#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ALDH1L2	160428	genome.wustl.edu	37	12	105433521	105433521	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr12:105433521G>C	ENST00000258494.9	-	17	2155	c.2015C>G	c.(2014-2016)tCc>tGc	p.S672C	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	672	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						AATAGGAGTGGATCCAGTGAA	0.388																																																	0													171.0	157.0	162.0					12																	105433521		2203	4300	6503	SO:0001583	missense	160428			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2015C>G	12.37:g.105433521G>C	ENSP00000258494:p.Ser672Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.S672C	ENST00000258494.9	37	c.2015	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843284	0.91197	.	.	ENSG00000136010	ENST00000258494	D	0.84589	-1.87	5.7	5.7	0.88788	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.96636	0.8902	H	0.99825	4.815	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.98419	1.0576	10	0.87932	D	0	.	19.8383	0.96670	0.0:0.0:1.0:0.0	.	672	Q3SY69	AL1L2_HUMAN	C	672	ENSP00000258494:S672C	ENSP00000258494:S672C	S	-	2	0	ALDH1L2	103957651	1.000000	0.71417	0.880000	0.34516	0.952000	0.60782	9.776000	0.99001	2.683000	0.91414	0.650000	0.86243	TCC	ALDH1L2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH		0.388	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	G	XM_090294		105433521	-1	no_errors	ENST00000258494	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD24	170961	genome.wustl.edu	37	19	4222784	4222784	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr19:4222784C>T	ENST00000600132.1	+	20	3565	c.3289C>T	c.(3289-3291)Cag>Tag	p.Q1097*	ANKRD24_ENST00000318934.4_Nonsense_Mutation_p.Q1097*|ANKRD24_ENST00000262970.5_Nonsense_Mutation_p.Q1187*	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1097										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TTTACAGCAGCAGCTGCAGGT	0.592																																																	0																																										SO:0001587	stop_gained	170961			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3289C>T	19.37:g.4222784C>T	ENSP00000471252:p.Gln1097*	Somatic		WXS	Illumina HiSeq	Phase_IV	O75268|O95781	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q1097*	ENST00000600132.1	37	c.3289	CCDS45925.1	19	.	.	.	.	.	.	.	.	.	.	C	38	7.162772	0.98107	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	.	.	.	4.34	2.06	0.26882	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999999	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	10.8299	0.46654	0.0:0.6288:0.3712:0.0	.	.	.	.	X	1097;1187	.	ENSP00000262970:Q1187X	Q	+	1	0	ANKRD24	4173784	1.000000	0.71417	0.989000	0.46669	0.508000	0.34012	0.583000	0.23849	0.356000	0.24157	0.306000	0.20318	CAG	ANKRD24	-	NULL		0.592	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	HGNC	protein_coding	OTTHUMT00000458188.1	C	XM_114000		4222784	+1	no_errors	ENST00000318934	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ARHGEF4	50649	genome.wustl.edu	37	2	131673587	131673587	+	5'Flank	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr2:131673587G>C	ENST00000326016.5	+	0	0				ARHGEF4_ENST00000392953.3_5'Flank|ARHGEF4_ENST00000428230.2_5'Flank|ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000409359.1_Missense_Mutation_p.E360Q	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TAATGAGTGTGAGTTGCCAGC	0.612																																																	0																																										SO:0001631	upstream_gene_variant	50649			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657		2.37:g.131673587G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	NULL	p.E360Q	ENST00000326016.5	37	c.1078	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	G	12.05	1.821266	0.32237	.	.	ENSG00000136002	ENST00000409359	T	0.58060	0.36	3.62	-0.321	0.12717	.	.	.	.	.	T	0.44871	0.1314	.	.	.	0.09310	N	1	P	0.49635	0.926	P	0.46825	0.528	T	0.32079	-0.9920	7	.	.	.	.	6.0472	0.19766	0.5016:0.0:0.4984:0.0	.	360	E7EV07	.	Q	360	ENSP00000386794:E360Q	.	E	+	1	0	ARHGEF4	131390057	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.032000	0.13732	0.020000	0.15106	0.313000	0.20887	GAG	ARHGEF4	-	NULL		0.612	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	G			131673587	+1	no_errors	ENST00000409359	ensembl	human	putative	70_37	missense	SNP	0.000	C
ARHGEF5	7984	genome.wustl.edu	37	7	144059772	144059772	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr7:144059772G>A	ENST00000056217.5	+	2	184	c.10G>A	c.(10-12)Gag>Aag	p.E4K		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	4					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GATGGAGGCTGAGGAGGCCCA	0.502																																																	0													41.0	49.0	46.0					7																	144059772		1496	3159	4655	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.10G>A	7.37:g.144059772G>A	ENSP00000056217:p.Glu4Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E4K	ENST00000056217.5	37	c.10	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320308	0.41096	.	.	ENSG00000050327	ENST00000498580;ENST00000056217	T	0.80653	-1.4	4.16	4.16	0.48862	.	0.215021	0.22811	U	0.055347	T	0.72431	0.3459	L	0.54323	1.7	0.80722	D	1	P	0.39181	0.663	B	0.29524	0.103	T	0.77568	-0.2539	10	0.87932	D	0	-13.2822	11.8195	0.52230	0.0:0.0:1.0:0.0	.	4	Q12774	ARHG5_HUMAN	K	4	ENSP00000056217:E4K	ENSP00000056217:E4K	E	+	1	0	ARHGEF5	143690705	1.000000	0.71417	0.995000	0.50966	0.062000	0.15995	3.027000	0.49697	2.156000	0.67533	0.650000	0.86243	GAG	ARHGEF5	-	NULL		0.502	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	G	NM_005435		144059772	+1	no_errors	ENST00000056217	ensembl	human	known	70_37	missense	SNP	0.995	A
ARHGEF5	7984	genome.wustl.edu	37	7	144059775	144059775	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr7:144059775G>A	ENST00000056217.5	+	2	187	c.13G>A	c.(13-15)Gag>Aag	p.E5K		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	5					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGAGGCTGAGGAGGCCCAGCG	0.507																																																	0													50.0	59.0	56.0					7																	144059775		1499	3159	4658	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.13G>A	7.37:g.144059775G>A	ENSP00000056217:p.Glu5Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E5K	ENST00000056217.5	37	c.13	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572668	0.28092	.	.	ENSG00000050327	ENST00000498580;ENST00000056217	T	0.79845	-1.31	4.16	3.24	0.37175	.	0.000000	0.36268	U	0.002696	T	0.77315	0.4112	L	0.54323	1.7	0.80722	D	1	D	0.52996	0.957	P	0.47346	0.544	T	0.79162	-0.1917	10	0.87932	D	0	-20.0407	8.0598	0.30627	0.1166:0.0:0.8834:0.0	.	5	Q12774	ARHG5_HUMAN	K	5	ENSP00000056217:E5K	ENSP00000056217:E5K	E	+	1	0	ARHGEF5	143690708	0.993000	0.37304	0.996000	0.52242	0.064000	0.16182	2.169000	0.42434	2.156000	0.67533	0.650000	0.86243	GAG	ARHGEF5	-	NULL		0.507	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	G	NM_005435		144059775	+1	no_errors	ENST00000056217	ensembl	human	known	70_37	missense	SNP	0.986	A
ARL14	80117	genome.wustl.edu	37	3	160395701	160395701	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:160395701C>G	ENST00000320767.2	+	1	754	c.567C>G	c.(565-567)ttC>ttG	p.F189L		NM_025047.2	NP_079323.1	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	189					small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	GTP binding (GO:0005525)			lung(6)	6			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			TGGCGTTCTTCAAGCAGAACT	0.458																																																	0													38.0	40.0	39.0					3																	160395701		2203	4300	6503	SO:0001583	missense	80117			AK026248	CCDS3192.1	3q25.33	2014-05-09	2005-11-03	2005-11-03	ENSG00000179674	ENSG00000179674		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22974	protein-coding gene	gene with protein product		614439	"""ADP-ribosylation factor 7"""	ARF7		15367757	Standard	NM_025047		Approved	FLJ22595	uc003fdq.3	Q8N4G2	OTTHUMG00000159031	ENST00000320767.2:c.567C>G	3.37:g.160395701C>G	ENSP00000323847:p.Phe189Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H655	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_SRP_receptor_beta_su,pfam_EF_GTP-bd_dom,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F189L	ENST00000320767.2	37	c.567	CCDS3192.1	3	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570527	0.45798	.	.	ENSG00000179674	ENST00000320767	T	0.59502	0.26	5.23	4.36	0.52297	.	4.814600	0.01519	U	0.018284	T	0.45337	0.1337	N	0.14661	0.345	0.36570	D	0.87295	B	0.13594	0.008	B	0.10450	0.005	T	0.45116	-0.9283	10	0.72032	D	0.01	-12.9737	7.0252	0.24936	0.0:0.7463:0.0:0.2537	.	189	Q8N4G2	ARL14_HUMAN	L	189	ENSP00000323847:F189L	ENSP00000323847:F189L	F	+	3	2	ARL14	161878395	0.128000	0.22383	1.000000	0.80357	0.773000	0.43773	-0.042000	0.12063	1.433000	0.47394	0.563000	0.77884	TTC	ARL14	-	NULL		0.458	ARL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL14	HGNC	protein_coding	OTTHUMT00000352958.1	C	NM_025047		160395701	+1	no_errors	ENST00000320767	ensembl	human	known	70_37	missense	SNP	1.000	G
ATP2A1	487	genome.wustl.edu	37	16	28912104	28912104	+	Missense_Mutation	SNP	G	G	A	rs143704560		TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr16:28912104G>A	ENST00000357084.3	+	15	2234	c.1967G>A	c.(1966-1968)cGa>cAa	p.R656Q	ATP2A1_ENST00000536376.1_Missense_Mutation_p.R531Q|ATP2A1_ENST00000395503.4_Missense_Mutation_p.R656Q	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	656					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						TACACGGGCCGAGAGTTCGAC	0.627																																																	0													80.0	68.0	72.0					16																	28912104		2197	4300	6497	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1967G>A	16.37:g.28912104G>A	ENSP00000349595:p.Arg656Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.R656Q	ENST00000357084.3	37	c.1967	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.338798	0.95783	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.99060	-5.38;-5.38;-5.38	5.4	4.44	0.53790	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98147	0.9388	L	0.41710	1.295	0.52099	D	0.999949	D;P;B	0.67145	0.996;0.573;0.323	P;B;B	0.54401	0.751;0.164;0.071	D	0.98243	1.0489	10	0.66056	D	0.02	.	13.2888	0.60258	0.0784:0.0:0.9216:0.0	.	531;656;656	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	Q	656;656;693;531	ENSP00000349595:R656Q;ENSP00000378879:R656Q;ENSP00000443101:R531Q	ENSP00000349595:R656Q	R	+	2	0	ATP2A1	28819605	1.000000	0.71417	0.869000	0.34112	0.841000	0.47740	9.783000	0.99037	1.284000	0.44531	0.555000	0.69702	CGA	ATP2A1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp		0.627	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	G	NM_004320		28912104	+1	no_errors	ENST00000357084	ensembl	human	known	70_37	missense	SNP	0.999	A
BCAS2	10286	genome.wustl.edu	37	1	115118335	115118335	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:115118335C>G	ENST00000369541.3	-	4	342	c.295G>C	c.(295-297)Gac>Cac	p.D99H	BCAS2_ENST00000485021.1_5'UTR	NM_005872.2	NP_005863.1	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2	99					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cell junction (GO:0030054)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)				biliary_tract(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)	13	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGTAATGTCATTTTTTTGA	0.383																																																	0													106.0	99.0	101.0					1																	115118335		2203	4300	6503	SO:0001583	missense	10286			AB020623	CCDS874.1	1p13.2	2010-01-25			ENSG00000116752	ENSG00000116752			975	protein-coding gene	gene with protein product		605783				9731529, 10403562	Standard	NM_005872		Approved	DAM1, SPF27, Snt309	uc001efa.3	O75934	OTTHUMG00000011898	ENST00000369541.3:c.295G>C	1.37:g.115118335C>G	ENSP00000358554:p.Asp99His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FGS0	Missense_Mutation	SNP	pfam_BCAS2	p.D99H	ENST00000369541.3	37	c.295	CCDS874.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701297	0.88924	.	.	ENSG00000116752	ENST00000369541	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.83188	0.5200	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.84795	0.0781	9	0.56958	D	0.05	-15.0525	19.5317	0.95231	0.0:1.0:0.0:0.0	.	99	O75934	SPF27_HUMAN	H	99	.	ENSP00000358554:D99H	D	-	1	0	BCAS2	114919858	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.269000	0.78482	2.701000	0.92244	0.644000	0.83932	GAC	BCAS2	-	pfam_BCAS2		0.383	BCAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS2	HGNC	protein_coding	OTTHUMT00000032871.1	C	NM_005872		115118335	-1	no_errors	ENST00000369541	ensembl	human	known	70_37	missense	SNP	1.000	G
DDIAS	220042	genome.wustl.edu	37	11	82643346	82643346	+	Silent	SNP	G	G	C	rs374066836		TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr11:82643346G>C	ENST00000533655.1	+	6	1178	c.966G>C	c.(964-966)ctG>ctC	p.L322L	C11orf82_ENST00000329143.3_Silent_p.L21L|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Silent_p.L322L	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		322					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						CTAAGGAGCTGAGTGCAGTTC	0.388																																																	0								G		0,4406		0,0,2203	83.0	86.0	85.0		966	1.4	0.0	11		85	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C11orf82	NM_145018.3		0,1,6502	CC,CG,GG		0.0116,0.0,0.0077		322/999	82643346	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	220042																														ENST00000533655.1:c.966G>C	11.37:g.82643346G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LK6|Q9H856	Silent	SNP	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold-like	p.L322	ENST00000533655.1	37	c.966	CCDS8263.1	11																																																																																			C11orf82	-	NULL		0.388	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf82	HGNC	protein_coding	OTTHUMT00000391936.1	G			82643346	+1	no_errors	ENST00000430323	ensembl	human	known	70_37	silent	SNP	0.001	C
C11orf53	341032	genome.wustl.edu	37	11	111156759	111156759	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr11:111156759G>C	ENST00000280325.4	+	4	838	c.691G>C	c.(691-693)Gaa>Caa	p.E231Q		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	231										endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		GGGGTCATATGAATGCCGCAG	0.512																																																	0													66.0	69.0	68.0					11																	111156759		2201	4297	6498	SO:0001583	missense	341032			BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.691G>C	11.37:g.111156759G>C	ENSP00000280325:p.Glu231Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E231Q	ENST00000280325.4	37	c.691	CCDS31674.1	11	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409520	0.62399	.	.	ENSG00000150750	ENST00000280325	.	.	.	5.08	5.08	0.68730	.	0.210244	0.39475	N	0.001342	T	0.78298	0.4261	M	0.72894	2.215	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.81011	-0.1126	9	0.87932	D	0	-24.8548	15.988	0.80176	0.0:0.0:1.0:0.0	.	231	Q8IXP5	CK053_HUMAN	Q	231	.	ENSP00000280325:E231Q	E	+	1	0	C11orf53	110661969	1.000000	0.71417	0.300000	0.25030	0.384000	0.30261	7.269000	0.78482	2.365000	0.80145	0.655000	0.94253	GAA	C11orf53	-	NULL		0.512	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf53	HGNC	protein_coding	OTTHUMT00000390989.1	G	NM_198498		111156759	+1	no_errors	ENST00000280325	ensembl	human	known	70_37	missense	SNP	1.000	C
CD164L2	388611	genome.wustl.edu	37	1	27709014	27709014	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:27709014C>G	ENST00000374030.1	-	2	372	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	CD164L2_ENST00000374025.3_Missense_Mutation_p.E78Q|CD164L2_ENST00000374027.3_Missense_Mutation_p.E78Q			Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	78						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CGGCACTGCTCCCACATGCAG	0.642																																																	0													43.0	44.0	44.0					1																	27709014		2203	4300	6503	SO:0001583	missense	388611			AY358761	CCDS302.1	1p36.11	2008-02-05			ENSG00000174950	ENSG00000174950			32043	protein-coding gene	gene with protein product							Standard	XM_005245868		Approved		uc001boc.3	Q6UWJ8	OTTHUMG00000003395	ENST00000374030.1:c.232G>C	1.37:g.27709014C>G	ENSP00000363142:p.Glu78Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPJ0|Q5JXD6	Missense_Mutation	SNP	pfam_CD164_MGC24	p.E78Q	ENST00000374030.1	37	c.232		1	.	.	.	.	.	.	.	.	.	.	C	3.744	-0.052939	0.07362	.	.	ENSG00000174950	ENST00000374030;ENST00000374027;ENST00000374025	T;T;T	0.40225	1.04;1.04;1.04	4.5	2.55	0.30701	.	0.425927	0.19050	N	0.124061	T	0.28267	0.0698	L	0.38838	1.175	0.24495	N	0.994283	B	0.17852	0.024	B	0.17433	0.018	T	0.16100	-1.0414	10	0.35671	T	0.21	-13.6936	4.797	0.13277	0.0:0.5426:0.3084:0.1491	.	78	Q6UWJ8	C16L2_HUMAN	Q	78	ENSP00000363142:E78Q;ENSP00000363139:E78Q;ENSP00000363137:E78Q	ENSP00000363137:E78Q	E	-	1	0	CD164L2	27581601	0.951000	0.32395	0.959000	0.39883	0.149000	0.21700	0.829000	0.27449	0.473000	0.27368	0.555000	0.69702	GAG	CD164L2	-	pfam_CD164_MGC24		0.642	CD164L2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CD164L2	HGNC	protein_coding	OTTHUMT00000009518.1	C	NM_207397		27709014	-1	no_errors	ENST00000374030	ensembl	human	known	70_37	missense	SNP	0.985	G
CERS2	29956	genome.wustl.edu	37	1	150940615	150940615	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:150940615G>A	ENST00000271688.6	-	4	740	c.354C>T	c.(352-354)ttC>ttT	p.F118F	CERS2_ENST00000368954.5_Silent_p.F118F|RP11-316M1.12_ENST00000560481.1_RNA|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000561294.1_Silent_p.F109F|CERS2_ENST00000345896.4_5'UTR	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	118					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GGCGGCGACGGAACCAACGCT	0.597																																																	0													67.0	72.0	70.0					1																	150940615		2203	4300	6503	SO:0001819	synonymous_variant	29956			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.354C>T	1.37:g.150940615G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Silent	SNP	pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeodomain	p.F118	ENST00000271688.6	37	c.354	CCDS973.1	1																																																																																			CERS2	-	pfam_Homeodomain,superfamily_Homeodomain-like,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_Homeodomain		0.597	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	HGNC	protein_coding	OTTHUMT00000084897.2	G	NM_022075		150940615	-1	no_errors	ENST00000271688	ensembl	human	known	70_37	silent	SNP	1.000	A
C1orf115	79762	genome.wustl.edu	37	1	220863780	220863780	+	Missense_Mutation	SNP	G	G	C	rs568991746	byFrequency	TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:220863780G>C	ENST00000294889.5	+	1	594	c.36G>C	c.(34-36)gaG>gaC	p.E12D		NM_024709.4	NP_078985.3	Q9H7X2	CA115_HUMAN	chromosome 1 open reading frame 115	12						integral component of membrane (GO:0016021)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0273)		GCAAGGCGGAGAGCAGCCTCC	0.721																																																	0													4.0	3.0	4.0					1																	220863780		1890	3709	5599	SO:0001583	missense	79762			AK024208	CCDS1524.1	1q41	2008-02-05			ENSG00000162817	ENSG00000162817			25873	protein-coding gene	gene with protein product						12477932	Standard	NM_024709		Approved	FLJ14146	uc001hmp.1	Q9H7X2	OTTHUMG00000037361	ENST00000294889.5:c.36G>C	1.37:g.220863780G>C	ENSP00000294889:p.Glu12Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRN3|D3DTB2	Missense_Mutation	SNP	NULL	p.E12D	ENST00000294889.5	37	c.36	CCDS1524.1	1	.	.	.	.	.	.	.	.	.	.	G	9.282	1.048435	0.19827	.	.	ENSG00000162817	ENST00000294889	.	.	.	4.67	-2.82	0.05787	.	1.925800	0.03672	U	0.244185	T	0.16128	0.0388	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21655	-1.0239	9	0.15066	T	0.55	-3.7551	9.3154	0.37930	0.161:0.4824:0.3566:0.0	.	12	Q9H7X2	CA115_HUMAN	D	12	.	ENSP00000294889:E12D	E	+	3	2	C1orf115	218930403	0.000000	0.05858	0.577000	0.28562	0.537000	0.34900	-1.104000	0.03326	0.017000	0.15025	0.491000	0.48974	GAG	C1orf115	-	NULL		0.721	C1orf115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf115	HGNC	protein_coding	OTTHUMT00000090922.3	G	NM_024709		220863780	+1	no_errors	ENST00000294889	ensembl	human	known	70_37	missense	SNP	0.000	C
COPB2	9276	genome.wustl.edu	37	3	139077085	139077085	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:139077085G>A	ENST00000333188.5	-	21	2763	c.2582C>T	c.(2581-2583)aCt>aTt	p.T861I	COPB2_ENST00000507777.1_Missense_Mutation_p.T832I	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	861					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						AATAACCGGAGTAGGAGAAGC	0.438																																																	0													124.0	106.0	112.0					3																	139077085		2203	4300	6503	SO:0001583	missense	9276			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2582C>T	3.37:g.139077085G>A	ENSP00000329419:p.Thr861Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZI8	Missense_Mutation	SNP	pirsf_Coatomer_b'su,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T861I	ENST00000333188.5	37	c.2582	CCDS3108.1	3	.	.	.	.	.	.	.	.	.	.	g	10.11	1.260499	0.23051	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	T;T	0.62639	0.01;0.11	4.77	2.92	0.33932	.	0.919055	0.09471	N	0.797678	T	0.43897	0.1268	N	0.17082	0.46	0.19945	N	0.999944	B	0.18968	0.032	B	0.21360	0.034	T	0.32214	-0.9915	10	0.37606	T	0.19	-19.1544	5.7983	0.18399	0.0982:0.0:0.7124:0.1893	.	861	P35606	COPB2_HUMAN	I	861;832	ENSP00000329419:T861I;ENSP00000422295:T832I	ENSP00000329419:T861I	T	-	2	0	COPB2	140559775	0.991000	0.36638	0.169000	0.22859	0.891000	0.51852	1.129000	0.31381	0.582000	0.29556	-0.127000	0.14921	ACT	COPB2	-	pirsf_Coatomer_b'su		0.438	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB2	HGNC	protein_coding	OTTHUMT00000358495.2	G	NM_004766		139077085	-1	no_errors	ENST00000333188	ensembl	human	known	70_37	missense	SNP	0.787	A
CUBN	8029	genome.wustl.edu	37	10	16949583	16949583	+	Missense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr10:16949583C>T	ENST00000377833.4	-	49	7694	c.7629G>A	c.(7627-7629)atG>atA	p.M2543I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2543	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAATGACTTTCATTGTGTTTC	0.413																																																	0													107.0	89.0	95.0					10																	16949583		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7629G>A	10.37:g.16949583C>T	ENSP00000367064:p.Met2543Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.M2543I	ENST00000377833.4	37	c.7629	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130340	0.56721	.	.	ENSG00000107611	ENST00000377833	T	0.19250	2.16	5.38	5.38	0.77491	CUB (5);	0.000000	0.56097	D	0.000022	T	0.35098	0.0920	M	0.76328	2.33	0.80722	D	1	P	0.48407	0.91	P	0.49999	0.628	T	0.03840	-1.0999	10	0.38643	T	0.18	.	13.7761	0.63055	0.0:0.9262:0.0:0.0738	.	2543	O60494	CUBN_HUMAN	I	2543	ENSP00000367064:M2543I	ENSP00000367064:M2543I	M	-	3	0	CUBN	16989589	1.000000	0.71417	0.996000	0.52242	0.198000	0.23893	4.236000	0.58675	2.672000	0.90937	0.650000	0.86243	ATG	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	C	NM_001081		16949583	-1	no_errors	ENST00000377833	ensembl	human	known	70_37	missense	SNP	1.000	T
DHX30	22907	genome.wustl.edu	37	3	47882630	47882630	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:47882630G>C	ENST00000445061.1	+	7	1037	c.630G>C	c.(628-630)atG>atC	p.M210I	DHX30_ENST00000348968.4_Missense_Mutation_p.M182I|DHX30_ENST00000446256.2_Missense_Mutation_p.M171I|DHX30_ENST00000457607.1_Missense_Mutation_p.M238I	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	210						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TCTTGTCCATGACCCAGCAGG	0.582																																																	0													52.0	54.0	53.0					3																	47882630		2203	4300	6503	SO:0001583	missense	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.630G>C	3.37:g.47882630G>C	ENSP00000405620:p.Met210Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M210I	ENST00000445061.1	37	c.630	CCDS2759.1	3	.	.	.	.	.	.	.	.	.	.	G	16.21	3.057675	0.55325	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03152	4.07;4.05;4.06;4.03	5.17	5.17	0.71159	.	0.310457	0.35585	N	0.003110	T	0.04272	0.0118	L	0.36672	1.1	0.42504	D	0.992941	B;B;B	0.16396	0.015;0.003;0.017	B;B;B	0.16289	0.004;0.01;0.015	T	0.47749	-0.9093	10	0.15952	T	0.53	.	15.8202	0.78633	0.0:0.0:1.0:0.0	.	210;171;238	Q7L2E3;Q7L2E3-3;Q7L2E3-2	DHX30_HUMAN;.;.	I	171;210;182;238	ENSP00000392601:M171I;ENSP00000405620:M210I;ENSP00000343442:M182I;ENSP00000394682:M238I	ENSP00000343442:M182I	M	+	3	0	DHX30	47857634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.888000	0.69758	2.386000	0.81285	0.655000	0.94253	ATG	DHX30	-	NULL		0.582	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHX30	HGNC	protein_coding	OTTHUMT00000257495.2	G	NM_138615		47882630	+1	no_errors	ENST00000445061	ensembl	human	known	70_37	missense	SNP	1.000	C
DSG3	1830	genome.wustl.edu	37	18	29038498	29038498	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr18:29038498G>C	ENST00000257189.4	+	4	390	c.307G>C	c.(307-309)Gac>Cac	p.D103H		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	103	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTTTGTTGTTGACAAAAACAC	0.458																																																	0													97.0	94.0	95.0					18																	29038498		2203	4300	6503	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.307G>C	18.37:g.29038498G>C	ENSP00000257189:p.Asp103His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.D103H	ENST00000257189.4	37	c.307	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020970	0.54576	.	.	ENSG00000134757	ENST00000257189	T	0.65732	-0.17	5.76	4.88	0.63580	Cadherin (5);Cadherin-like (1);	0.000000	0.51477	D	0.000099	T	0.79364	0.4433	M	0.87381	2.88	0.43448	D	0.995639	D	0.71674	0.998	D	0.71414	0.973	T	0.81703	-0.0812	10	0.87932	D	0	.	11.0569	0.47925	0.1426:0.0:0.8574:0.0	.	103	P32926	DSG3_HUMAN	H	103	ENSP00000257189:D103H	ENSP00000257189:D103H	D	+	1	0	DSG3	27292496	0.994000	0.37717	0.994000	0.49952	0.497000	0.33675	1.400000	0.34577	2.880000	0.98712	0.650000	0.86243	GAC	DSG3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.458	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	G	NM_001944		29038498	+1	no_errors	ENST00000257189	ensembl	human	known	70_37	missense	SNP	0.994	C
EGR4	1961	genome.wustl.edu	37	2	73519561	73519561	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr2:73519561G>A	ENST00000545030.1	-	2	868	c.794C>T	c.(793-795)tCg>tTg	p.S265L	EGR4_ENST00000436467.2_Missense_Mutation_p.S162L	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	265	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGCGCAAGGCGAGGCCTCCCA	0.721																																																	0													8.0	11.0	10.0					2																	73519561		2169	4251	6420	SO:0001583	missense	1961				CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.794C>T	2.37:g.73519561G>A	ENSP00000445626:p.Ser265Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S265L	ENST00000545030.1	37	c.794	CCDS1925.2	2	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322320	0.23994	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.15139	2.45;2.79	4.39	4.39	0.52855	.	0.663371	0.14050	N	0.344855	T	0.12305	0.0299	N	0.24115	0.695	0.27841	N	0.94112	B;B	0.20780	0.029;0.048	B;B	0.19148	0.011;0.024	T	0.07252	-1.0782	10	0.62326	D	0.03	-8.1456	9.4657	0.38811	0.0984:0.0:0.9016:0.0	.	162;265	Q05215;G3V1T5	EGR4_HUMAN;.	L	265;162	ENSP00000445626:S265L;ENSP00000419687:S162L	ENSP00000419687:S162L	S	-	2	0	EGR4	73373069	0.112000	0.22096	0.985000	0.45067	0.221000	0.24807	1.161000	0.31773	2.267000	0.75376	0.555000	0.69702	TCG	EGR4	-	NULL		0.721	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGR4	HGNC	protein_coding		G	NM_001965		73519561	-1	no_errors	ENST00000545030	ensembl	human	known	70_37	missense	SNP	0.958	A
EHBP1L1	254102	genome.wustl.edu	37	11	65351108	65351108	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr11:65351108G>C	ENST00000309295.4	+	9	3230	c.2965G>C	c.(2965-2967)Gaa>Caa	p.E989Q		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	989						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GAAGGGGAAAGAAGCTGAGGG	0.587																																																	0													13.0	14.0	14.0					11																	65351108		1849	4096	5945	SO:0001583	missense	254102			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.2965G>C	11.37:g.65351108G>C	ENSP00000312671:p.Glu989Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E989Q	ENST00000309295.4	37	c.2965	CCDS44649.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.405|7.405	0.633560|0.633560	0.14322|0.14322	.|.	.|.	ENSG00000173442|ENSG00000173442	ENST00000309295|ENST00000533465	T|.	0.71698|.	-0.59|.	5.15|5.15	3.15|3.15	0.36227|0.36227	.|.	0.768039|.	0.11162|.	N|.	0.593005|.	T|T	0.34019|0.34019	0.0883|0.0883	L|L	0.32530|0.32530	0.975|0.975	0.25737|0.25737	N|N	0.985207|0.985207	B|.	0.18461|.	0.028|.	B|.	0.14578|.	0.011|.	T|T	0.18935|0.18935	-1.0321|-1.0321	10|5	0.51188|.	T|.	0.08|.	.|.	8.1511|8.1511	0.31141|0.31141	0.0901:0.1601:0.7498:0.0|0.0901:0.1601:0.7498:0.0	.|.	989|.	Q8N3D4|.	EH1L1_HUMAN|.	Q|T	989|38	ENSP00000312671:E989Q|.	ENSP00000312671:E989Q|.	E|R	+|+	1|2	0|0	EHBP1L1|EHBP1L1	65107684|65107684	0.012000|0.012000	0.17670|0.17670	0.051000|0.051000	0.19133|0.19133	0.160000|0.160000	0.22226|0.22226	1.332000|1.332000	0.33805|0.33805	1.165000|1.165000	0.42670|0.42670	-0.436000|-0.436000	0.05848|0.05848	GAA|AGA	EHBP1L1	-	NULL		0.587	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1	G	XM_170658		65351108	+1	no_errors	ENST00000309295	ensembl	human	known	70_37	missense	SNP	0.065	C
ZNF606	80095	genome.wustl.edu	37	19	58514257	58514257	+	5'UTR	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr19:58514257C>G	ENST00000341164.4	-	0	460				ZNF606_ENST00000546715.1_5'Flank|ZNF606_ENST00000547121.1_5'Flank|ZNF606_ENST00000536132.1_5'Flank|CTD-2368P22.1_ENST00000550135.1_Missense_Mutation_p.A260G|ZNF606_ENST00000552579.1_5'Flank|ZNF606_ENST00000547828.1_5'Flank	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GGCAGCGGCGCCGCCATGACA	0.726																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.-161G>C	19.37:g.58514257C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	NULL	p.A260G	ENST00000341164.4	37	c.779	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	C	10.42	1.344857	0.24426	.	.	ENSG00000176593	ENST00000550135	.	.	.	3.49	1.2	0.21068	.	.	.	.	.	T	0.54711	0.1875	.	.	.	0.20074	N	0.999936	D	0.64830	0.994	D	0.62955	0.909	T	0.41034	-0.9531	7	0.87932	D	0	.	6.8713	0.24123	0.0:0.7133:0.1785:0.1083	.	260	Q8N9G5	.	G	260	.	ENSP00000449124:A260G	A	+	2	0	CTD-2368P22.1	63206069	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.177000	0.09796	0.225000	0.20959	0.195000	0.17529	GCC	CTD-2368P22.1	-	NULL		0.726	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000176593	Clone_based_vega_gene	protein_coding	OTTHUMT00000405961.1	C	NM_025027		58514257	+1	no_errors	ENST00000550135	ensembl	human	putative	70_37	missense	SNP	0.003	G
EPRS	2058	genome.wustl.edu	37	1	220142417	220142417	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:220142417G>C	ENST00000366923.3	-	31	4640	c.4371C>G	c.(4369-4371)atC>atG	p.I1457M	EPRS_ENST00000468487.1_5'UTR	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1457	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TGGTCTTTTTGATCCAGTCCT	0.338																																																	0													118.0	115.0	116.0					1																	220142417		2203	4300	6503	SO:0001583	missense	2058			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.4371C>G	1.37:g.220142417G>C	ENSP00000355890:p.Ile1457Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_ligase_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_ligase_II_C,prints_Glu/Gln-tRNA-synth_Ib,prints_Pro-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-ligase_IIa_arc-type,tigrfam_Glu-tRNA-synth_Ib_arc/euk	p.I1457M	ENST00000366923.3	37	c.4371	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794920	0.50208	.	.	ENSG00000136628	ENST00000366923	T	0.13778	2.56	5.45	3.55	0.40652	Prolyl-tRNA synthetase, class II, C-terminal (3);Prolyl-tRNA synthetase, class II (1);	0.000000	0.85682	D	0.000000	T	0.38692	0.1050	M	0.89353	3.025	0.46631	D	0.999138	D	0.89917	1.0	D	0.91635	0.999	T	0.17048	-1.0382	10	0.87932	D	0	-16.6571	6.9783	0.24688	0.1451:0.0:0.715:0.1398	.	1457	P07814	SYEP_HUMAN	M	1457	ENSP00000355890:I1457M	ENSP00000355890:I1457M	I	-	3	3	EPRS	218209040	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.391000	0.34475	0.651000	0.30788	0.655000	0.94253	ATC	EPRS	-	pfam_Pro-tRNA_ligase_II_C,superfamily_Pro-tRNA_synth_II,smart_Pro-tRNA_ligase_II_C,tigrfam_Pro-tRNA-ligase_IIa_arc-type		0.338	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	G	NM_004446		220142417	-1	no_errors	ENST00000366923	ensembl	human	known	70_37	missense	SNP	1.000	C
FAM120A	23196	genome.wustl.edu	37	9	96320970	96320970	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr9:96320970G>C	ENST00000277165.6	+	15	2970	c.2776G>C	c.(2776-2778)Gac>Cac	p.D926H	FAM120A_ENST00000340893.4_Intron|FAM120A_ENST00000333936.5_Missense_Mutation_p.D954H	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	926	RNA binding.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTCAGGCAGTGACAGCAGCAG	0.612																																																	0													57.0	55.0	56.0					9																	96320970		2203	4300	6503	SO:0001583	missense	23196			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2776G>C	9.37:g.96320970G>C	ENSP00000277165:p.Asp926His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.D954H	ENST00000277165.6	37	c.2860	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558476	0.65538	.	.	ENSG00000048828	ENST00000277165;ENST00000333936	T;T	0.31769	1.49;1.48	5.67	4.77	0.60923	.	0.080841	0.52532	D	0.000066	T	0.38746	0.1052	N	0.22421	0.69	0.80722	D	1	D;B	0.89917	1.0;0.047	D;B	0.85130	0.997;0.033	T	0.11179	-1.0598	10	0.13853	T	0.58	-15.3885	15.0483	0.71844	0.0:0.1416:0.8584:0.0	.	954;926	Q9NZB2-6;Q9NZB2	.;F120A_HUMAN	H	926;954	ENSP00000277165:D926H;ENSP00000334918:D954H	ENSP00000277165:D926H	D	+	1	0	FAM120A	95360791	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.069000	0.71209	1.387000	0.46486	0.655000	0.94253	GAC	FAM120A	-	NULL		0.612	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	G	NM_014612		96320970	+1	no_errors	ENST00000333936	ensembl	human	known	70_37	missense	SNP	1.000	C
FAT4	79633	genome.wustl.edu	37	4	126369917	126369917	+	Silent	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr4:126369917C>T	ENST00000394329.3	+	9	7759	c.7746C>T	c.(7744-7746)gtC>gtT	p.V2582V	FAT4_ENST00000335110.5_Silent_p.V880V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2582	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACCAACCAGTCAGCTCTCTTG	0.418																																																	0													64.0	62.0	62.0					4																	126369917		2203	4299	6502	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7746C>T	4.37:g.126369917C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V2582	ENST00000394329.3	37	c.7746	CCDS3732.3	4																																																																																			FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.418	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	C	NM_024582		126369917	+1	no_errors	ENST00000394329	ensembl	human	known	70_37	silent	SNP	0.000	T
GNB5	10681	genome.wustl.edu	37	15	52427908	52427908	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr15:52427908C>G	ENST00000261837.7	-	8	738	c.673G>C	c.(673-675)Gag>Cag	p.E225Q	GNB5_ENST00000396335.4_Missense_Mutation_p.E113Q|GNB5_ENST00000559348.1_5'UTR|CTD-2184D3.7_ENST00000560613.1_RNA|CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000358784.7_Missense_Mutation_p.E183Q	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	225					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		TGCCCGCTCTCCACGTCCCAC	0.612																																																	0													79.0	76.0	77.0					15																	52427908		2195	4293	6488	SO:0001583	missense	10681			AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.673G>C	15.37:g.52427908C>G	ENSP00000261837:p.Glu225Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep	p.E225Q	ENST00000261837.7	37	c.673	CCDS10149.1	15	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266590	0.80358	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.01379	4.96	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.059206	0.64402	N	0.000003	T	0.05318	0.0141	L	0.46670	1.46	0.80722	D	1	B;D	0.55605	0.002;0.972	B;P	0.57846	0.005;0.828	T	0.42275	-0.9461	10	0.56958	D	0.05	-33.1081	19.1927	0.93674	0.0:1.0:0.0:0.0	.	225;113	O14775;O14775-3	GBB5_HUMAN;.	Q	225;183;23;113	ENSP00000261837:E225Q	ENSP00000261837:E225Q	E	-	1	0	GNB5	50215200	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.344000	0.79328	2.516000	0.84829	0.650000	0.86243	GAG	GNB5	-	superfamily_WD40_repeat_dom,pirsf_Guanine_nucleotide-bd_bsu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.612	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNB5	HGNC	protein_coding	OTTHUMT00000254842.1	C			52427908	-1	no_errors	ENST00000261837	ensembl	human	known	70_37	missense	SNP	1.000	G
GPR68	8111	genome.wustl.edu	37	14	91701059	91701059	+	Silent	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr14:91701059G>C	ENST00000531499.2	-	2	675	c.336C>G	c.(334-336)ctC>ctG	p.L112L	GPR68_ENST00000238699.3_Silent_p.L122L|GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_Silent_p.L112L			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	112					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		AGATGCAGCAGAGGAAGCCCA	0.627																																																	0													68.0	53.0	58.0					14																	91701059		2203	4300	6503	SO:0001819	synonymous_variant	8111			U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.336C>G	14.37:g.91701059G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13334|Q4VBB4|Q6IX34	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_OGR1_rcpt,prints_GPCR_Rhodpsn,prints_P2_purnocptor,prints_Psych_rcpt	p.L122	ENST00000531499.2	37	c.366	CCDS9894.2	14																																																																																			GPR68	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.627	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR68	HGNC	protein_coding	OTTHUMT00000395245.2	G			91701059	-1	no_errors	ENST00000238699	ensembl	human	known	70_37	silent	SNP	1.000	C
IKZF2	22807	genome.wustl.edu	37	2	213921756	213921757	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr2:213921756_213921757insT	ENST00000434687.1	-	5	515_516	c.206_207insA	c.(205-207)gatfs	p.D69fs	IKZF2_ENST00000342002.2_Frame_Shift_Ins_p.D75fs|IKZF2_ENST00000374319.4_Frame_Shift_Ins_p.D69fs|IKZF2_ENST00000457361.1_Frame_Shift_Ins_p.D69fs|IKZF2_ENST00000421754.2_Frame_Shift_Ins_p.D69fs|IKZF2_ENST00000413091.3_Frame_Shift_Ins_p.D69fs|IKZF2_ENST00000451136.2_Frame_Shift_Ins_p.D69fs|IKZF2_ENST00000374327.4_Intron			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	69				D -> N (in Ref. 1; AAF09441 and 2; AAS99857/AAS99859/AAS99861/AAS99862/ AAS99863/AAS99864). {ECO:0000305}.	positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CCCTGATCTCATCTTCACGGCT	0.45																																																	0																																										SO:0001589	frameshift_variant	22807			AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.207dupA	2.37:g.213921757_213921757dupT	ENSP00000412869:p.Asp69fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D69fs	ENST00000434687.1	37	c.207_206	CCDS2395.1	2																																																																																			IKZF2	-	NULL		0.450	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	-	NM_016260		213921757	-1	no_errors	ENST00000434687	ensembl	human	known	70_37	frame_shift_ins	INS	0.080:0.808	T
KBTBD12	166348	genome.wustl.edu	37	3	127642964	127642964	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:127642964G>C	ENST00000405109.1	+	2	1527	c.1060G>C	c.(1060-1062)Gaa>Caa	p.E354Q	KBTBD12_ENST00000492025.1_3'UTR|KBTBD12_ENST00000405256.1_Missense_Mutation_p.E354Q|KBTBD12_ENST00000343941.4_Intron|KBTBD12_ENST00000407609.3_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	354										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CAAGAATGTTGAAATTTATAG	0.338																																																	0													67.0	65.0	65.0					3																	127642964		1827	4079	5906	SO:0001583	missense	166348				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1060G>C	3.37:g.127642964G>C	ENSP00000385957:p.Glu354Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E354Q	ENST00000405109.1	37	c.1060	CCDS33848.2	3	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425737	0.62733	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.67865	-0.29;-0.29	5.62	5.62	0.85841	Kelch-type beta propeller (1);	.	.	.	.	T	0.79975	0.4539	M	0.63843	1.955	0.58432	D	0.999996	D	0.89917	1.0	D	0.63488	0.915	T	0.80301	-0.1440	9	0.66056	D	0.02	.	20.0333	0.97547	0.0:0.0:1.0:0.0	.	354	Q3ZCT8	KBTBC_HUMAN	Q	354	ENSP00000385957:E354Q;ENSP00000385879:E354Q	ENSP00000385957:E354Q	E	+	1	0	KBTBD12	129125654	1.000000	0.71417	0.997000	0.53966	0.524000	0.34500	9.322000	0.96357	2.810000	0.96702	0.585000	0.79938	GAA	KBTBD12	-	pirsf_Kelch-like_gigaxonin		0.338	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	HGNC	protein_coding	OTTHUMT00000318682.1	G	NM_207335		127642964	+1	no_errors	ENST00000405109	ensembl	human	known	70_37	missense	SNP	1.000	C
KIAA1586	57691	genome.wustl.edu	37	6	56917955	56917955	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr6:56917955C>T	ENST00000370733.4	+	4	865	c.658C>T	c.(658-660)Cag>Tag	p.Q220*	KIAA1586_ENST00000545356.1_Nonsense_Mutation_p.Q193*	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	220							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TGGTAAAATTCAGGATTTGTT	0.284																																																	0													40.0	44.0	43.0					6																	56917955		2200	4297	6497	SO:0001587	stop_gained	57691			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.658C>T	6.37:g.56917955C>T	ENSP00000359768:p.Gln220*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4M3|Q8IW25	Nonsense_Mutation	SNP	superfamily_RNaseH-like_dom	p.Q220*	ENST00000370733.4	37	c.658	CCDS34480.1	6	.	.	.	.	.	.	.	.	.	.	c	9.333	1.061125	0.19987	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	.	.	.	4.07	2.09	0.27110	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	4.4881	0.11799	0.2813:0.6027:0.0:0.116	.	.	.	.	X	220;193	.	ENSP00000359768:Q220X	Q	+	1	0	KIAA1586	57025914	1.000000	0.71417	0.981000	0.43875	0.009000	0.06853	0.376000	0.20535	0.342000	0.23796	-0.373000	0.07131	CAG	KIAA1586	-	NULL		0.284	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1586	HGNC	protein_coding	OTTHUMT00000041033.1	C	NM_020931		56917955	+1	no_errors	ENST00000370733	ensembl	human	known	70_37	nonsense	SNP	0.991	T
LAMC1	3915	genome.wustl.edu	37	1	183104287	183104287	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:183104287G>A	ENST00000258341.4	+	24	4367	c.4110G>A	c.(4108-4110)ctG>ctA	p.L1370L		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1370	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TCAACAACCTGAAAGGTAGAA	0.438																																																	0													52.0	46.0	48.0					1																	183104287		2203	4300	6503	SO:0001819	synonymous_variant	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.4110G>A	1.37:g.183104287G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYE7	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L1370	ENST00000258341.4	37	c.4110	CCDS1351.1	1																																																																																			LAMC1	-	NULL		0.438	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	G	NM_002293		183104287	+1	no_errors	ENST00000258341	ensembl	human	known	70_37	silent	SNP	1.000	A
LMOD3	56203	genome.wustl.edu	37	3	69171504	69171504	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:69171504C>G	ENST00000420581.2	-	1	213	c.34G>C	c.(34-36)Gaa>Caa	p.E12Q	LMOD3_ENST00000475434.1_Missense_Mutation_p.E12Q|LMOD3_ENST00000489031.1_Missense_Mutation_p.E12Q	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	12						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		TCGAGAAGTTCTTCTTGATCT	0.343																																																	0													42.0	39.0	40.0					3																	69171504		1833	4084	5917	SO:0001583	missense	56203			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.34G>C	3.37:g.69171504C>G	ENSP00000414670:p.Glu12Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Missense_Mutation	SNP	pfam_Tropomodulin	p.E12Q	ENST00000420581.2	37	c.34	CCDS46862.1	3	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586730	0.86851	.	.	ENSG00000163380	ENST00000420581;ENST00000489031;ENST00000475434	T;T;T	0.13538	2.58;2.58;2.58	5.23	5.23	0.72850	.	0.309838	0.35615	N	0.003081	T	0.26557	0.0649	L	0.56769	1.78	0.48288	D	0.999622	P	0.51351	0.944	P	0.53360	0.724	T	0.01382	-1.1369	10	0.20519	T	0.43	-19.7908	18.786	0.91955	0.0:1.0:0.0:0.0	.	12	Q0VAK6	LMOD3_HUMAN	Q	12	ENSP00000414670:E12Q;ENSP00000417210:E12Q;ENSP00000418645:E12Q	ENSP00000414670:E12Q	E	-	1	0	LMOD3	69254194	0.997000	0.39634	0.974000	0.42286	0.905000	0.53344	4.222000	0.58580	2.440000	0.82611	0.591000	0.81541	GAA	LMOD3	-	NULL		0.343	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD3	HGNC	protein_coding	OTTHUMT00000352138.1	C	XM_067529		69171504	-1	no_errors	ENST00000420581	ensembl	human	known	70_37	missense	SNP	1.000	G
LRRC45	201255	genome.wustl.edu	37	17	79988571	79988571	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr17:79988571G>C	ENST00000306688.3	+	17	2245	c.1903G>C	c.(1903-1905)Gag>Cag	p.E635Q	RAC3_ENST00000306897.4_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	635						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CCGGGAGGCGGAGATCGCCCG	0.697																																																	0													8.0	11.0	10.0					17																	79988571		2125	4210	6335	SO:0001583	missense	201255			BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1903G>C	17.37:g.79988571G>C	ENSP00000306760:p.Glu635Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E635Q	ENST00000306688.3	37	c.1903	CCDS11797.1	17	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952122	0.92660	.	.	ENSG00000169683	ENST00000306688	T	0.44482	0.92	4.5	4.5	0.54988	.	0.070853	0.56097	D	0.000036	T	0.41971	0.1182	L	0.34521	1.04	0.44995	D	0.99801	D	0.57899	0.981	P	0.52109	0.69	T	0.15521	-1.0434	9	.	.	.	-20.4498	13.1592	0.59535	0.0:0.1608:0.8392:0.0	.	635	Q96CN5	LRC45_HUMAN	Q	635	ENSP00000306760:E635Q	.	E	+	1	0	LRRC45	77581860	1.000000	0.71417	0.156000	0.22583	0.988000	0.76386	8.869000	0.92326	2.331000	0.79229	0.491000	0.48974	GAG	LRRC45	-	NULL		0.697	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC45	HGNC	protein_coding	OTTHUMT00000442058.1	G	NM_144999		79988571	+1	no_errors	ENST00000306688	ensembl	human	known	70_37	missense	SNP	0.989	C
MAP4K2	5871	genome.wustl.edu	37	11	64559459	64559459	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr11:64559459C>G	ENST00000294066.2	-	27	2105	c.2014G>C	c.(2014-2016)Gag>Cag	p.E672Q	MAP4K2_ENST00000377350.3_Missense_Mutation_p.E664Q	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	672	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						CCGGGCCCCTCAGGCCCCTCG	0.692																																																	0													10.0	13.0	12.0					11																	64559459		2167	4259	6426	SO:0001583	missense	5871			BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.2014G>C	11.37:g.64559459C>G	ENSP00000294066:p.Glu672Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VU3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.E672Q	ENST00000294066.2	37	c.2014	CCDS8082.1	11	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014959	0.35511	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.70164	-0.44;-0.46	4.72	4.72	0.59763	Citron-like (3);	0.713791	0.13476	N	0.385062	T	0.46210	0.1381	N	0.14661	0.345	0.33004	D	0.526675	P;B	0.41748	0.761;0.037	B;B	0.36534	0.227;0.02	T	0.50955	-0.8766	10	0.12430	T	0.62	.	13.2144	0.59851	0.0:1.0:0.0:0.0	.	664;672	Q86VU3;Q12851	.;M4K2_HUMAN	Q	672;664	ENSP00000294066:E672Q;ENSP00000366567:E664Q	ENSP00000294066:E672Q	E	-	1	0	MAP4K2	64316035	0.990000	0.36364	0.928000	0.36995	0.901000	0.52897	3.372000	0.52387	2.187000	0.69744	0.456000	0.33151	GAG	MAP4K2	-	pfam_Citron,smart_Citron		0.692	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K2	HGNC	protein_coding	OTTHUMT00000105239.1	C	NM_004579		64559459	-1	no_errors	ENST00000294066	ensembl	human	known	70_37	missense	SNP	0.993	G
NFE2L1	4779	genome.wustl.edu	37	17	46136124	46136124	+	Silent	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr17:46136124C>T	ENST00000362042.3	+	6	2056	c.1440C>T	c.(1438-1440)tcC>tcT	p.S480S	RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000357480.5_Silent_p.S450S|NFE2L1_ENST00000582155.1_Silent_p.S292S|NFE2L1_ENST00000361665.3_Silent_p.S469S|NFE2L1_ENST00000536222.1_Silent_p.S324S|NFE2L1_ENST00000585291.1_Silent_p.S450S|NFE2L1_ENST00000583378.1_Silent_p.S281S	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	480					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CAGGCCTTTCCTTAGACTCGA	0.522																																																	0													96.0	96.0	96.0					17																	46136124		2203	4300	6503	SO:0001819	synonymous_variant	4779			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.1440C>T	17.37:g.46136124C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S480	ENST00000362042.3	37	c.1440	CCDS11524.1	17																																																																																			NFE2L1	-	NULL		0.522	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1	C	NM_003204		46136124	+1	no_errors	ENST00000362042	ensembl	human	known	70_37	silent	SNP	1.000	T
NKAP	79576	genome.wustl.edu	37	X	119068474	119068474	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chrX:119068474C>G	ENST00000371410.3	-	5	886	c.720G>C	c.(718-720)aaG>aaC	p.K240N	NKAP_ENST00000477789.1_5'UTR	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	240	Lys-rich.|Necessary for interaction with CIR1.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						GTTTCTTCTTCTTTTCCTTTT	0.264																																																	0													74.0	74.0	74.0					X																	119068474		2203	4295	6498	SO:0001583	missense	79576			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.720G>C	X.37:g.119068474C>G	ENSP00000360464:p.Lys240Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IPW6|Q96BQ2|Q9H638	Missense_Mutation	SNP	pfam_DUF926	p.K240N	ENST00000371410.3	37	c.720	CCDS14592.1	X	.	.	.	.	.	.	.	.	.	.	C	5.287	0.238265	0.10023	.	.	ENSG00000101882	ENST00000371410	T	0.18810	2.19	3.87	3.0	0.34707	.	0.099263	0.64402	D	0.000002	T	0.33147	0.0853	M	0.72894	2.215	0.48087	D	0.99958	D;D	0.61697	0.983;0.99	P;P	0.54174	0.637;0.744	T	0.05099	-1.0906	10	0.40728	T	0.16	-6.8138	9.906	0.41377	0.0:0.8908:0.0:0.1092	.	240;240	Q8N5F7;A0PJ73	NKAP_HUMAN;.	N	240	ENSP00000360464:K240N	ENSP00000360464:K240N	K	-	3	2	NKAP	118952502	1.000000	0.71417	0.993000	0.49108	0.062000	0.15995	0.539000	0.23175	0.754000	0.32968	0.544000	0.68410	AAG	NKAP	-	NULL		0.264	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAP	HGNC	protein_coding	OTTHUMT00000058072.1	C	NM_024528		119068474	-1	no_errors	ENST00000371410	ensembl	human	known	70_37	missense	SNP	1.000	G
PRKCQ	5588	genome.wustl.edu	37	10	6525506	6525506	+	Missense_Mutation	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr10:6525506G>C	ENST00000263125.5	-	11	1174	c.1075C>G	c.(1075-1077)Ctt>Gtt	p.L359V	PRKCQ_ENST00000539722.1_Missense_Mutation_p.L234V|PRKCQ_ENST00000397176.2_Missense_Mutation_p.L359V	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	359					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GGTTCTGGAAGATGGCACATT	0.413																																					Ovarian(50;572 1126 10530 25349 30594)												0													129.0	123.0	125.0					10																	6525506		2203	4300	6503	SO:0001583	missense	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1075C>G	10.37:g.6525506G>C	ENSP00000263125:p.Leu359Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L359V	ENST00000263125.5	37	c.1075	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	7.885|7.885	0.731000|0.731000	0.15507|0.15507	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.68479	.|-0.33;-0.29;-0.33	5.24|5.24	3.24|3.24	0.37175|0.37175	.|.	.|2.319440	.|0.01482	.|N	.|0.016729	T|T	0.59376|0.59376	0.2189|0.2189	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.18968	.|0.001;0.032;0.016;0.003	.|B;B;B;B	.|0.16289	.|0.003;0.013;0.015;0.006	T|T	0.47611|0.47611	-0.9104|-0.9104	5|10	.|0.29301	.|T	.|0.29	.|.	15.0356|15.0356	0.71744|0.71744	0.0:0.2697:0.7303:0.0|0.0:0.2697:0.7303:0.0	.|.	.|234;131;359;359	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	M|V	131|359;359;234	.|ENSP00000263125:L359V;ENSP00000380361:L359V;ENSP00000441752:L234V	.|ENSP00000263125:L359V	I|L	-|-	3|1	3|0	PRKCQ|PRKCQ	6565512|6565512	0.400000|0.400000	0.25295|0.25295	0.001000|0.001000	0.08648|0.08648	0.000000|0.000000	0.00434|0.00434	3.542000|3.542000	0.53625|0.53625	1.179000|1.179000	0.42884|0.42884	-0.182000|-0.182000	0.12963|0.12963	ATC|CTT	PRKCQ	-	pirsf_Prot_kin_PKC_delta		0.413	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	G	NM_006257		6525506	-1	no_errors	ENST00000263125	ensembl	human	known	70_37	missense	SNP	0.019	C
PROM1	8842	genome.wustl.edu	37	4	16002130	16002130	+	Missense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr4:16002130C>T	ENST00000510224.1	-	14	1815	c.1567G>A	c.(1567-1569)Gaa>Aaa	p.E523K	PROM1_ENST00000447510.2_Missense_Mutation_p.E523K|PROM1_ENST00000508167.1_Missense_Mutation_p.E514K|PROM1_ENST00000505450.1_Missense_Mutation_p.E514K|PROM1_ENST00000540805.1_Missense_Mutation_p.E523K|PROM1_ENST00000543373.1_Missense_Mutation_p.E514K|PROM1_ENST00000539194.1_Missense_Mutation_p.E523K			O43490	PROM1_HUMAN	prominin 1	523					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CGGAATAATTCCTTGCTCGTG	0.358																																																	0													77.0	70.0	72.0					4																	16002130		1832	4091	5923	SO:0001583	missense	8842			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1567G>A	4.37:g.16002130C>T	ENSP00000426809:p.Glu523Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.E523K	ENST00000510224.1	37	c.1567	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.090808	0.00367	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.31	2.68	0.31781	.	0.507943	0.22886	N	0.054450	T	0.13457	0.0326	N	0.01015	-1.05	0.09310	N	1	B;B;B;B;B;B	0.14012	0.007;0.007;0.007;0.007;0.008;0.009	B;B;B;B;B;B	0.17098	0.01;0.01;0.01;0.01;0.002;0.017	T	0.26710	-1.0095	10	0.18276	T	0.48	-20.2856	7.654	0.28365	0.0:0.289:0.0:0.711	.	514;523;514;523;514;523	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	K	523;523;523;514;514;523;514	ENSP00000415481:E523K;ENSP00000438045:E523K;ENSP00000443620:E523K;ENSP00000426090:E514K;ENSP00000427346:E514K;ENSP00000426809:E523K;ENSP00000445526:E514K	ENSP00000415481:E523K	E	-	1	0	PROM1	15611228	0.598000	0.26882	0.008000	0.14137	0.003000	0.03518	0.623000	0.24447	0.748000	0.32831	-0.355000	0.07637	GAA	PROM1	-	pfam_Prominin		0.358	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	C	NM_006017		16002130	-1	no_errors	ENST00000447510	ensembl	human	known	70_37	missense	SNP	0.015	T
RASSF1	11186	genome.wustl.edu	37	3	50369018	50369018	+	Silent	SNP	G	G	C			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:50369018G>C	ENST00000357043.2	-	4	779	c.744C>G	c.(742-744)ctC>ctG	p.L248L	RASSF1_ENST00000359365.4_Silent_p.L244L|RASSF1_ENST00000327761.3_Silent_p.L174L|RASSF1_ENST00000395126.3_Silent_p.L93L					Ras association (RalGDS/AF-6) domain family member 1											lung(2)|ovary(1)|skin(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CGCGCTCAAAGAGTGCAAACT	0.592																																																	0													71.0	80.0	77.0					3																	50369018		2203	4300	6503	SO:0001819	synonymous_variant	11186			AF132675	CCDS2820.1, CCDS2821.1, CCDS2822.1, CCDS43096.1	3p21.3	2008-02-22	2008-02-22		ENSG00000068028	ENSG00000068028			9882	protein-coding gene	gene with protein product		605082					Standard	NM_170713		Approved	NORE2A, REH3P21, RDA32, 123F2	uc003dad.1	Q9NS23	OTTHUMG00000149958	ENST00000357043.2:c.744C>G	3.37:g.50369018G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L248	ENST00000357043.2	37	c.744	CCDS2820.1	3																																																																																			RASSF1	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.592	RASSF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF1	HGNC	protein_coding	OTTHUMT00000314304.1	G			50369018	-1	no_errors	ENST00000357043	ensembl	human	known	70_37	silent	SNP	0.898	C
RFPL1	5988	genome.wustl.edu	37	22	29833943	29833943	+	5'Flank	DEL	T	T	-			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr22:29833943delT	ENST00000354373.2	+	0	0				RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1								zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						AAGGATGTGAttttttttttt	0.423																																																	0																																										SO:0001631	upstream_gene_variant	10740			AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516		22.37:g.29833943delT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IC06|Q9UJ97	RNA	DEL	-	NULL	ENST00000354373.2	37	NULL	CCDS13857.2	22																																																																																			RFPL1-AS1	-	-		0.423	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1-AS1	HGNC	protein_coding	OTTHUMT00000318719.1	T	NM_021026		29833943	-1	no_errors	ENST00000461286	ensembl	human	known	70_37	rna	DEL	0.007	-
RHBDL3	162494	genome.wustl.edu	37	17	30615838	30615838	+	Missense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr17:30615838C>T	ENST00000269051.4	+	4	336	c.322C>T	c.(322-324)Cgc>Tgc	p.R108C	RHBDL3_ENST00000536287.1_Missense_Mutation_p.R10C|RHBDL3_ENST00000538145.1_Missense_Mutation_p.R100C	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	108						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				CAACAGCTTCCGCCAAGCCAT	0.632																																																	0													38.0	33.0	35.0					17																	30615838		2203	4300	6503	SO:0001583	missense	162494			AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.322C>T	17.37:g.30615838C>T	ENSP00000269051:p.Arg108Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom,pirsf_Peptidase_S54_rhomboid_met,pfscan_EF_HAND_2	p.R108C	ENST00000269051.4	37	c.322	CCDS32613.1	17	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030850	0.93575	.	.	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.69040	-0.37;0.24;0.79;1.19	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.79919	0.4529	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.964;0.983	T	0.78497	-0.2181	10	0.48119	T	0.1	-5.7969	19.8011	0.96507	0.0:1.0:0.0:0.0	.	108;100;108	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	C	108;108;100;10	ENSP00000394849:R108C;ENSP00000269051:R108C;ENSP00000442092:R100C;ENSP00000466508:R10C	ENSP00000269051:R108C	R	+	1	0	RHBDL3	27639951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.656000	0.67988	2.679000	0.91253	0.561000	0.74099	CGC	RHBDL3	-	pirsf_Peptidase_S54_rhomboid_met		0.632	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RHBDL3	HGNC	protein_coding	OTTHUMT00000447120.1	C	NM_138328		30615838	+1	no_errors	ENST00000269051	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF149	284996	genome.wustl.edu	37	2	101924597	101924597	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr2:101924597G>A	ENST00000295317.3	-	1	561	c.454C>T	c.(454-456)Cac>Tac	p.H152Y	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	152	PA.				cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						TCACCCGCGTGAGACATGGGC	0.687																																					Colon(25;331 612 6521 7355 31028)												0													22.0	27.0	25.0					2																	101924597		2178	4252	6430	SO:0001583	missense	284996			AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.454C>T	2.37:g.101924597G>A	ENSP00000295317:p.His152Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H152Y	ENST00000295317.3	37	c.454	CCDS2051.1	2	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252153	0.59212	.	.	ENSG00000163162	ENST00000295317	T	0.06218	3.33	4.67	3.79	0.43588	Protease-associated domain, PA (1);	0.000000	0.64402	D	0.000017	T	0.12220	0.0297	M	0.76433	2.335	0.53005	D	0.999965	P	0.47677	0.899	B	0.42882	0.401	T	0.03364	-1.1044	10	0.87932	D	0	.	14.2563	0.66053	0.0:0.0:0.8501:0.1499	.	152	Q8NC42	RN149_HUMAN	Y	152	ENSP00000295317:H152Y	ENSP00000295317:H152Y	H	-	1	0	RNF149	101291029	1.000000	0.71417	0.997000	0.53966	0.062000	0.15995	4.328000	0.59253	0.931000	0.37242	0.313000	0.20887	CAC	RNF149	-	pfam_Protease-assoc_domain		0.687	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	HGNC	protein_coding	OTTHUMT00000253180.2	G	NM_173647		101924597	-1	no_errors	ENST00000295317	ensembl	human	known	70_37	missense	SNP	1.000	A
SFTPA2	729238	genome.wustl.edu	37	10	81319157	81319157	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr10:81319157C>G	ENST00000372325.2	-	3	167	c.83G>C	c.(82-84)gGa>gCa	p.G28A	SFTPA2_ENST00000372327.5_Missense_Mutation_p.G28A	NM_001098668.2	NP_001092138.1	Q8IWL1	SFPA2_HUMAN	surfactant protein A2	28	Collagen-like.				respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			ACCAGGGCTTCCAACACAAAC	0.632									Pulmonary Fibrosis, Idiopathic																																								0													163.0	143.0	150.0					10																	81319157		2203	4296	6499	SO:0001583	missense	729238	Familial Cancer Database	Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia		CCDS41540.1	10q22.3	2012-11-02	2008-08-26			ENSG00000185303		"""Collectins"""	10799	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A2A"""	178642	"""surfactant, pulmonary-associated protein A2"""				Standard	NM_001098668		Approved	SP-A2, COLEC5	uc001kal.4	Q8IWL1		ENST00000372325.2:c.83G>C	10.37:g.81319157C>G	ENSP00000361400:p.Gly28Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPA7|B2RXI6|B2RXK9|C9J9I7|E3VLC6|E3VLC7|E3VLC8|E3VLC9|P07714|Q14DV3|Q5RIR8|Q5RIR9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G28A	ENST00000372325.2	37	c.83	CCDS41540.1	10	.	.	.	.	.	.	.	.	.	.	N	6.139	0.393854	0.11638	.	.	ENSG00000185303	ENST00000372325;ENST00000537207;ENST00000372327;ENST00000417041	D;D;D	0.99329	-5.75;-5.75;-5.75	2.78	0.419	0.16438	.	0.253832	0.27971	N	0.017112	D	0.97009	0.9023	L	0.41492	1.28	0.09310	N	1	B	0.20887	0.049	B	0.25291	0.059	D	0.94117	0.7376	10	0.46703	T	0.11	-6.3453	8.0746	0.30710	0.0:0.5034:0.4966:0.0	.	28	E3VLC8	.	A	28;43;28;28	ENSP00000361400:G28A;ENSP00000361402:G28A;ENSP00000397375:G28A	ENSP00000361400:G28A	G	-	2	0	SFTPA2	80989163	0.000000	0.05858	0.084000	0.20598	0.431000	0.31685	-0.025000	0.12413	0.252000	0.21531	0.536000	0.68110	GGA	SFTPA2	-	pfam_Collagen		0.632	SFTPA2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SFTPA2	HGNC	protein_coding	OTTHUMT00000048961.1	C	NM_001098668		81319157	-1	no_errors	ENST00000372325	ensembl	human	known	70_37	missense	SNP	0.079	G
SLC5A4	6527	genome.wustl.edu	37	22	32625325	32625325	+	Missense_Mutation	SNP	C	C	G	rs142416109		TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr22:32625325C>G	ENST00000266086.4	-	11	1147	c.1136G>C	c.(1135-1137)cGa>cCa	p.R379P	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	379					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATCAGGCCTCGCAGTCCTGG	0.537																																																	0													70.0	67.0	68.0					22																	32625325		2203	4300	6503	SO:0001583	missense	6527			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1136G>C	22.37:g.32625325C>G	ENSP00000266086:p.Arg379Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	O15279	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.R379P	ENST00000266086.4	37	c.1136	CCDS13903.1	22	.	.	.	.	.	.	.	.	.	.	.	16.41	3.115693	0.56505	.	.	ENSG00000100191	ENST00000266086	D	0.88975	-2.45	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.96040	0.8710	H	0.95079	3.62	0.80722	D	1	P	0.52577	0.954	D	0.72982	0.979	D	0.96995	0.9725	10	0.87932	D	0	.	15.39	0.74735	0.0:1.0:0.0:0.0	.	379	Q9NY91	SC5A4_HUMAN	P	379	ENSP00000266086:R379P	ENSP00000266086:R379P	R	-	2	0	SLC5A4	30955325	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	5.845000	0.69437	2.574000	0.86865	0.655000	0.94253	CGA	SLC5A4	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.537	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A4	HGNC	protein_coding	OTTHUMT00000315724.1	C	NM_014227		32625325	-1	no_errors	ENST00000266086	ensembl	human	known	70_37	missense	SNP	1.000	G
SPICE1	152185	genome.wustl.edu	37	3	113187200	113187200	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:113187200G>A	ENST00000295872.4	-	10	1200	c.941C>T	c.(940-942)tCa>tTa	p.S314L		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	314					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GCTACCTGATGATATGTTTTT	0.378																																																	0													121.0	121.0	121.0					3																	113187200		2203	4300	6503	SO:0001583	missense	152185			AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.941C>T	3.37:g.113187200G>A	ENSP00000295872:p.Ser314Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DN72|Q8WUX6	Missense_Mutation	SNP	NULL	p.S314L	ENST00000295872.4	37	c.941	CCDS2973.1	3	.	.	.	.	.	.	.	.	.	.	A	2.096	-0.407130	0.04832	.	.	ENSG00000163611	ENST00000295872	T	0.31510	1.49	5.31	1.59	0.23543	.	0.463200	0.20909	N	0.083501	T	0.12263	0.0298	N	0.04203	-0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.32295	-0.9912	10	0.14656	T	0.56	-1.7426	9.5717	0.39431	0.5717:0.0:0.4283:0.0	.	210;314	B3KX77;Q8N0Z3	.;SPICE_HUMAN	L	314	ENSP00000295872:S314L	ENSP00000295872:S314L	S	-	2	0	SPICE1	114669890	0.000000	0.05858	0.001000	0.08648	0.272000	0.26649	0.824000	0.27379	0.037000	0.15575	-0.556000	0.04195	TCA	SPICE1	-	NULL		0.378	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPICE1	HGNC	protein_coding	OTTHUMT00000354177.2	G	NM_144718		113187200	-1	no_errors	ENST00000295872	ensembl	human	known	70_37	missense	SNP	0.000	A
SLC7A14	57709	genome.wustl.edu	37	3	170216629	170216629	+	Missense_Mutation	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr3:170216629C>T	ENST00000231706.5	-	4	901	c.586G>A	c.(586-588)Gcg>Acg	p.A196T	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	196					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			ACGATGACCGCGATCAACAGA	0.468																																																	0													133.0	110.0	118.0					3																	170216629		2203	4300	6503	SO:0001583	missense	57709			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.586G>A	3.37:g.170216629C>T	ENSP00000231706:p.Ala196Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV33|Q9HCF9	Missense_Mutation	SNP	pfam_AA-permease_dom	p.A196T	ENST00000231706.5	37	c.586	CCDS33892.1	3	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413039	0.25465	.	.	ENSG00000013293	ENST00000231706	D	0.89415	-2.51	5.78	5.78	0.91487	Amino acid permease domain (1);	0.098469	0.64402	D	0.000002	T	0.70116	0.3187	N	0.00811	-1.165	0.54753	D	0.999987	P	0.39404	0.672	B	0.31812	0.136	T	0.75169	-0.3412	10	0.19147	T	0.46	.	20.0203	0.97492	0.0:1.0:0.0:0.0	.	196	Q8TBB6	S7A14_HUMAN	T	196	ENSP00000231706:A196T	ENSP00000231706:A196T	A	-	1	0	SLC7A14	171699323	1.000000	0.71417	0.379000	0.26080	0.160000	0.22226	6.051000	0.71072	2.730000	0.93505	0.655000	0.94253	GCG	SLC7A14	-	pfam_AA-permease_dom		0.468	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	C	NM_020949		170216629	-1	no_errors	ENST00000231706	ensembl	human	known	70_37	missense	SNP	0.996	T
SZT2	23334	genome.wustl.edu	37	1	43908244	43908244	+	Silent	SNP	C	C	T			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:43908244C>T	ENST00000562955.1	+	57	7935	c.7935C>T	c.(7933-7935)ctC>ctT	p.L2645L	SZT2_ENST00000372442.1_Silent_p.L1803L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2702					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						AGCTTGGCCTCTTCCATCATT	0.557																																																	0													92.0	94.0	93.0					1																	43908244		2203	4300	6503	SO:0001819	synonymous_variant	23334			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7935C>T	1.37:g.43908244C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Silent	SNP	NULL	p.L2645	ENST00000562955.1	37	c.7935	CCDS30694.2	1																																																																																			SZT2	-	NULL		0.557	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	C	NM_015284		43908244	+1	no_errors	ENST00000562955	ensembl	human	known	70_37	silent	SNP	0.950	T
TARBP1	6894	genome.wustl.edu	37	1	234613973	234613973	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr1:234613973C>G	ENST00000040877.1	-	1	876	c.877G>C	c.(877-879)Gag>Cag	p.E293Q		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	293					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GCCGACACCTCCACCGCCCTC	0.716																																																	0													10.0	12.0	11.0					1																	234613973		2084	4160	6244	SO:0001583	missense	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.877G>C	1.37:g.234613973C>G	ENSP00000040877:p.Glu293Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.E293Q	ENST00000040877.1	37	c.877	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801454	0.50315	.	.	ENSG00000059588	ENST00000040877	T	0.05786	3.39	4.48	3.54	0.40534	.	0.209825	0.39985	N	0.001212	T	0.04724	0.0128	N	0.16478	0.41	0.28263	N	0.924746	B	0.14805	0.011	B	0.12837	0.008	T	0.27262	-1.0079	10	0.29301	T	0.29	-22.2545	13.1185	0.59313	0.0:0.8371:0.1629:0.0	.	293	Q13395	TARB1_HUMAN	Q	293	ENSP00000040877:E293Q	ENSP00000040877:E293Q	E	-	1	0	TARBP1	232680596	0.998000	0.40836	0.990000	0.47175	0.861000	0.49209	1.991000	0.40727	1.012000	0.39366	0.484000	0.47621	GAG	TARBP1	-	NULL		0.716	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	C	NM_005646		234613973	-1	no_errors	ENST00000040877	ensembl	human	known	70_37	missense	SNP	1.000	G
TGFBI	7045	genome.wustl.edu	37	5	135382658	135382658	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr5:135382658C>G	ENST00000442011.2	+	5	739	c.578C>G	c.(577-579)tCt>tGt	p.S193C	TGFBI_ENST00000305126.8_Missense_Mutation_p.S193C	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	193	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACCCTCACCTCTATGTACCAG	0.522																																																	0													60.0	60.0	60.0					5																	135382658		2053	4213	6266	SO:0001583	missense	7045			M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.578C>G	5.37:g.135382658C>G	ENSP00000416330:p.Ser193Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.S193C	ENST00000442011.2	37	c.578	CCDS47266.1	5	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667438	0.88348	.	.	ENSG00000120708	ENST00000442011;ENST00000305126	D;D	0.92647	-3.08;-3.08	5.55	5.55	0.83447	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.97315	0.9122	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97992	1.0355	10	0.87932	D	0	-13.0287	19.5213	0.95185	0.0:1.0:0.0:0.0	.	193	Q15582	BGH3_HUMAN	C	193	ENSP00000416330:S193C;ENSP00000306306:S193C	ENSP00000306306:S193C	S	+	2	0	TGFBI	135410557	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	7.818000	0.86416	2.610000	0.88304	0.555000	0.69702	TCT	TGFBI	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_FAS1_domain		0.522	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBI	HGNC	protein_coding	OTTHUMT00000372108.1	C			135382658	+1	no_errors	ENST00000305126	ensembl	human	known	70_37	missense	SNP	1.000	G
TANGO6	79613	genome.wustl.edu	37	16	68894388	68894388	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr16:68894388C>G	ENST00000261778.1	+	2	708	c.696C>G	c.(694-696)ttC>ttG	p.F232L		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	232						integral component of membrane (GO:0016021)											AACTGGGATTCTGCCCAACCA	0.463																																																	0													77.0	75.0	76.0					16																	68894388		1945	4143	6088	SO:0001583	missense	79613				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.696C>G	16.37:g.68894388C>G	ENSP00000261778:p.Phe232Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2411,superfamily_ARM-type_fold	p.F232L	ENST00000261778.1	37	c.696	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108048	0.77096	.	.	ENSG00000103047	ENST00000261778	T	0.62498	0.02	4.99	3.03	0.35002	.	.	.	.	.	T	0.72423	0.3458	M	0.63428	1.95	0.34081	D	0.659629	D;D	0.69078	0.997;0.997	D;D	0.70716	0.97;0.97	T	0.77859	-0.2431	9	0.48119	T	0.1	-7.8814	9.6337	0.39795	0.0:0.8268:0.0:0.1732	.	232;71	Q9C0B7;B3KTB6	TMCO7_HUMAN;.	L	232	ENSP00000261778:F232L	ENSP00000261778:F232L	F	+	3	2	TMCO7	67451889	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.981000	0.29526	1.103000	0.41568	0.655000	0.94253	TTC	TMCO7	-	NULL		0.463	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO7	HGNC	protein_coding	OTTHUMT00000433471.2	C	XM_928235.2		68894388	+1	no_errors	ENST00000261778	ensembl	human	known	70_37	missense	SNP	1.000	G
TP53BP1	7158	genome.wustl.edu	37	15	43784623	43784623	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr15:43784623G>A	ENST00000263801.3	-	2	288	c.36C>T	c.(34-36)ttC>ttT	p.F12F	TP53BP1_ENST00000382044.4_Silent_p.F17F|TP53BP1_ENST00000450115.2_Silent_p.F17F|TP53BP1_ENST00000382039.3_Silent_p.F17F	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	12					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTTGCTGAGAGAAATCTGAAT	0.458								Other conserved DNA damage response genes																																									0													130.0	127.0	128.0					15																	43784623		2201	4298	6499	SO:0001819	synonymous_variant	7158			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.36C>T	15.37:g.43784623G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.F17	ENST00000263801.3	37	c.51	CCDS10096.1	15																																																																																			TP53BP1	-	NULL		0.458	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	G			43784623	-1	no_errors	ENST00000382044	ensembl	human	known	70_37	silent	SNP	1.000	A
TUT1	64852	genome.wustl.edu	37	11	62344739	62344739	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr11:62344739G>A	ENST00000476907.1	-	6	1876	c.1185C>T	c.(1183-1185)ttC>ttT	p.F395F	MIR3654_ENST00000496634.2_Silent_p.F395F|EEF1G_ENST00000378019.3_5'Flank|TUT1_ENST00000308436.7_Silent_p.F433F			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	395					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AGAGACTCAGGAAACGGGAGT	0.602																																																	0													66.0	65.0	65.0					11																	62344739		2202	4299	6501	SO:0001819	synonymous_variant	64852			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1185C>T	11.37:g.62344739G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Silent	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F433	ENST00000476907.1	37	c.1299		11																																																																																			TUT1	-	NULL		0.602	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	G	NM_022830		62344739	-1	no_errors	ENST00000308436	ensembl	human	known	70_37	silent	SNP	1.000	A
UBA2	10054	genome.wustl.edu	37	19	34954993	34954993	+	Missense_Mutation	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr19:34954993G>A	ENST00000246548.4	+	15	1631	c.1561G>A	c.(1561-1563)Gac>Aac	p.D521N	UBA2_ENST00000439527.2_Missense_Mutation_p.D425N|UBA2_ENST00000592791.1_Missense_Mutation_p.D47N	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	521					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TCAAGCAGATGACTTCCTCCA	0.318																																																	0													87.0	90.0	89.0					19																	34954993		2203	4300	6503	SO:0001583	missense	10054			BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.1561G>A	19.37:g.34954993G>A	ENSP00000246548:p.Asp521Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB	p.D521N	ENST00000246548.4	37	c.1561	CCDS12439.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.360802	0.95877	.	.	ENSG00000126261	ENST00000246548;ENST00000439527	T;T	0.34072	1.38;1.38	5.48	5.48	0.80851	Molybdenum cofactor biosynthesis, MoeB (1);	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72459	-0.4287	10	0.87932	D	0	-20.4007	18.4948	0.90861	0.0:0.0:1.0:0.0	.	521	Q9UBT2	SAE2_HUMAN	N	521;425	ENSP00000246548:D521N;ENSP00000437484:D425N	ENSP00000246548:D521N	D	+	1	0	UBA2	39646833	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.022000	0.93678	2.741000	0.93983	0.555000	0.69702	GAC	UBA2	-	superfamily_Molybdenum_cofac_synth_MoeB		0.318	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA2	HGNC	protein_coding	OTTHUMT00000459257.3	G	NM_005499		34954993	+1	no_errors	ENST00000246548	ensembl	human	known	70_37	missense	SNP	1.000	A
USP8	9101	genome.wustl.edu	37	15	50741664	50741664	+	Missense_Mutation	SNP	C	C	G			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr15:50741664C>G	ENST00000396444.3	+	4	655	c.317C>G	c.(316-318)tCt>tGt	p.S106C	USP8_ENST00000433963.1_Missense_Mutation_p.S106C|USP8_ENST00000425032.3_Intron|USP8_ENST00000307179.4_Missense_Mutation_p.S106C	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	106	MIT.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GAAAGACTCTCTGAAAGCCTT	0.269																																																	0													40.0	42.0	41.0					15																	50741664		2191	4289	6480	SO:0001583	missense	9101			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.317C>G	15.37:g.50741664C>G	ENSP00000379721:p.Ser106Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_DUF1873,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_Rsp5_WWP,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19	p.S106C	ENST00000396444.3	37	c.317	CCDS10137.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595591	0.86953	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179	T;T;T	0.21191	2.02;2.02;2.02	5.83	5.83	0.93111	Domain of unknown function DUF1873 (1);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.35748	-0.9776	10	0.72032	D	0.01	-17.3622	20.1047	0.97888	0.0:1.0:0.0:0.0	.	106	P40818	UBP8_HUMAN	C	106	ENSP00000379721:S106C;ENSP00000405537:S106C;ENSP00000302239:S106C	ENSP00000302239:S106C	S	+	2	0	USP8	48528956	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.823000	0.75282	2.762000	0.94881	0.655000	0.94253	TCT	USP8	-	pfam_DUF1873		0.269	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	C	NM_005154		50741664	+1	no_errors	ENST00000307179	ensembl	human	known	70_37	missense	SNP	1.000	G
ZFYVE1	53349	genome.wustl.edu	37	14	73444865	73444865	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr14:73444865G>A	ENST00000556143.1	-	7	2217	c.1497C>T	c.(1495-1497)ctC>ctT	p.L499L	ZFYVE1_ENST00000394207.2_Silent_p.L84L|ZFYVE1_ENST00000554145.1_Intron|ZFYVE1_ENST00000318876.5_Silent_p.L499L|ZFYVE1_ENST00000555072.1_Silent_p.L84L|ZFYVE1_ENST00000553891.1_Silent_p.L499L	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	499					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		CATATTTTGCGAGACCCATCC	0.507																																																	0													120.0	115.0	117.0					14																	73444865		2203	4300	6503	SO:0001819	synonymous_variant	53349			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.1497C>T	14.37:g.73444865G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,superfamily_Growth_fac_rcpt,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.L499	ENST00000556143.1	37	c.1497	CCDS9811.1	14																																																																																			ZFYVE1	-	superfamily_Growth_fac_rcpt		0.507	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE1	HGNC	protein_coding	OTTHUMT00000413172.1	G	NM_021260		73444865	-1	no_errors	ENST00000553891	ensembl	human	known	70_37	silent	SNP	0.292	A
ZNF622	90441	genome.wustl.edu	37	5	16465736	16465736	+	Silent	SNP	G	G	A			TCGA-HM-A4S6-01A-11D-A26G-09	TCGA-HM-A4S6-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	542f81e6-6083-44ac-96e3-546512629746	6e2cce33-ac0f-44f4-a406-2a00d1179507	g.chr5:16465736G>A	ENST00000308683.2	-	1	165	c.39C>T	c.(37-39)ttC>ttT	p.F13F		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	13					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						CCGCGTCGCGGAACGCCACCC	0.642																																																	0													34.0	37.0	36.0					5																	16465736		2202	4298	6500	SO:0001819	synonymous_variant	90441			AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.39C>T	5.37:g.16465736G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.F13	ENST00000308683.2	37	c.39	CCDS3886.1	5																																																																																			ZNF622	-	smart_Znf_U1,smart_Znf_C2H2-like		0.642	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF622	HGNC	protein_coding	OTTHUMT00000207105.1	G	NM_033414		16465736	-1	no_errors	ENST00000308683	ensembl	human	known	70_37	silent	SNP	0.941	A
