUMAN	gasdermin A	16					apoptotic process (GO:0006915)	perinuclear region of cytoplasm (GO:0048471)				NS(1)|endometrium(2)|large_intestine(3)|lung(1)	7						GACAGCTAAACCCTCGAGGGG	0.577																																																	0													54.0	60.0	58.0					17																	38121988		1981	4154	6135	SO:0001583	missense	284110			AB093591	CCDS45669.1	17q21.2	2008-07-31	2008-07-31	2008-07-31		ENSG00000167914			13311	protein-coding gene	gene with protein product		611218	"""gasdermin"", ""gasdermin 1"""	GSDM, GSDM1		12883658, 15010812, 17350798	Standard	NM_178171		Approved	FLJ39120	uc002htl.1	Q96QA5		ENST00000301659.4:c.48C>A	17.37:g.38121988C>A	ENSP00000301659:p.Asn16Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MC5|Q86VE7|Q8N1M6	Missense_Mutation	SNP	pfam_Gasdermin	p.N16K	ENST00000301659.4	37	c.48	CCDS45669.1	17	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566092	0.27915	.	.	ENSG00000167914	ENST00000301659	T	0.22743	1.94	5.36	4.18	0.49190	.	0.458932	0.22040	N	0.065467	T	0.40423	0.1116	M	0.70595	2.14	0.30013	N	0.814969	D	0.64830	0.994	D	0.66716	0.946	T	0.26121	-1.0112	10	0.48119	T	0.1	-14.3442	9.8444	0.41017	0.0:0.8905:0.0:0.1095	.	16	Q96QA5	GSDMA_HUMAN	K	16	ENSP00000301659:N16K	ENSP00000301659:N16K	N	+	3	2	GSDMA	35375514	1.000000	0.71417	0.995000	0.50966	0.864000	0.49448	1.724000	0.38064	2.523000	0.85059	0.462000	0.41574	AAC	GSDMA	-	pfam_Gasdermin		0.577	GSDMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMA	HGNC	protein_coding	OTTHUMT00000446847.1	C	NM_178171		38121988	+1	no_errors	ENST00000301659	ensembl	human	known	70_37	missense	SNP	0.995	A
GUCY1B2	2974	genome.wustl.edu	37	13	51599571	51599571	+	RNA	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr13:51599571G>A	ENST00000493639.2	-	0	793				RNA5SP29_ENST00000410988.1_RNA	NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										TTCATGAGATGCCCTGGACAT	0.458																																																	0													154.0	144.0	147.0					13																	51599571		692	1591	2283			2974			AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51599571G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZ64	RNA	SNP	-	NULL	ENST00000493639.2	37	NULL		13																																																																																			GUCY1B2	-	-		0.458	GUCY1B2-001	KNOWN	basic	processed_transcript	GUCY1B2	HGNC	pseudogene	OTTHUMT00000045014.3	G			51599571	-1	no_errors	ENST00000389600	ensembl	human	known	70_37	rna	SNP	0.998	A
GUCY2D	3000	genome.wustl.edu	37	17	7909952	7909952	+	Missense_Mutation	SNP	G	G	A	rs144151076		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:7909952G>A	ENST00000254854.4	+	4	1448	c.1298G>A	c.(1297-1299)cGg>cAg	p.R433Q		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	433					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GCCGGTACCCGGATGCACTTC	0.652																																																	0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	23.0	22.0	23.0		1298	3.1	0.0	17	dbSNP_134	23	0,8600		0,0,4300	no	missense	GUCY2D	NM_000180.3	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	433/1104	7909952	1,13005	2203	4300	6503	SO:0001583	missense	3000			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1298G>A	17.37:g.7909952G>A	ENSP00000254854:p.Arg433Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6LEA7	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.R433Q	ENST00000254854.4	37	c.1298	CCDS11127.1	17	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571548	0.45798	2.27E-4	0.0	ENSG00000132518	ENST00000254854	T	0.74421	-0.84	5.15	3.1	0.35709	.	0.396313	0.18689	N	0.133940	T	0.53045	0.1772	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.09377	0.004	T	0.37337	-0.9710	10	0.33141	T	0.24	.	12.818	0.57677	0.0:0.6809:0.3191:0.0	.	433	Q02846	GUC2D_HUMAN	Q	433	ENSP00000254854:R433Q	ENSP00000254854:R433Q	R	+	2	0	GUCY2D	7850677	0.000000	0.05858	0.002000	0.10522	0.022000	0.10575	1.022000	0.30052	0.536000	0.28733	-0.234000	0.12200	CGG	GUCY2D	-	NULL		0.652	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2D	HGNC	protein_coding	OTTHUMT00000226973.2	G			7909952	+1	no_errors	ENST00000254854	ensembl	human	known	70_37	missense	SNP	0.007	A
HCRTR1	3061	genome.wustl.edu	37	1	32090632	32090632	+	Missense_Mutation	SNP	G	G	A	rs201416198		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:32090632G>A	ENST00000373706.5	+	6	1153	c.1000G>A	c.(1000-1002)Gaa>Aaa	p.E334K	HCRTR1_ENST00000373705.1_Missense_Mutation_p.E334K|HCRTR1_ENST00000403528.2_Missense_Mutation_p.E334K|HCRTR1_ENST00000468521.1_3'UTR			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	334					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CAGTGACCGCGAAGCTGTCTA	0.602																																																	0													102.0	85.0	91.0					1																	32090632		2203	4300	6503	SO:0001583	missense	3061			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1000G>A	1.37:g.32090632G>A	ENSP00000362810:p.Glu334Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3A6|Q9HBV6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.E334K	ENST00000373706.5	37	c.1000	CCDS344.1	1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086357	0.55861	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.36699	1.24;1.24;1.24	4.95	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.054725	0.64402	D	0.000001	T	0.25975	0.0633	L	0.43598	1.365	0.45806	D	0.998681	B;P	0.43314	0.386;0.803	B;B	0.34722	0.103;0.188	T	0.09997	-1.0649	10	0.06494	T	0.89	.	16.4941	0.84223	0.0:0.0:1.0:0.0	.	334;334	A6NMV7;O43613	.;OX1R_HUMAN	K	334	ENSP00000384387:E334K;ENSP00000362810:E334K;ENSP00000362809:E334K	ENSP00000362809:E334K	E	+	1	0	HCRTR1	31863219	1.000000	0.71417	0.945000	0.38365	0.482000	0.33219	5.860000	0.69546	2.677000	0.91161	0.561000	0.74099	GAA	HCRTR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt		0.602	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	G	NM_001525		32090632	+1	no_errors	ENST00000373706	ensembl	human	known	70_37	missense	SNP	0.998	A
HEATR4	399671	genome.wustl.edu	37	14	73945456	73945456	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:73945456T>C	ENST00000553558.1	-	18	3257	c.2936A>G	c.(2935-2937)gAt>gGt	p.D979G	HEATR4_ENST00000334988.2_Missense_Mutation_p.D979G|HEATR4_ENST00000566478.1_5'UTR|RP1-240K6.3_ENST00000515412.2_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.D932G	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	979										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		GGTGCGTAGATCTTTGACAAG	0.483																																																	0													154.0	136.0	142.0					14																	73945456		2203	4300	6503	SO:0001583	missense	399671			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2936A>G	14.37:g.73945456T>C	ENSP00000450444:p.Asp979Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7V9|E9KL41	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.D979G	ENST00000553558.1	37	c.2936	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	T	14.72	2.621090	0.46736	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.28255	1.62	4.37	4.37	0.52481	.	0.664722	0.14036	N	0.345767	T	0.21347	0.0514	L	0.27053	0.805	0.26108	N	0.980723	P	0.42908	0.793	B	0.37601	0.254	T	0.09751	-1.0660	10	0.62326	D	0.03	-7.0542	10.299	0.43642	0.0:0.0:0.0:1.0	.	979	Q86WZ0	HEAT4_HUMAN	G	979;932	ENSP00000450444:D979G	ENSP00000335447:D932G	D	-	2	0	HEATR4	73015209	0.988000	0.35896	0.993000	0.49108	0.327000	0.28475	1.711000	0.37930	2.200000	0.70718	0.369000	0.22263	GAT	HEATR4	-	NULL		0.483	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	T	NM_203309		73945456	-1	no_errors	ENST00000334988	ensembl	human	known	70_37	missense	SNP	0.997	C
HIST1H4C	8364	genome.wustl.edu	37	6	26104486	26104486	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:26104486G>A	ENST00000377803.2	+	1	383	c.311G>A	c.(310-312)tGa>tAa	p.*104*		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	0					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						TTCGGCGGCTGAATCTAAGAA	0.483																																																	0													43.0	41.0	41.0					6																	26104486		2203	4300	6503	SO:0001819	synonymous_variant	8364			X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.311G>A	6.37:g.26104486G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.*104	ENST00000377803.2	37	c.311	CCDS4583.1	6																																																																																			HIST1H4C	-	NULL		0.483	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	HGNC	protein_coding	OTTHUMT00000040092.2	G	NM_003542		26104486	+1	no_errors	ENST00000377803	ensembl	human	known	70_37	silent	SNP	0.258	A
HIST1H1B	3009	genome.wustl.edu	37	6	27834864	27834864	+	Silent	SNP	C	C	T	rs368971921		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:27834864C>T	ENST00000331442.3	-	1	495	c.444G>A	c.(442-444)gcG>gcA	p.A148A		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	148					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)	p.A148A(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CTGCCTTTTTCGCCCCTGCAG	0.627																																																	1	Substitution - coding silent(1)	endometrium(1)											96.0	111.0	106.0					6																	27834864		2203	4299	6502	SO:0001819	synonymous_variant	3009			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.444G>A	6.37:g.27834864C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14529|Q3MJ42	Silent	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.A148	ENST00000331442.3	37	c.444	CCDS4635.1	6																																																																																			HIST1H1B	-	NULL		0.627	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	C	NM_005322		27834864	-1	no_errors	ENST00000331442	ensembl	human	known	70_37	silent	SNP	0.007	T
HLA-DQA2	3118	genome.wustl.edu	37	6	32713607	32713607	+	Missense_Mutation	SNP	C	C	T	rs144060347		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:32713607C>T	ENST00000374940.3	+	3	473	c.371C>T	c.(370-372)aCg>aTg	p.T124M		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	124	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTTCCTGTGACGCTGGGTCAG	0.507													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24198	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR	1,3021		0,1,1510	193.0	152.0	167.0		371	-6.1	0.1	6	dbSNP_134	167	0,5418		0,0,2709	no	missense	HLA-DQA2	NM_020056.4	81	0,1,4219	TT,TC,CC		0.0,0.0331,0.0118	benign	124/256	32713607	1,8439	1511	2709	4220	SO:0001583	missense	3118				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.371C>T	6.37:g.32713607C>T	ENSP00000364076:p.Thr124Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like	p.T124M	ENST00000374940.3	37	c.371	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	1.637	-0.517475	0.04171	3.31E-4	0.0	ENSG00000237541	ENST00000374940	T	0.02944	4.1	3.06	-6.13	0.02118	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	1.076460	0.07279	N	0.870376	T	0.00356	0.0011	N	0.03304	-0.355	0.19575	N	0.999965	B	0.12630	0.006	B	0.08055	0.003	T	0.47674	-0.9099	10	0.27785	T	0.31	.	1.4748	0.02424	0.1405:0.315:0.142:0.4025	.	124	P01906	DQA2_HUMAN	M	124	ENSP00000364076:T124M	ENSP00000364076:T124M	T	+	2	0	HLA-DQA2	32821585	0.016000	0.18221	0.086000	0.20670	0.026000	0.11368	-0.799000	0.04560	-0.954000	0.03640	0.174000	0.16983	ACG	HLA-DQA2	-	pfam_Ig_C1-set,pfscan_Ig-like		0.507	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	HGNC	protein_coding	OTTHUMT00000076179.2	C	NM_020056		32713607	+1	no_errors	ENST00000374940	ensembl	human	known	70_37	missense	SNP	0.664	T
HMGXB3	22993	genome.wustl.edu	37	5	149404045	149404045	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:149404045C>G	ENST00000502717.1	+	7	1726	c.1262C>G	c.(1261-1263)tCc>tGc	p.S421C	HMGXB3_ENST00000503427.1_Intron	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	667					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						GTGATCATCTCCGATGCCCAT	0.522																																																	0													85.0	89.0	88.0					5																	149404045		692	1591	2283	SO:0001583	missense	22993			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.1262C>G	5.37:g.149404045C>G	ENSP00000421917:p.Ser421Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9Y4|Q86UG3|Q9UMF4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.S421C	ENST00000502717.1	37	c.1262	CCDS54935.1	5	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637665	0.67130	.	.	ENSG00000113716	ENST00000502717	.	.	.	5.47	5.47	0.80525	.	0.073913	0.56097	D	0.000027	T	0.77184	0.4093	L	0.56769	1.78	0.51482	D	0.999924	D	0.89917	1.0	D	0.83275	0.996	T	0.75167	-0.3413	8	.	.	.	-8.5379	19.3674	0.94469	0.0:1.0:0.0:0.0	.	667	Q12766	HMGX3_HUMAN	C	421	.	.	S	+	2	0	HMGXB3	149384238	0.999000	0.42202	1.000000	0.80357	0.540000	0.34992	5.060000	0.64312	2.567000	0.86603	0.650000	0.86243	TCC	HMGXB3	-	NULL		0.522	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	C	XM_001717202		149404045	+1	no_errors	ENST00000502717	ensembl	human	known	70_37	missense	SNP	1.000	G
HOXB7	3217	genome.wustl.edu	37	17	46687942	46687942	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:46687942C>T	ENST00000239165.7	-	1	437	c.339G>A	c.(337-339)caG>caA	p.Q113Q	HOXB7_ENST00000567101.2_Intron	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	113					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						CCGAGTCCCTCTGCTCCTTGG	0.667																																																	0													8.0	8.0	8.0					17																	46687942		2121	4156	6277	SO:0001819	synonymous_variant	3217				CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.339G>A	17.37:g.46687942C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3N8|Q15957|Q53FN3|Q96BQ6	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.Q113	ENST00000239165.7	37	c.339	CCDS11532.1	17																																																																																			HOXB7	-	NULL		0.667	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB7	HGNC	protein_coding	OTTHUMT00000358097.3	C			46687942	-1	no_errors	ENST00000239165	ensembl	human	known	70_37	silent	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	70969968	70969968	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:70969968C>T	ENST00000393567.2	-	45	7195	c.7045G>A	c.(7045-7047)Gag>Aag	p.E2349K		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2349					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CGCTCCAGCTCCTGCTGTAGC	0.517																																																	0													4.0	4.0	4.0					16																	70969968		1546	3387	4933	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.7045G>A	16.37:g.70969968C>T	ENSP00000377197:p.Glu2349Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.E2348K	ENST00000393567.2	37	c.7042	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.158057	0.94686	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01051	5.4	5.49	5.49	0.81192	.	0.000000	0.32884	U	0.005528	T	0.03520	0.0101	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.72144	-0.4379	10	0.14656	T	0.56	.	18.9626	0.92682	0.0:1.0:0.0:0.0	.	2348	F8WD23	.	K	2349;2348	ENSP00000377197:E2349K	ENSP00000313052:E2348K	E	-	1	0	HYDIN	69527469	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.453000	0.66645	2.586000	0.87340	0.609000	0.83330	GAG	HYDIN	-	NULL		0.517	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	C			70969968	-1	no_errors	ENST00000316490	ensembl	human	known	70_37	missense	SNP	1.000	T
IFI35	3430	genome.wustl.edu	37	17	41165087	41165087	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:41165087C>T	ENST00000415816.2	+	3	367	c.144C>T	c.(142-144)atC>atT	p.I48I	IFI35_ENST00000438323.2_Silent_p.I48I	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	48					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.I48M(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		TGCCCAAGATCCCCCTGGTAT	0.557																																																	1	Substitution - Missense(1)	large_intestine(1)											143.0	142.0	142.0					17																	41165087		2203	4300	6503	SO:0001819	synonymous_variant	3430			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.144C>T	17.37:g.41165087C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JGX1|Q92984|Q99537|Q9BV98	Silent	SNP	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.I48	ENST00000415816.2	37	c.144		17																																																																																			IFI35	-	pfam_Interferon_induced_35kDa_N		0.557	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	HGNC	protein_coding	OTTHUMT00000395851.1	C	NM_005533		41165087	+1	no_errors	ENST00000438323	ensembl	human	known	70_37	silent	SNP	0.001	T
IFI35	3430	genome.wustl.edu	37	17	41165321	41165321	+	Missense_Mutation	SNP	C	C	G	rs369524898		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:41165321C>G	ENST00000415816.2	+	4	529	c.306C>G	c.(304-306)atC>atG	p.I102M	IFI35_ENST00000438323.2_Missense_Mutation_p.I102M	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	102					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		AGCACACGATCAACATGGAGG	0.612																																																	0													55.0	55.0	55.0					17																	41165321		2203	4300	6503	SO:0001583	missense	3430			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.306C>G	17.37:g.41165321C>G	ENSP00000394579:p.Ile102Met	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JGX1|Q92984|Q99537|Q9BV98	Missense_Mutation	SNP	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.I102M	ENST00000415816.2	37	c.306		17	.	.	.	.	.	.	.	.	.	.	C	13.90	2.373957	0.42105	.	.	ENSG00000068079	ENST00000415816;ENST00000438323	T;T	0.52057	0.68;0.68	5.08	-3.99	0.04069	Nmi/IFP 35 (1);	0.387436	0.28021	N	0.016919	T	0.50017	0.1591	L	0.60455	1.87	0.09310	N	1	D	0.62365	0.991	P	0.60012	0.867	T	0.48917	-0.8992	10	0.87932	D	0	.	5.6387	0.17552	0.1273:0.3766:0.0:0.4961	.	102	P80217	IN35_HUMAN	M	102	ENSP00000394579:I102M;ENSP00000395590:I102M	ENSP00000394579:I102M	I	+	3	3	IFI35	38418847	0.007000	0.16637	0.000000	0.03702	0.623000	0.37688	-0.034000	0.12225	-0.918000	0.03808	-0.367000	0.07326	ATC	IFI35	-	pfam_Nmi/IFP35		0.612	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	HGNC	protein_coding	OTTHUMT00000395851.1	C	NM_005533		41165321	+1	no_errors	ENST00000438323	ensembl	human	known	70_37	missense	SNP	0.000	G
IGSF9B	22997	genome.wustl.edu	37	11	133816074	133816074	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:133816074G>A	ENST00000321016.8	-	2	374	c.144C>T	c.(142-144)atC>atT	p.I48I	IGSF9B_ENST00000533871.2_Silent_p.I48I			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	48	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TCACTGGGTGGATCACGTCGC	0.632																																																	0													50.0	57.0	54.0					11																	133816074		2145	4233	6378	SO:0001819	synonymous_variant	22997			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.144C>T	11.37:g.133816074G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	G5EA26	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I48	ENST00000321016.8	37	c.144		11																																																																																			IGSF9B	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.632	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		G	XM_290502		133816074	-1	no_errors	ENST00000321016	ensembl	human	known	70_37	silent	SNP	1.000	A
INPP1	3628	genome.wustl.edu	37	2	191235744	191235744	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:191235744C>G	ENST00000322522.4	+	6	1272	c.816C>G	c.(814-816)atC>atG	p.I272M	INPP1_ENST00000541441.1_Missense_Mutation_p.I272M|INPP1_ENST00000392329.2_Missense_Mutation_p.I272M	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	272					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			AGGAGACTATCAAAGCTGCAT	0.483																																					Melanoma(130;184 1743 2185 19805 38428)												0													140.0	136.0	138.0					2																	191235744		2203	4300	6503	SO:0001583	missense	3628				CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.816C>G	2.37:g.191235744C>G	ENSP00000325423:p.Ile272Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Inositol_monophosphatase	p.I272M	ENST00000322522.4	37	c.816	CCDS2305.1	2	.	.	.	.	.	.	.	.	.	.	C	16.86	3.238179	0.58886	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441	T;T;T	0.32753	1.44;1.44;1.44	5.34	4.46	0.54185	.	0.113763	0.64402	D	0.000009	T	0.49813	0.1579	M	0.81942	2.565	0.46260	D	0.998951	P	0.44044	0.825	P	0.52309	0.695	T	0.56655	-0.7943	10	0.66056	D	0.02	-21.9972	13.9478	0.64096	0.0:0.847:0.153:0.0	.	272	P49441	INPP_HUMAN	M	272	ENSP00000376142:I272M;ENSP00000325423:I272M;ENSP00000440650:I272M	ENSP00000325423:I272M	I	+	3	3	INPP1	190943989	1.000000	0.71417	0.913000	0.36048	0.705000	0.40729	0.876000	0.28092	1.485000	0.48380	0.449000	0.29647	ATC	INPP1	-	pfam_Inositol_monophosphatase		0.483	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP1	HGNC	protein_coding	OTTHUMT00000255932.2	C			191235744	+1	no_errors	ENST00000322522	ensembl	human	known	70_37	missense	SNP	1.000	G
INSM1	3642	genome.wustl.edu	37	20	20350277	20350277	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:20350277C>G	ENST00000310227.1	+	1	1513	c.1366C>G	c.(1366-1368)Cag>Gag	p.Q456E		NM_002196.2	NP_002187.1	Q01101	INSM1_HUMAN	insulinoma-associated 1	456					adrenal chromaffin cell differentiation (GO:0061104)|cell cycle (GO:0007049)|endocrine pancreas development (GO:0031018)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|noradrenergic neuron development (GO:0003358)|norepinephrine biosynthetic process (GO:0042421)|pancreatic A cell differentiation (GO:0003310)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of gene expression (GO:0010468)|regulation of protein complex assembly (GO:0043254)|sympathetic ganglion development (GO:0061549)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell differentiation (GO:0003309)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|cyclin binding (GO:0030332)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			liver(1)|lung(3)|ovary(1)|prostate(1)	6				READ - Rectum adenocarcinoma(2;0.0649)		CAAGGGCGCTCAGGAGCGCCA	0.716																																																	0													18.0	21.0	20.0					20																	20350277		2182	4279	6461	SO:0001583	missense	3642				CCDS13143.1	20p11.2	2012-07-10			ENSG00000173404	ENSG00000173404			6090	protein-coding gene	gene with protein product		600010				8188699, 16569215	Standard	NM_002196		Approved	IA-1, IA1	uc002wrx.3	Q01101	OTTHUMG00000032004	ENST00000310227.1:c.1366C>G	20.37:g.20350277C>G	ENSP00000312631:p.Gln456Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q456E	ENST00000310227.1	37	c.1366	CCDS13143.1	20	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573412	0.65765	.	.	ENSG00000173404	ENST00000310227	T	0.27720	1.65	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.64402	U	0.000002	T	0.48241	0.1489	M	0.62723	1.935	0.35210	D	0.775054	D	0.58620	0.983	P	0.57620	0.824	T	0.60929	-0.7165	10	0.62326	D	0.03	-17.0604	15.5543	0.76180	0.1384:0.8616:0.0:0.0	.	456	Q01101	INSM1_HUMAN	E	456	ENSP00000312631:Q456E	ENSP00000312631:Q456E	Q	+	1	0	INSM1	20298277	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.578000	0.60929	2.522000	0.85027	0.650000	0.86243	CAG	INSM1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.716	INSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSM1	HGNC	protein_coding	OTTHUMT00000078223.1	C	NM_002196		20350277	+1	no_errors	ENST00000310227	ensembl	human	known	70_37	missense	SNP	1.000	G
L3HYPDH	112849	genome.wustl.edu	37	14	59953442	59953442	+	5'Flank	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:59953442C>G	ENST00000247194.4	-	0	0				JKAMP_ENST00000556985.1_Missense_Mutation_p.Q6E|JKAMP_ENST00000425728.2_Intron|JKAMP_ENST00000356057.5_Intron|JKAMP_ENST00000557560.1_3'UTR|JKAMP_ENST00000554271.1_Missense_Mutation_p.Q20E|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_Missense_Mutation_p.Q6E	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)						metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	TGTCGATATTCAACCAGCATG	0.318																																																	0													89.0	83.0	85.0					14																	59953442		1792	4066	5858	SO:0001631	upstream_gene_variant	51528			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941		14.37:g.59953442C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LJ5	Missense_Mutation	SNP	pfam_DUF766	p.Q6E	ENST00000247194.4	37	c.16	CCDS9739.1	14	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014754	0.35511	.	.	ENSG00000050130	ENST00000261247;ENST00000556985;ENST00000554271	.	.	.	5.1	5.1	0.69264	.	0.752607	0.13514	N	0.382248	T	0.45776	0.1359	N	0.17474	0.49	0.80722	D	1	B;B	0.23806	0.091;0.051	B;B	0.17098	0.017;0.017	T	0.32268	-0.9913	9	0.38643	T	0.18	.	18.4684	0.90763	0.0:1.0:0.0:0.0	.	20;6	G3V2M4;Q9P055-4	.;.	E	6;6;20	.	ENSP00000261247:Q6E	Q	+	1	0	JKAMP	59023195	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.446000	0.44908	2.541000	0.85698	0.655000	0.94253	CAA	JKAMP	-	NULL		0.318	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	JKAMP	HGNC	protein_coding	OTTHUMT00000072254.5	C	NM_144581		59953442	+1	no_errors	ENST00000555491	ensembl	human	known	70_37	missense	SNP	1.000	G
JUND	3727	genome.wustl.edu	37	19	18391439	18391439	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:18391439G>A	ENST00000252818.3	-	1	993	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	MIR3188_ENST00000583494.1_RNA	NM_005354.4	NP_005345.3	P17535	JUND_HUMAN	jun D proto-oncogene	286	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|circadian rhythm (GO:0007623)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|nucleus (GO:0005634)|protein complex (GO:0043234)	double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			lung(2)|prostate(1)	3						TTGCGCTTGCGGCACTTGGAG	0.667																																																	0													21.0	21.0	21.0					19																	18391439		2190	4278	6468	SO:0001583	missense	3727				CCDS32959.1	19p13.2	2013-01-10				ENSG00000130522		"""basic leucine zipper proteins"""	6206	protein-coding gene	gene with protein product	"""transcription factor jun-D"", ""JunD-FL isoform"", ""activator protein 1"""	165162				2112242, 1903194	Standard	NM_005354		Approved	AP-1	uc002nip.2	P17535		ENST00000252818.3:c.856C>T	19.37:g.18391439G>A	ENSP00000252818:p.Arg286Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EK9	Missense_Mutation	SNP	pfam_JNK,pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.R286C	ENST00000252818.3	37	c.856	CCDS32959.1	19	.	.	.	.	.	.	.	.	.	.	.	19.80	3.894250	0.72639	.	.	ENSG00000130522	ENST00000252818	D	0.94280	-3.39	3.16	2.08	0.27032	Basic-leucine zipper (bZIP) transcription factor (3);Eukaryotic transcription factor, Skn-1-like, DNA-binding (2);bZIP transcription factor, bZIP-1 (1);	0.068487	0.56097	U	0.000025	D	0.96969	0.9010	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.64144	0.922	D	0.95718	0.8764	10	0.87932	D	0	.	7.8929	0.29688	0.0:0.0:0.5529:0.447	.	286	P17535	JUND_HUMAN	C	286	ENSP00000252818:R286C	ENSP00000252818:R286C	R	-	1	0	JUND	18252439	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.619000	0.61218	0.655000	0.30866	0.450000	0.29827	CGC	JUND	-	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun		0.667	JUND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUND	HGNC	protein_coding	OTTHUMT00000466318.2	G	NM_005354		18391439	-1	no_errors	ENST00000252818	ensembl	human	known	70_37	missense	SNP	1.000	A
KANK1	23189	genome.wustl.edu	37	9	745203	745203	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:745203C>G	ENST00000382303.1	+	16	4679	c.4027C>G	c.(4027-4029)Cct>Gct	p.P1343A	KANK1_ENST00000382297.2_Missense_Mutation_p.P1343A|KANK1_ENST00000382293.3_Missense_Mutation_p.P1185A|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1343					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GAAGACGTCTCCTGGCCCCAC	0.478																																																	0													203.0	217.0	212.0					9																	745203		2203	4300	6503	SO:0001583	missense	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.4027C>G	9.37:g.745203C>G	ENSP00000371740:p.Pro1343Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P1343A	ENST00000382303.1	37	c.4027	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911039	0.92178	.	.	ENSG00000107104	ENST00000382303;ENST00000397976;ENST00000382297;ENST00000382293;ENST00000382289	T;T;T	0.39406	1.08;1.08;1.12	5.9	5.9	0.94986	.	0.000000	0.56097	D	0.000031	T	0.63510	0.2517	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.62604	-0.6819	10	0.72032	D	0.01	-22.856	20.2799	0.98512	0.0:1.0:0.0:0.0	.	389;1343	F5H7I5;Q14678	.;KANK1_HUMAN	A	1343;389;1343;1185;321	ENSP00000371740:P1343A;ENSP00000371734:P1343A;ENSP00000371730:P1185A	ENSP00000371726:P321A	P	+	1	0	KANK1	735203	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	7.154000	0.77437	2.800000	0.96347	0.643000	0.83706	CCT	KANK1	-	NULL		0.478	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	C	NM_015158		745203	+1	no_errors	ENST00000382297	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNQ3	3786	genome.wustl.edu	37	8	133142219	133142219	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:133142219C>T	ENST00000388996.4	-	15	2329	c.1909G>A	c.(1909-1911)Gac>Aac	p.D637N	KCNQ3_ENST00000521134.1_Missense_Mutation_p.D517N|KCNQ3_ENST00000519445.1_Missense_Mutation_p.D625N	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	637					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACGAGGAAGTCCAGCTTCTTC	0.512																																																	0													68.0	63.0	64.0					8																	133142219		2203	4300	6503	SO:0001583	missense	3786			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1909G>A	8.37:g.133142219C>T	ENSP00000373648:p.Asp637Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.D637N	ENST00000388996.4	37	c.1909	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757470	0.89843	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99714	-6.5;-6.5;-6.5	5.73	5.73	0.89815	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.048944	0.85682	D	0.000000	D	0.99560	0.9842	L	0.54908	1.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98635	1.0673	10	0.62326	D	0.03	-25.2433	18.8866	0.92381	0.0:1.0:0.0:0.0	.	625;637	E7ET42;O43525	.;KCNQ3_HUMAN	N	637;517;625;614;516	ENSP00000373648:D637N;ENSP00000429799:D517N;ENSP00000428790:D625N	ENSP00000373648:D637N	D	-	1	0	KCNQ3	133211401	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.294000	0.78760	2.712000	0.92718	0.555000	0.69702	GAC	KCNQ3	-	pfam_K_chnl_volt-dep_KCNQ_C		0.512	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	C	NM_004519		133142219	-1	no_errors	ENST00000388996	ensembl	human	known	70_37	missense	SNP	1.000	T
KCTD2	23510	genome.wustl.edu	37	17	73045417	73045417	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:73045417G>A	ENST00000322444.6	+	2	448	c.442G>A	c.(442-444)Gaa>Aaa	p.E148K	ATP5H_ENST00000344546.4_5'Flank|ATP5H_ENST00000301587.4_5'Flank|KCTD2_ENST00000584767.1_3'UTR|KCTD2_ENST00000581589.1_5'UTR	NM_015353.1	NP_056168.1	Q14681	KCTD2_HUMAN	potassium channel tetramerization domain containing 2	148	BTB.				protein homooligomerization (GO:0051260)		protein complex binding (GO:0032403)			kidney(1)|lung(2)	3	all_lung(278;0.226)					GGAGTTGGCAGAAGAAGGTAA	0.423																																																	0													90.0	71.0	77.0					17																	73045417		2203	4300	6503	SO:0001583	missense	23510			BC033329	CCDS32728.1	17q25.2	2013-06-20	2013-06-20			ENSG00000180901			21294	protein-coding gene	gene with protein product		613422	"""potassium channel tetramerisation domain containing 2"""			12620391	Standard	XR_248405		Approved	KIAA0176	uc002jmp.3	Q14681		ENST00000322444.6:c.442G>A	17.37:g.73045417G>A	ENSP00000312814:p.Glu148Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.E148K	ENST00000322444.6	37	c.442	CCDS32728.1	17	.	.	.	.	.	.	.	.	.	.	G	28.5	4.927842	0.92389	.	.	ENSG00000180901	ENST00000322444;ENST00000375286	T	0.47528	0.84	4.86	4.86	0.63082	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.62600	0.2441	M	0.79805	2.47	0.80722	D	1	P	0.44429	0.835	P	0.49477	0.612	T	0.67864	-0.5560	10	0.54805	T	0.06	-8.4429	17.7578	0.88455	0.0:0.0:1.0:0.0	.	148	Q14681	KCTD2_HUMAN	K	148;130	ENSP00000312814:E148K	ENSP00000312814:E148K	E	+	1	0	KCTD2	70557012	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.317000	0.96327	2.521000	0.84997	0.655000	0.94253	GAA	KCTD2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.423	KCTD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD2	HGNC	protein_coding	OTTHUMT00000445538.1	G			73045417	+1	no_errors	ENST00000322444	ensembl	human	known	70_37	missense	SNP	1.000	A
KCTD20	222658	genome.wustl.edu	37	6	36452603	36452604	+	Splice_Site	INS	-	-	A	rs11450552|rs528951573|rs201092661		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:36452603_36452604insA	ENST00000373731.2	+	7	1358		c.e7+2		KCTD20_ENST00000536244.1_Splice_Site|KCTD20_ENST00000449081.2_Splice_Site|KCTD20_ENST00000474988.1_Splice_Site|KCTD20_ENST00000544295.1_Splice_Site	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20						protein homooligomerization (GO:0051260)			p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						GAATTGAAGGTAAAAAAAAAAA	0.376																																																	1	Unknown(1)	lung(1)																																								SO:0001630	splice_region_variant	222658			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.967+2->A	6.37:g.36452614_36452614dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Splice_Site	INS	-	e6+2	ENST00000373731.2	37	c.967+2_967+1	CCDS4821.1	6																																																																																			KCTD20	-	-		0.376	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD20	HGNC	protein_coding	OTTHUMT00000040345.2	-	NM_173562	Intron	36452604	+1	no_errors	ENST00000373731	ensembl	human	known	70_37	splice_site_ins	INS	1.000:0.447	A
KDM3A	55818	genome.wustl.edu	37	2	86669240	86669240	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:86669240G>A	ENST00000409556.1	+	3	435	c.70G>A	c.(70-72)Gac>Aac	p.D24N	KDM3A_ENST00000409064.1_Missense_Mutation_p.D24N|KDM3A_ENST00000312912.5_Missense_Mutation_p.D24N|KDM3A_ENST00000542128.1_Missense_Mutation_p.D24N			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	24				D -> G (in Ref. 2; CAH18459/CAH18373). {ECO:0000305}.	androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GTCCGCAGCCGACGGCAGCGA	0.642																																					NSCLC(96;1150 1523 6936 46253 49736)												0													70.0	71.0	71.0					2																	86669240		2203	4300	6503	SO:0001583	missense	55818			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.70G>A	2.37:g.86669240G>A	ENSP00000386660:p.Asp24Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.D24N	ENST00000409556.1	37	c.70	CCDS1990.1	2	.	.	.	.	.	.	.	.	.	.	G	11.54	1.668501	0.29604	.	.	ENSG00000115548	ENST00000452034;ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000427678;ENST00000542128	T;T;T;T	0.61859	0.21;0.21;0.21;0.07	3.63	2.54	0.30619	.	0.669153	0.13056	N	0.417264	T	0.39172	0.1068	L	0.36672	1.1	0.31310	N	0.687275	P;B	0.34546	0.456;0.327	B;B	0.26864	0.074;0.022	T	0.50415	-0.8831	10	0.62326	D	0.03	.	3.8148	0.08811	0.1862:0.0:0.5797:0.2341	.	24;24	F5H070;Q9Y4C1	.;KDM3A_HUMAN	N	24	ENSP00000386660:D24N;ENSP00000323659:D24N;ENSP00000386516:D24N;ENSP00000438324:D24N	ENSP00000323659:D24N	D	+	1	0	KDM3A	86522751	0.992000	0.36948	0.985000	0.45067	0.464000	0.32679	2.669000	0.46825	1.573000	0.49748	0.462000	0.41574	GAC	KDM3A	-	NULL		0.642	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	G	NM_018433		86669240	+1	no_errors	ENST00000312912	ensembl	human	known	70_37	missense	SNP	0.911	A
KIAA0100	9703	genome.wustl.edu	37	17	26955504	26955504	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:26955504C>T	ENST00000528896.2	-	24	4447	c.4373G>A	c.(4372-4374)tGg>tAg	p.W1458*	KIAA0100_ENST00000544884.1_Nonsense_Mutation_p.W1315*|KIAA0100_ENST00000389003.3_Nonsense_Mutation_p.W1315*	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1458						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGTAGTTGTCCAGGAAATCCG	0.453																																																	0													152.0	137.0	142.0					17																	26955504		2203	4300	6503	SO:0001587	stop_gained	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.4373G>A	17.37:g.26955504C>T	ENSP00000436773:p.Trp1458*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Nonsense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.W1458*	ENST00000528896.2	37	c.4373	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	C	46	12.466418	0.99670	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	.	.	.	5.47	5.47	0.80525	.	0.057962	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3285	0.94273	0.0:1.0:0.0:0.0	.	.	.	.	X	1458;1428;1458;1315	.	ENSP00000005905:W1458X	W	-	2	0	KIAA0100	23979631	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.155000	0.77445	2.575000	0.86900	0.655000	0.94253	TGG	KIAA0100	-	NULL		0.453	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	C	NM_014680		26955504	-1	no_errors	ENST00000005905	ensembl	human	known	70_37	nonsense	SNP	1.000	T
KIAA0754	643314	genome.wustl.edu	37	1	39877564	39877564	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:39877564C>T	ENST00000530275.1	+	1	1414	c.1219C>T	c.(1219-1221)Ctg>Ttg	p.L407L	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000372915.3_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	407										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTTAATACCCTGGATTCTTC	0.408																																																	0													96.0	94.0	94.0					1																	39877564		1876	4115	5991	SO:0001819	synonymous_variant	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1219C>T	1.37:g.39877564C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PMC2|Q6ZSB2	Silent	SNP	NULL	p.L407	ENST00000530275.1	37	c.1219		1																																																																																			KIAA0754	-	NULL		0.408	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	C	NM_015038		39877564	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	silent	SNP	1.000	T
KIAA1549L	25758	genome.wustl.edu	37	11	33564473	33564473	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:33564473A>G	ENST00000321505.4	+	1	653	c.473A>G	c.(472-474)gAg>gGg	p.E158G	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.E158G|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.E158G			Q6ZVL6	K154L_HUMAN	KIAA1549-like	158						integral component of membrane (GO:0016021)											GCAGCTCCAGAGAATTCCAGA	0.537											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													91.0	88.0	89.0					11																	33564473		1896	4107	6003	SO:0001583	missense	25758			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.473A>G	11.37:g.33564473A>G	ENSP00000315295:p.Glu158Gly	Somatic	841	WXS	Illumina HiSeq	Phase_IV	B0QYU0	Missense_Mutation	SNP	NULL	p.E158G	ENST00000321505.4	37	c.473	CCDS44565.2	11	.	.	.	.	.	.	.	.	.	.	A	19.99	3.929363	0.73327	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654	.	.	.	5.53	1.72	0.24424	.	.	.	.	.	T	0.19644	0.0472	N	0.19112	0.55	0.22457	N	0.999089	B;B	0.28178	0.014;0.202	B;B	0.28991	0.011;0.097	T	0.21484	-1.0244	8	0.30078	T	0.28	-5.0267	2.7839	0.05368	0.6237:0.1519:0.0789:0.1455	.	158;158	E9PAT2;Q6ZVL6-2	.;.	G	158	.	ENSP00000265654:E158G	E	+	2	0	C11orf41	33521049	0.993000	0.37304	0.754000	0.31244	0.981000	0.71138	1.108000	0.31123	0.382000	0.24878	0.459000	0.35465	GAG	KIAA1549L	-	NULL		0.537	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	A	NM_012194		33564473	+1	no_errors	ENST00000389726	ensembl	human	known	70_37	missense	SNP	0.839	G
KIAA1875	340390	genome.wustl.edu	37	8	145163767	145163767	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:145163767C>T	ENST00000323662.8	+	3	823	c.798C>T	c.(796-798)ttC>ttT	p.F266F				A6NE52	K1875_HUMAN	KIAA1875	266										large_intestine(1)	1						TGCGCTGCTTCGCGGCCTATG	0.662																																																	0																																										SO:0001819	synonymous_variant	340390			AB058778		8q24.3	2013-01-10			ENSG00000179698	ENSG00000179698		"""WD repeat domain containing"""	26959	protein-coding gene	gene with protein product						11347906	Standard	NR_024207		Approved		uc011lky.1	A6NE52	OTTHUMG00000165245	ENST00000323662.8:c.798C>T	8.37:g.145163767C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96JF2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F266	ENST00000323662.8	37	c.798		8																																																																																			KIAA1875	-	superfamily_WD40_repeat_dom		0.662	KIAA1875-007	PUTATIVE	basic|appris_principal	protein_coding	KIAA1875	HGNC	protein_coding	OTTHUMT00000382917.1	C	NM_032529		145163767	+1	no_errors	ENST00000534167	ensembl	human	known	70_37	silent	SNP	0.005	T
KLHL8	57563	genome.wustl.edu	37	4	88084771	88084771	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:88084771G>A	ENST00000273963.5	-	10	2104	c.1763C>T	c.(1762-1764)tCt>tTt	p.S588F	KLHL8_ENST00000512111.1_Missense_Mutation_p.S588F|KLHL8_ENST00000498875.2_Missense_Mutation_p.S512F|KLHL8_ENST00000545252.1_Missense_Mutation_p.S237F|KLHL8_ENST00000425278.2_Missense_Mutation_p.S405F	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	588					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TCTGCAGTGAGACACAGATCC	0.398																																																	0													107.0	98.0	101.0					4																	88084771		2203	4300	6503	SO:0001583	missense	57563			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1763C>T	4.37:g.88084771G>A	ENSP00000273963:p.Ser588Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XA3|Q6N018	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S588F	ENST00000273963.5	37	c.1763	CCDS3617.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.227918	0.95173	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	T;T;T;T;T	0.74106	-0.81;-0.19;-0.19;-0.24;-0.81	5.86	5.86	0.93980	Galactose oxidase, beta-propeller (1);	0.055132	0.85682	D	0.000000	T	0.78742	0.4331	L	0.52573	1.65	0.80722	D	1	D;P;P	0.54397	0.966;0.927;0.831	P;P;P	0.55161	0.77;0.77;0.76	T	0.72606	-0.4242	10	0.17369	T	0.5	.	18.3586	0.90367	0.0:0.0:1.0:0.0	.	405;512;588	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	F	588;512;405;237;588	ENSP00000273963:S588F;ENSP00000426451:S512F;ENSP00000408854:S405F;ENSP00000439514:S237F;ENSP00000424131:S588F	ENSP00000273963:S588F	S	-	2	0	KLHL8	88303795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.429000	0.97481	2.778000	0.95560	0.591000	0.81541	TCT	KLHL8	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.398	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL8	HGNC	protein_coding	OTTHUMT00000253040.1	G			88084771	-1	no_errors	ENST00000273963	ensembl	human	known	70_37	missense	SNP	1.000	A
KRT2	3849	genome.wustl.edu	37	12	53045652	53045652	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:53045652C>T	ENST00000309680.3	-	1	296	c.275G>A	c.(274-276)aGa>aAa	p.R92K		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	92	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		accacctcctctgccaccaaa	0.617																																																	0													53.0	35.0	41.0					12																	53045652		2200	4298	6498	SO:0001583	missense	3849				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.275G>A	12.37:g.53045652C>T	ENSP00000310861:p.Arg92Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VAQ2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.R92K	ENST00000309680.3	37	c.275	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265586	0.59431	.	.	ENSG00000172867	ENST00000309680	D	0.86865	-2.18	3.74	3.74	0.42951	.	.	.	.	.	D	0.84848	0.5563	M	0.65498	2.005	0.28857	N	0.895745	B	0.29766	0.256	B	0.21917	0.037	T	0.79981	-0.1574	9	0.44086	T	0.13	.	13.8384	0.63424	0.0:1.0:0.0:0.0	.	92	P35908	K22E_HUMAN	K	92	ENSP00000310861:R92K	ENSP00000310861:R92K	R	-	2	0	KRT2	51331919	0.324000	0.24652	0.999000	0.59377	0.981000	0.71138	2.658000	0.46733	2.390000	0.81377	0.561000	0.74099	AGA	KRT2	-	NULL		0.617	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	HGNC	protein_coding	OTTHUMT00000405704.1	C	NM_000423		53045652	-1	no_errors	ENST00000309680	ensembl	human	known	70_37	missense	SNP	1.000	T
KRTAP19-8	728299	genome.wustl.edu	37	21	32410600	32410600	+	Missense_Mutation	SNP	C	C	T	rs200348786		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr21:32410600C>T	ENST00000382822.2	-	1	195	c.163G>A	c.(163-165)Gga>Aga	p.G55R		NM_001099219.1	NP_001092689.1	Q3LI54	KR198_HUMAN	keratin associated protein 19-8	55						intermediate filament (GO:0005882)				endometrium(2)|upper_aerodigestive_tract(1)	3						CCATATCCTCCGTAGTATAAT	0.483																																																	0								C	ARG/GLY	1,4397	2.1+/-5.4	0,1,2198	90.0	109.0	103.0		163	3.4	0.0	21		103	2,8594	2.2+/-6.3	0,2,4296	yes	missense	KRTAP19-8	NM_001099219.1	125	0,3,6494	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	55/64	32410600	3,12991	2199	4298	6497	SO:0001583	missense	728299			AB096964	CCDS42917.1	21q22.11	2007-11-23			ENSG00000206102	ENSG00000206102		"""Keratin associated proteins"""	33898	protein-coding gene	gene with protein product							Standard	NM_001099219		Approved		uc010glt.3	Q3LI54	OTTHUMG00000057787	ENST00000382822.2:c.163G>A	21.37:g.32410600C>T	ENSP00000372272:p.Gly55Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_KRTAP	p.G55R	ENST00000382822.2	37	c.163	CCDS42917.1	21	.	.	.	.	.	.	.	.	.	.	C	8.147	0.786430	0.16189	2.27E-4	2.33E-4	ENSG00000206102	ENST00000382822	T	0.11277	2.79	4.31	3.41	0.39046	.	0.480462	0.14821	N	0.296474	T	0.19725	0.0474	.	.	.	0.09310	N	1	D	0.57899	0.981	P	0.54460	0.753	T	0.04885	-1.0920	9	0.87932	D	0	.	8.1256	0.30997	0.0:0.8883:0.0:0.1117	.	55	Q3LI54	KR198_HUMAN	R	55	ENSP00000372272:G55R	ENSP00000372272:G55R	G	-	1	0	KRTAP19-8	31332471	0.005000	0.15991	0.028000	0.17463	0.010000	0.07245	0.208000	0.17415	1.152000	0.42452	0.505000	0.49811	GGA	KRTAP19-8	-	pfam_KRTAP		0.483	KRTAP19-8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	KRTAP19-8	HGNC	protein_coding	OTTHUMT00000128239.3	C	NM_001099219		32410600	-1	no_errors	ENST00000382822	ensembl	human	known	70_37	missense	SNP	0.061	T
LAMP2	3920	genome.wustl.edu	37	X	119581704	119581704	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:119581704G>A	ENST00000200639.4	-	5	869	c.733C>T	c.(733-735)Cag>Tag	p.Q245*	LAMP2_ENST00000434600.2_Nonsense_Mutation_p.Q245*|LAMP2_ENST00000371335.4_Nonsense_Mutation_p.Q245*|LAMP2_ENST00000538785.1_Nonsense_Mutation_p.Q134*|LAMP2_ENST00000540603.1_Nonsense_Mutation_p.Q198*			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	245	Second lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						ACCTTATCCTGAGTGATGTTC	0.403																																																	0													205.0	169.0	181.0					X																	119581704		2203	4300	6503	SO:0001587	stop_gained	3920			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.733C>T	X.37:g.119581704G>A	ENSP00000200639:p.Gln245*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Nonsense_Mutation	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.Q245*	ENST00000200639.4	37	c.733	CCDS14599.1	X	.	.	.	.	.	.	.	.	.	.	g	37	6.198455	0.97367	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	.	.	.	5.92	2.85	0.33270	.	1.148760	0.06230	N	0.688518	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	0.8324	5.98	0.19401	0.0773:0.2273:0.5683:0.1272	.	.	.	.	X	245;134;245;245;198	.	ENSP00000200639:Q245X	Q	-	1	0	LAMP2	119465732	1.000000	0.71417	0.855000	0.33649	0.991000	0.79684	1.756000	0.38390	0.611000	0.30052	0.597000	0.82753	CAG	LAMP2	-	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop		0.403	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	HGNC	protein_coding	OTTHUMT00000058099.1	G			119581704	-1	no_errors	ENST00000434600	ensembl	human	known	70_37	nonsense	SNP	0.293	A
LCMT2	9836	genome.wustl.edu	37	15	43620819	43620819	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr15:43620819C>G	ENST00000305641.5	-	1	1984	c.1869G>C	c.(1867-1869)ttG>ttC	p.L623F	LCMT2_ENST00000544735.1_Missense_Mutation_p.L202F|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_3'UTR|ADAL_ENST00000389651.4_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	623					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	ACTCAGAGCTCAATCCTGTAG	0.448																																																	0													113.0	107.0	109.0					15																	43620819		2201	4299	6500	SO:0001583	missense	9836			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.1869G>C	15.37:g.43620819C>G	ENSP00000307214:p.Leu623Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.L623F	ENST00000305641.5	37	c.1869	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	C	6.459	0.452864	0.12283	.	.	ENSG00000168806	ENST00000305641;ENST00000544735	T;T	0.66815	-0.23;-0.23	5.7	2.61	0.31194	Kelch-type beta propeller (1);	0.380247	0.23055	N	0.052445	T	0.46229	0.1382	L	0.27053	0.805	0.30351	N	0.784801	B	0.06786	0.001	B	0.04013	0.001	T	0.35176	-0.9799	10	0.10111	T	0.7	-12.8901	8.4846	0.33063	0.0:0.4907:0.426:0.0833	.	623	O60294	LCMT2_HUMAN	F	623;202	ENSP00000307214:L623F;ENSP00000442022:L202F	ENSP00000307214:L623F	L	-	3	2	LCMT2	41408111	0.906000	0.30813	0.999000	0.59377	0.980000	0.70556	1.154000	0.31688	0.755000	0.32990	-0.136000	0.14681	TTG	LCMT2	-	NULL		0.448	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	C	NM_014793		43620819	-1	no_errors	ENST00000305641	ensembl	human	known	70_37	missense	SNP	0.992	G
LDB2	9079	genome.wustl.edu	37	4	16504717	16504717	+	Intron	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:16504717G>T	ENST00000304523.5	-	8	1215				LDB2_ENST00000441778.2_Intron|RP11-446J8.1_ENST00000512370.1_RNA|LDB2_ENST00000502640.1_Missense_Mutation_p.A310E|LDB2_ENST00000515064.1_Intron|LDB2_ENST00000503178.2_Missense_Mutation_p.A186E	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2						epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TGTCCTTAGTGCGCAGCCTGA	0.413																																																	0																																										SO:0001627	intron_variant	9079			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.892-221C>A	4.37:g.16504717G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60619|O75480	Missense_Mutation	SNP	NULL	p.A186E	ENST00000304523.5	37	c.557	CCDS3420.1	4	.	.	.	.	.	.	.	.	.	.	G	6.953	0.545701	0.13312	.	.	ENSG00000169744	ENST00000502640;ENST00000503178	.	.	.	5.49	3.62	0.41486	.	.	.	.	.	T	0.26340	0.0643	.	.	.	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12156	0.001;0.007	T	0.16129	-1.0413	7	0.19147	T	0.46	.	9.4336	0.38626	0.0:0.128:0.6597:0.2123	.	186;310	B7Z2D3;E9PFI4	.;.	E	310;186	.	ENSP00000423963:A310E	A	-	2	0	LDB2	16113815	0.726000	0.28059	0.982000	0.44146	0.997000	0.91878	1.841000	0.39240	1.421000	0.47157	0.655000	0.94253	GCA	LDB2	-	NULL		0.413	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDB2	HGNC	protein_coding	OTTHUMT00000250321.2	G			16504717	-1	no_errors	ENST00000503178	ensembl	human	known	70_37	missense	SNP	0.357	T
LDLR	3949	genome.wustl.edu	37	19	11216264	11216264	+	Missense_Mutation	SNP	G	G	A	rs121908029		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:11216264G>A	ENST00000558518.1	+	4	869	c.682G>A	c.(682-684)Gag>Aag	p.E228K	LDLR_ENST00000535915.1_Missense_Mutation_p.E187K|LDLR_ENST00000558013.1_Missense_Mutation_p.E228K|LDLR_ENST00000545707.1_Intron|LDLR_ENST00000455727.2_Intron|LDLR_ENST00000557933.1_Missense_Mutation_p.E228K	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	228	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.		E -> CK (in Chieti-3). {ECO:0000269|PubMed:10660340}.|E -> K (in FH; French Canadian-3/Mexico; 2% of French Canadians). {ECO:0000269|PubMed:2318961}.|E -> Q (in Tulsa-2).		cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	CAAATCTGACGAGGAAAACTG	0.637																																					GBM(18;201 575 7820 21545)												1	Unknown(1)	lung(1)	GRCh37	CM900153|CM920424|CM920425|CX983276	LDLR	M|X	rs121908029						27.0	32.0	30.0					19																	11216264		2198	4297	6495	SO:0001583	missense	3949			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.682G>A	19.37:g.11216264G>A	ENSP00000454071:p.Glu228Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E228K	ENST00000558518.1	37	c.682	CCDS12254.1	19	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656133	0.88056	.	.	ENSG00000130164	ENST00000252444;ENST00000535915	D	0.98849	-5.18	5.6	5.6	0.85130	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000018	D	0.99551	0.9839	H	0.98682	4.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.998	D	0.97898	1.0301	10	0.87932	D	0	.	18.3742	0.90430	0.0:0.0:1.0:0.0	.	107;187;240;228	B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;LDLR_HUMAN	K	228;187	ENSP00000440520:E187K	ENSP00000252444:E228K	E	+	1	0	LDLR	11077264	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	9.751000	0.98889	2.648000	0.89879	0.591000	0.81541	GAG	LDLR	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.637	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLR	HGNC	protein_coding	OTTHUMT00000415973.2	G			11216264	+1	no_errors	ENST00000558518	ensembl	human	known	70_37	missense	SNP	1.000	A
FAM230C	26080	genome.wustl.edu	37	22	21663213	21663214	+	lincRNA	INS	-	-	GA			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr22:21663213_21663214insGA	ENST00000436681.1	-	0	956_957																											GGCGTCCTCGCTGGCGATGCCG	0.743																																																	0																																												26080																															22.37:g.21663213_21663214insGA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			LINC00281	-	-		0.743	KB-1183D5.13-003	KNOWN	basic	lincRNA	LINC00281	HGNC	lincRNA	OTTHUMT00000320109.1	-			21663214	-1	no_errors	ENST00000436681	ensembl	human	known	70_37	rna	INS	0.000:0.000	GA
LRRC38	126755	genome.wustl.edu	37	1	13839596	13839596	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:13839596G>A	ENST00000376085.3	-	1	947	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	165					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CTGAGGCTGCGCAGGTTGTTG	0.667																																																	0																																										SO:0001583	missense	126755			BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.493C>T	1.37:g.13839596G>A	ENSP00000365253:p.Arg165Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96B32	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R165C	ENST00000376085.3	37	c.493	CCDS53269.1	1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875865	0.33162	.	.	ENSG00000162494	ENST00000376085	T	0.58210	0.35	4.47	3.54	0.40534	.	0.564214	0.18975	N	0.126029	T	0.59418	0.2192	L	0.39898	1.24	0.43729	D	0.996216	D	0.61697	0.99	P	0.59595	0.86	T	0.61168	-0.7117	10	0.72032	D	0.01	.	13.0711	0.59061	0.0:0.1632:0.8368:0.0	.	165	Q5VT99	LRC38_HUMAN	C	165	ENSP00000365253:R165C	ENSP00000365253:R165C	R	-	1	0	LRRC38	13712183	0.714000	0.27936	1.000000	0.80357	0.032000	0.12392	1.317000	0.33631	0.832000	0.34804	-0.556000	0.04195	CGC	LRRC38	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.667	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC38	HGNC	protein_coding	OTTHUMT00000021793.1	G			13839596	-1	no_errors	ENST00000376085	ensembl	human	known	70_37	missense	SNP	0.994	A
MAGEA6	4105	genome.wustl.edu	37	X	151870004	151870004	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:151870004G>C	ENST00000329342.5	+	3	919	c.694G>C	c.(694-696)Gag>Cag	p.E232Q		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	232	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.E232Q(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGGTGTTTGAGGGGAGGGA	0.537																																																	1	Substitution - Missense(1)	urinary_tract(1)											160.0	155.0	156.0					X																	151870004		2202	4300	6502	SO:0001583	missense	4105				CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.694G>C	X.37:g.151870004G>C	ENSP00000329199:p.Glu232Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8IF93|Q6NW44	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E232Q	ENST00000329342.5	37	c.694	CCDS14708.1	X	.	.	.	.	.	.	.	.	.	.	g	4.266	0.048376	0.08243	.	.	ENSG00000197172	ENST00000329342;ENST00000457643	T;T	0.05258	3.47;3.47	0.605	0.605	0.17553	.	.	.	.	.	T	0.06781	0.0173	L	0.38175	1.15	0.09310	N	1	B	0.19445	0.036	B	0.34346	0.18	T	0.45145	-0.9281	8	0.29301	T	0.29	.	.	.	.	.	232	P43360	MAGA6_HUMAN	Q	232	ENSP00000329199:E232Q;ENSP00000401806:E232Q	ENSP00000329199:E232Q	E	+	1	0	MAGEA6	151620660	0.000000	0.05858	0.012000	0.15200	0.165000	0.22458	-0.258000	0.08733	0.573000	0.29400	0.181000	0.17075	GAG	MAGEA6	-	pfam_MAGE,pfscan_MAGE		0.537	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA6	HGNC	protein_coding	OTTHUMT00000058747.2	G	NM_005363		151870004	+1	no_errors	ENST00000329342	ensembl	human	known	70_37	missense	SNP	0.012	C
STRBP	55342	genome.wustl.edu	37	9	125876195	125876195	+	Intron	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:125876195G>C	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						tggcagagctgagcagttgtg	0.488																																																	0																																										SO:0001627	intron_variant	81571			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-4163C>G	9.37:g.125876195G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	-	NULL	ENST00000530364.1	37	NULL		9																																																																																			MIR600HG	-	-		0.488	STRBP-009	PUTATIVE	basic	processed_transcript	MIR600HG	HGNC	protein_coding	OTTHUMT00000392598.1	G			125876195	-1	no_errors	ENST00000449175	ensembl	human	known	70_37	rna	SNP	0.000	C
MLIP	90523	genome.wustl.edu	37	6	54034338	54034338	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:54034338C>T	ENST00000274897.5	+	8	1020	c.907C>T	c.(907-909)Ctt>Ttt	p.L303F	MLIP_ENST00000370877.2_Missense_Mutation_p.L199F|MLIP_ENST00000502396.1_Missense_Mutation_p.L838F|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000509997.1_Missense_Mutation_p.L157F|MLIP_ENST00000358276.5_Missense_Mutation_p.L203F|MLIP_ENST00000514921.1_Missense_Mutation_p.L827F|MLIP_ENST00000370876.2_Missense_Mutation_p.L147F	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	303						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						TCCTACAACTCTTCCAAGAGC	0.338																																																	0													61.0	65.0	64.0					6																	54034338		2203	4296	6499	SO:0001583	missense	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.907C>T	6.37:g.54034338C>T	ENSP00000274897:p.Leu303Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.L303F	ENST00000274897.5	37	c.907	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	C	5.352	0.250295	0.10130	.	.	ENSG00000146147	ENST00000274897;ENST00000514921;ENST00000370877;ENST00000509997;ENST00000370876;ENST00000447836;ENST00000502396;ENST00000358276;ENST00000370878;ENST00000514433	T;T;T;T;T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24;1.24	5.41	2.46	0.29980	.	0.469421	0.20317	N	0.094720	T	0.31918	0.0812	L	0.50333	1.59	0.09310	N	0.999998	D;P;D;D	0.58970	0.971;0.944;0.984;0.971	P;P;P;P	0.59056	0.839;0.715;0.851;0.839	T	0.11421	-1.0588	10	0.36615	T	0.2	-3.4391	13.3406	0.60542	0.0:0.5382:0.4618:0.0	.	838;147;303;827	Q5VWP3-3;Q5VWP3-2;Q5VWP3;D6RE05	.;.;MLIP_HUMAN;.	F	303;827;199;157;147;137;838;203;137;232	ENSP00000274897:L303F;ENSP00000425142:L827F;ENSP00000359914:L199F;ENSP00000427584:L157F;ENSP00000359913:L147F;ENSP00000411917:L137F;ENSP00000426290:L838F;ENSP00000351019:L203F;ENSP00000421444:L232F	ENSP00000274897:L303F	L	+	1	0	MLIP	54142297	0.999000	0.42202	1.000000	0.80357	0.927000	0.56198	0.496000	0.22499	0.802000	0.34089	0.650000	0.86243	CTT	MLIP	-	NULL		0.338	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	C	NM_138569		54034338	+1	no_errors	ENST00000274897	ensembl	human	known	70_37	missense	SNP	1.000	T
MRGPRG	386746	genome.wustl.edu	37	11	3239921	3239921	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:3239921G>C	ENST00000332314.3	-	1	122	c.123C>G	c.(121-123)atC>atG	p.I41M	MRGPRG-AS1_ENST00000434798.1_RNA|MRGPRG-AS1_ENST00000420873.2_RNA|MRGPRG-AS1_ENST00000541883.1_RNA	NM_001164377.1	NP_001157849.1	Q86SM5	MRGRG_HUMAN	MAS-related GPR, member G	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)										GGCCCTTCTTGATGCGGAAGC	0.642																																																	0													119.0	136.0	131.0					11																	3239921		692	1588	2280	SO:0001583	missense	386746			AY255583	CCDS44520.1	11p15.4	2012-08-21	2004-03-25		ENSG00000182170	ENSG00000182170		"""GPCR / Class A : Orphans"""	24829	protein-coding gene	gene with protein product		607234	"""G protein-coupled receptor 169"""	GPR169		12679517	Standard	NM_001164377		Approved	mrgG	uc001lxp.2	Q86SM5	OTTHUMG00000011709	ENST00000332314.3:c.123C>G	11.37:g.3239921G>C	ENSP00000330612:p.Ile41Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.I41M	ENST00000332314.3	37	c.123	CCDS44520.1	11	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199848	0.38905	.	.	ENSG00000182170	ENST00000332314	T	0.16073	2.37	3.78	-2.96	0.05547	.	.	.	.	.	T	0.07143	0.0181	L	0.27944	0.81	0.09310	N	1	.	.	.	.	.	.	T	0.40794	-0.9544	7	0.02654	T	1	-33.3142	3.9617	0.09413	0.0991:0.4435:0.3071:0.1503	.	.	.	.	M	41	ENSP00000330612:I41M	ENSP00000330612:I41M	I	-	3	3	MRGPRG	3196497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.344000	0.07780	-0.389000	0.07786	-0.302000	0.09304	ATC	MRGPRG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.642	MRGPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRG	HGNC	protein_coding	OTTHUMT00000032347.1	G			3239921	-1	no_errors	ENST00000332314	ensembl	human	known	70_37	missense	SNP	0.000	C
MT-ND6	4541	genome.wustl.edu	37	M	14530	14531	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrM:14530_14531insC	ENST00000361681.2	-	1	142_143	c.143_144insG	c.(142-144)ggafs	p.G48fs	MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	48					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCCATATAACCTCCCCCAAAAT	0.401																																																	0																																										SO:0001589	frameshift_variant	4541					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.144dupG	M.37:g.14530_14530dupC	ENSP00000354665:p.Gly48fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34774|Q8HG30	Frame_Shift_Ins	INS	pfam_NADH_UbQ/plastoQ_OxRdtase_su6	p.G49fs	ENST00000361681.2	37	c.144_143		MT																																																																																			MT-ND6	-	pfam_NADH_UbQ/plastoQ_OxRdtase_su6		0.401	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	MT-ND6	HGNC	protein_coding		-	YP_003024037		14531	-1	no_errors	ENST00000361681	ensembl	human	known	70_37	frame_shift_ins	INS	NULL	C
MTRF1	9617	genome.wustl.edu	37	13	41834684	41834684	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr13:41834684G>T	ENST00000379480.4	-	2	460	c.360C>A	c.(358-360)taC>taA	p.Y120*	MTRF1_ENST00000239852.6_5'UTR|MTRF1_ENST00000379477.1_Nonsense_Mutation_p.Y120*|MTRF1_ENST00000430347.2_Nonsense_Mutation_p.Y133*	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	120					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		GAATTTCTTGGTAAATGGCTG	0.403																																																	0													171.0	166.0	168.0					13																	41834684		2203	4300	6503	SO:0001587	stop_gained	9617			AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.360C>A	13.37:g.41834684G>T	ENSP00000368793:p.Tyr120*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DG01|Q5T6Y5|Q8IUQ6	Nonsense_Mutation	SNP	pfam_Pep_chain_release_fac_I_II,pfam_PCRF,smart_PCRF	p.Y133*	ENST00000379480.4	37	c.399	CCDS9378.1	13	.	.	.	.	.	.	.	.	.	.	G	38	6.829508	0.97869	.	.	ENSG00000120662	ENST00000379480;ENST00000379477;ENST00000430347;ENST00000239852;ENST00000452359	.	.	.	4.78	2.82	0.32997	.	0.328049	0.32028	N	0.006692	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.2287	2.1329	0.03754	0.4772:0.0:0.2769:0.2459	.	.	.	.	X	120;120;133;120;120	.	ENSP00000239852:Y120X	Y	-	3	2	MTRF1	40732684	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.781000	0.26774	0.505000	0.28104	0.591000	0.81541	TAC	MTRF1	-	NULL		0.403	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRF1	HGNC	protein_coding	OTTHUMT00000044666.3	G	NM_004294		41834684	-1	no_errors	ENST00000430347	ensembl	human	known	70_37	nonsense	SNP	0.997	T
MUC16	94025	genome.wustl.edu	37	19	8976330	8976330	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:8976330C>T	ENST00000397910.4	-	75	42701	c.42498G>A	c.(42496-42498)ctG>ctA	p.L14166L	MUC16_ENST00000596956.1_Intron|MUC16_ENST00000380951.5_Silent_p.L807L	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14197	SEA 14. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGCTGACTCAGCTCCCAGT	0.572																																																	0													49.0	48.0	48.0					19																	8976330		2000	4174	6174	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42498G>A	19.37:g.8976330C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.L14166	ENST00000397910.4	37	c.42498	CCDS54212.1	19																																																																																			MUC16	-	pfam_SEA		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	C	NM_024690		8976330	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	silent	SNP	0.310	T
MUC4	4585	genome.wustl.edu	37	3	195513258	195513258	+	Silent	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:195513258G>T	ENST00000463781.3	-	2	5652	c.5193C>A	c.(5191-5193)gtC>gtA	p.V1731V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.V1731V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGGGCTAGTGACAGGAAGAG	0.597																																																	0													26.0	24.0	24.0					3																	195513258		688	1583	2271	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5193C>A	3.37:g.195513258G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V1731	ENST00000463781.3	37	c.5193	CCDS54700.1	3																																																																																			MUC4	-	NULL		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513258	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	silent	SNP	0.639	T
MYBPC2	4606	genome.wustl.edu	37	19	50961953	50961953	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:50961953C>G	ENST00000357701.5	+	21	2499	c.2448C>G	c.(2446-2448)atC>atG	p.I816M		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	816	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GGGTCAACATCGCGGGGCGCA	0.672																																																	0													30.0	38.0	35.0					19																	50961953		2022	4173	6195	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2448C>G	19.37:g.50961953C>G	ENSP00000350332:p.Ile816Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I816M	ENST00000357701.5	37	c.2448	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	c	12.85	2.060692	0.36373	.	.	ENSG00000086967	ENST00000357701	T	0.56941	0.43	4.05	-2.59	0.06209	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.478549	0.12918	U	0.428438	T	0.36082	0.0954	L	0.31926	0.97	0.32516	N	0.536859	P	0.35612	0.512	B	0.33042	0.157	T	0.40646	-0.9552	10	0.45353	T	0.12	.	10.3872	0.44148	0.0:0.6161:0.0:0.3839	.	816	Q14324	MYPC2_HUMAN	M	816	ENSP00000350332:I816M	ENSP00000350332:I816M	I	+	3	3	MYBPC2	55653765	0.000000	0.05858	0.993000	0.49108	0.968000	0.65278	-3.255000	0.00538	-0.317000	0.08677	0.457000	0.33378	ATC	MYBPC2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.672	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	C	NM_004533		50961953	+1	no_errors	ENST00000357701	ensembl	human	known	70_37	missense	SNP	0.997	G
MYH2	4620	genome.wustl.edu	37	17	10428320	10428320	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:10428320C>T	ENST00000245503.5	-	34	5109	c.4725G>A	c.(4723-4725)aaG>aaA	p.K1575K	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000397183.2_Silent_p.K1575K|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1575					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CAACCTCAGACTTGACTTGGT	0.448																																																	0													113.0	112.0	112.0					17																	10428320		2203	4298	6501	SO:0001819	synonymous_variant	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4725G>A	17.37:g.10428320C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1575	ENST00000245503.5	37	c.4725	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_tail		0.448	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	C	NM_017534		10428320	-1	no_errors	ENST00000245503	ensembl	human	known	70_37	silent	SNP	1.000	T
MYH3	4621	genome.wustl.edu	37	17	10532970	10532970	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:10532970C>T	ENST00000583535.1	-	40	5827	c.5740G>A	c.(5740-5742)Gca>Aca	p.A1914T	MYH3_ENST00000226209.7_Missense_Mutation_p.A1914T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1914					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGAGATTCTGCGATATCCGCA	0.562																																																	0													87.0	77.0	80.0					17																	10532970		2203	4300	6503	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5740G>A	17.37:g.10532970C>T	ENSP00000464317:p.Ala1914Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1914T	ENST00000583535.1	37	c.5740	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365783	0.82463	.	.	ENSG00000109063	ENST00000226209	D	0.81499	-1.5	5.0	5.0	0.66597	Myosin tail (1);	.	.	.	.	D	0.93815	0.8022	H	0.98155	4.16	0.53005	D	0.999961	D	0.89917	1.0	D	0.75020	0.985	D	0.95776	0.8813	9	0.87932	D	0	.	18.8532	0.92241	0.0:1.0:0.0:0.0	.	1914	P11055	MYH3_HUMAN	T	1914	ENSP00000226209:A1914T	ENSP00000226209:A1914T	A	-	1	0	MYH3	10473695	1.000000	0.71417	0.970000	0.41538	0.193000	0.23685	5.924000	0.70054	2.769000	0.95229	0.655000	0.94253	GCA	MYH3	-	pfam_Myosin_tail		0.562	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	C	NM_002470		10532970	-1	no_errors	ENST00000226209	ensembl	human	known	70_37	missense	SNP	1.000	T
MYOC	4653	genome.wustl.edu	37	1	171605176	171605176	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:171605176C>T	ENST00000037502.6	-	3	1475	c.1404G>A	c.(1402-1404)aaG>aaA	p.K468K		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	468	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TATAGCGGTTCTTGAATGGGA	0.488																																																	0													213.0	186.0	195.0					1																	171605176		2203	4300	6503	SO:0001819	synonymous_variant	4653			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.1404G>A	1.37:g.171605176C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD84|O00620|Q7Z6Q9	Silent	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.K468	ENST00000037502.6	37	c.1404	CCDS1297.1	1																																																																																			MYOC	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like		0.488	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOC	HGNC	protein_coding	OTTHUMT00000084178.2	C	NM_000261		171605176	-1	no_errors	ENST00000037502	ensembl	human	known	70_37	silent	SNP	1.000	T
NAALADL2	254827	genome.wustl.edu	37	3	175042010	175042010	+	Missense_Mutation	SNP	T	T	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:175042010T>C	ENST00000454872.1	+	5	1114	c.986T>C	c.(985-987)aTc>aCc	p.I329T	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	329						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CTTCTGTATATCGATCCTTGT	0.413																																																	0													236.0	231.0	233.0					3																	175042010		1899	4112	6011	SO:0001583	missense	254827				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.986T>C	3.37:g.175042010T>C	ENSP00000404705:p.Ile329Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	superfamily_TFR-like_dimer_dom	p.I329T	ENST00000454872.1	37	c.986	CCDS46960.1	3	.	.	.	.	.	.	.	.	.	.	T	7.650	0.682659	0.14907	.	.	ENSG00000177694	ENST00000454872	T	0.38722	1.12	5.79	5.79	0.91817	.	0.536226	0.17966	N	0.156017	T	0.27349	0.0671	N	0.24115	0.695	0.22803	N	0.998714	B	0.13594	0.008	B	0.17979	0.02	T	0.19353	-1.0308	10	0.10902	T	0.67	-4.7902	10.6686	0.45745	0.0:0.0741:0.0:0.9259	.	329	Q58DX5	NADL2_HUMAN	T	329	ENSP00000404705:I329T	ENSP00000404705:I329T	I	+	2	0	NAALADL2	176524704	1.000000	0.71417	0.959000	0.39883	0.886000	0.51366	2.437000	0.44828	2.208000	0.71279	0.460000	0.39030	ATC	NAALADL2	-	NULL		0.413	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	T	NM_207015		175042010	+1	no_errors	ENST00000454872	ensembl	human	known	70_37	missense	SNP	0.989	C
NAB2	4665	genome.wustl.edu	37	12	57485047	57485047	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:57485047G>A	ENST00000300131.3	+	2	601	c.223G>A	c.(223-225)Gcg>Acg	p.A75T	NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000357680.4_Missense_Mutation_p.A75T|NAB2_ENST00000342556.6_Missense_Mutation_p.A75T	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	75	NCD1.				cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GCTGTGTGAGGCGGGTGAGGA	0.627																																																	0													87.0	97.0	94.0					12																	57485047		2203	4300	6503	SO:0001583	missense	4665			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.223G>A	12.37:g.57485047G>A	ENSP00000300131:p.Ala75Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	pfam_NAB_co-repressor_dom,pfam_Nab_N,superfamily_SAM/pointed	p.A75T	ENST00000300131.3	37	c.223	CCDS8930.1	12	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026154	0.93518	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	D;D;D	0.82344	-1.6;-1.6;-1.6	4.43	4.43	0.53597	Nab, N-terminal (2);	0.000000	0.64402	D	0.000001	D	0.90414	0.6999	M	0.79123	2.44	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.91728	0.5394	10	0.87932	D	0	-10.4165	14.6094	0.68504	0.0:0.0:1.0:0.0	.	75	Q15742	NAB2_HUMAN	T	75	ENSP00000300131:A75T;ENSP00000341491:A75T;ENSP00000350309:A75T	ENSP00000300131:A75T	A	+	1	0	NAB2	55771314	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	9.603000	0.98315	2.295000	0.77249	0.561000	0.74099	GCG	NAB2	-	pfam_Nab_N,superfamily_SAM/pointed		0.627	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAB2	HGNC	protein_coding	OTTHUMT00000412222.1	G	NM_005967		57485047	+1	no_errors	ENST00000300131	ensembl	human	known	70_37	missense	SNP	1.000	A
NCR2	9436	genome.wustl.edu	37	6	41310655	41310655	+	Intron	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:41310655G>T	ENST00000373089.5	+	4	732				NCR2_ENST00000373083.4_Splice_Site|NCR2_ENST00000373086.3_Splice_Site	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2						cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					CTCATCTCAAGGGTTTTAAGG	0.587																																																	0																																										SO:0001627	intron_variant	9436			AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.644+768G>T	6.37:g.41310655G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Splice_Site	SNP	-	e5-1	ENST00000373089.5	37	c.681-1	CCDS4855.1	6	.	.	.	.	.	.	.	.	.	.	G	5.574	0.290776	0.10567	.	.	ENSG00000096264	ENST00000373083;ENST00000373086	.	.	.	2.15	2.15	0.27550	.	.	.	.	.	.	.	.	.	.	.	0.28679	N	0.905193	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8704	0.29563	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCR2	41418633	0.067000	0.21026	0.002000	0.10522	0.002000	0.02628	1.452000	0.35156	1.519000	0.48950	0.455000	0.32223	.	NCR2	-	-		0.587	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR2	HGNC	protein_coding	OTTHUMT00000040511.3	G			41310655	+1	no_errors	ENST00000373086	ensembl	human	known	70_37	splice_site	SNP	0.002	T
NGF	4803	genome.wustl.edu	37	1	115828996	115828996	+	Missense_Mutation	SNP	C	C	T	rs199511298		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:115828996C>T	ENST00000369512.2	-	3	589	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	141					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CCAACCCACACGCTGACACTG	0.537																																																	0								C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	113.0	96.0	102.0		421	2.1	1.0	1		102	0,8600		0,0,4300	no	missense	NGF	NM_002506.2	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	141/242	115828996	1,13005	2203	4300	6503	SO:0001583	missense	4803				CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.421G>A	1.37:g.115828996C>T	ENSP00000358525:p.Val141Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Missense_Mutation	SNP	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pirsf_Nerve_growth_factor-like,prints_Nerve_growth_factor-rel,prints_Nerve_growth_factor_bsu_mml,prints_Nerve_growth_factor_bsu,pfscan_Nerve_growth_factor-rel	p.V141M	ENST00000369512.2	37	c.421	CCDS882.1	1	.	.	.	.	.	.	.	.	.	.	C	0.936	-0.710954	0.03230	2.27E-4	0.0	ENSG00000134259	ENST00000369512	T	0.77877	-1.13	5.14	2.07	0.26955	Nerve growth factor-related (5);	0.330696	0.32518	N	0.005998	T	0.34164	0.0888	L	0.34521	1.04	0.31842	N	0.623372	B	0.33073	0.396	B	0.25884	0.064	T	0.30822	-0.9965	10	0.05620	T	0.96	-12.1745	7.233	0.26053	0.0:0.6036:0.0:0.3964	.	141	P01138	NGF_HUMAN	M	141	ENSP00000358525:V141M	ENSP00000358525:V141M	V	-	1	0	NGF	115630519	0.958000	0.32768	1.000000	0.80357	0.983000	0.72400	0.084000	0.14891	0.593000	0.29745	0.313000	0.20887	GTG	NGF	-	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pirsf_Nerve_growth_factor-like,prints_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel		0.537	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGF	HGNC	protein_coding	OTTHUMT00000032832.1	C	NM_002506		115828996	-1	no_errors	ENST00000369512	ensembl	human	known	70_37	missense	SNP	0.996	T
NID2	22795	genome.wustl.edu	37	14	52509538	52509538	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:52509538G>C	ENST00000216286.5	-	6	1540	c.1541C>G	c.(1540-1542)tCc>tGc	p.S514C	NID2_ENST00000541773.1_Missense_Mutation_p.S461C	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	514	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					ATAAAACTTGGATTGGCAGTG	0.512																																																	0													127.0	108.0	115.0					14																	52509538		2203	4300	6503	SO:0001583	missense	22795			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1541C>G	14.37:g.52509538G>C	ENSP00000216286:p.Ser514Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.S514C	ENST00000216286.5	37	c.1541	CCDS9706.1	14	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410087	0.83340	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	D;D	0.88277	-2.36;-1.76	5.76	5.76	0.90799	Epidermal growth factor-like (1);	0.347261	0.34932	N	0.003571	D	0.93265	0.7854	M	0.76574	2.34	0.33140	D	0.544301	D;D;B	0.76494	0.99;0.999;0.249	P;P;B	0.62740	0.789;0.906;0.103	D	0.95113	0.8240	10	0.66056	D	0.02	.	14.7489	0.69511	0.0:0.0:0.8553:0.1447	.	461;516;514	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	C	514;461;516	ENSP00000216286:S514C;ENSP00000443730:S461C	ENSP00000216286:S514C	S	-	2	0	NID2	51579288	1.000000	0.71417	0.995000	0.50966	0.871000	0.50021	5.191000	0.65110	2.880000	0.98712	0.650000	0.86243	TCC	NID2	-	smart_EG-like_dom		0.512	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	HGNC	protein_coding	OTTHUMT00000276888.1	G			52509538	-1	no_errors	ENST00000216286	ensembl	human	known	70_37	missense	SNP	1.000	C
NKX2-2	4821	genome.wustl.edu	37	20	21492887	21492887	+	Missense_Mutation	SNP	G	G	A	rs375540703		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:21492887G>A	ENST00000377142.4	-	2	852	c.496C>T	c.(496-498)Cgc>Tgc	p.R166C	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	166					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGCGTGAGGCGGATGAGGCTG	0.652																																																	0													40.0	41.0	41.0					20																	21492887		2202	4300	6502	SO:0001583	missense	4821			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.496C>T	20.37:g.21492887G>A	ENSP00000366347:p.Arg166Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R166C	ENST00000377142.4	37	c.496	CCDS13145.1	20	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341786	0.81911	.	.	ENSG00000125820	ENST00000377142	D	0.95756	-3.8	4.98	4.98	0.66077	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95043	0.8395	N	0.12746	0.255	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.96797	0.9586	10	0.87932	D	0	.	17.8583	0.88773	0.0:0.0:1.0:0.0	.	166	O95096	NKX22_HUMAN	C	166	ENSP00000366347:R166C	ENSP00000366347:R166C	R	-	1	0	NKX2-2	21440887	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.125000	0.57931	2.291000	0.77112	0.462000	0.41574	CGC	NKX2-2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa		0.652	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2	HGNC	protein_coding	OTTHUMT00000078278.9	G			21492887	-1	no_errors	ENST00000377142	ensembl	human	known	70_37	missense	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228400470	228400470	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:228400470G>A	ENST00000422127.1	+	2	1030	c.986G>A	c.(985-987)cGc>cAc	p.R329H	OBSCN_ENST00000570156.2_Missense_Mutation_p.R329H|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.R329H|C1orf145_ENST00000295012.5_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	329					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTCGTAGTGCGCGGTGAGCTC	0.682																																																	0													9.0	11.0	10.0					1																	228400470		1981	4113	6094	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.986G>A	1.37:g.228400470G>A	ENSP00000409493:p.Arg329His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R329H	ENST00000422127.1	37	c.986	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437595	0.43224	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.05081	3.5;3.5	4.91	3.99	0.46301	Immunoglobulin-like fold (1);	1.172130	0.06782	N	0.785401	T	0.05547	0.0146	L	0.46157	1.445	0.80722	D	1	P;P	0.38167	0.487;0.621	B;B	0.24006	0.023;0.05	T	0.39461	-0.9613	10	0.39692	T	0.17	-1.5022	3.6634	0.08246	0.2049:0.0:0.5852:0.2099	.	329;329	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	329	ENSP00000284548:R329H;ENSP00000409493:R329H	ENSP00000284548:R329H	R	+	2	0	OBSCN	226467093	1.000000	0.71417	0.997000	0.53966	0.704000	0.40688	4.207000	0.58480	1.041000	0.40125	0.643000	0.83706	CGC	OBSCN	-	smart_Ig_sub		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		G	NM_052843		228400470	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	missense	SNP	1.000	A
OGDHL	55753	genome.wustl.edu	37	10	50944452	50944452	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr10:50944452C>T	ENST00000374103.4	-	21	2790	c.2705G>A	c.(2704-2706)cGg>cAg	p.R902Q	OGDHL_ENST00000490844.1_5'UTR|OGDHL_ENST00000432695.1_Missense_Mutation_p.R693Q|OGDHL_ENST00000419399.1_Missense_Mutation_p.R845Q	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	902					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTGGCTGCTCCGCTCCTTCAC	0.617																																																	0													121.0	111.0	115.0					10																	50944452		2203	4300	6503	SO:0001583	missense	55753			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2705G>A	10.37:g.50944452C>T	ENSP00000363216:p.Arg902Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.R902Q	ENST00000374103.4	37	c.2705	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.659523	0.96734	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.12147	2.71;2.71;2.71	5.19	5.19	0.71726	.	0.053342	0.64402	D	0.000001	T	0.45696	0.1355	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.995	T	0.54227	-0.8325	10	0.87932	D	0	.	18.7031	0.91627	0.0:1.0:0.0:0.0	.	845;693;902	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	Q	902;845;693	ENSP00000363216:R902Q;ENSP00000401356:R845Q;ENSP00000390240:R693Q	ENSP00000363216:R902Q	R	-	2	0	OGDHL	50614458	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.818000	0.86416	2.427000	0.82271	0.484000	0.47621	CGG	OGDHL	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.617	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	C	NM_018245		50944452	-1	no_errors	ENST00000374103	ensembl	human	known	70_37	missense	SNP	1.000	T
OPN1MW2	728458	genome.wustl.edu	37	X	153492789	153492789	+	Missense_Mutation	SNP	G	G	T	rs139163406		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:153492789G>T	ENST00000369929.4	+	3	598	c.538G>T	c.(538-540)Gct>Tct	p.A180S	OPN1MW2_ENST00000488220.1_3'UTR	NM_001048181.2	NP_001041646.1	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive 2	180					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|stomach(2)|urinary_tract(1)	6	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGGATCTGGGCTGCTGTGTG	0.567																																																	0													1.0	1.0	1.0					X																	153492789		575	867	1442	SO:0001583	missense	728458				CCDS35447.1	Xq28	2012-08-08			ENSG00000166160	ENSG00000166160		"""GPCR / Class A : Opsin receptors"""	26952	protein-coding gene	gene with protein product							Standard	NM_001048181		Approved			P04001	OTTHUMG00000024231	ENST00000369929.4:c.538G>T	X.37:g.153492789G>T	ENSP00000358945:p.Ala180Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_red/grn,prints_GPCR_Rhodpsn,prints_Opsin	p.A180S	ENST00000369929.4	37	c.538	CCDS35447.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.004|0.004	-2.252386|-2.252386	0.00268|0.00268	.|.	.|.	ENSG00000166160|ENSG00000166160	ENST00000369929|ENST00000430419	T|.	0.34667|.	1.35|.	2.65|2.65	0.698|0.698	0.18087|0.18087	.|.	0.388144|.	0.28349|.	N|.	0.015679|.	T|T	0.56891|0.56891	0.2016|0.2016	.|.	.|.	.|.	0.48236|0.48236	D|D	0.999611|0.999611	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.47873|0.47873	-0.9083|-0.9083	7|4	0.22109|.	T|.	0.4|.	.|.	9.0731|9.0731	0.36504|0.36504	0.0:0.0:0.4436:0.5564|0.0:0.0:0.4436:0.5564	.|.	.|.	.|.	.|.	S|V	180|42	ENSP00000358945:A180S|.	ENSP00000358945:A180S|.	A|G	+|+	1|2	0|0	OPN1MW2|OPN1MW2	153145983|153145983	0.000000|0.000000	0.05858|0.05858	0.956000|0.956000	0.39512|0.39512	0.016000|0.016000	0.09150|0.09150	-3.673000|-3.673000	0.00397|0.00397	-0.164000|-0.164000	0.10927|0.10927	-1.182000|-1.182000	0.01712|0.01712	GCT|GGC	OPN1MW2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.567	OPN1MW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1MW2	HGNC	protein_coding	OTTHUMT00000061149.2	G	NM_001048181		153492789	+1	no_errors	ENST00000369929	ensembl	human	known	70_37	missense	SNP	0.989	T
OR2T27	403239	genome.wustl.edu	37	1	248813636	248813636	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:248813636G>T	ENST00000344889.3	-	1	549	c.550C>A	c.(550-552)Ctt>Att	p.L184I		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGCTTCAGAAGGGCAGGCACC	0.552																																																	0													21.0	8.0	12.0					1																	248813636		2135	4050	6185	SO:0001583	missense	403239				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.550C>A	1.37:g.248813636G>T	ENSP00000342008:p.Leu184Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L184I	ENST00000344889.3	37	c.550	CCDS31124.1	1	.	.	.	.	.	.	.	.	.	.	.	2.045	-0.419186	0.04766	.	.	ENSG00000187701	ENST00000344889	T	0.00069	8.77	3.3	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32258	N	0.006350	T	0.00178	0.0005	L	0.56396	1.775	0.09310	N	1	B	0.22983	0.078	B	0.30716	0.119	T	0.21759	-1.0236	10	0.51188	T	0.08	.	10.7042	0.45946	0.0:0.1964:0.8036:0.0	.	184	Q8NH04	O2T27_HUMAN	I	184	ENSP00000342008:L184I	ENSP00000342008:L184I	L	-	1	0	OR2T27	246880259	0.000000	0.05858	0.822000	0.32727	0.014000	0.08584	-0.514000	0.06298	1.854000	0.53819	0.194000	0.17425	CTT	OR2T27	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.552	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T27	HGNC	protein_coding	OTTHUMT00000097124.1	G	NM_001001824		248813636	-1	no_errors	ENST00000344889	ensembl	human	known	70_37	missense	SNP	0.002	T
OR52H1	390067	genome.wustl.edu	37	11	5566286	5566286	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:5566286G>A	ENST00000322653.4	-	1	493	c.468C>T	c.(466-468)atC>atT	p.I156I	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCGAAAGGAGATGCCCATAG	0.473																																																	0													100.0	90.0	93.0					11																	5566286		2201	4297	6498	SO:0001819	synonymous_variant	390067			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.468C>T	11.37:g.5566286G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EH26|Q6IF79	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I156	ENST00000322653.4	37	c.468	CCDS31386.1	11																																																																																			OR52H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.473	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52H1	HGNC	protein_coding	OTTHUMT00000143400.1	G	NM_001005289		5566286	-1	no_errors	ENST00000322653	ensembl	human	known	70_37	silent	SNP	0.005	A
OR56A4	120793	genome.wustl.edu	37	11	6024247	6024247	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:6024247G>A	ENST00000330728.4	-	1	177	c.132C>T	c.(130-132)gtC>gtT	p.V44V		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAATCTGGAGACCCAGTGTA	0.463																																																	0													120.0	118.0	119.0					11																	6024247		2201	4296	6497	SO:0001819	synonymous_variant	120793			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.132C>T	11.37:g.6024247G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EH17	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V44	ENST00000330728.4	37	c.132	CCDS31404.1	11																																																																																			OR56A4	-	NULL		0.463	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56A4	HGNC	protein_coding	OTTHUMT00000383756.2	G	NM_001005179		6024247	-1	no_errors	ENST00000330728	ensembl	human	known	70_37	silent	SNP	0.000	A
OR56B4	196335	genome.wustl.edu	37	11	6129931	6129931	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:6129931A>G	ENST00000316529.3	+	1	1018	c.923A>G	c.(922-924)cAg>cGg	p.Q308R	RP11-290F24.3_ENST00000529961.1_RNA	NM_001005181.1	NP_001005181.1	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B, member 4	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(10)|skin(6)|urinary_tract(2)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGGCTTTCAGAGACTGCTT	0.483																																																	0													88.0	90.0	89.0					11																	6129931		2201	4296	6497	SO:0001583	missense	196335			AB065513	CCDS31406.1	11p15.4	2012-08-09			ENSG00000180919	ENSG00000180919		"""GPCR / Class A : Olfactory receptors"""	15248	protein-coding gene	gene with protein product							Standard	NM_001005181		Approved		uc010qzx.2	Q8NH76	OTTHUMG00000165531	ENST00000316529.3:c.923A>G	11.37:g.6129931A>G	ENSP00000321196:p.Gln308Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFD7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.Q308R	ENST00000316529.3	37	c.923	CCDS31406.1	11	.	.	.	.	.	.	.	.	.	.	A	10.15	1.272132	0.23221	.	.	ENSG00000180919	ENST00000316529	T	0.34072	1.38	4.01	-0.201	0.13212	.	0.263059	0.19038	U	0.124375	T	0.13670	0.0331	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.13442	-1.0509	10	0.62326	D	0.03	.	0.2692	0.00229	0.405:0.1512:0.2128:0.231	.	308	Q8NH76	O56B4_HUMAN	R	308	ENSP00000321196:Q308R	ENSP00000321196:Q308R	Q	+	2	0	OR56B4	6086507	0.000000	0.05858	0.749000	0.31150	0.477000	0.33069	0.860000	0.27871	0.191000	0.20236	0.449000	0.29647	CAG	OR56B4	-	NULL		0.483	OR56B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56B4	HGNC	protein_coding	OTTHUMT00000384668.1	A	NM_001005181		6129931	+1	no_errors	ENST00000316529	ensembl	human	known	70_37	missense	SNP	0.014	G
OR7A5	26659	genome.wustl.edu	37	19	14938895	14938895	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:14938895G>A	ENST00000322301.3	-	2	246	c.159C>T	c.(157-159)tcC>tcT	p.S53S	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.S53S			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	53					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TGTGGAGGTGGGAGTCTGAGA	0.512																																																	0													102.0	94.0	97.0					19																	14938895		2203	4297	6500	SO:0001819	synonymous_variant	26659			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.159C>T	19.37:g.14938895G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R682|Q6IFP1|Q96R96	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S53	ENST00000322301.3	37	c.159	CCDS12318.1	19																																																																																			OR7A5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.512	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A5	HGNC	protein_coding	OTTHUMT00000466518.1	G	NM_017506		14938895	-1	no_errors	ENST00000322301	ensembl	human	known	70_37	silent	SNP	0.016	A
PAAF1	80227	genome.wustl.edu	37	11	73627672	73627672	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:73627672G>A	ENST00000310571.3	+	9	955	c.902G>A	c.(901-903)gGa>gAa	p.G301E	PAAF1_ENST00000535604.1_Missense_Mutation_p.G186E|PAAF1_ENST00000544909.1_Missense_Mutation_p.G302E|PAAF1_ENST00000376384.5_Missense_Mutation_p.G284E|PAAF1_ENST00000541951.1_Missense_Mutation_p.G186E|PAAF1_ENST00000536003.1_Missense_Mutation_p.G284E|PAAF1_ENST00000544552.1_Missense_Mutation_p.G284E	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	301					viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					ACTCAAGATGGAAACATTTAT	0.438																																																	0													129.0	116.0	121.0					11																	73627672		2200	4293	6493	SO:0001583	missense	80227			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.902G>A	11.37:g.73627672G>A	ENSP00000311665:p.Gly301Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G301E	ENST00000310571.3	37	c.902	CCDS8226.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.57|15.57	2.871310|2.871310	0.51695|0.51695	.|.	.|.	ENSG00000175575|ENSG00000175575	ENST00000540659|ENST00000541951;ENST00000310571;ENST00000535604;ENST00000536003;ENST00000544552;ENST00000376384;ENST00000544909	.|T;T;T;T;T;T;T	.|0.23754	.|1.89;1.89;1.89;1.89;1.89;1.89;1.89	5.42|5.42	5.42|5.42	0.78866|0.78866	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.54870|0.54870	0.1885|0.1885	M|M	0.81497|0.81497	2.545|2.545	0.51012|0.51012	D|D	0.999902|0.999902	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.998	T|T	0.56183|0.56183	-0.8021|-0.8021	5|10	.|0.48119	.|T	.|0.1	-8.5774|-8.5774	17.7649|17.7649	0.88475|0.88475	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|284;301	.|Q9BRP4-2;Q9BRP4	.|.;PAAF1_HUMAN	K|E	111|186;301;186;284;284;284;302	.|ENSP00000441333:G186E;ENSP00000311665:G301E;ENSP00000438789:G186E;ENSP00000438124:G284E;ENSP00000441494:G284E;ENSP00000365564:G284E;ENSP00000438071:G302E	.|ENSP00000311665:G301E	E|G	+|+	1|2	0|0	PAAF1|PAAF1	73305320|73305320	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.364000|6.364000	0.73086|0.73086	2.536000|2.536000	0.85505|0.85505	0.655000|0.655000	0.94253|0.94253	GAA|GGA	PAAF1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.438	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAAF1	HGNC	protein_coding	OTTHUMT00000397885.1	G	NM_025155		73627672	+1	no_errors	ENST00000310571	ensembl	human	known	70_37	missense	SNP	1.000	A
PCDHB4	56131	genome.wustl.edu	37	5	140502562	140502562	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:140502562G>C	ENST00000194152.1	+	1	982	c.982G>C	c.(982-984)Gga>Cga	p.G328R	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	328	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCCTTTCTGGAAAAGGCAC	0.413																																																	0													164.0	179.0	174.0					5																	140502562		2203	4300	6503	SO:0001583	missense	56131			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.982G>C	5.37:g.140502562G>C	ENSP00000194152:p.Gly328Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G328R	ENST00000194152.1	37	c.982	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941264	0.53079	.	.	ENSG00000081818	ENST00000194152	T	0.54479	0.57	4.41	3.53	0.40419	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.72078	0.3416	M	0.80332	2.49	0.39355	D	0.965821	D	0.89917	1.0	D	0.87578	0.998	T	0.77950	-0.2395	9	0.87932	D	0	.	13.0627	0.59015	0.0791:0.0:0.9209:0.0	.	328	Q9Y5E5	PCDB4_HUMAN	R	328	ENSP00000194152:G328R	ENSP00000194152:G328R	G	+	1	0	PCDHB4	140482746	0.011000	0.17503	0.995000	0.50966	0.992000	0.81027	1.283000	0.33237	1.201000	0.43203	0.650000	0.86243	GGA	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.413	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	G	NM_018938		140502562	+1	no_errors	ENST00000194152	ensembl	human	known	70_37	missense	SNP	0.932	C
PCYT1A	5130	genome.wustl.edu	37	3	195968876	195968876	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:195968876C>T	ENST00000292823.2	-	8	823	c.651G>A	c.(649-651)gcG>gcA	p.A217A	PCYT1A_ENST00000419333.1_Silent_p.A217A|PCYT1A_ENST00000431016.1_Silent_p.A217A	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	217					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	GGTTCCGCCTCGCATACACAT	0.502																																																	0													138.0	113.0	121.0					3																	195968876		2203	4300	6503	SO:0001819	synonymous_variant	5130			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.651G>A	3.37:g.195968876C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	pfam_Cytidylyltransf,superfamily_NA-bd_OB-fold-like,tigrfam_Cyt_trans-like	p.A217	ENST00000292823.2	37	c.651	CCDS3315.1	3																																																																																			PCYT1A	-	NULL		0.502	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1A	HGNC	protein_coding	OTTHUMT00000341147.1	C	NM_005017		195968876	-1	no_errors	ENST00000292823	ensembl	human	known	70_37	silent	SNP	0.677	T
PDIA6	10130	genome.wustl.edu	37	2	10959439	10959439	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:10959439G>C	ENST00000404371.2	-	3	473	c.136C>G	c.(136-138)Ccc>Gcc	p.P46A	PDIA6_ENST00000404824.2_Missense_Mutation_p.P42A|PDIA6_ENST00000381611.4_5'UTR	NM_001282704.1	NP_001269633.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	0	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		TACATTATGGGACTTTTCCTT	0.488																																					GBM(73;509 1219 34219 41343 41551)												0																																										SO:0001583	missense	10130			BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000404371.2:c.136C>G	2.37:g.10959439G>C	ENSP00000385385:p.Pro46Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Disulphide_isomerase	p.P46A	ENST00000404371.2	37	c.136		2	.	.	.	.	.	.	.	.	.	.	G	3.661	-0.069483	0.07228	.	.	ENSG00000143870	ENST00000404371;ENST00000404824	T;T	0.09350	2.99;3.77	1.08	0.163	0.14986	.	.	.	.	.	T	0.05273	0.0140	.	.	.	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.44019	-0.9355	8	0.21540	T	0.41	.	3.3448	0.07131	0.2919:0.0:0.7081:0.0	.	42;46	B5MCQ5;Q15084-2	.;.	A	46;42	ENSP00000385385:P46A;ENSP00000384459:P42A	ENSP00000385385:P46A	P	-	1	0	PDIA6	10876890	0.010000	0.17322	0.001000	0.08648	0.003000	0.03518	0.409000	0.21082	0.026000	0.15269	-0.251000	0.11542	CCC	PDIA6	-	NULL		0.488	PDIA6-002	PUTATIVE	basic|exp_conf	protein_coding	PDIA6	HGNC	protein_coding	OTTHUMT00000323575.2	G	NM_005742		10959439	-1	no_errors	ENST00000404371	ensembl	human	putative	70_37	missense	SNP	0.001	C
PDK4	5166	genome.wustl.edu	37	7	95219000	95219000	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr7:95219000G>A	ENST00000005178.5	-	7	920	c.723C>T	c.(721-723)atC>atT	p.I241I		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	241	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GAACATACACGATGTGAATTG	0.289																																																	0													101.0	112.0	109.0					7																	95219000		2203	4298	6501	SO:0001819	synonymous_variant	5166			U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.723C>T	7.37:g.95219000G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.I241	ENST00000005178.5	37	c.723	CCDS5643.1	7																																																																																			PDK4	-	superfamily_ATPase-like_ATP-bd		0.289	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK4	HGNC	protein_coding	OTTHUMT00000333298.1	G	NM_002612		95219000	-1	no_errors	ENST00000005178	ensembl	human	known	70_37	silent	SNP	0.453	A
PDZRN3	23024	genome.wustl.edu	37	3	73453428	73453428	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:73453428G>A	ENST00000263666.4	-	4	1151	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M	PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000462146.2_Missense_Mutation_p.T3M|PDZRN3_ENST00000535920.1_Missense_Mutation_p.T68M|PDZRN3_ENST00000466780.1_Missense_Mutation_p.T3M|PDZRN3_ENST00000479530.1_Missense_Mutation_p.T63M	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	346					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGATGGAGGCGTGAACATTTT	0.532																																																	0													212.0	170.0	184.0					3																	73453428		2203	4300	6503	SO:0001583	missense	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1037C>T	3.37:g.73453428G>A	ENSP00000263666:p.Thr346Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING,pfscan_Znf_TRAF	p.T346M	ENST00000263666.4	37	c.1037	CCDS33789.1	3	.	.	.	.	.	.	.	.	.	.	G	15.49	2.847598	0.51164	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.10860	2.83;3.58;3.45;3.45;3.58;3.58	6.07	4.28	0.50868	PDZ/DHR/GLGF (1);	0.232551	0.41823	D	0.000810	T	0.16981	0.0408	L	0.54323	1.7	0.33955	D	0.644936	D;D;D;D	0.63046	0.989;0.986;0.981;0.992	P;B;P;B	0.52710	0.707;0.361;0.513;0.431	T	0.22034	-1.0228	10	0.54805	T	0.06	.	6.993	0.24765	0.1499:0.2349:0.6153:0.0	.	68;63;63;346	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	M	346;68;3;3;63;346;44	ENSP00000263666:T346M;ENSP00000442026:T68M;ENSP00000418168:T3M;ENSP00000418484:T3M;ENSP00000418624:T63M;ENSP00000419250:T44M	ENSP00000263666:T346M	T	-	2	0	PDZRN3	73536118	0.535000	0.26370	0.465000	0.27155	0.587000	0.36485	1.046000	0.30354	0.896000	0.36366	0.655000	0.94253	ACG	PDZRN3	-	superfamily_PDZ		0.532	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	G	XM_041363		73453428	-1	no_errors	ENST00000263666	ensembl	human	known	70_37	missense	SNP	0.988	A
PHC2	1912	genome.wustl.edu	37	1	33837992	33837992	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:33837992C>G	ENST00000257118.5	-	2	284	c.231G>C	c.(229-231)caG>caC	p.Q77H	PHC2_ENST00000419414.2_Missense_Mutation_p.Q77H|PHC2_ENST00000431992.1_Missense_Mutation_p.Q77H|PHC2_ENST00000373416.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	77	Gln-rich.				multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CGGCGTACATCTGCTGCAGGT	0.677																																																	0													29.0	29.0	29.0					1																	33837992		2203	4300	6503	SO:0001583	missense	1912			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.231G>C	1.37:g.33837992C>G	ENSP00000257118:p.Gln77His	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.Q77H	ENST00000257118.5	37	c.231	CCDS378.1	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958699	0.92726	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.76578	-0.38;-1.03;-0.56	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.87954	0.6308	M	0.79123	2.44	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.996	D;D;D	0.87578	0.998;0.995;0.986	D	0.89558	0.3804	10	0.87932	D	0	-12.0192	15.8807	0.79201	0.0:1.0:0.0:0.0	.	77;77;77	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	H	77	ENSP00000389436:Q77H;ENSP00000257118:Q77H;ENSP00000391440:Q77H	ENSP00000257118:Q77H	Q	-	3	2	PHC2	33610579	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.905000	0.69893	2.326000	0.78906	0.655000	0.94253	CAG	PHC2	-	NULL		0.677	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	C	NM_198040		33837992	-1	no_errors	ENST00000419414	ensembl	human	known	70_37	missense	SNP	1.000	G
PIGG	54872	genome.wustl.edu	37	4	502747	502747	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:502747G>C	ENST00000453061.2	+	5	995	c.889G>C	c.(889-891)Gaa>Caa	p.E297Q	PIGG_ENST00000509768.1_Missense_Mutation_p.E208Q|PIGG_ENST00000503111.1_Missense_Mutation_p.E208Q|PIGG_ENST00000296306.7_Missense_Mutation_p.E208Q|PIGG_ENST00000383028.4_Missense_Mutation_p.E164Q|PIGG_ENST00000536264.1_Missense_Mutation_p.E175Q|PIGG_ENST00000504346.1_Missense_Mutation_p.E208Q|PIGG_ENST00000310340.5_Missense_Mutation_p.E297Q	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	297					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						TTCTGCGTTTGAAAGGAAACC	0.393																																																	0													73.0	73.0	73.0					4																	502747		2203	4300	6503	SO:0001583	missense	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.889G>C	4.37:g.502747G>C	ENSP00000415203:p.Glu297Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E297Q	ENST00000453061.2	37	c.889	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	9.680	1.149100	0.21288	.	.	ENSG00000174227	ENST00000296306;ENST00000536264;ENST00000310340;ENST00000453061;ENST00000504346;ENST00000503111;ENST00000383028;ENST00000509768	T;T;T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.63	3.79	0.43588	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.140644	0.64402	N	0.000005	T	0.20700	0.0498	N	0.25031	0.7	0.30716	N	0.748744	B;B;B;B;B;B	0.21071	0.009;0.051;0.02;0.01;0.036;0.004	B;B;B;B;B;B	0.23018	0.014;0.041;0.043;0.024;0.026;0.012	T	0.10109	-1.0644	10	0.10636	T	0.68	.	15.7458	0.77939	0.0:0.2737:0.7262:0.0	.	175;164;208;208;297;297	B4DKC7;Q5H8A4-3;D6RFE8;Q5H8A4-5;Q5H8A4;Q5H8A4-2	.;.;.;.;PIGG_HUMAN;.	Q	208;175;297;297;208;208;164;208	ENSP00000296306:E208Q;ENSP00000439240:E175Q;ENSP00000311750:E297Q;ENSP00000415203:E297Q;ENSP00000424800:E208Q;ENSP00000426002:E208Q;ENSP00000372494:E164Q;ENSP00000421550:E208Q	ENSP00000296306:E208Q	E	+	1	0	PIGG	492747	1.000000	0.71417	0.915000	0.36163	0.967000	0.64934	2.042000	0.41222	1.368000	0.46115	0.655000	0.94253	GAA	PIGG	-	superfamily_Alkaline_phosphatase_core		0.393	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	G	NM_017733		502747	+1	no_errors	ENST00000453061	ensembl	human	known	70_37	missense	SNP	0.998	C
PLCB2	5330	genome.wustl.edu	37	15	40589076	40589076	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr15:40589076C>T	ENST00000260402.3	-	14	1606	c.1357G>A	c.(1357-1359)Gat>Aat	p.D453N	PLCB2_ENST00000557821.1_Missense_Mutation_p.D453N|PLCB2_ENST00000456256.2_Missense_Mutation_p.D453N	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	453	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CCCCTGAGATCCTCAGGGCTG	0.557																																																	0													81.0	83.0	82.0					15																	40589076		1974	4161	6135	SO:0001583	missense	5330				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1357G>A	15.37:g.40589076C>T	ENSP00000260402:p.Asp453Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6J2|B9EGH5	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.D453N	ENST00000260402.3	37	c.1357	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055636	0.75960	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.64438	-0.1;-0.1	4.55	4.55	0.56014	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.054444	0.64402	D	0.000001	T	0.62024	0.2394	L	0.46614	1.455	0.80722	D	1	P;B;B	0.39920	0.695;0.101;0.024	B;B;B	0.43225	0.412;0.034;0.034	T	0.65759	-0.6090	10	0.51188	T	0.08	.	17.4629	0.87624	0.0:1.0:0.0:0.0	.	453;453;453	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	N	453	ENSP00000260402:D453N;ENSP00000411991:D453N	ENSP00000260402:D453N	D	-	1	0	PLCB2	38376368	1.000000	0.71417	0.992000	0.48379	0.307000	0.27823	7.627000	0.83176	2.517000	0.84864	0.655000	0.94253	GAT	PLCB2	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom		0.557	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	HGNC	protein_coding	OTTHUMT00000418430.1	C			40589076	-1	no_errors	ENST00000260402	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEKHO1	51177	genome.wustl.edu	37	1	150131110	150131110	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:150131110C>T	ENST00000369124.4	+	6	900	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.R174W|PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.R25W	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	208	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGAGAGCTTTCGGGTTGACCT	0.612																																																	0													74.0	74.0	74.0					1																	150131110		2203	4300	6503	SO:0001583	missense	51177			AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.622C>T	1.37:g.150131110C>T	ENSP00000358120:p.Arg208Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R208W	ENST00000369124.4	37	c.622	CCDS945.1	1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831276	0.71258	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.55413	0.53;0.52	4.97	4.06	0.47325	.	0.220091	0.42420	D	0.000709	T	0.58264	0.2110	M	0.64997	1.995	0.48395	D	0.999649	D	0.89917	1.0	D	0.69654	0.965	T	0.64655	-0.6356	10	0.87932	D	0	-29.1076	11.9311	0.52847	0.3156:0.6844:0.0:0.0	.	208	Q53GL0	PKHO1_HUMAN	W	25;174;208;88	ENSP00000025469:R174W;ENSP00000358120:R208W	ENSP00000025469:R174W	R	+	1	2	PLEKHO1	148397734	0.990000	0.36364	0.996000	0.52242	0.996000	0.88848	2.898000	0.48672	1.298000	0.44778	0.655000	0.94253	CGG	PLEKHO1	-	NULL		0.612	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHO1	HGNC	protein_coding	OTTHUMT00000034962.1	C	NM_016274		150131110	+1	no_errors	ENST00000369124	ensembl	human	known	70_37	missense	SNP	0.997	T
PLXNB3	5365	genome.wustl.edu	37	X	153039425	153039425	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:153039425G>T	ENST00000361971.5	+	20	3505	c.3391G>T	c.(3391-3393)Gtg>Ttg	p.V1131L	PLXNB3_ENST00000538282.1_Missense_Mutation_p.V741L|PLXNB3_ENST00000538776.1_Missense_Mutation_p.V784L|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538966.1_Missense_Mutation_p.V1154L	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1131	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CAACGTGCAAGTGGACTTCGC	0.687																																																	0													47.0	48.0	47.0					X																	153039425		2201	4298	6499	SO:0001583	missense	5365			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3391G>T	X.37:g.153039425G>T	ENSP00000355378:p.Val1131Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.V1154L	ENST00000361971.5	37	c.3460	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472265	0.26423	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.68025	5.28;5.24;4.66;-0.3	5.28	3.52	0.40303	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.123056	0.53938	D	0.000049	T	0.55673	0.1935	L	0.53249	1.67	0.09310	N	0.999998	B;B;B	0.30563	0.11;0.285;0.11	B;B;B	0.32928	0.042;0.155;0.109	T	0.41088	-0.9528	10	0.08837	T	0.75	.	8.4202	0.32696	0.19:0.0:0.81:0.0	.	784;1154;1131	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	L	1154;1131;784;741	ENSP00000442736:V1154L;ENSP00000355378:V1131L;ENSP00000445569:V784L;ENSP00000441919:V741L	ENSP00000355378:V1131L	V	+	1	0	PLXNB3	152692619	0.831000	0.29352	0.371000	0.25978	0.098000	0.18820	1.145000	0.31577	0.450000	0.26774	0.529000	0.55759	GTG	PLXNB3	-	superfamily_Ig_E-set,smart_IPT_TIG_rcpt		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	G			153039425	+1	no_errors	ENST00000538966	ensembl	human	known	70_37	missense	SNP	0.092	T
POFUT2	23275	genome.wustl.edu	37	21	46705580	46705580	+	Intron	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr21:46705580C>G	ENST00000349485.5	-	2	409				POFUT2_ENST00000471540.1_5'Flank|POFUT2_ENST00000331343.7_Intron|BX322557.10_ENST00000454115.2_RNA	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2						fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		CCCAGCGTGCCGCTCGGCCTC	0.537																																																	0													51.0	53.0	52.0					21																	46705580		2203	4300	6503	SO:0001627	intron_variant	23275			AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.382+12G>C	21.37:g.46705580C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	RNA	SNP	-	NULL	ENST00000349485.5	37	NULL	CCDS13719.1	21																																																																																			POFUT2	-	-		0.537	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT2	HGNC	protein_coding	OTTHUMT00000192573.2	C	NM_015227		46705580	-1	no_errors	ENST00000476653	ensembl	human	putative	70_37	rna	SNP	0.000	G
PPM1G	5496	genome.wustl.edu	37	2	27607771	27607771	+	Missense_Mutation	SNP	T	T	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:27607771T>G	ENST00000344034.4	-	5	858	c.594A>C	c.(592-594)gaA>gaC	p.E198D	PPM1G_ENST00000350803.4_Missense_Mutation_p.E198D	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	198					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GTGAAGGAGTTTCCCTAGTTG	0.597																																																	0													175.0	159.0	165.0					2																	27607771		2203	4300	6503	SO:0001583	missense	5496			Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.594A>C	2.37:g.27607771T>G	ENSP00000342778:p.Glu198Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.E198D	ENST00000344034.4	37	c.594	CCDS1752.1	2	.	.	.	.	.	.	.	.	.	.	T	11.26	1.586033	0.28268	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412	T;T	0.43294	0.95;0.95	5.75	4.6	0.57074	Protein phosphatase 2C-like (3);	0.557967	0.18265	N	0.146500	T	0.23451	0.0567	N	0.16478	0.41	0.30887	N	0.73076	B	0.28470	0.213	B	0.23419	0.046	T	0.14420	-1.0473	10	0.13108	T	0.6	-4.9645	10.1664	0.42882	0.0:0.0785:0.0:0.9215	.	198	O15355	PPM1G_HUMAN	D	198;198;181	ENSP00000342778:E198D;ENSP00000264714:E198D	ENSP00000342778:E198D	E	-	3	2	PPM1G	27461275	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	1.618000	0.36954	2.202000	0.70862	0.533000	0.62120	GAA	PPM1G	-	superfamily_PP2C-like,smart_PP2C-like		0.597	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1G	HGNC	protein_coding	OTTHUMT00000215032.1	T	NM_002707		27607771	-1	no_errors	ENST00000344034	ensembl	human	known	70_37	missense	SNP	0.993	G
POLR1A	25885	genome.wustl.edu	37	2	86257483	86257483	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:86257483C>G	ENST00000263857.6	-	31	4993	c.4615G>C	c.(4615-4617)Gac>Cac	p.D1539H	POLR1A_ENST00000409681.1_Missense_Mutation_p.D1478H			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1539					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GAGCTCATGTCAAAGTTGATC	0.517																																																	0													117.0	107.0	110.0					2																	86257483		1977	4144	6121	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4615G>C	2.37:g.86257483C>G	ENSP00000263857:p.Asp1539His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.D1539H	ENST00000263857.6	37	c.4615	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571064	0.86542	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67523	-0.27;-0.27	4.12	4.12	0.48240	RNA polymerase Rpb1, domain 5 (1);	0.118608	0.53938	D	0.000041	T	0.76378	0.3979	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.79605	-0.1734	10	0.66056	D	0.02	-35.3337	17.2845	0.87137	0.0:1.0:0.0:0.0	.	1539	O95602	RPA1_HUMAN	H	1539;1478	ENSP00000263857:D1539H;ENSP00000386300:D1478H	ENSP00000263857:D1539H	D	-	1	0	POLR1A	86110994	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.361000	0.79497	2.250000	0.74265	0.655000	0.94253	GAC	POLR1A	-	pfam_RNA_pol_Rpb1_5		0.517	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	C	NM_015425		86257483	-1	no_errors	ENST00000263857	ensembl	human	known	70_37	missense	SNP	1.000	G
PSG2	5670	genome.wustl.edu	37	19	43586776	43586776	+	5'UTR	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:43586776C>T	ENST00000406487.1	-	0	44				PSG2_ENST00000491995.1_5'UTR	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2						cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				GATCCAGAAACTTCCTGAGCA	0.597																																																	0													37.0	41.0	40.0					19																	43586776		692	1591	2283	SO:0001623	5_prime_UTR_variant	5670				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.-55G>A	19.37:g.43586776C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCD9|Q9UEA4|Q9UQ78	RNA	SNP	-	NULL	ENST00000406487.1	37	NULL	CCDS12616.1	19																																																																																			PSG2	-	-		0.597	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG2	HGNC	protein_coding	OTTHUMT00000323083.1	C	NM_031246		43586776	-1	no_errors	ENST00000491995	ensembl	human	known	70_37	rna	SNP	0.001	T
PTPRG	5793	genome.wustl.edu	37	3	62063909	62063909	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:62063909G>A	ENST00000474889.1	+	5	969	c.592G>A	c.(592-594)Gga>Aga	p.G198R	PTPRG_ENST00000295874.10_Missense_Mutation_p.G198R	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	198	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CAGAATAATCGGAGCCATGGC	0.313																																																	0													56.0	57.0	56.0					3																	62063909		2202	4300	6502	SO:0001583	missense	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.592G>A	3.37:g.62063909G>A	ENSP00000418112:p.Gly198Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.G198R	ENST00000474889.1	37	c.592	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124843	0.56613	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.66995	-0.24;-0.24	6.07	6.07	0.98685	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.190513	0.43919	D	0.000501	T	0.71896	0.3394	L	0.38175	1.15	0.49299	D	0.999776	D;D	0.71674	0.998;0.994	P;P	0.59288	0.855;0.723	T	0.63305	-0.6667	10	0.16420	T	0.52	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	198;198	P23470-2;P23470	.;PTPRG_HUMAN	R	198	ENSP00000418112:G198R;ENSP00000295874:G198R	ENSP00000295874:G198R	G	+	1	0	PTPRG	62038949	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.988000	0.88194	2.885000	0.99019	0.655000	0.94253	GGA	PTPRG	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.313	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	G	NM_002841		62063909	+1	no_errors	ENST00000474889	ensembl	human	known	70_37	missense	SNP	1.000	A
R3HCC1L	27291	genome.wustl.edu	37	10	99995795	99995795	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr10:99995795G>C	ENST00000298999.3	+	9	2446	c.2143G>C	c.(2143-2145)Gca>Cca	p.A715P	R3HCC1L_ENST00000370586.2_Missense_Mutation_p.A121P|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.A131P|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.A715P	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	729							nucleotide binding (GO:0000166)										CCTCCAGCCAGCAAAGGAGCG	0.478																																																	0													72.0	70.0	71.0					10																	99995795		2203	4300	6503	SO:0001583	missense	27291			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.2143G>C	10.37:g.99995795G>C	ENSP00000298999:p.Ala715Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.A715P	ENST00000298999.3	37	c.2143	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993543	0.54041	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.78	5.78	0.91487	.	0.176894	0.48286	D	0.000182	T	0.50360	0.1611	L	0.33339	1.005	0.80722	D	1	D;D;D	0.89917	0.971;1.0;0.999	P;D;D	0.72338	0.673;0.977;0.975	T	0.26780	-1.0093	9	.	.	.	-7.8579	19.1384	0.93438	0.0:0.0:1.0:0.0	.	121;729;715	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	P	715;715;121;131;122	ENSP00000359616:A715P;ENSP00000298999:A715P;ENSP00000359618:A121P;ENSP00000314018:A131P	.	A	+	1	0	C10orf28	99985785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.791000	0.62460	2.890000	0.99128	0.655000	0.94253	GCA	R3HCC1L	-	NULL		0.478	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1	G	NM_014472		99995795	+1	no_errors	ENST00000298999	ensembl	human	known	70_37	missense	SNP	1.000	C
RABL6	55684	genome.wustl.edu	37	9	139733894	139733894	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:139733894G>T	ENST00000311502.7	+	12	1950	c.1714G>T	c.(1714-1716)Gac>Tac	p.D572Y	RABL6_ENST00000371663.4_Missense_Mutation_p.D573Y|RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000371675.3_Missense_Mutation_p.D457Y			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	572					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CGTCATGGATGACCCCGACTT	0.642																																																	0													33.0	39.0	37.0					9																	139733894		2121	4239	6360	SO:0001583	missense	55684			AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1714G>T	9.37:g.139733894G>T	ENSP00000311134:p.Asp572Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.D573Y	ENST00000311502.7	37	c.1717	CCDS48058.1	9	.	.	.	.	.	.	.	.	.	.	.	20.4	3.992430	0.74703	.	.	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000371675;ENST00000435930	T;T;T;D	0.82167	-0.74;-0.75;-0.76;-1.58	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.90741	0.7094	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.92247	0.5805	10	0.87932	D	0	-33.935	15.6762	0.77326	0.0:0.0:1.0:0.0	.	366;573;572	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	Y	573;572;457;366	ENSP00000360727:D573Y;ENSP00000311134:D572Y;ENSP00000360740:D457Y;ENSP00000408442:D366Y	ENSP00000311134:D572Y	D	+	1	0	C9orf86	138853715	1.000000	0.71417	0.985000	0.45067	0.462000	0.32619	6.689000	0.74562	2.037000	0.60232	0.462000	0.41574	GAC	RABL6	-	NULL		0.642	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	HGNC	protein_coding	OTTHUMT00000055141.4	G	NM_024718		139733894	+1	no_errors	ENST00000371663	ensembl	human	known	70_37	missense	SNP	1.000	T
RAD21L1	642636	genome.wustl.edu	37	20	1223271	1223271	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:1223271G>T	ENST00000409241.1	+	9	958	c.865G>T	c.(865-867)Gag>Tag	p.E289*	RAD21L1_ENST00000402452.1_Nonsense_Mutation_p.E289*|RAD21L1_ENST00000381882.2_Nonsense_Mutation_p.E289*	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	289					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						AGACATTGCTGAGAAAAGGAA	0.348																																																	0													52.0	42.0	45.0					20																	1223271		692	1591	2283	SO:0001587	stop_gained	642636			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.865G>T	20.37:g.1223271G>T	ENSP00000386414:p.Glu289*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Nonsense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.E289*	ENST00000409241.1	37	c.865	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.358821	0.95854	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	.	.	.	4.77	2.68	0.31781	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	3.0762	0.06247	0.0998:0.2448:0.5:0.1554	.	.	.	.	X	289	.	ENSP00000371306:E289X	E	+	1	0	RAD21L1	1171271	0.992000	0.36948	0.998000	0.56505	0.911000	0.54048	0.967000	0.29344	1.194000	0.43101	0.557000	0.71058	GAG	RAD21L1	-	NULL		0.348	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	G			1223271	+1	no_errors	ENST00000409241	ensembl	human	known	70_37	nonsense	SNP	0.961	T
RBM39	9584	genome.wustl.edu	37	20	34326959	34326959	+	Intron	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:34326959G>C	ENST00000253363.6	-	3	75				RBM39_ENST00000528062.3_Intron|RBM39_ENST00000407261.4_Intron|RBM39_ENST00000397370.3_Intron|RBM39_ENST00000361162.6_Intron|RBM39_ENST00000463098.1_5'Flank			Q14498	RBM39_HUMAN	RNA binding motif protein 39						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GTTGATAGAAGAACATCATGA	0.388																																																	0													103.0	87.0	93.0					20																	34326959		2203	4300	6503	SO:0001627	intron_variant	9584			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.52-20C>G	20.37:g.34326959G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	RNA	SNP	-	NULL	ENST00000253363.6	37	NULL	CCDS13266.1	20																																																																																			RBM39	-	-		0.388	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	G	NM_184237		34326959	-1	no_errors	ENST00000487604	ensembl	human	putative	70_37	rna	SNP	1.000	C
RHCE	6006	genome.wustl.edu	37	1	25737867	25737867	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:25737867G>A	ENST00000349320.3	-	3	452	c.64C>T	c.(64-66)Cat>Tat	p.H22Y	RHCE_ENST00000495048.1_Intron|RHCE_ENST00000455194.1_Intron|RHCE_ENST00000349438.4_Intron|RHCE_ENST00000346452.4_Intron|RHCE_ENST00000243186.6_Intron|RHCE_ENST00000413854.1_Intron|RHCE_ENST00000425135.1_Intron|RHCE_ENST00000340849.4_Intron|RHCE_ENST00000374352.2_Missense_Mutation_p.H22Y|RHCE_ENST00000294413.7_Intron			P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	0						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		TGATAACAATGAGAAGCTCTC	0.398																																																	0																																										SO:0001583	missense	6006			BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000349320.3:c.64C>T	1.37:g.25737867G>A	ENSP00000311185:p.His22Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.H22Y	ENST00000349320.3	37	c.64		1	.	.	.	.	.	.	.	.	.	.	G	8.215	0.801212	0.16397	.	.	ENSG00000188672	ENST00000374352;ENST00000349320	T;T	0.20598	2.06;2.06	3.04	-1.55	0.08558	.	.	.	.	.	T	0.12347	0.0300	.	.	.	0.09310	N	0.999998	P	0.52316	0.952	B	0.39531	0.302	T	0.16217	-1.0410	8	0.48119	T	0.1	.	3.4275	0.07416	0.4185:0.2062:0.3753:0.0	.	22	Q5VSJ9	.	Y	22	ENSP00000363472:H22Y;ENSP00000311185:H22Y	ENSP00000311185:H22Y	H	-	1	0	RHCE	25610454	0.000000	0.05858	0.002000	0.10522	0.060000	0.15804	-0.599000	0.05700	-0.319000	0.08652	0.561000	0.74099	CAT	RHCE	-	superfamily_NH4_transpt_AmtB-like		0.398	RHCE-005	PUTATIVE	basic	protein_coding	RHCE	HGNC	protein_coding	OTTHUMT00000101974.1	G	NM_020485		25737867	-1	no_errors	ENST00000374352	ensembl	human	known	70_37	missense	SNP	0.002	A
RGS18	64407	genome.wustl.edu	37	1	192127615	192127615	+	5'UTR	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:192127615G>A	ENST00000367460.3	+	0	29				RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18						G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGCAGAGACAGAAAGAAACGC	0.323																																																	0																																										SO:0001623	5_prime_UTR_variant	64407			AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.-153G>A	1.37:g.192127615G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD23	RNA	SNP	-	NULL	ENST00000367460.3	37	NULL	CCDS1374.1	1																																																																																			RGS18	-	-		0.323	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	HGNC	protein_coding	OTTHUMT00000086382.1	G	NM_130782		192127615	+1	no_errors	ENST00000481707	ensembl	human	known	70_37	rna	SNP	0.003	A
RNF44	22838	genome.wustl.edu	37	5	175956299	175956299	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:175956299delT	ENST00000274811.4	-	10	1750	c.1226delA	c.(1225-1227)aagfs	p.K409fs	RNF44_ENST00000537487.1_Frame_Shift_Del_p.K328fs	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	409							zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTCAACCACTTGTCAACACA	0.592																																																	0													68.0	65.0	66.0					5																	175956299		2203	4300	6503	SO:0001589	frameshift_variant	22838			AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.1226delA	5.37:g.175956299delT	ENSP00000274811:p.Lys409fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYE0|Q8ND05|Q9UPQ2	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.K409fs	ENST00000274811.4	37	c.1226	CCDS4404.1	5																																																																																			RNF44	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.592	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF44	HGNC	protein_coding	OTTHUMT00000253156.2	T			175956299	-1	no_errors	ENST00000274811	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
ROPN1	54763	genome.wustl.edu	37	3	123699316	123699316	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:123699316C>T	ENST00000184183.4	-	3	353	c.13G>A	c.(13-15)Gat>Aat	p.D5N	ROPN1_ENST00000484329.1_Missense_Mutation_p.D5N|ROPN1_ENST00000479867.1_Missense_Mutation_p.D5N|ROPN1_ENST00000459660.1_Missense_Mutation_p.D5N|ROPN1_ENST00000405845.3_Missense_Mutation_p.D5N|ROPN1_ENST00000495093.1_Missense_Mutation_p.D5N	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	5						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		GTTGGCTTATCTGTCTGAGCC	0.512																																																	0													74.0	74.0	74.0					3																	123699316		2203	4300	6503	SO:0001583	missense	54763			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.13G>A	3.37:g.123699316C>T	ENSP00000184183:p.Asp5Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DN99|Q9UF38	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.D5N	ENST00000184183.4	37	c.13	CCDS3026.1	3	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110063	0.56398	.	.	ENSG00000065371	ENST00000184183;ENST00000405845;ENST00000467907;ENST00000460743;ENST00000495336;ENST00000496145;ENST00000459660;ENST00000479867;ENST00000480459;ENST00000498333;ENST00000495093;ENST00000484329	T;T;T;T	0.35236	1.78;1.78;1.38;1.32	4.11	3.23	0.37069	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.171205	0.39759	N	0.001261	T	0.29684	0.0741	L	0.42245	1.32	0.34595	D	0.715904	P	0.37330	0.59	B	0.35413	0.202	T	0.48445	-0.9035	10	0.56958	D	0.05	-2.9193	11.6079	0.51043	0.0:0.8199:0.1801:0.0	.	5	Q9HAT0	ROP1A_HUMAN	N	5	ENSP00000184183:D5N;ENSP00000385919:D5N;ENSP00000417067:D5N;ENSP00000420310:D5N	ENSP00000184183:D5N	D	-	1	0	ROPN1	125182006	0.687000	0.27671	0.780000	0.31762	0.305000	0.27757	1.344000	0.33941	1.088000	0.41272	0.555000	0.69702	GAT	ROPN1	-	superfamily_cAMP_dep_PK_reg_su_I/II_a/b		0.512	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	HGNC	protein_coding	OTTHUMT00000356188.2	C	NM_017578		123699316	-1	no_errors	ENST00000184183	ensembl	human	known	70_37	missense	SNP	0.981	T
RPS13	6207	genome.wustl.edu	37	11	17098993	17098993	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:17098993G>C	ENST00000525634.1	-	2	200	c.55C>G	c.(55-57)Cga>Gga	p.R19G	RPS13_ENST00000526895.1_5'UTR|SNORD14A_ENST00000606526.1_RNA|PIK3C2A_ENST00000531428.1_5'Flank|RPS13_ENST00000228140.2_Missense_Mutation_p.R19G|SNORD14B_ENST00000364533.1_RNA			P62277	RS13_HUMAN	ribosomal protein S13	19					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						ACGCTGCGTCGATAGGGTAAA	0.632																																																	0													47.0	52.0	50.0					11																	17098993		2200	4294	6494	SO:0001583	missense	6207			X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.55C>G	11.37:g.17098993G>C	ENSP00000435777:p.Arg19Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R549|P19116|Q02546|Q29200|Q498Y0	Missense_Mutation	SNP	pfam_Ribosomal_S13/S15_N,pfam_Ribosomal_S15,superfamily_S15_NS1_RNA-bd	p.R19G	ENST00000525634.1	37	c.55	CCDS7823.1	11	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447511	0.84101	.	.	ENSG00000110700	ENST00000228140;ENST00000525634;ENST00000533969	T	0.26660	1.72	6.07	6.07	0.98685	Ribosomal protein S13/S15, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.89534	3.04	0.80722	D	1	B	0.15719	0.014	B	0.32211	0.142	T	0.45381	-0.9265	10	0.72032	D	0.01	-36.9433	14.175	0.65534	0.0:0.0:0.8507:0.1493	.	19	P62277	RS13_HUMAN	G	19	ENSP00000432096:R19G	ENSP00000228140:R19G	R	-	1	2	RPS13	17055569	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.097000	0.41748	2.884000	0.98904	0.655000	0.94253	CGA	RPS13	-	pfam_Ribosomal_S13/S15_N		0.632	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS13	HGNC	protein_coding	OTTHUMT00000387320.2	G	NM_001017		17098993	-1	no_errors	ENST00000525634	ensembl	human	known	70_37	missense	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	39002929	39002929	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:39002929G>A	ENST00000359596.3	+	63	9278	c.9278G>A	c.(9277-9279)cGc>cAc	p.R3093H	RYR1_ENST00000355481.4_Missense_Mutation_p.R3093H|RYR1_ENST00000360985.3_Missense_Mutation_p.R3093H			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3093					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCTGGCCTCCGCTCCTTCTTC	0.617																																																	0													78.0	77.0	77.0					19																	39002929		2203	4300	6503	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9278G>A	19.37:g.39002929G>A	ENSP00000352608:p.Arg3093His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R3093H	ENST00000359596.3	37	c.9278	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151462	0.78001	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.96913	-4.17;-4.17;-4.17	4.46	4.46	0.54185	.	0.000000	0.64402	U	0.000002	D	0.97670	0.9236	M	0.70595	2.14	0.53688	D	0.999979	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.991	D	0.97536	1.0083	10	0.41790	T	0.15	.	16.9115	0.86141	0.0:0.0:1.0:0.0	.	3093;3093;3093	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	H	3093;3093;3093;13	ENSP00000352608:R3093H;ENSP00000347667:R3093H;ENSP00000354254:R3093H	ENSP00000347667:R3093H	R	+	2	0	RYR1	43694769	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.633000	0.98432	2.303000	0.77524	0.591000	0.81541	CGC	RYR1	-	NULL		0.617	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	G			39002929	+1	no_errors	ENST00000359596	ensembl	human	known	70_37	missense	SNP	1.000	A
SACS	26278	genome.wustl.edu	37	13	23914001	23914001	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr13:23914001C>T	ENST00000382292.3	-	9	4287	c.4014G>A	c.(4012-4014)aaG>aaA	p.K1338K	SACS_ENST00000382298.3_Silent_p.K1338K|SACS_ENST00000402364.1_Silent_p.K588K			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1338					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGAGATATATCTTCTGAATAA	0.338																																																	0													96.0	87.0	90.0					13																	23914001		2203	4300	6503	SO:0001819	synonymous_variant	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4014G>A	13.37:g.23914001C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin,superfamily_ATPase-like_ATP-bd,superfamily_DnaJ_N,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_N,pfscan_Ubiquitin_supergroup	p.K1338	ENST00000382292.3	37	c.4014	CCDS9300.2	13																																																																																			SACS	-	NULL		0.338	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	C	NM_014363		23914001	-1	no_errors	ENST00000382292	ensembl	human	known	70_37	silent	SNP	0.998	T
SALL3	27164	genome.wustl.edu	37	18	76754968	76754968	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr18:76754968G>C	ENST00000537592.2	+	2	2977	c.2977G>C	c.(2977-2979)Gaa>Caa	p.E993Q	SALL3_ENST00000536229.3_Intron|SALL3_ENST00000575389.2_Intron	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	993					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GAGCGCGTTGGAAATCCACTA	0.572																																																	0													62.0	61.0	61.0					18																	76754968		2203	4300	6503	SO:0001583	missense	27164			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2977G>C	18.37:g.76754968G>C	ENSP00000441823:p.Glu993Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E993Q	ENST00000537592.2	37	c.2977	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	G	9.799	1.180125	0.21787	.	.	ENSG00000256463	ENST00000537592	T	0.04317	3.65	5.28	3.47	0.39725	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.408437	0.18918	N	0.127576	T	0.03011	0.0089	N	0.05012	-0.13	0.80722	D	1	B	0.22003	0.063	B	0.20767	0.031	T	0.48091	-0.9065	10	0.14656	T	0.56	-2.9311	15.6967	0.77506	0.0:0.2831:0.7169:0.0	.	993	Q9BXA9	SALL3_HUMAN	Q	993	ENSP00000441823:E993Q	ENSP00000299466:E993Q	E	+	1	0	SALL3	74855956	1.000000	0.71417	0.765000	0.31456	0.717000	0.41224	2.687000	0.46976	0.580000	0.29522	0.561000	0.74099	GAA	SALL3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.572	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	G	NM_171999		76754968	+1	no_errors	ENST00000537592	ensembl	human	known	70_37	missense	SNP	1.000	C
SCN7A	6332	genome.wustl.edu	37	2	167266421	167266421	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:167266421C>T	ENST00000409855.1	-	24	3862	c.3736G>A	c.(3736-3738)Gat>Aat	p.D1246N		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1246					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GTTACCACATCAAAGATGAAT	0.333																																																	0													35.0	34.0	35.0					2																	167266421		1847	4084	5931	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3736G>A	2.37:g.167266421C>T	ENSP00000386796:p.Asp1246Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.D1246N	ENST00000409855.1	37	c.3736	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843916	0.91197	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.96992	-4.2	5.54	5.54	0.83059	.	0.125819	0.48286	D	0.000188	D	0.97971	0.9332	M	0.88310	2.945	0.45161	D	0.998177	D	0.67145	0.996	P	0.57846	0.828	D	0.98487	1.0608	10	0.87932	D	0	.	17.0229	0.86438	0.0:1.0:0.0:0.0	.	1246	Q01118	SCN7A_HUMAN	N	1246	ENSP00000386796:D1246N	ENSP00000259060:D1246N	D	-	1	0	SCN7A	166974667	1.000000	0.71417	0.998000	0.56505	0.518000	0.34316	7.625000	0.83145	2.880000	0.98712	0.650000	0.86243	GAT	SCN7A	-	NULL		0.333	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	C			167266421	-1	no_errors	ENST00000409855	ensembl	human	known	70_37	missense	SNP	1.000	T
SCG2	7857	genome.wustl.edu	37	2	224462894	224462894	+	Silent	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:224462894G>C	ENST00000305409.2	-	2	1339	c.1107C>G	c.(1105-1107)ctC>ctG	p.L369L		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0	Interaction with FANCD2.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCCCAGTTTTGAGCATCTCAA	0.458																																																	0													70.0	71.0	70.0					2																	224462894		2203	4300	6503	SO:0001819	synonymous_variant	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1107C>G	2.37:g.224462894G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	pfam_Granin	p.L369	ENST00000305409.2	37	c.1107	CCDS2457.1	2																																																																																			SCG2	-	pfam_Granin		0.458	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	G	NM_003469		224462894	-1	no_errors	ENST00000305409	ensembl	human	known	70_37	silent	SNP	0.010	C
SDCCAG8	10806	genome.wustl.edu	37	1	243652402	243652402	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:243652402G>C	ENST00000366541.3	+	17	2190	c.2072G>C	c.(2071-2073)aGg>aCg	p.R691T	AKT3_ENST00000336199.5_Intron|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.R648T|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.R546T	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	691	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CTCCTGGAGAGGCAGAGCCTG	0.622																																																	0													27.0	29.0	28.0					1																	243652402		2203	4299	6502	SO:0001583	missense	10806			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.2072G>C	1.37:g.243652402G>C	ENSP00000355499:p.Arg691Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.R691T	ENST00000366541.3	37	c.2072	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279064	0.80692	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.73789	-0.53;-0.78;-0.75;0.2	5.63	4.72	0.59763	.	0.057860	0.64402	D	0.000003	T	0.70579	0.3240	L	0.29908	0.895	0.80722	D	1	P;P	0.51351	0.728;0.944	P;P	0.52957	0.447;0.714	T	0.66630	-0.5875	10	0.23302	T	0.38	-1.9467	11.9789	0.53109	0.0817:0.0:0.9183:0.0	.	648;691	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	T	648;691;546;392	ENSP00000348137:R648T;ENSP00000355499:R691T;ENSP00000341260:R546T;ENSP00000410200:R392T	ENSP00000341260:R546T	R	+	2	0	SDCCAG8	241719025	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	5.317000	0.65822	1.368000	0.46115	0.650000	0.86243	AGG	SDCCAG8	-	NULL		0.622	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	G	NM_006642		243652402	+1	no_errors	ENST00000366541	ensembl	human	known	70_37	missense	SNP	1.000	C
SEC23A	10484	genome.wustl.edu	37	14	39514438	39514438	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr14:39514438G>C	ENST00000307712.6	-	16	2345	c.1828C>G	c.(1828-1830)Caa>Gaa	p.Q610E	SEC23A_ENST00000545328.2_Missense_Mutation_p.Q581E|SEC23A_ENST00000536508.1_Missense_Mutation_p.Q508E|SEC23A_ENST00000537403.1_Missense_Mutation_p.Q408E	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	610					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		GTCAGATCTTGACGCATAAAA	0.353																																																	0													98.0	92.0	94.0					14																	39514438		2203	4300	6503	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1828C>G	14.37:g.39514438G>C	ENSP00000306881:p.Gln610Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.Q610E	ENST00000307712.6	37	c.1828	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	G	9.530	1.110698	0.20714	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.49	5.49	0.81192	Sec23/Sec24, helical domain (2);	0.000000	0.85682	D	0.000000	T	0.60830	0.2299	N	0.00197	-1.87	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.003;0.002;0.002	T	0.68961	-0.5271	10	0.02654	T	1	-12.2857	19.7347	0.96198	0.0:0.0:1.0:0.0	.	581;508;610	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	E	408;610;508;581	ENSP00000444193:Q408E;ENSP00000306881:Q610E;ENSP00000437715:Q508E;ENSP00000445393:Q581E	ENSP00000306881:Q610E	Q	-	1	0	SEC23A	38584189	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.792000	0.99085	2.746000	0.94184	0.655000	0.94253	CAA	SEC23A	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom		0.353	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	G			39514438	-1	no_errors	ENST00000307712	ensembl	human	known	70_37	missense	SNP	1.000	C
SEC31A	22872	genome.wustl.edu	37	4	83778199	83778199	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:83778199G>A	ENST00000395310.2	-	16	1969	c.1787C>T	c.(1786-1788)gCc>gTc	p.A596V	SEC31A_ENST00000505472.1_Missense_Mutation_p.A596V|SEC31A_ENST00000326950.5_Missense_Mutation_p.A557V|SEC31A_ENST00000355196.2_Missense_Mutation_p.A596V|SEC31A_ENST00000505984.1_Missense_Mutation_p.A557V|SEC31A_ENST00000513858.1_Missense_Mutation_p.A557V|SEC31A_ENST00000509142.1_Missense_Mutation_p.A596V|SEC31A_ENST00000311785.7_Missense_Mutation_p.A596V|SEC31A_ENST00000443462.2_Missense_Mutation_p.A591V|SEC31A_ENST00000432794.1_Missense_Mutation_p.A596V|SEC31A_ENST00000448323.1_Missense_Mutation_p.A596V|SEC31A_ENST00000500777.2_Missense_Mutation_p.A557V|SEC31A_ENST00000508479.1_Missense_Mutation_p.A596V|SEC31A_ENST00000348405.4_Missense_Mutation_p.A557V|SEC31A_ENST00000264405.5_Missense_Mutation_p.A329V|SEC31A_ENST00000508502.1_Missense_Mutation_p.A596V	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	596					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				AATGGCATCGGCCATGCGGTT	0.418																																																	0													86.0	81.0	83.0					4																	83778199		2203	4300	6503	SO:0001583	missense	22872			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1787C>T	4.37:g.83778199G>A	ENSP00000378721:p.Ala596Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A596V	ENST00000395310.2	37	c.1787	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.654932	0.96724	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479;ENST00000510167	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.53423	0.76;0.65;1.85;1.87;0.74;1.76;1.85;0.76;0.74;0.62;0.65;1.86;1.85;2.74;1.79;1.83;1.96	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.77212	0.4097	M	0.91561	3.22	0.80722	D	1	D;D;D;D;P;D;D;D;D	0.89917	1.0;0.984;1.0;0.997;0.851;1.0;0.999;1.0;1.0	D;P;D;D;P;D;D;D;D	0.91635	0.999;0.906;0.999;0.964;0.623;0.996;0.997;0.999;0.999	T	0.81543	-0.0885	10	0.72032	D	0.01	-18.564	19.949	0.97192	0.0:0.0:1.0:0.0	.	591;557;596;557;557;596;596;596;329	B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.;.;.;.;.;.;.;SC31A_HUMAN;.	V	557;557;596;591;596;596;596;557;596;596;557;596;596;329;557;596;184	ENSP00000337602:A557V;ENSP00000426886:A557V;ENSP00000378721:A596V;ENSP00000408027:A591V;ENSP00000426569:A596V;ENSP00000407944:A596V;ENSP00000400926:A596V;ENSP00000325087:A557V;ENSP00000309070:A596V;ENSP00000421633:A596V;ENSP00000421464:A557V;ENSP00000424635:A596V;ENSP00000347329:A596V;ENSP00000264405:A329V;ENSP00000424451:A557V;ENSP00000425999:A596V;ENSP00000422267:A184V	ENSP00000264405:A329V	A	-	2	0	SEC31A	83997223	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.706000	0.92434	0.655000	0.94253	GCC	SEC31A	-	NULL		0.418	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	G	NM_016211		83778199	-1	no_errors	ENST00000432794	ensembl	human	known	70_37	missense	SNP	1.000	A
SENP5	205564	genome.wustl.edu	37	3	196612651	196612651	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:196612651G>A	ENST00000323460.5	+	2	848	c.599G>A	c.(598-600)tGc>tAc	p.C200Y	SENP5_ENST00000445299.2_Missense_Mutation_p.C200Y|SENP5_ENST00000419026.1_Intron	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	200					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TACGGCTGCTGCCAAGGGCCG	0.468																																					Ovarian(47;891 1095 11174 13858 51271)												0													44.0	45.0	45.0					3																	196612651		2203	4300	6503	SO:0001583	missense	205564			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.599G>A	3.37:g.196612651G>A	ENSP00000327197:p.Cys200Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DY82|Q96SA5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.C200Y	ENST00000323460.5	37	c.599	CCDS3322.1	3	.	.	.	.	.	.	.	.	.	.	G	5.665	0.307275	0.10733	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.46819	0.86;0.86	5.58	-2.5	0.06384	.	1.130820	0.06453	N	0.728081	T	0.20373	0.0490	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.49428	-0.8941	10	0.02654	T	1	2.1932	10.7097	0.45975	0.4996:0.0:0.5004:0.0	.	200;200	B4DY82;Q96HI0	.;SENP5_HUMAN	Y	200	ENSP00000327197:C200Y;ENSP00000390231:C200Y	ENSP00000327197:C200Y	C	+	2	0	SENP5	198097048	0.664000	0.27457	0.966000	0.40874	0.532000	0.34746	-0.058000	0.11750	-0.609000	0.05724	-0.302000	0.09304	TGC	SENP5	-	NULL		0.468	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP5	HGNC	protein_coding	OTTHUMT00000340524.1	G	NM_152699		196612651	+1	no_errors	ENST00000323460	ensembl	human	known	70_37	missense	SNP	0.985	A
SERPINA7	6906	genome.wustl.edu	37	X	105279118	105279118	+	Missense_Mutation	SNP	C	C	T	rs375380232		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:105279118C>T	ENST00000327674.4	-	2	1216	c.881G>A	c.(880-882)cGc>cAc	p.R294H	SERPINA7_ENST00000487487.1_5'UTR|SERPINA7_ENST00000372563.1_Missense_Mutation_p.R294H			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	294					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CTGTAGTAAGCGGTTCCACTT	0.493																																																	0								C	HIS/ARG	0,3835		0,0,0,1632,571	216.0	208.0	211.0		881	-1.4	0.0	X		211	1,6727		0,0,1,2428,1871	no	missense	SERPINA7	NM_000354.5	29	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	benign	294/416	105279118	1,10562	2203	4300	6503	SO:0001583	missense	6906			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.881G>A	X.37:g.105279118C>T	ENSP00000329374:p.Arg294His	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUX1	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Prot_inh_Lserp2	p.R294H	ENST00000327674.4	37	c.881	CCDS14518.1	X	.	.	.	.	.	.	.	.	.	.	C	0.146	-1.096529	0.01843	0.0	1.49E-4	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.87887	-2.31;-2.31	4.63	-1.42	0.08913	Serpin domain (3);	1.027290	0.07715	N	0.942678	T	0.75496	0.3857	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.56111	-0.8033	10	0.14252	T	0.57	.	8.7991	0.34898	0.0:0.3457:0.0:0.6543	.	294	P05543	THBG_HUMAN	H	294	ENSP00000329374:R294H;ENSP00000361644:R294H	ENSP00000329374:R294H	R	-	2	0	SERPINA7	105165774	0.000000	0.05858	0.016000	0.15963	0.665000	0.39181	-0.142000	0.10311	-0.340000	0.08388	-0.197000	0.12766	CGC	SERPINA7	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.493	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA7	HGNC	protein_coding	OTTHUMT00000057790.1	C	NM_000354		105279118	-1	no_errors	ENST00000327674	ensembl	human	known	70_37	missense	SNP	0.231	T
SERTAD3	29946	genome.wustl.edu	37	19	40947907	40947907	+	Missense_Mutation	SNP	C	C	G	rs543523788		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:40947907C>G	ENST00000322354.3	-	2	577	c.81G>C	c.(79-81)caG>caC	p.Q27H	SERTAD3_ENST00000392028.4_Missense_Mutation_p.Q27H|SERTAD3_ENST00000601217.1_5'Flank|CTC-492K19.4_ENST00000599050.1_RNA	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	27	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGGTAGCTCTGAAGGCCTG	0.587																																																	0													37.0	32.0	34.0					19																	40947907		2203	4300	6503	SO:0001583	missense	29946			AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.81G>C	19.37:g.40947907C>G	ENSP00000325414:p.Gln27His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQB3|Q96CQ2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.Q27H	ENST00000322354.3	37	c.81	CCDS12558.1	19	.	.	.	.	.	.	.	.	.	.	C	2.070	-0.413286	0.04799	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	4.21	0.661	0.17874	.	0.324095	0.24085	N	0.041686	T	0.13970	0.0338	N	0.08118	0	0.19575	N	0.999964	B	0.22480	0.07	B	0.21917	0.037	T	0.14504	-1.0470	9	0.22706	T	0.39	-3.2324	3.4975	0.07661	0.0:0.5303:0.2098:0.2599	.	27	Q9UJW9	SRTD3_HUMAN	H	27	.	ENSP00000325414:Q27H	Q	-	3	2	SERTAD3	45639747	0.836000	0.29430	0.581000	0.28614	0.504000	0.33889	0.348000	0.20031	0.430000	0.26230	-0.182000	0.12963	CAG	SERTAD3	-	pfscan_SERTA		0.587	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SERTAD3	HGNC	protein_coding	OTTHUMT00000462573.1	C	NM_013368		40947907	-1	no_errors	ENST00000322354	ensembl	human	known	70_37	missense	SNP	0.447	G
SET	6418	genome.wustl.edu	37	9	131457120	131457120	+	3'UTR	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:131457120G>C	ENST00000372692.4	+	0	1291				SET_ENST00000322030.8_3'UTR|SET_ENST00000372688.4_3'UTR	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene						DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		GAAATACCTTGAGCAGAATAC	0.398			T	NUP214	AML																																			Dom	yes		9	9q34	6418	SET translocation		L	0																																										SO:0001624	3_prime_UTR_variant	6418			M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.*177G>C	9.37:g.131457120G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	RNA	SNP	-	NULL	ENST00000372692.4	37	NULL	CCDS48037.1	9																																																																																			SET	-	-		0.398	SET-001	KNOWN	basic|CCDS	protein_coding	SET	HGNC	protein_coding	OTTHUMT00000054476.2	G	NM_001122821		131457120	+1	no_errors	ENST00000494141	ensembl	human	known	70_37	rna	SNP	1.000	C
SETBP1	26040	genome.wustl.edu	37	18	42532180	42532180	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr18:42532180G>A	ENST00000282030.5	+	4	3171	c.2875G>A	c.(2875-2877)Gag>Aag	p.E959K		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	959						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AGACCTGGAGGAGCTAATCAC	0.478									Schinzel-Giedion syndrome																																								0													76.0	74.0	75.0					18																	42532180		2203	4300	6503	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2875G>A	18.37:g.42532180G>A	ENSP00000282030:p.Glu959Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.E959K	ENST00000282030.5	37	c.2875	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123428	0.77436	.	.	ENSG00000152217	ENST00000282030	D	0.92752	-3.1	6.02	6.02	0.97574	.	0.053120	0.64402	D	0.000001	D	0.93099	0.7803	L	0.32530	0.975	0.52501	D	0.999959	D	0.61697	0.99	P	0.57371	0.819	D	0.93365	0.6730	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	959	Q9Y6X0	SETBP_HUMAN	K	959	ENSP00000282030:E959K	ENSP00000282030:E959K	E	+	1	0	SETBP1	40786178	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.811000	0.99226	2.865000	0.98341	0.655000	0.94253	GAG	SETBP1	-	NULL		0.478	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	G	NM_001130110		42532180	+1	no_errors	ENST00000282030	ensembl	human	known	70_37	missense	SNP	1.000	A
SEZ6	124925	genome.wustl.edu	37	17	27308731	27308731	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:27308731C>T	ENST00000317338.12	-	2	810	c.382G>A	c.(382-384)Gcg>Acg	p.A128T	SEZ6_ENST00000335960.6_Missense_Mutation_p.A128T|SEZ6_ENST00000360295.9_Missense_Mutation_p.A128T|SEZ6_ENST00000442608.3_Missense_Mutation_p.A128T|PIPOX_ENST00000583215.1_Intron			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	128	Pro-rich.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			GTGGGTACCGCAGCCATGGCT	0.652																																																	0													27.0	33.0	31.0					17																	27308731		2202	4300	6502	SO:0001583	missense	124925			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.382G>A	17.37:g.27308731C>T	ENSP00000312942:p.Ala128Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.A128T	ENST00000317338.12	37	c.382	CCDS45639.1	17	.	.	.	.	.	.	.	.	.	.	C	7.985	0.752081	0.15778	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000335960;ENST00000541381	T;T;T	0.27104	1.72;1.69;2.65	4.98	2.9	0.33743	.	0.385688	0.21502	N	0.073504	T	0.15392	0.0371	L	0.29908	0.895	0.09310	N	1	B;B;B	0.30361	0.145;0.277;0.181	B;B;B	0.24394	0.053;0.053;0.024	T	0.16867	-1.0388	10	0.72032	D	0.01	.	5.7121	0.17941	0.0:0.6199:0.2643:0.1158	.	128;128;128	F5GZF9;Q53EL9-3;Q53EL9	.;.;SEZ6_HUMAN	T	128;128;3;128;128	ENSP00000403784:A128T;ENSP00000353440:A128T;ENSP00000337407:A128T	ENSP00000312942:A3T	A	-	1	0	SEZ6	24332857	0.010000	0.17322	0.031000	0.17742	0.081000	0.17604	0.601000	0.24119	1.099000	0.41499	0.462000	0.41574	GCG	SEZ6	-	NULL		0.652	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	C			27308731	-1	no_errors	ENST00000317338	ensembl	human	known	70_37	missense	SNP	0.010	T
SLC12A5	57468	genome.wustl.edu	37	20	44670127	44670127	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:44670127C>A	ENST00000454036.2	+	8	1132	c.1083C>A	c.(1081-1083)aaC>aaA	p.N361K	SLC12A5_ENST00000243964.3_Missense_Mutation_p.N338K	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	361					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCACCCGAAACAATGTCACAG	0.572																																																	0													86.0	80.0	82.0					20																	44670127		2203	4300	6503	SO:0001583	missense	57468			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1083C>A	20.37:g.44670127C>A	ENSP00000387694:p.Asn361Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.N361K	ENST00000454036.2	37	c.1083	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357857	0.82243	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.68025	-0.3;-0.3	4.77	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.78597	0.4308	M	0.76328	2.33	0.80722	D	1	D;D	0.71674	0.992;0.998	P;D	0.68483	0.805;0.958	T	0.78406	-0.2216	10	0.40728	T	0.16	.	12.3007	0.54872	0.0:0.9184:0.0:0.0816	.	361;338	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	K	361;338	ENSP00000387694:N361K;ENSP00000243964:N338K	ENSP00000243964:N338K	N	+	3	2	SLC12A5	44103534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.906000	0.56340	1.229000	0.43630	0.655000	0.94253	AAC	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS		0.572	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	C			44670127	+1	no_errors	ENST00000454036	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC5A2	6524	genome.wustl.edu	37	16	31496157	31496157	+	Silent	SNP	C	C	T	rs149913553		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:31496157C>T	ENST00000330498.3	+	3	235	c.216C>T	c.(214-216)ttC>ttT	p.F72F	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	72					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	CCTCTCTCTTCGCCAGCAACA	0.657																																																	0			GRCh37	CM034966	SLC5A2	M	rs149913553	C		2,4392	4.2+/-10.8	0,2,2195	47.0	52.0	50.0		216	-0.9	1.0	16	dbSNP_134	50	0,8600		0,0,4300	no	coding-synonymous	SLC5A2	NM_003041.3		0,2,6495	TT,TC,CC		0.0,0.0455,0.0154		72/673	31496157	2,12992	2197	4300	6497	SO:0001819	synonymous_variant	6524				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.216C>T	16.37:g.31496157C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRD2	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.F72	ENST00000330498.3	37	c.216	CCDS10714.1	16																																																																																			SLC5A2	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.657	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	HGNC	protein_coding	OTTHUMT00000255627.2	C			31496157	+1	no_errors	ENST00000330498	ensembl	human	known	70_37	silent	SNP	0.997	T
SLIT2	9353	genome.wustl.edu	37	4	20618553	20618553	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:20618553G>T	ENST00000504154.1	+	35	4120	c.3868G>T	c.(3868-3870)Gtg>Ttg	p.V1290L	SLIT2_ENST00000503837.1_Missense_Mutation_p.V1286L|SLIT2_ENST00000273739.5_Missense_Mutation_p.V1303L|SLIT2_ENST00000503823.1_Missense_Mutation_p.V1282L	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1290	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAAGAGTAACGTGGCATCTCT	0.562																																																	0													44.0	43.0	43.0					4																	20618553		2203	4300	6503	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3868G>T	4.37:g.20618553G>T	ENSP00000422591:p.Val1290Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.V1290L	ENST00000504154.1	37	c.3868	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	9.326	1.059286	0.19987	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92	5.96	5.11	0.69529	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.919326	0.09535	N	0.788994	T	0.47746	0.1462	N	0.01473	-0.845	0.28133	N	0.930102	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.29397	-1.0013	10	0.21540	T	0.41	.	10.0633	0.42288	0.2:0.0:0.8:0.0	.	1282;1290	O94813-3;O94813	.;SLIT2_HUMAN	L	1282;1290;1303;1286;1286	ENSP00000427548:V1282L;ENSP00000422591:V1290L;ENSP00000273739:V1303L;ENSP00000422261:V1286L	ENSP00000273739:V1303L	V	+	1	0	SLIT2	20227651	0.979000	0.34478	0.997000	0.53966	0.989000	0.77384	1.895000	0.39778	2.833000	0.97629	0.650000	0.86243	GTG	SLIT2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.562	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	G			20618553	+1	no_errors	ENST00000504154	ensembl	human	known	70_37	missense	SNP	0.768	T
SOX3	6658	genome.wustl.edu	37	X	139587210	139587210	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:139587210C>T	ENST00000370536.2	-	1	15	c.16G>A	c.(16-18)Gag>Aag	p.E6K		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	6					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					GATGAGTTCTCTCGAACAGGT	0.627																																																	0													9.0	10.0	10.0					X																	139587210		2181	4245	6426	SO:0001583	missense	6658				CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.16G>A	X.37:g.139587210C>T	ENSP00000359567:p.Glu6Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	pfam_HMG_superfamily,pfam_TF_SOX,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E6K	ENST00000370536.2	37	c.16	CCDS14669.1	X	.	.	.	.	.	.	.	.	.	.	c	9.045	0.990555	0.18966	.	.	ENSG00000134595	ENST00000370536	D	0.97976	-4.64	3.01	2.12	0.27331	.	.	.	.	.	D	0.91922	0.7442	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	D	0.83831	0.0252	8	.	.	.	.	5.718	0.17970	0.0:0.8412:0.0:0.1588	.	6	P41225	SOX3_HUMAN	K	6	ENSP00000359567:E6K	.	E	-	1	0	SOX3	139414876	0.008000	0.16893	0.014000	0.15608	0.163000	0.22366	1.049000	0.30392	0.641000	0.30601	0.525000	0.51046	GAG	SOX3	-	NULL		0.627	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	HGNC	protein_coding	OTTHUMT00000058577.1	C			139587210	-1	no_errors	ENST00000370536	ensembl	human	known	70_37	missense	SNP	0.184	T
SPRED1	161742	genome.wustl.edu	37	15	38616984	38616984	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr15:38616984G>A	ENST00000299084.4	+	4	1257	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	SPRED1_ENST00000561205.1_3'UTR	NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	133					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ATCAAAAAATGAAGCTGAAGG	0.313									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)												0													28.0	30.0	29.0					15																	38616984		2199	4294	6493	SO:0001583	missense	161742	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.397G>A	15.37:g.38616984G>A	ENSP00000299084:p.Glu133Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.E133K	ENST00000299084.4	37	c.397	CCDS32193.1	15	.	.	.	.	.	.	.	.	.	.	G	16.77	3.215867	0.58452	.	.	ENSG00000166068	ENST00000299084	T	0.73258	-0.73	4.05	4.05	0.47172	.	0.563444	0.19672	N	0.108736	T	0.63861	0.2547	L	0.54323	1.7	0.29531	N	0.852752	B	0.28713	0.22	B	0.21708	0.036	T	0.61178	-0.7115	10	0.33141	T	0.24	-10.6723	14.0507	0.64734	0.0:0.0:1.0:0.0	.	133	Q7Z699	SPRE1_HUMAN	K	133	ENSP00000299084:E133K	ENSP00000299084:E133K	E	+	1	0	SPRED1	36404276	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.628000	0.61282	2.549000	0.85964	0.655000	0.94253	GAA	SPRED1	-	NULL		0.313	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	HGNC	protein_coding	OTTHUMT00000418217.1	G			38616984	+1	no_errors	ENST00000299084	ensembl	human	known	70_37	missense	SNP	1.000	A
SPTA1	6708	genome.wustl.edu	37	1	158606546	158606546	+	Missense_Mutation	SNP	T	T	G	rs370558180		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:158606546T>G	ENST00000368147.4	-	37	5375	c.5195A>C	c.(5194-5196)aAg>aCg	p.K1732T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1732					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCGTATCAACTTCTCCCTAAA	0.473																																																	0								T	THR/LYS	0,3748		0,0,1874	105.0	102.0	103.0		5195	4.0	0.9	1		103	1,8227		0,1,4113	no	missense	SPTA1	NM_003126.2	78	0,1,5987	GG,GT,TT		0.0122,0.0,0.0084	probably-damaging	1732/2420	158606546	1,11975	1874	4114	5988	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5195A>C	1.37:g.158606546T>G	ENSP00000357129:p.Lys1732Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.K1732T	ENST00000368147.4	37	c.5195	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414143	0.42817	0.0	1.22E-4	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54279	0.58;0.58	5.13	4.01	0.46588	.	.	.	.	.	T	0.63803	0.2542	M	0.85542	2.76	0.47153	D	0.999339	D	0.89917	1.0	D	0.97110	1.0	T	0.68202	-0.5471	9	0.56958	D	0.05	.	8.5503	0.33447	0.0:0.0879:0.0:0.9121	.	1732	P02549	SPTA1_HUMAN	T	1732	ENSP00000357130:K1732T;ENSP00000357129:K1732T	ENSP00000357129:K1732T	K	-	2	0	SPTA1	156873170	1.000000	0.71417	0.861000	0.33841	0.006000	0.05464	5.309000	0.65774	0.987000	0.38709	0.454000	0.30748	AAG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	T	NM_003126		158606546	-1	no_errors	ENST00000368148	ensembl	human	known	70_37	missense	SNP	1.000	G
SRR	63826	genome.wustl.edu	37	17	2222189	2222189	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:2222189G>A	ENST00000344595.5	+	4	683	c.365G>A	c.(364-366)gGa>gAa	p.G122E	SRR_ENST00000576848.1_Intron	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	122					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)			NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	CAAGCCTACGGAGCGTCAATT	0.448																																																	0													163.0	153.0	157.0					17																	2222189		2203	4300	6503	SO:0001583	missense	63826			AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.365G>A	17.37:g.2222189G>A	ENSP00000339435:p.Gly122Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTI5|Q6IA55	Missense_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF	p.G122E	ENST00000344595.5	37	c.365	CCDS11017.1	17	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931336	0.73442	.	.	ENSG00000167720	ENST00000344595	D	0.99277	-5.67	5.2	5.2	0.72013	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.99629	0.9864	H	0.96208	3.785	0.58432	D	0.999995	D	0.89917	1.0	D	0.77004	0.989	D	0.97677	1.0170	10	0.87932	D	0	-38.918	17.7256	0.88364	0.0:0.0:1.0:0.0	.	122	Q9GZT4	SRR_HUMAN	E	122	ENSP00000339435:G122E	ENSP00000339435:G122E	G	+	2	0	SRR	2168939	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	4.553000	0.60753	2.413000	0.81919	0.650000	0.86243	GGA	SRR	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF		0.448	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRR	HGNC	protein_coding	OTTHUMT00000207129.2	G	NM_021947		2222189	+1	no_errors	ENST00000344595	ensembl	human	known	70_37	missense	SNP	1.000	A
SRRM2	23524	genome.wustl.edu	37	16	2815031	2815031	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:2815031C>G	ENST00000301740.8	+	11	5051	c.4502C>G	c.(4501-4503)tCa>tGa	p.S1501*		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1501	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.S1501L(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CGTTCTCCATCATCCCCAGAG	0.522																																																	1	Substitution - Missense(1)	lung(1)											134.0	136.0	135.0					16																	2815031		2198	4300	6498	SO:0001587	stop_gained	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4502C>G	16.37:g.2815031C>G	ENSP00000301740:p.Ser1501*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Nonsense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S1501*	ENST00000301740.8	37	c.4502	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	41	8.687813	0.98914	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	.	.	.	5.9	5.9	0.94986	.	0.000000	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.1152	15.7823	0.78269	0.0:1.0:0.0:0.0	.	.	.	.	X	1501;1501;753	.	ENSP00000301740:S1501X	S	+	2	0	SRRM2	2755032	0.998000	0.40836	0.999000	0.59377	0.873000	0.50193	2.947000	0.49058	2.806000	0.96561	0.655000	0.94253	TCA	SRRM2	-	NULL		0.522	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	C			2815031	+1	no_errors	ENST00000301740	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ST8SIA3	51046	genome.wustl.edu	37	18	55024435	55024435	+	Missense_Mutation	SNP	A	A	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr18:55024435A>C	ENST00000324000.3	+	3	2628	c.594A>C	c.(592-594)caA>caC	p.Q198H		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	198					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		AGGCTTTCCAAAGAGATGTTG	0.413																																																	0													72.0	76.0	75.0					18																	55024435		2203	4300	6503	SO:0001583	missense	51046			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.594A>C	18.37:g.55024435A>C	ENSP00000320431:p.Gln198His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.Q198H	ENST00000324000.3	37	c.594	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	A	9.320	1.057704	0.19907	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.30714	1.52	5.96	3.55	0.40652	.	0.218379	0.51477	N	0.000095	T	0.18759	0.0450	N	0.25380	0.74	0.35152	D	0.769852	B	0.02656	0.0	B	0.06405	0.002	T	0.11131	-1.0600	10	0.41790	T	0.15	-9.9829	5.6163	0.17434	0.5709:0.2858:0.1433:0.0	.	198	O43173	SIA8C_HUMAN	H	305;198	ENSP00000320431:Q198H	ENSP00000320431:Q198H	Q	+	3	2	ST8SIA3	53175433	0.308000	0.24509	1.000000	0.80357	0.998000	0.95712	-0.269000	0.08596	0.493000	0.27837	0.533000	0.62120	CAA	ST8SIA3	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.413	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	A	NM_015879		55024435	+1	no_errors	ENST00000324000	ensembl	human	known	70_37	missense	SNP	0.992	C
STXBP3	6814	genome.wustl.edu	37	1	109299362	109299362	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:109299362C>T	ENST00000370008.3	+	4	282	c.232C>T	c.(232-234)Ctt>Ttt	p.L78F		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	78	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AATGAAAGCTCTTTATTTCAT	0.294																																																	0													41.0	43.0	42.0					1																	109299362		2202	4292	6494	SO:0001583	missense	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.232C>T	1.37:g.109299362C>T	ENSP00000359025:p.Leu78Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.L78F	ENST00000370008.3	37	c.232	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325786	0.60743	.	.	ENSG00000116266	ENST00000370008	T	0.81415	-1.49	5.86	4.93	0.64822	.	0.109304	0.64402	D	0.000014	T	0.74884	0.3775	L	0.38175	1.15	0.34099	D	0.661658	D	0.56287	0.975	P	0.56088	0.791	T	0.79885	-0.1614	10	0.87932	D	0	-8.8575	12.3858	0.55330	0.4164:0.5836:0.0:0.0	.	78	O00186	STXB3_HUMAN	F	78	ENSP00000359025:L78F	ENSP00000359025:L78F	L	+	1	0	STXBP3	109100885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.796000	0.47869	1.433000	0.47394	0.591000	0.81541	CTT	STXBP3	-	pfam_Sec1-like,superfamily_Sec1-like		0.294	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1	C	NM_007269		109299362	+1	no_errors	ENST00000370008	ensembl	human	known	70_37	missense	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152085168	152085169	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:152085168_152085169CC>AA	ENST00000368804.1	-	2	523_524	c.524_525GG>TT	c.(523-525)cGG>cTT	p.R175L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	175					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGCCTTTGCCGCCACAGCTC	0.579																																																	0																																										SO:0001583	missense	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.524_525delinsAA	1.37:g.152085168_152085169delinsAA	ENSP00000357794:p.Arg175Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUI3	Silent|Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.R175|p.R175L	ENST00000368804.1	37	c.525|c.524	CCDS41396.1	1																																																																																			TCHH	-	NULL		0.579	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	C	NM_007113		152085168|152085169	-1	no_errors	ENST00000368804	ensembl	human	known	70_37	silent|missense	SNP	0.282|0.069	A
TEX10	54881	genome.wustl.edu	37	9	103109309	103109309	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:103109309A>G	ENST00000374902.4	-	3	736	c.560T>C	c.(559-561)gTa>gCa	p.V187A	TEX10_ENST00000535814.1_Missense_Mutation_p.V190A|TEX10_ENST00000537512.1_Missense_Mutation_p.V122A	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	187						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		AATAAGTTCTACAAAATTCTT	0.408																																																	0													68.0	71.0	70.0					9																	103109309		2203	4300	6503	SO:0001583	missense	54881			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.560T>C	9.37:g.103109309A>G	ENSP00000364037:p.Val187Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	pfam_IPI1-like_dom,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V187A	ENST00000374902.4	37	c.560	CCDS6748.1	9	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128672	0.77549	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000537512	T;T;T	0.66099	-0.19;-0.19;-0.19	5.32	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	0.065999	0.64402	D	0.000007	T	0.71854	0.3389	L	0.53249	1.67	0.51012	D	0.9999	D;D;D	0.62365	0.991;0.991;0.968	P;P;P	0.60286	0.872;0.872;0.831	T	0.72171	-0.4371	10	0.42905	T	0.14	-8.8888	15.2772	0.73750	1.0:0.0:0.0:0.0	.	122;190;187	B7Z9D5;B4DYV2;Q9NXF1	.;.;TEX10_HUMAN	A	190;187;122	ENSP00000444555:V190A;ENSP00000364037:V187A;ENSP00000438120:V122A	ENSP00000364037:V187A	V	-	2	0	TEX10	102149130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.010000	0.58986	0.482000	0.46254	GTA	TEX10	-	pfam_IPI1-like_dom,superfamily_ARM-type_fold		0.408	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	A	NM_017746		103109309	-1	no_errors	ENST00000374902	ensembl	human	known	70_37	missense	SNP	1.000	G
TIMELESS	8914	genome.wustl.edu	37	12	56826872	56826872	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:56826872C>G	ENST00000553532.1	-	6	619	c.469G>C	c.(469-471)Gaa>Caa	p.E157Q	TIMELESS_ENST00000229201.4_Missense_Mutation_p.E157Q|TIMELESS_ENST00000554616.1_Missense_Mutation_p.E157Q					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						AGGATCCGTTCAATCAGCAAG	0.512																																																	0													224.0	147.0	173.0					12																	56826872		2203	4300	6503	SO:0001583	missense	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.469G>C	12.37:g.56826872C>G	ENSP00000450607:p.Glu157Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.E157Q	ENST00000553532.1	37	c.469	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.272221	0.95429	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.49720	0.77;0.77;0.77	5.31	5.31	0.75309	Timeless protein (1);	0.000000	0.85682	D	0.000000	T	0.66277	0.2773	L	0.60845	1.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.64723	-0.6340	10	0.46703	T	0.11	-20.346	18.1301	0.89598	0.0:1.0:0.0:0.0	.	157;157	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	Q	157	ENSP00000229201:E157Q;ENSP00000450607:E157Q;ENSP00000450848:E157Q	ENSP00000229201:E157Q	E	-	1	0	TIMELESS	55113139	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.861000	0.69553	2.671000	0.90904	0.455000	0.32223	GAA	TIMELESS	-	pfam_Timeless		0.512	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	C	NM_003920		56826872	-1	no_errors	ENST00000553532	ensembl	human	known	70_37	missense	SNP	1.000	G
TLR3	7098	genome.wustl.edu	37	4	187005261	187005261	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr4:187005261C>G	ENST00000296795.3	+	4	2525	c.2421C>G	c.(2419-2421)atC>atG	p.I807M	TLR3_ENST00000504367.1_Missense_Mutation_p.I530M	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	807	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TTAACAGCATCAAAAGAAGCA	0.333																																																	0													56.0	61.0	59.0					4																	187005261		2202	4300	6502	SO:0001583	missense	7098			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.2421C>G	4.37:g.187005261C>G	ENSP00000296795:p.Ile807Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.I807M	ENST00000296795.3	37	c.2421	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458155	0.26161	.	.	ENSG00000164342	ENST00000296795;ENST00000542020;ENST00000504367	T;T	0.24151	1.87;1.87	5.98	2.01	0.26516	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.126945	0.64402	D	0.000001	T	0.22360	0.0539	L	0.32530	0.975	0.44207	D	0.997039	P	0.44946	0.846	P	0.51806	0.68	T	0.06826	-1.0805	10	0.33141	T	0.24	.	2.3859	0.04365	0.4625:0.2847:0.0996:0.1533	.	807	O15455	TLR3_HUMAN	M	807;807;530	ENSP00000296795:I807M;ENSP00000423684:I530M	ENSP00000296795:I807M	I	+	3	3	TLR3	187242255	0.920000	0.31207	0.993000	0.49108	0.971000	0.66376	0.081000	0.14823	0.833000	0.34828	-0.284000	0.09977	ATC	TLR3	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom		0.333	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	HGNC	protein_coding	OTTHUMT00000360313.4	C			187005261	+1	no_errors	ENST00000296795	ensembl	human	known	70_37	missense	SNP	0.906	G
TMEM131	23505	genome.wustl.edu	37	2	98409038	98409038	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:98409038C>G	ENST00000186436.5	-	31	4183	c.3955G>C	c.(3955-3957)Gaa>Caa	p.E1319Q		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1319	Pro-rich.					integral component of membrane (GO:0016021)		p.E1206Q(1)|p.E1206*(1)|p.E1319Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GACAGCCTTTCAGGCTGCGGC	0.677																																																	3	Substitution - Missense(2)|Substitution - Nonsense(1)	cervix(2)|breast(1)											21.0	25.0	23.0					2																	98409038		2093	4223	6316	SO:0001583	missense	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3955G>C	2.37:g.98409038C>G	ENSP00000186436:p.Glu1319Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.E1319Q	ENST00000186436.5	37	c.3955	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288090	0.40494	.	.	ENSG00000075568	ENST00000186436	T	0.24151	1.87	5.91	5.91	0.95273	.	0.562624	0.18838	N	0.129774	T	0.24812	0.0602	L	0.36672	1.1	0.80722	D	1	B	0.17465	0.022	B	0.14023	0.01	T	0.05131	-1.0904	10	0.21014	T	0.42	-2.0572	19.8936	0.96942	0.0:1.0:0.0:0.0	.	1319	Q92545	TM131_HUMAN	Q	1319	ENSP00000186436:E1319Q	ENSP00000186436:E1319Q	E	-	1	0	TMEM131	97775470	0.161000	0.22892	0.008000	0.14137	0.651000	0.38670	3.599000	0.54045	2.793000	0.96121	0.655000	0.94253	GAA	TMEM131	-	NULL		0.677	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	C	XM_371542		98409038	-1	no_errors	ENST00000186436	ensembl	human	known	70_37	missense	SNP	0.036	G
TMEM14B	81853	genome.wustl.edu	37	6	10749469	10749469	+	5'UTR	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:10749469G>C	ENST00000379542.5	+	0	158				SYCP2L_ENST00000543878.1_5'UTR|TMEM14B_ENST00000379530.3_5'UTR|RP11-637O19.3_ENST00000480294.1_5'UTR|TMEM14B_ENST00000461342.1_5'UTR|TMEM14B_ENST00000473276.1_5'UTR|RP11-421M1.8_ENST00000606522.1_lincRNA|TMEM14B_ENST00000491103.1_Intron|TMEM14B_ENST00000481240.1_5'UTR|TMEM14B_ENST00000475942.1_5'UTR|TMEM14B_ENST00000467317.1_5'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TCTGGACTGAGAAGAGAAGAA	0.502																																																	0													74.0	82.0	79.0					6																	10749469		2203	4300	6503	SO:0001623	5_prime_UTR_variant	81853			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.-10G>C	6.37:g.10749469G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-		0.502	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	G	NM_030969		10749469	+1	no_errors	ENST00000492297	ensembl	human	known	70_37	rna	SNP	0.029	C
TMEM14B	81853	genome.wustl.edu	37	6	10749477	10749477	+	5'UTR	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:10749477G>A	ENST00000379542.5	+	0	166				SYCP2L_ENST00000543878.1_5'UTR|TMEM14B_ENST00000379530.3_5'UTR|RP11-637O19.3_ENST00000480294.1_5'UTR|TMEM14B_ENST00000461342.1_5'UTR|TMEM14B_ENST00000473276.1_5'UTR|RP11-421M1.8_ENST00000606522.1_lincRNA|TMEM14B_ENST00000491103.1_Intron|TMEM14B_ENST00000481240.1_5'UTR|TMEM14B_ENST00000475942.1_5'UTR|TMEM14B_ENST00000467317.1_5'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				GAGAAGAGAAGAATGGAGAAG	0.498																																																	0													76.0	85.0	82.0					6																	10749477		2203	4300	6503	SO:0001623	5_prime_UTR_variant	81853			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.-2G>A	6.37:g.10749477G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-		0.498	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	G	NM_030969		10749477	+1	no_errors	ENST00000492297	ensembl	human	known	70_37	rna	SNP	0.913	A
TMEM14B	81853	genome.wustl.edu	37	6	10756864	10756864	+	3'UTR	DEL	A	A	-	rs398065562		TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:10756864delA	ENST00000379542.5	+	0	625				TMEM14B_ENST00000491103.1_3'UTR|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000481240.1_Intron|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000473276.1_3'UTR|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000379530.3_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				CATTTTACCTAAAAAAAAAAA	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	81853			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*113A>-	6.37:g.10756864delA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	DEL	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-		0.368	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	A	NM_030969		10756864	+1	no_errors	ENST00000486421	ensembl	human	known	70_37	rna	DEL	0.005	-
TMEM151B	441151	genome.wustl.edu	37	6	44240838	44240838	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:44240838C>T	ENST00000451188.2	+	2	448	c.171C>T	c.(169-171)ctC>ctT	p.L57L	TMEM151B_ENST00000438774.2_Silent_p.L57L|RP11-444E17.6_ENST00000505802.1_5'Flank	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	57						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						CCAAGTCCCTCTGCCGTGAGT	0.647																																																	0													158.0	130.0	139.0					6																	44240838		692	1591	2283	SO:0001819	synonymous_variant	441151			AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.171C>T	6.37:g.44240838C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T9V7	Silent	SNP	NULL	p.L57	ENST00000451188.2	37	c.171	CCDS47437.1	6																																																																																			TMEM151B	-	NULL		0.647	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TMEM151B	HGNC	protein_coding	OTTHUMT00000040740.2	C	NM_001039704		44240838	+1	no_errors	ENST00000451188	ensembl	human	known	70_37	silent	SNP	1.000	T
TMEM18	129787	genome.wustl.edu	37	2	669621	669621	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:669621C>G	ENST00000281017.3	-	5	475	c.382G>C	c.(382-384)Gag>Cag	p.E128Q	TMEM18_ENST00000405941.3_Missense_Mutation_p.E131Q|TMEM18_ENST00000355654.2_Missense_Mutation_p.E115Q	NM_152834.2	NP_690047.2	Q96B42	TMM18_HUMAN	transmembrane protein 18	128	DNA-binding.				cell migration (GO:0016477)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)	10	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		tttcttctctcttGTGCATTC	0.448																																																	0													139.0	131.0	133.0					2																	669621		2203	4300	6503	SO:0001583	missense	129787			AL137269	CCDS33141.1	2p25.3	2008-02-05			ENSG00000151353	ENSG00000151353			25257	protein-coding gene	gene with protein product		613220				12477932	Standard	NM_152834		Approved	DKFZp434C1714	uc002qwl.3	Q96B42	OTTHUMG00000151381	ENST00000281017.3:c.382G>C	2.37:g.669621C>G	ENSP00000281017:p.Glu128Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W4X9|Q8N5H2|Q9NTH3	Missense_Mutation	SNP	NULL	p.E128Q	ENST00000281017.3	37	c.382	CCDS33141.1	2	.	.	.	.	.	.	.	.	.	.	C	8.739	0.918421	0.17982	.	.	ENSG00000151353	ENST00000281017;ENST00000355654;ENST00000405941	.	.	.	5.13	-2.57	0.06248	.	0.338290	0.30820	N	0.008802	T	0.21881	0.0527	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.20306	-1.0279	9	0.33940	T	0.23	-13.366	13.796	0.63171	0.1181:0.2025:0.6794:0.0	.	128	Q96B42	TMM18_HUMAN	Q	128;115;131	.	ENSP00000281017:E128Q	E	-	1	0	TMEM18	659621	0.912000	0.30974	0.000000	0.03702	0.006000	0.05464	1.256000	0.32921	-0.089000	0.12484	-0.324000	0.08512	GAG	TMEM18	-	NULL		0.448	TMEM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM18	HGNC	protein_coding	OTTHUMT00000322427.1	C	NM_152834		669621	-1	no_errors	ENST00000281017	ensembl	human	known	70_37	missense	SNP	0.000	G
TMEM182	130827	genome.wustl.edu	37	2	103431219	103431219	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr2:103431219C>T	ENST00000412401.2	+	5	687	c.482C>T	c.(481-483)tCa>tTa	p.S161L	TMEM182_ENST00000409528.1_Missense_Mutation_p.S65L|TMEM182_ENST00000486293.1_Intron|TMEM182_ENST00000409173.1_Missense_Mutation_p.S118L	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	161						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						ATCCTATTTTCATTGGTGGTG	0.443																																																	0													83.0	71.0	75.0					2																	103431219		2203	4300	6503	SO:0001583	missense	130827			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.482C>T	2.37:g.103431219C>T	ENSP00000394178:p.Ser161Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	NULL	p.S161L	ENST00000412401.2	37	c.482	CCDS2064.1	2	.	.	.	.	.	.	.	.	.	.	C	4.741	0.137748	0.09032	.	.	ENSG00000170417	ENST00000409528;ENST00000409173;ENST00000412401	T;T;T	0.61392	0.11;0.11;0.11	6.16	4.39	0.52855	.	0.176983	0.52532	D	0.000078	T	0.41604	0.1166	N	0.20881	0.62	0.26840	N	0.968385	B;B	0.19583	0.037;0.037	B;B	0.22152	0.023;0.038	T	0.23226	-1.0194	10	0.21540	T	0.41	-5.7482	11.2955	0.49276	0.0:0.8607:0.0:0.1393	.	161;118	Q6ZP80;B8ZZ71	TM182_HUMAN;.	L	65;118;161	ENSP00000387258:S65L;ENSP00000387184:S118L;ENSP00000394178:S161L	ENSP00000387184:S118L	S	+	2	0	TMEM182	102797651	0.799000	0.28903	0.224000	0.23877	0.940000	0.58332	3.766000	0.55280	0.948000	0.37687	0.650000	0.86243	TCA	TMEM182	-	NULL		0.443	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1	C	NM_144632		103431219	+1	no_errors	ENST00000412401	ensembl	human	known	70_37	missense	SNP	0.453	T
TMEM79	84283	genome.wustl.edu	37	1	156261440	156261440	+	3'UTR	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:156261440C>G	ENST00000405535.2	+	0	1407				TMEM79_ENST00000495881.1_3'UTR|TMEM79_ENST00000357501.2_Missense_Mutation_p.H174D|C1orf85_ENST00000482579.1_5'Flank|TMEM79_ENST00000295694.5_3'UTR	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79						cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					GGGTCTGACACATCTTTGAAC	0.682																																																	0													10.0	12.0	11.0					1																	156261440		2159	4216	6375	SO:0001624	3_prime_UTR_variant	84283			BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.*51C>G	1.37:g.156261440C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE22|D3DVB8	Missense_Mutation	SNP	NULL	p.H174D	ENST00000405535.2	37	c.520	CCDS1138.1	1	.	.	.	.	.	.	.	.	.	.	C	2.749	-0.260388	0.05791	.	.	ENSG00000163472	ENST00000357501	.	.	.	2.02	-0.0236	0.13942	.	.	.	.	.	T	0.21387	0.0515	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.29027	-1.0025	5	0.87932	D	0	.	6.5047	0.22188	0.0:0.6875:0.0:0.3125	.	.	.	.	D	174	.	ENSP00000350100:H174D	H	+	1	0	TMEM79	154528064	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.490000	0.06482	-0.323000	0.08602	-0.921000	0.02739	CAT	TMEM79	-	NULL		0.682	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM79	HGNC	protein_coding	OTTHUMT00000052101.1	C	NM_032323		156261440	+1	no_errors	ENST00000357501	ensembl	human	known	70_37	missense	SNP	0.000	G
TNPO1	3842	genome.wustl.edu	37	5	72196870	72196870	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:72196870G>T	ENST00000337273.5	+	22	2910	c.2484G>T	c.(2482-2484)atG>atT	p.M828I	TNPO1_ENST00000506351.2_Missense_Mutation_p.M820I|TNPO1_ENST00000454282.1_Missense_Mutation_p.M778I|TNPO1_ENST00000523768.1_Missense_Mutation_p.M778I	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	828					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TTTGTACCATGATCAGTGTGA	0.328																																																	0													90.0	87.0	88.0					5																	72196870		2203	4300	6503	SO:0001583	missense	3842			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.2484G>T	5.37:g.72196870G>T	ENSP00000336712:p.Met828Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.M828I	ENST00000337273.5	37	c.2484	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449002	0.63178	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351;ENST00000519220	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.8	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41949	0.1181	M	0.62209	1.925	0.80722	D	1	B;B	0.32338	0.365;0.083	B;B	0.28465	0.09;0.043	T	0.41893	-0.9483	10	0.56958	D	0.05	-18.8415	15.305	0.73985	0.0673:0.0:0.9327:0.0	.	778;828	Q92973-3;Q92973	.;TNPO1_HUMAN	I	828;778;778;820;339	ENSP00000336712:M828I;ENSP00000398524:M778I;ENSP00000428899:M778I;ENSP00000425118:M820I	ENSP00000336712:M828I	M	+	3	0	TNPO1	72232626	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.384000	0.97219	1.596000	0.50062	0.650000	0.86243	ATG	TNPO1	-	superfamily_ARM-type_fold		0.328	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	G	NM_002270		72196870	+1	no_errors	ENST00000337273	ensembl	human	known	70_37	missense	SNP	1.000	T
TOX	9760	genome.wustl.edu	37	8	59851877	59851877	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:59851877G>T	ENST00000361421.1	-	3	615	c.395C>A	c.(394-396)tCt>tAt	p.S132Y		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	132						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				AATGGAATTAGAAAGCAGTGT	0.488																																					Pancreas(161;610 1969 17913 21374 22725)												0													113.0	113.0	113.0					8																	59851877		2203	4300	6503	SO:0001583	missense	9760				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.395C>A	8.37:g.59851877G>T	ENSP00000354842:p.Ser132Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AV5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.S132Y	ENST00000361421.1	37	c.395	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593858	0.46214	.	.	ENSG00000198846	ENST00000361421	T	0.53640	0.61	5.86	5.86	0.93980	.	0.363680	0.29594	N	0.011712	T	0.46405	0.1391	L	0.43152	1.355	0.47949	D	0.999558	B	0.22480	0.07	B	0.29524	0.103	T	0.26538	-1.0100	9	.	.	.	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	132	O94900	TOX_HUMAN	Y	132	ENSP00000354842:S132Y	.	S	-	2	0	TOX	60014431	1.000000	0.71417	0.785000	0.31869	0.735000	0.41995	8.159000	0.89651	2.777000	0.95525	0.591000	0.81541	TCT	TOX	-	NULL		0.488	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	G	NM_014729		59851877	-1	no_errors	ENST00000361421	ensembl	human	known	70_37	missense	SNP	0.998	T
TP73	7161	genome.wustl.edu	37	1	3638614	3638614	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:3638614C>T	ENST00000378295.4	+	5	614	c.459C>T	c.(457-459)tgC>tgT	p.C153C	TP73_ENST00000378290.4_Silent_p.C82C|TP73_ENST00000604479.1_Silent_p.C153C|TP73_ENST00000604074.1_Silent_p.C153C|TP73_ENST00000357733.3_Silent_p.C153C|TP73_ENST00000354437.4_Silent_p.C153C|TP73_ENST00000603362.1_Silent_p.C153C|TP73_ENST00000346387.4_Silent_p.C153C|TP73_ENST00000378288.4_Silent_p.C104C|TP73_ENST00000378280.1_Silent_p.C104C|TP73_ENST00000378285.1_Silent_p.C104C	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	153	DNA-binding. {ECO:0000255}.				activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		AACTCTACTGCCAGATCGCCA	0.627																																																	0													120.0	110.0	113.0					1																	3638614		2203	4300	6503	SO:0001819	synonymous_variant	7161			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.459C>T	1.37:g.3638614C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Silent	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.C153	ENST00000378295.4	37	c.459	CCDS49.1	1																																																																																			TP73	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.627	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	C	NM_005427		3638614	+1	no_errors	ENST00000378295	ensembl	human	known	70_37	silent	SNP	1.000	T
TPD52L2	7165	genome.wustl.edu	37	20	62507208	62507208	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr20:62507208G>C	ENST00000346249.4	+	4	430	c.354G>C	c.(352-354)gaG>gaC	p.E118D	TPD52L2_ENST00000348257.5_Intron|TPD52L2_ENST00000351424.4_Intron|TPD52L2_ENST00000217121.5_Missense_Mutation_p.E118D|TPD52L2_ENST00000352482.4_Missense_Mutation_p.E118D|TPD52L2_ENST00000358548.4_Intron|TPD52L2_ENST00000369927.4_Intron	NM_001243891.1|NM_003288.3	NP_001230820.1|NP_003279.2	O43399	TPD54_HUMAN	tumor protein D52-like 2	118					regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)					AGTGGAATGAGAAAGTGACCC	0.463																																																	0													143.0	134.0	137.0					20																	62507208		2203	4300	6503	SO:0001583	missense	7165			AF004430	CCDS13540.1, CCDS13541.1, CCDS13542.1, CCDS13543.1, CCDS13544.1, CCDS13545.1, CCDS58785.1, CCDS74752.1, CCDS74753.1	20q13.2-q13.3	2007-12-19			ENSG00000101150	ENSG00000101150			12007	protein-coding gene	gene with protein product		603747				9484778	Standard	NM_199360		Approved	D54, hD54	uc002ygy.3	O43399	OTTHUMG00000033009	ENST00000346249.4:c.354G>C	20.37:g.62507208G>C	ENSP00000343547:p.Glu118Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DPJ6|E1P5G7|O43398|Q5JWU5|Q5JWU6|Q5JWU8|Q5U0E0|Q9H3Z6	Missense_Mutation	SNP	pfam_TPD52	p.E118D	ENST00000346249.4	37	c.354	CCDS13540.1	20	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881237	0.33255	.	.	ENSG00000101150	ENST00000346249;ENST00000352482;ENST00000217121	T;T;T	0.32023	1.47;1.49;1.47	5.78	1.44	0.22558	.	0.197000	0.42964	N	0.000625	T	0.17066	0.0410	L	0.35723	1.085	0.80722	D	1	B;B;B;B;B	0.16396	0.001;0.017;0.017;0.017;0.017	B;B;B;B;B	0.22386	0.007;0.014;0.014;0.027;0.039	T	0.21999	-1.0229	10	0.02654	T	1	-23.7185	6.0995	0.20039	0.2031:0.2786:0.5183:0.0	.	69;118;118;118;118	B4DDV4;Q6FGS1;O43399;Q5U0E0;Q5JWU6	.;.;TPD54_HUMAN;.;.	D	118	ENSP00000343547:E118D;ENSP00000344647:E118D;ENSP00000217121:E118D	ENSP00000217121:E118D	E	+	3	2	TPD52L2	61977652	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.306000	0.33505	0.062000	0.16340	0.555000	0.69702	GAG	TPD52L2	-	pfam_TPD52		0.463	TPD52L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPD52L2	HGNC	protein_coding	OTTHUMT00000080248.1	G			62507208	+1	no_errors	ENST00000217121	ensembl	human	known	70_37	missense	SNP	1.000	C
TPR	7175	genome.wustl.edu	37	1	186292841	186292841	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:186292841G>C	ENST00000367478.4	-	43	6570	c.6274C>G	c.(6274-6276)Cag>Gag	p.Q2092E		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2092					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCCAACTCCTGAGGTGGGGCA	0.473			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0													129.0	132.0	131.0					1																	186292841		1898	4132	6030	SO:0001583	missense	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6274C>G	1.37:g.186292841G>C	ENSP00000356448:p.Gln2092Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q2092E	ENST00000367478.4	37	c.6274	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373625	0.82573	.	.	ENSG00000047410	ENST00000367478	T	0.23147	1.92	5.36	5.36	0.76844	.	0.122293	0.56097	D	0.000025	T	0.29190	0.0726	M	0.62723	1.935	0.39831	D	0.972973	P	0.42409	0.779	B	0.38755	0.281	T	0.10382	-1.0632	10	0.16896	T	0.51	.	19.4568	0.94895	0.0:0.0:1.0:0.0	.	2092	P12270	TPR_HUMAN	E	2092	ENSP00000356448:Q2092E	ENSP00000356448:Q2092E	Q	-	1	0	TPR	184559464	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.344000	0.65981	2.673000	0.90976	0.650000	0.86243	CAG	TPR	-	NULL		0.473	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	G	NM_003292		186292841	-1	no_errors	ENST00000367478	ensembl	human	known	70_37	missense	SNP	0.998	C
TPSAB1	7177	genome.wustl.edu	37	16	1292149	1292149	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:1292149G>A	ENST00000338844.3	+	6	769	c.736G>A	c.(736-738)Gag>Aag	p.E246K	TPSAB1_ENST00000461509.2_Missense_Mutation_p.E253K	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				CAGCTGGGGCGAGGGCTGTGC	0.657																																																	0													50.0	48.0	49.0					16																	1292149		2197	4277	6474	SO:0001583	missense	7177			M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.736G>A	16.37:g.1292149G>A	ENSP00000343577:p.Glu246Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.E246K	ENST00000338844.3	37	c.736	CCDS10431.1	16	.	.	.	.	.	.	.	.	.	.	G	2.082	-0.410477	0.04799	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.88277	-2.36;-2.36	3.08	0.934	0.19477	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.102790	0.02137	N	0.056800	T	0.74137	0.3677	N	0.04768	-0.165	0.09310	N	1	B;B	0.30068	0.225;0.267	B;B	0.19148	0.014;0.024	T	0.66412	-0.5930	10	0.17832	T	0.49	.	5.1024	0.14766	0.121:0.0:0.6742:0.2048	.	237;246	Q15661-2;Q15661	.;TRYB1_HUMAN	K	246;253	ENSP00000343577:E246K;ENSP00000418247:E253K	ENSP00000343577:E246K	E	+	1	0	TPSAB1	1232150	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.832000	0.04400	0.140000	0.18849	0.184000	0.17185	GAG	TPSAB1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.657	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TPSAB1	HGNC	protein_coding	OTTHUMT00000206914.1	G	NM_003294		1292149	+1	no_errors	ENST00000562675	ensembl	human	known	70_37	missense	SNP	0.008	A
TSHZ1	10194	genome.wustl.edu	37	18	72998082	72998082	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr18:72998082C>T	ENST00000580243.1	+	2	1068	c.720C>T	c.(718-720)ttC>ttT	p.F240F	TSHZ1_ENST00000322038.5_Silent_p.F195F			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	240					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GCTCCGTCTTCACGGGCGCCA	0.617																																																	0													55.0	46.0	49.0					18																	72998082		2203	4300	6503	SO:0001819	synonymous_variant	10194			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.720C>T	18.37:g.72998082C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60534|Q4LE29|Q53EU4	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.F240	ENST00000580243.1	37	c.720		18																																																																																			TSHZ1	-	NULL		0.617	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	C	NM_005786		72998082	+1	no_errors	ENST00000580243	ensembl	human	known	70_37	silent	SNP	1.000	T
UHMK1	127933	genome.wustl.edu	37	1	162493066	162493066	+	3'UTR	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:162493066G>C	ENST00000489294.1	+	0	2144				UHMK1_ENST00000545294.1_3'UTR|UHMK1_ENST00000282169.8_3'UTR|UHMK1_ENST00000538489.1_3'UTR	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1						cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)			endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGAATCCTGTGAGCTAATACA	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	127933			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.*726G>C	1.37:g.162493066G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8K4|G3V1M1|Q96C22	RNA	SNP	-	NULL	ENST00000489294.1	37	NULL	CCDS1239.1	1																																																																																			UHMK1	-	-		0.328	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	HGNC	protein_coding	OTTHUMT00000076788.1	G	NM_175866		162493066	+1	no_errors	ENST00000282169	ensembl	human	known	70_37	rna	SNP	0.010	C
USP17L2	377630	genome.wustl.edu	37	8	11995421	11995421	+	Missense_Mutation	SNP	G	G	C			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr8:11995421G>C	ENST00000333796.3	-	1	1165	c.849C>G	c.(847-849)ttC>ttG	p.F283L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	283	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TGACATCGGAGAATCTCTTCA	0.493																																																	0													26.0	30.0	29.0					8																	11995421		1315	2977	4292	SO:0001583	missense	377630			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.849C>G	8.37:g.11995421G>C	ENSP00000333329:p.Phe283Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19	p.F283L	ENST00000333796.3	37	c.849	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	G	11.47	1.646978	0.29246	.	.	ENSG00000223443	ENST00000333796	T	0.44083	0.93	0.745	0.745	0.18359	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.071226	0.56097	D	0.000031	T	0.67979	0.2951	H	0.97340	3.985	0.09310	N	1	D	0.71674	0.998	D	0.70935	0.971	T	0.57429	-0.7813	10	0.87932	D	0	.	3.144	0.06466	0.3214:0.0:0.6786:0.0	.	283	Q6R6M4	U17L2_HUMAN	L	283	ENSP00000333329:F283L	ENSP00000333329:F283L	F	-	3	2	USP17L2	12032830	0.791000	0.28800	0.022000	0.16811	0.011000	0.07611	1.051000	0.30417	0.733000	0.32492	0.472000	0.43445	TTC	USP17L2	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.493	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	G	NM_201402		11995421	-1	no_errors	ENST00000333796	ensembl	human	known	70_37	missense	SNP	0.045	C
USP44	84101	genome.wustl.edu	37	12	95912058	95912058	+	Missense_Mutation	SNP	A	A	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr12:95912058A>G	ENST00000258499.3	-	6	2299	c.2011T>C	c.(2011-2013)Tat>Cat	p.Y671H	USP44_ENST00000537435.2_Missense_Mutation_p.Y671H|USP44_ENST00000393091.2_Missense_Mutation_p.Y671H|USP44_ENST00000552440.1_3'UTR	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	671	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						AACAAGATATAAGCTTGAGCC	0.428																																																	0													120.0	111.0	114.0					12																	95912058		2203	4300	6503	SO:0001583	missense	84101			AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.2011T>C	12.37:g.95912058A>G	ENSP00000258499:p.Tyr671His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDW3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.Y671H	ENST00000258499.3	37	c.2011	CCDS9053.1	12	.	.	.	.	.	.	.	.	.	.	A	27.4	4.827843	0.90955	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000537435	T;T;T	0.61392	0.11;0.11;0.11	6.0	6.0	0.97389	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.85839	0.5790	H	0.98559	4.265	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	D	0.91337	0.5094	10	0.87932	D	0	.	16.56	0.84537	1.0:0.0:0.0:0.0	.	671	Q9H0E7	UBP44_HUMAN	H	671	ENSP00000258499:Y671H;ENSP00000376806:Y671H;ENSP00000442629:Y671H	ENSP00000258499:Y671H	Y	-	1	0	USP44	94436189	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.101000	0.94219	2.313000	0.78055	0.454000	0.30748	TAT	USP44	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.428	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP44	HGNC	protein_coding	OTTHUMT00000408312.1	A	NM_032147		95912058	-1	no_errors	ENST00000258499	ensembl	human	known	70_37	missense	SNP	1.000	G
VAV3	10451	genome.wustl.edu	37	1	108116734	108116734	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:108116734C>G	ENST00000370056.4	-	26	2711	c.2437G>C	c.(2437-2439)Gat>Cat	p.D813H	VAV3_ENST00000415432.2_Missense_Mutation_p.D253H|VAV3_ENST00000544443.1_Missense_Mutation_p.D217H|VAV3_ENST00000527011.1_Missense_Mutation_p.D841H|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	813	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.|Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTCACCACATCTCCTTTCAAC	0.463																																																	0													270.0	238.0	249.0					1																	108116734		2203	4300	6503	SO:0001583	missense	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.2437G>C	1.37:g.108116734C>G	ENSP00000359073:p.Asp813His	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.D813H	ENST00000370056.4	37	c.2437	CCDS785.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.141463	0.94560	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.93	5.93	0.95920	Src homology-3 domain (4);Variant SH3 (1);	0.041303	0.85682	D	0.000000	T	0.48537	0.1505	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.87578	0.993;0.971;0.998;0.995	T	0.52313	-0.8592	10	0.72032	D	0.01	.	20.3312	0.98718	0.0:1.0:0.0:0.0	.	841;245;813;253	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	H	813;841;217;253	ENSP00000359073:D813H;ENSP00000432540:D841H;ENSP00000446404:D217H;ENSP00000394897:D253H	ENSP00000359073:D813H	D	-	1	0	VAV3	107918257	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.818000	0.86416	2.797000	0.96272	0.655000	0.94253	GAT	VAV3	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.463	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	C	NM_006113		108116734	-1	no_errors	ENST00000370056	ensembl	human	known	70_37	missense	SNP	1.000	G
VIP	7432	genome.wustl.edu	37	6	153073374	153073374	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:153073374C>G	ENST00000367244.3	+	2	234	c.62C>G	c.(61-63)tCa>tGa	p.S21*	VIP_ENST00000367243.3_Nonsense_Mutation_p.S21*	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	21					body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		GTGCTCTTCTCACAGACTTCG	0.468																																																	0													167.0	138.0	148.0					6																	153073374		2203	4300	6503	SO:0001587	stop_gained	7432				CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.62C>G	6.37:g.153073374C>G	ENSP00000356213:p.Ser21*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TCY8|Q5TCY9|Q96QK3	Nonsense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.S21*	ENST00000367244.3	37	c.62	CCDS5240.1	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952654	0.73787	.	.	ENSG00000146469	ENST00000367244;ENST00000367243	.	.	.	5.61	5.61	0.85477	.	0.241288	0.36740	N	0.002431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-0.7848	11.8384	0.52340	0.0:0.9186:0.0:0.0814	.	.	.	.	X	21	.	ENSP00000356212:S21X	S	+	2	0	VIP	153115067	0.991000	0.36638	0.937000	0.37676	0.001000	0.01503	3.035000	0.49759	2.645000	0.89757	0.585000	0.79938	TCA	VIP	-	NULL		0.468	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VIP	HGNC	protein_coding	OTTHUMT00000042751.1	C			153073374	+1	no_errors	ENST00000367244	ensembl	human	known	70_37	nonsense	SNP	0.995	G
VMP1	81671	genome.wustl.edu	37	17	57915729	57915729	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr17:57915729C>T	ENST00000262291.4	+	11	1358	c.1048C>T	c.(1048-1050)Cac>Tac	p.H350Y	VMP1_ENST00000588617.1_3'UTR|MIR21_ENST00000362134.1_RNA|VMP1_ENST00000545362.1_Missense_Mutation_p.H294Y|VMP1_ENST00000537567.1_Missense_Mutation_p.H216Y|VMP1_ENST00000536180.1_Missense_Mutation_p.H253Y|VMP1_ENST00000539763.1_Missense_Mutation_p.H158Y	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	350					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						GCAGAAGCTTCACCACAAAAG	0.517																																																	0													91.0	83.0	86.0					17																	57915729		2203	4300	6503	SO:0001583	missense	81671				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.1048C>T	17.37:g.57915729C>T	ENSP00000262291:p.His350Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	NULL	p.H350Y	ENST00000262291.4	37	c.1048	CCDS11619.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.476525	0.96291	.	.	ENSG00000062716	ENST00000262291;ENST00000537567;ENST00000539763;ENST00000536180;ENST00000545362	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.84906	0.5576	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.74023	0.974;0.93;0.974;0.982	D	0.84836	0.0805	9	0.49607	T	0.09	-7.8348	20.4024	0.99000	0.0:1.0:0.0:0.0	.	216;253;294;350	B4DED7;B4DGZ7;F5H2J3;Q96GC9	.;.;.;VMP1_HUMAN	Y	350;216;158;253;294	.	ENSP00000262291:H350Y	H	+	1	0	VMP1	55270511	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.536000	0.82023	2.827000	0.97445	0.650000	0.86243	CAC	VMP1	-	NULL		0.517	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMP1	HGNC	protein_coding	OTTHUMT00000448793.1	C	NM_030938		57915729	+1	no_errors	ENST00000262291	ensembl	human	known	70_37	missense	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49934112	49934112	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr10:49934112C>T	ENST00000325239.5	+	5	805	c.778C>T	c.(778-780)Cag>Tag	p.Q260*	WDFY4_ENST00000413659.2_Nonsense_Mutation_p.Q260*|WDFY4_ENST00000360890.2_Nonsense_Mutation_p.Q260*	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	260						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCAGTACCTGCAGGGTATGGC	0.562																																																	0													24.0	20.0	21.0					10																	49934112		692	1591	2283	SO:0001587	stop_gained	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.778C>T	10.37:g.49934112C>T	ENSP00000320563:p.Gln260*	Somatic		WXS	Illumina HiSeq	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q260*	ENST00000325239.5	37	c.778	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.025227	0.97211	.	.	ENSG00000128815	ENST00000360890;ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	.	.	.	5.84	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	14.0282	0.64599	0.2952:0.7047:0.0:0.0	.	.	.	.	X	260;269;260;260;260	.	ENSP00000320563:Q260X	Q	+	1	0	WDFY4	49604118	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.112000	0.57845	0.740000	0.32651	0.561000	0.74099	CAG	WDFY4	-	superfamily_ARM-type_fold		0.562	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		C	XM_033379		49934112	+1	no_errors	ENST00000325239	ensembl	human	known	70_37	nonsense	SNP	1.000	T
WDR31	114987	genome.wustl.edu	37	9	116082750	116082750	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr9:116082750C>G	ENST00000374193.4	-	9	913	c.667G>C	c.(667-669)Gct>Cct	p.A223P	WDR31_ENST00000341761.4_Missense_Mutation_p.A222P|WDR31_ENST00000461942.1_5'UTR|WDR31_ENST00000374195.3_Missense_Mutation_p.A98P	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	223										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						AACATATGAGCTACCTGCAGC	0.478																																																	0													95.0	84.0	88.0					9																	116082750		2203	4300	6503	SO:0001583	missense	114987			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.667G>C	9.37:g.116082750C>G	ENSP00000363308:p.Ala223Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W0T9|Q96EG8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A223P	ENST00000374193.4	37	c.667	CCDS35110.1	9	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528074	0.85706	.	.	ENSG00000148225	ENST00000374193;ENST00000374195;ENST00000341761	T;T;T	0.06528	3.29;3.29;3.29	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056767	0.64402	D	0.000001	T	0.26557	0.0649	M	0.76002	2.32	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.74674	0.963;0.984	T	0.00070	-1.2135	10	0.39692	T	0.17	-15.1113	19.1813	0.93625	0.0:1.0:0.0:0.0	.	223;222	Q8NA23;Q8NA23-2	WDR31_HUMAN;.	P	223;98;222	ENSP00000363308:A223P;ENSP00000363310:A98P;ENSP00000345027:A222P	ENSP00000345027:A222P	A	-	1	0	WDR31	115122571	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.915000	0.56409	2.771000	0.95319	0.563000	0.77884	GCT	WDR31	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.478	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	HGNC	protein_coding	OTTHUMT00000053734.2	C	NM_145241		116082750	-1	no_errors	ENST00000374193	ensembl	human	known	70_37	missense	SNP	1.000	G
WDR64	128025	genome.wustl.edu	37	1	241875110	241875110	+	Silent	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:241875110C>G	ENST00000366552.2	+	8	1158	c.951C>G	c.(949-951)gtC>gtG	p.V317V	WDR64_ENST00000437684.2_Silent_p.V317V	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	317										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CCAGGCCTGTCAGAGAGTTTT	0.368																																																	0													118.0	110.0	112.0					1																	241875110		2203	4300	6503	SO:0001819	synonymous_variant	128025			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.951C>G	1.37:g.241875110C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V317	ENST00000366552.2	37	c.951		1																																																																																			WDR64	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.368	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		C	NM_144625		241875110	+1	no_errors	ENST00000366552	ensembl	human	known	70_37	silent	SNP	1.000	G
XIRP1	165904	genome.wustl.edu	37	3	39228399	39228399	+	Silent	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr3:39228399C>T	ENST00000340369.3	-	2	2766	c.2538G>A	c.(2536-2538)ctG>ctA	p.L846L	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Silent_p.L846L	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	846					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTTCCTGCACCAGCAGCCCCT	0.592																																																	0													38.0	37.0	37.0					3																	39228399		2203	4300	6503	SO:0001819	synonymous_variant	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2538G>A	3.37:g.39228399C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	pfam_Actin-binding_Xin_repeat	p.L846	ENST00000340369.3	37	c.2538	CCDS2683.1	3																																																																																			XIRP1	-	NULL		0.592	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	C	XM_093522		39228399	-1	no_errors	ENST00000340369	ensembl	human	known	70_37	silent	SNP	0.999	T
TSIX	9383	genome.wustl.edu	37	X	73046247	73046247	+	lincRNA	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:73046247G>A	ENST00000604411.1	+	0	34208				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CTCAAGTGGAGAAGATGTGAA	0.388																																																	0													31.0	30.0	30.0					X																	73046247		876	1991	2867			7503					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73046247G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-		0.388	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	G	NR_003255		73046247	-1	no_errors	ENST00000429829	ensembl	human	known	70_37	rna	SNP	0.000	A
ZBTB33	10009	genome.wustl.edu	37	X	119388943	119388943	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:119388943C>T	ENST00000326624.2	+	2	1901	c.1673C>T	c.(1672-1674)tCt>tTt	p.S558F	ZBTB33_ENST00000557385.1_Missense_Mutation_p.S558F	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	558	Interaction with CTNND1. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGTGGCAAATCTTTCATCAAC	0.413																																																	0													140.0	125.0	130.0					X																	119388943		2203	4300	6503	SO:0001583	missense	10009			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1673C>T	X.37:g.119388943C>T	ENSP00000314153:p.Ser558Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S558F	ENST00000326624.2	37	c.1673	CCDS14596.1	X	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730092	0.48939	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.19394	2.15;2.15	5.55	5.55	0.83447	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.161068	0.56097	D	0.000029	T	0.41419	0.1158	L	0.55834	1.745	0.46317	D	0.998983	D	0.60160	0.987	P	0.62885	0.908	T	0.21449	-1.0245	10	0.72032	D	0.01	-4.5684	17.3434	0.87303	0.0:1.0:0.0:0.0	.	558	Q86T24	KAISO_HUMAN	F	558	ENSP00000314153:S558F;ENSP00000450969:S558F	ENSP00000314153:S558F	S	+	2	0	ZBTB33;AC002086.1	119272971	0.997000	0.39634	1.000000	0.80357	0.983000	0.72400	1.831000	0.39141	2.308000	0.77769	0.513000	0.50165	TCT	ZBTB33	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB33	HGNC	protein_coding	OTTHUMT00000058085.2	C	NM_006777		119388943	+1	no_errors	ENST00000326624	ensembl	human	known	70_37	missense	SNP	1.000	T
ZCCHC11	23318	genome.wustl.edu	37	1	52926879	52926879	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr1:52926879C>G	ENST00000371544.3	-	19	3510	c.3248G>C	c.(3247-3249)aGa>aCa	p.R1083T	ZCCHC11_ENST00000371541.1_5'Flank|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.R1083T	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1083					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						AGCTAGCATTCTTGTGTTATG	0.289																																																	0													101.0	100.0	100.0					1																	52926879		2203	4294	6497	SO:0001583	missense	23318			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.3248G>C	1.37:g.52926879C>G	ENSP00000360599:p.Arg1083Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.R1083T	ENST00000371544.3	37	c.3248	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615528	0.87359	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.69672	0.3137	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	0.981;1.0	P;D	0.83275	0.877;0.996	T	0.70781	-0.4779	10	0.72032	D	0.01	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	842;1083	E9PKX1;Q5TAX3	.;TUT4_HUMAN	T	1083;1083;1012;842	ENSP00000257177:R1083T;ENSP00000360599:R1083T;ENSP00000433486:R1012T;ENSP00000435256:R842T	ENSP00000257177:R1083T	R	-	2	0	ZCCHC11	52699467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.461000	0.80834	2.873000	0.98535	0.563000	0.77884	AGA	ZCCHC11	-	NULL		0.289	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	C	XM_038288		52926879	-1	no_errors	ENST00000257177	ensembl	human	known	70_37	missense	SNP	1.000	G
ZDHHC11	79844	genome.wustl.edu	37	5	850645	850645	+	Missense_Mutation	SNP	G	G	A	rs138515363	byFrequency	TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr5:850645G>A	ENST00000283441.8	-	1	456	c.73C>T	c.(73-75)Ccg>Tcg	p.P25S	ZDHHC11_ENST00000424784.2_Missense_Mutation_p.P25S	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	25						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			ATGCGGGGCGGCAAGACCAGC	0.607																																																	0													91.0	91.0	91.0					5																	850645		2203	4300	6503	SO:0001583	missense	79844			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.73C>T	5.37:g.850645G>A	ENSP00000283441:p.Pro25Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWR9	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.P25S	ENST00000283441.8	37	c.73	CCDS3857.1	5	.	.	.	.	.	.	.	.	.	.	N	15.90	2.970862	0.53614	.	.	ENSG00000188818	ENST00000424784;ENST00000283441	T;T	0.60040	0.22;0.22	4.17	1.28	0.21552	.	.	.	.	.	T	0.57651	0.2068	L	0.44542	1.39	0.20074	N	0.999939	D	0.69078	0.997	P	0.59643	0.861	T	0.46034	-0.9220	9	0.54805	T	0.06	-15.0998	2.5058	0.04645	0.1074:0.1886:0.5097:0.1944	.	25	Q9H8X9	ZDH11_HUMAN	S	25	ENSP00000397719:P25S;ENSP00000283441:P25S	ENSP00000283441:P25S	P	-	1	0	ZDHHC11	903645	0.184000	0.23200	0.000000	0.03702	0.001000	0.01503	2.014000	0.40951	0.049000	0.15920	0.511000	0.50034	CCG	ZDHHC11	-	NULL		0.607	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	HGNC	protein_coding	OTTHUMT00000206681.3	G	NM_024786		850645	-1	no_errors	ENST00000283441	ensembl	human	known	70_37	missense	SNP	0.002	A
ZDHHC13	54503	genome.wustl.edu	37	11	19197384	19197384	+	Silent	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr11:19197384G>A	ENST00000446113.2	+	17	1867	c.1746G>A	c.(1744-1746)caG>caA	p.Q582Q	ZDHHC13_ENST00000399351.3_Silent_p.Q452Q	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	582					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						GATTCATGCAGAACCTGGCAG	0.423																																																	0													94.0	88.0	90.0					11																	19197384		1856	4102	5958	SO:0001819	synonymous_variant	54503			AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.1746G>A	11.37:g.19197384G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Silent	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase	p.Q582	ENST00000446113.2	37	c.1746	CCDS44550.1	11																																																																																			ZDHHC13	-	NULL		0.423	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZDHHC13	HGNC	protein_coding	OTTHUMT00000387821.1	G	NM_019028		19197384	+1	no_errors	ENST00000446113	ensembl	human	known	70_37	silent	SNP	1.000	A
ZFHX3	463	genome.wustl.edu	37	16	72822199	72822199	+	Missense_Mutation	SNP	C	C	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr16:72822199C>T	ENST00000268489.5	-	10	10648	c.9976G>A	c.(9976-9978)Gcc>Acc	p.A3326T	RP5-991G20.4_ENST00000569195.1_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.A2412T|RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3326					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A3326T(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CTCTGCAGGGCGCCAGGGATC	0.597																																																	1	Substitution - Missense(1)	urinary_tract(1)											32.0	34.0	33.0					16																	72822199		2196	4300	6496	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.9976G>A	16.37:g.72822199C>T	ENSP00000268489:p.Ala3326Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.A3326T	ENST00000268489.5	37	c.9976	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623299	0.46840	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.74526	-0.85;-0.81	5.23	4.28	0.50868	.	0.000000	0.49916	D	0.000135	T	0.58061	0.2096	N	0.25647	0.755	0.58432	D	0.999999	B	0.29612	0.251	B	0.16289	0.015	T	0.53570	-0.8420	10	0.17369	T	0.5	.	13.9842	0.64324	0.0:0.9264:0.0:0.0736	.	3326	Q15911	ZFHX3_HUMAN	T	3326;2412	ENSP00000268489:A3326T;ENSP00000438926:A2412T	ENSP00000268489:A3326T	A	-	1	0	ZFHX3	71379700	0.044000	0.20184	1.000000	0.80357	0.998000	0.95712	0.513000	0.22770	1.208000	0.43306	0.557000	0.71058	GCC	ZFHX3	-	NULL		0.597	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	C	NM_006885		72822199	-1	no_errors	ENST00000268489	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF626	199777	genome.wustl.edu	37	19	20808330	20808330	+	Missense_Mutation	SNP	A	A	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:20808330A>T	ENST00000601440.1	-	4	499	c.353T>A	c.(352-354)aTa>aAa	p.I118K	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						ATCCACACTTATACATCCTTT	0.338																																																	0													90.0	95.0	93.0					19																	20808330		2168	4282	6450	SO:0001583	missense	199777			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.353T>A	19.37:g.20808330A>T	ENSP00000469958:p.Ile118Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N8T4|Q96QM1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I118K	ENST00000601440.1	37	c.353	CCDS42535.1	19	.	.	.	.	.	.	.	.	.	.	N	0.003	-2.561253	0.00136	.	.	ENSG00000188171	ENST00000392298;ENST00000453075;ENST00000305570	.	.	.	0.898	0.898	0.19264	.	.	.	.	.	T	0.03053	0.0090	N	0.00038	-2.515	0.22389	N	0.999142	B	0.02656	0.0	B	0.01281	0.0	T	0.33727	-0.9857	8	0.02654	T	1	.	3.9915	0.09539	0.5932:0.0:0.0:0.4068	.	118	Q68DY1	ZN626_HUMAN	K	118;42;118	.	ENSP00000445201:I118K	I	-	2	0	ZNF626	20600170	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-0.294000	0.08309	-1.002000	0.03429	-1.123000	0.02005	ATA	ZNF626	-	NULL		0.338	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	A	NM_145297		20808330	-1	no_errors	ENST00000601440	ensembl	human	known	70_37	missense	SNP	0.085	T
ZNF568	374900	genome.wustl.edu	37	19	37413710	37413710	+	Missense_Mutation	SNP	T	T	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:37413710T>G	ENST00000333987.7	+	3	544	c.38T>G	c.(37-39)gTg>gGg	p.V13G	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000415168.1_Intron|ZNF568_ENST00000427117.1_Missense_Mutation_p.V13G	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	13					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATAGCTGTGTGACAATGGAG	0.512																																																	0													112.0	110.0	110.0					19																	37413710		1987	4161	6148	SO:0001583	missense	374900			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.38T>G	19.37:g.37413710T>G	ENSP00000334685:p.Val13Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V13G	ENST00000333987.7	37	c.38	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	T	9.613	1.131726	0.21041	.	.	ENSG00000198453	ENST00000427117;ENST00000333987;ENST00000444991	T;T;T	0.08458	5.62;3.36;3.09	3.05	0.813	0.18749	.	.	.	.	.	T	0.03783	0.0107	N	0.08118	0	0.31517	N	0.66286	B	0.02656	0.0	B	0.01281	0.0	T	0.26573	-1.0099	9	0.51188	T	0.08	.	3.3376	0.07106	0.2239:0.0:0.2556:0.5205	.	13	Q3ZCX4	ZN568_HUMAN	G	13	ENSP00000407012:V13G;ENSP00000334685:V13G;ENSP00000389794:V13G	ENSP00000334685:V13G	V	+	2	0	ZNF568	42105550	0.001000	0.12720	0.514000	0.27761	0.458000	0.32498	-0.261000	0.08694	0.107000	0.17824	0.454000	0.30748	GTG	ZNF568	-	NULL		0.512	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	T	NM_198539		37413710	+1	no_errors	ENST00000333987	ensembl	human	known	70_37	missense	SNP	0.627	G
ZNF630	57232	genome.wustl.edu	37	X	47919232	47919232	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chrX:47919232C>A	ENST00000409324.3	-	5	825	c.599G>T	c.(598-600)aGa>aTa	p.R200I	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000276054.4_Missense_Mutation_p.R76I|ZNF630_ENST00000442455.3_Missense_Mutation_p.R186I	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						GGGGTTCTTTCTTGCATAGCT	0.383																																																	0													54.0	47.0	49.0					X																	47919232		2193	4290	6483	SO:0001583	missense	57232			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.599G>T	X.37:g.47919232C>A	ENSP00000386393:p.Arg200Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R200I	ENST00000409324.3	37	c.599	CCDS35237.2	X	.	.	.	.	.	.	.	.	.	.	.	15.02	2.709860	0.48517	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324;ENST00000428686	T;T;T;T	0.09445	3.15;2.98;3.22;5.29	2.65	-0.21	0.13176	.	.	.	.	.	T	0.05364	0.0142	N	0.20986	0.625	0.26874	N	0.967683	P	0.39964	0.697	B	0.29440	0.102	T	0.29731	-1.0002	9	0.87932	D	0	.	5.1186	0.14849	0.0:0.5:0.3607:0.1392	.	200	Q2M218	ZN630_HUMAN	I	186;76;200;200	ENSP00000393163:R186I;ENSP00000354683:R76I;ENSP00000386393:R200I;ENSP00000407278:R200I	ENSP00000354683:R76I	R	-	2	0	ZNF630	47804176	0.000000	0.05858	0.001000	0.08648	0.098000	0.18820	0.191000	0.17076	-0.373000	0.07979	0.544000	0.68410	AGA	ZNF630	-	NULL		0.383	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	HGNC	protein_coding	OTTHUMT00000327254.1	C	NM_001037735		47919232	-1	no_errors	ENST00000409324	ensembl	human	known	70_37	missense	SNP	0.505	A
ZNF701	55762	genome.wustl.edu	37	19	53077398	53077398	+	Missense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:53077398G>T	ENST00000540331.1	+	3	421	c.196G>T	c.(196-198)Ggg>Tgg	p.G66W	ZNF701_ENST00000391785.3_5'UTR|CTD-3099C6.7_ENST00000599222.1_RNA|ZNF701_ENST00000301093.2_Missense_Mutation_p.G66W	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		AAAGGAGTCAGGGATGGCTCT	0.428																																					NSCLC(89;451 1475 9611 20673 52284)												0													181.0	138.0	152.0					19																	53077398		2203	4300	6503	SO:0001583	missense	55762			AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.196G>T	19.37:g.53077398G>T	ENSP00000444339:p.Gly66Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G66W	ENST00000540331.1	37	c.196	CCDS54311.1	19	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300772	0.40694	.	.	ENSG00000167562	ENST00000301093;ENST00000540331	T;T	0.06142	3.34;3.34	1.17	-1.5	0.08691	.	.	.	.	.	T	0.10895	0.0266	L	0.34521	1.04	0.09310	N	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.23976	-1.0173	8	.	.	.	.	4.1496	0.10232	0.4534:0.0:0.5466:0.0	.	66	F5GZM6	.	W	66	ENSP00000301093:G66W;ENSP00000444339:G66W	.	G	+	1	0	ZNF701	57769210	0.005000	0.15991	0.001000	0.08648	0.688000	0.40055	0.292000	0.19011	-0.372000	0.07992	0.306000	0.20318	GGG	ZNF701	-	NULL		0.428	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF701	HGNC	protein_coding	OTTHUMT00000463467.1	G	NM_018260		53077398	+1	no_errors	ENST00000301093	ensembl	human	known	70_37	missense	SNP	0.001	T
ZNF804B	219578	genome.wustl.edu	37	7	88966314	88966314	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr7:88966314G>T	ENST00000333190.4	+	4	4627	c.4018G>T	c.(4018-4020)Gag>Tag	p.E1340*		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1340							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGAAGTGAAAGAGGCCTTAAA	0.353										HNSCC(36;0.09)																																							0													60.0	61.0	60.0					7																	88966314		2203	4299	6502	SO:0001587	stop_gained	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.4018G>T	7.37:g.88966314G>T	ENSP00000329638:p.Glu1340*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTV2|Q7Z714|Q96MN7	Nonsense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.E1340*	ENST00000333190.4	37	c.4018	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.621012	0.99583	.	.	ENSG00000182348	ENST00000333190	.	.	.	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.44711	D	0.997706	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-19.7339	19.3014	0.94145	0.0:0.0:1.0:0.0	.	.	.	.	X	1340	.	ENSP00000329638:E1340X	E	+	1	0	ZNF804B	88804250	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.862000	0.48388	2.854000	0.98071	0.655000	0.94253	GAG	ZNF804B	-	NULL		0.353	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	G	NM_181646		88966314	+1	no_errors	ENST00000333190	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZNF99	7652	genome.wustl.edu	37	19	22942361	22942361	+	Missense_Mutation	SNP	C	C	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:22942361C>A	ENST00000596209.1	-	4	440	c.350G>T	c.(349-351)tGt>tTt	p.C117F	ZNF99_ENST00000397104.3_Missense_Mutation_p.C138F	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C138F(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GACACTTTCACAATCTTTTCT	0.328																																																	1	Substitution - Missense(1)	endometrium(1)											108.0	102.0	104.0					19																	22942361		1854	4103	5957	SO:0001583	missense	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.350G>T	19.37:g.22942361C>A	ENSP00000472969:p.Cys117Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C138F	ENST00000596209.1	37	c.413	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	N	0.014	-1.592955	0.00864	.	.	ENSG00000213973	ENST00000397104	T	0.06768	3.26	0.257	0.257	0.15574	.	.	.	.	.	T	0.13756	0.0333	M	0.68593	2.085	0.19575	N	0.999964	P	0.50443	0.935	P	0.54238	0.746	T	0.20075	-1.0286	9	0.10111	T	0.7	.	6.4228	0.21754	0.0:0.9998:0.0:2.0E-4	.	138	A8MXY4	ZNF99_HUMAN	F	138	ENSP00000380293:C138F	ENSP00000380293:C138F	C	-	2	0	ZNF99	22734201	0.000000	0.05858	0.079000	0.20413	0.072000	0.16883	-1.615000	0.02055	0.384000	0.24942	0.385000	0.25706	TGT	ZNF99	-	NULL		0.328	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	C	XM_065124		22942361	-1	no_errors	ENST00000397104	ensembl	human	known	70_37	missense	SNP	0.505	A
ZNF813	126017	genome.wustl.edu	37	19	53993928	53993928	+	Missense_Mutation	SNP	C	C	G			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr19:53993928C>G	ENST00000396403.4	+	4	570	c.442C>G	c.(442-444)Ctg>Gtg	p.L148V	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TCATTCGCATCTGCCTGAACT	0.408																																																	0													158.0	162.0	161.0					19																	53993928		2203	4297	6500	SO:0001583	missense	126017			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.442C>G	19.37:g.53993928C>G	ENSP00000379684:p.Leu148Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L148V	ENST00000396403.4	37	c.442	CCDS46172.1	19	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975136	0.34848	.	.	ENSG00000198346	ENST00000468450;ENST00000396403	T;T	0.05717	3.69;3.4	0.961	0.961	0.19638	.	.	.	.	.	T	0.21962	0.0529	M	0.83692	2.655	0.46336	D	0.998997	D	0.89917	1.0	D	0.87578	0.998	T	0.01977	-1.1236	9	0.66056	D	0.02	.	7.7282	0.28771	0.0:1.0:0.0:0.0	.	148	Q6ZN06	ZN813_HUMAN	V	95;148	ENSP00000419821:L95V;ENSP00000379684:L148V	ENSP00000379684:L148V	L	+	1	2	ZNF813	58685740	0.000000	0.05858	0.007000	0.13788	0.059000	0.15707	-1.259000	0.02861	0.820000	0.34516	0.205000	0.17691	CTG	ZNF813	-	NULL		0.408	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	HGNC	protein_coding	OTTHUMT00000350638.1	C	NM_001004301		53993928	+1	no_errors	ENST00000396403	ensembl	human	known	70_37	missense	SNP	0.327	G
ZSCAN23	222696	genome.wustl.edu	37	6	28402379	28402379	+	Missense_Mutation	SNP	G	G	A			TCGA-FU-A40J-01A-11D-A243-09	TCGA-FU-A40J-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	956cb80b-81d3-4f19-9b71-cb636dc91845	22622949-a302-41a5-be56-040320a61c74	g.chr6:28402379G>A	ENST00000289788.4	-	4	1178	c.1033C>T	c.(1033-1035)Cgt>Tgt	p.R345C	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	345					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						AGGACTGAACGTCGACTAAAA	0.443																																																	0													143.0	121.0	128.0					6																	28402379		692	1591	2283	SO:0001583	missense	222696			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.1033C>T	6.37:g.28402379G>A	ENSP00000289788:p.Arg345Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R345C	ENST00000289788.4	37	c.1033	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	G	15.76	2.927718	0.52759	.	.	ENSG00000187987	ENST00000289788	T	0.08634	3.07	3.93	1.91	0.25777	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34906	N	0.003592	T	0.11707	0.0285	M	0.76938	2.355	0.09310	N	1	D	0.89917	1.0	P	0.60415	0.874	T	0.02505	-1.1149	10	0.59425	D	0.04	.	10.0008	0.41927	0.0:0.0:0.6395:0.3605	.	345	Q3MJ62	ZSC23_HUMAN	C	345	ENSP00000289788:R345C	ENSP00000289788:R345C	R	-	1	0	ZSCAN23	28510358	0.000000	0.05858	0.995000	0.50966	0.993000	0.82548	-0.302000	0.08221	0.782000	0.33613	0.650000	0.86243	CGT	ZSCAN23	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	G	XM_167147		28402379	-1	no_errors	ENST00000289788	ensembl	human	known	70_37	missense	SNP	0.041	A
