#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ADPGK	83440	genome.wustl.edu	37	15	73044861	73044861	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr15:73044861C>A	ENST00000311669.8	-	7	1405	c.1312G>T	c.(1312-1314)Gag>Tag	p.E438*	ADPGK_ENST00000456471.2_Nonsense_Mutation_p.E164*	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	439	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						GAGCCTGCCTCCGAATGGGAA	0.522																																																	0													95.0	96.0	96.0					15																	73044861		1911	4117	6028	SO:0001587	stop_gained	83440			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1312G>T	15.37:g.73044861C>A	ENSP00000312250:p.Glu438*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Nonsense_Mutation	SNP	pfam_ADP_PFK/GK	p.E438*	ENST00000311669.8	37	c.1312	CCDS42057.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.067230|5.067230	0.93898|0.93898	.|.	.|.	ENSG00000159322|ENSG00000159322	ENST00000311669;ENST00000443764;ENST00000456471|ENST00000331065	.|.	.|.	.|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.228496|.	0.51477|.	D|.	0.000083|.	.|T	.|0.75324	.|0.3834	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75542	.|-0.3281	.|5	0.36615|0.56958	T|D	0.2|0.05	-4.6292|-4.6292	15.9588|15.9588	0.79910|0.79910	0.0:0.866:0.134:0.0|0.0:0.866:0.134:0.0	.|.	.|.	.|.	.|.	X|V	438;358;164|315	.|.	ENSP00000312250:E438X|ENSP00000332964:G315V	E|G	-|-	1|2	0|0	ADPGK|ADPGK	70831914|70831914	1.000000|1.000000	0.71417|0.71417	0.013000|0.013000	0.15412|0.15412	0.920000|0.920000	0.55202|0.55202	5.889000|5.889000	0.69766|0.69766	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GAG|GGA	ADPGK	-	pfam_ADP_PFK/GK		0.522	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK	HGNC	protein_coding	OTTHUMT00000420434.1	C	NM_031284		73044861	-1	no_errors	ENST00000311669	ensembl	human	known	70_37	nonsense	SNP	0.954	A
ANKS1B	56899	genome.wustl.edu	37	12	100048924	100048924	+	Missense_Mutation	SNP	G	G	A	rs377459874		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr12:100048924G>A	ENST00000547776.2	-	9	1192	c.1193C>T	c.(1192-1194)aCg>aTg	p.T398M	ANKS1B_ENST00000329257.7_Missense_Mutation_p.T398M|ANKS1B_ENST00000547010.1_De_novo_Start_InFrame	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	398						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGGCCCACACGTATTTTCATC	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		16060	0.0		0.001	False		,,,				2504	0.0																0								G	MET/THR	1,3821		0,1,1910	119.0	117.0	118.0		1193	3.5	0.2	12		118	1,8241		0,1,4120	no	missense	ANKS1B	NM_152788.4	81	0,2,6030	AA,AG,GG		0.0121,0.0262,0.0166	possibly-damaging	398/1249	100048924	2,12062	1911	4121	6032	SO:0001583	missense	56899			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1193C>T	12.37:g.100048924G>A	ENSP00000449629:p.Thr398Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTyr_interaction_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTyr_interaction_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTyr_interaction_dom,pfscan_SAM,prints_Ankyrin_rpt	p.T398M	ENST00000547776.2	37	c.1193	CCDS55872.1	12	.	.	.	.	.	.	.	.	.	.	G	9.507	1.104632	0.20632	2.62E-4	1.21E-4	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	T;T;T	0.51071	0.85;0.85;0.72	5.47	3.51	0.40186	.	0.251827	0.30959	N	0.008522	T	0.31104	0.0786	N	0.22421	0.69	0.46078	D	0.998858	P;P	0.51791	0.948;0.913	B;B	0.39876	0.312;0.165	T	0.05971	-1.0853	9	.	.	.	-4.2304	12.7356	0.57222	0.0:0.4365:0.5635:0.0	.	364;398	F8VVQ4;Q7Z6G8	.;ANS1B_HUMAN	M	398;398;364	ENSP00000449629:T398M;ENSP00000331381:T398M;ENSP00000449894:T364M	.	T	-	2	0	ANKS1B	98573055	1.000000	0.71417	0.180000	0.23079	0.246000	0.25737	2.677000	0.46892	1.292000	0.44672	-0.283000	0.09986	ACG	ANKS1B	-	NULL		0.378	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	G	NM_020140		100048924	-1	no_errors	ENST00000329257	ensembl	human	known	70_37	missense	SNP	0.717	A
AP3B1	8546	genome.wustl.edu	37	5	77330203	77330203	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:77330203G>T	ENST00000255194.6	-	24	3051	c.2876C>A	c.(2875-2877)aCt>aAt	p.T959N	AP3B1_ENST00000519295.1_Missense_Mutation_p.T910N|AP3B1_ENST00000523204.1_5'UTR	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	959					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GAAACTGGCAGTCTGAGTAGA	0.348									Hermansky-Pudlak syndrome																																								0													80.0	83.0	82.0					5																	77330203		2203	4300	6503	SO:0001583	missense	8546	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2876C>A	5.37:g.77330203G>T	ENSP00000255194:p.Thr959Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.T959N	ENST00000255194.6	37	c.2876	CCDS4041.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.68|17.68	3.448416|3.448416	0.63178|0.63178	.|.	.|.	ENSG00000132842|ENSG00000132842	ENST00000522901|ENST00000255194;ENST00000519295	.|T;T	.|0.54279	.|0.58;0.58	6.05|6.05	5.18|5.18	0.71444|0.71444	.|.	.|0.209202	.|0.50627	.|D	.|0.000103	T|T	0.49847|0.49847	0.1581|0.1581	L|L	0.46157|0.46157	1.445|1.445	0.45995|0.45995	D|D	0.998801|0.998801	.|P	.|0.43169	.|0.8	.|B	.|0.41860	.|0.368	T|T	0.51084|0.51084	-0.8750|-0.8750	5|10	.|0.45353	.|T	.|0.12	-9.7264|-9.7264	15.1332|15.1332	0.72542|0.72542	0.0672:0.0:0.9328:0.0|0.0672:0.0:0.9328:0.0	.|.	.|959	.|O00203	.|AP3B1_HUMAN	M|N	59|959;910	.|ENSP00000255194:T959N;ENSP00000430597:T910N	.|ENSP00000255194:T959N	L|T	-|-	1|2	2|0	AP3B1|AP3B1	77365959|77365959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.481000|4.481000	0.60250|0.60250	1.576000|1.576000	0.49790|0.49790	0.650000|0.650000	0.86243|0.86243	CTG|ACT	AP3B1	-	pirsf_AP3_beta		0.348	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	G			77330203	-1	no_errors	ENST00000255194	ensembl	human	known	70_37	missense	SNP	1.000	T
ARF4	378	genome.wustl.edu	37	3	57557237	57557238	+	3'UTR	INS	-	-	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:57557237_57557238insA	ENST00000303436.6	-	0	1511_1512				ARF4_ENST00000496292.1_3'UTR|ARF4_ENST00000489843.1_3'UTR	NM_001660.3	NP_001651.1	P18085	ARF4_HUMAN	ADP-ribosylation factor 4						activation of phospholipase D activity (GO:0031584)|brain development (GO:0007420)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein transport (GO:0015031)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to axon injury (GO:0048678)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	epidermal growth factor receptor binding (GO:0005154)|GTP binding (GO:0005525)			large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0449)|Kidney(284;0.0561)		ATATACTGAGCAAAAAATCAGG	0.302																																																	0																																										SO:0001624	3_prime_UTR_variant	378			M36341	CCDS2884.1	3p21.2-p21.1	2007-03-19			ENSG00000168374	ENSG00000168374		"""ADP-ribosylation factors"""	655	protein-coding gene	gene with protein product		601177	"""ADP-ribosylation factor 2"""	ARF2		2107548	Standard	NM_001660		Approved		uc003dix.4	P18085	OTTHUMG00000158601	ENST00000303436.6:c.*702->T	3.37:g.57557243_57557243dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7J7|P21371	RNA	INS	-	NULL	ENST00000303436.6	37	NULL	CCDS2884.1	3																																																																																			ARF4	-	-		0.302	ARF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF4	HGNC	protein_coding	OTTHUMT00000351443.1	-	NM_001660		57557238	-1	no_errors	ENST00000489843	ensembl	human	known	70_37	rna	INS	1.000:1.000	A
ARMC4	55130	genome.wustl.edu	37	10	28250610	28250610	+	Missense_Mutation	SNP	C	C	A	rs147175768	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr10:28250610C>A	ENST00000305242.5	-	10	1365	c.1273G>T	c.(1273-1275)Gat>Tat	p.D425Y	ARMC4_ENST00000537576.1_Missense_Mutation_p.D117Y|ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000239715.3_Missense_Mutation_p.D282Y	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	425					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.D425Y(3)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GAGGAGCTATCGCTAACAGTT	0.413																																																	3	Substitution - Missense(3)	skin(2)|NS(1)											68.0	63.0	65.0					10																	28250610		2203	4295	6498	SO:0001583	missense	55130			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1273G>T	10.37:g.28250610C>A	ENSP00000306410:p.Asp425Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP/TIF31_domain,smart_Armadillo,pfscan_Armadillo	p.D425Y	ENST00000305242.5	37	c.1273	CCDS7157.1	10	90	0.04120879120879121	20	0.04065040650406504	16	0.04419889502762431	10	0.017482517482517484	44	0.05804749340369393	C	12.66	2.005911	0.35415	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000537573;ENST00000434029;ENST00000239715	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.4	5.4	0.78164	.	0.268930	0.40640	N	0.001048	T	0.02970	0.0088	L	0.50333	1.59	0.50813	D	0.999894	P	0.45569	0.861	B	0.37267	0.245	T	0.00956	-1.1501	10	0.72032	D	0.01	-9.8277	18.3066	0.90184	0.0:1.0:0.0:0.0	.	425	Q5T2S8	ARMC4_HUMAN	Y	117;425;117;319;282	ENSP00000443208:D117Y;ENSP00000306410:D425Y;ENSP00000398155:D319Y;ENSP00000239715:D282Y	ENSP00000239715:D282Y	D	-	1	0	ARMC4	28290616	1.000000	0.71417	0.912000	0.35992	0.024000	0.10985	5.087000	0.64480	2.677000	0.91161	0.650000	0.86243	GAT	ARMC4	-	NULL		0.413	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	C	NM_018076		28250610	-1	no_errors	ENST00000305242	ensembl	human	known	70_37	missense	SNP	1.000	A
ARNT	405	genome.wustl.edu	37	1	150785761	150785761	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:150785761C>T	ENST00000358595.5	-	21	2367	c.2167G>A	c.(2167-2169)Gtg>Atg	p.V723M	ARNT_ENST00000515192.1_Missense_Mutation_p.V709M|ARNT_ENST00000354396.2_Missense_Mutation_p.V721M|ARNT_ENST00000505755.1_Missense_Mutation_p.V708M|RNU6-1309P_ENST00000363305.1_RNA	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	723	Gln-rich.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGACACCCACACCCTCTGCT	0.522			T	ETV6	AML						OREG0013788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	0													95.0	93.0	94.0					1																	150785761		2203	4300	6503	SO:0001583	missense	405			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.2167G>A	1.37:g.150785761C>T	ENSP00000351407:p.Val723Met	Somatic	1735	WXS	Illumina HiSeq	Phase_IV	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.V723M	ENST00000358595.5	37	c.2167	CCDS970.1	1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839454	0.91117	.	.	ENSG00000143437	ENST00000358595;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.85	5.85	0.93711	.	0.411581	0.25299	N	0.031668	T	0.65801	0.2726	M	0.71581	2.175	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.968;0.998;0.998;0.997;0.996	T	0.66296	-0.5959	10	0.66056	D	0.02	.	20.1663	0.98152	0.0:1.0:0.0:0.0	.	707;721;709;708;723	A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;ARNT_HUMAN	M	723;721;709;674;708	ENSP00000351407:V723M;ENSP00000346372:V721M;ENSP00000423851:V709M;ENSP00000427571:V708M	ENSP00000346372:V721M	V	-	1	0	ARNT	149052385	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.897000	0.69831	2.773000	0.95371	0.585000	0.79938	GTG	ARNT	-	NULL		0.522	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARNT	HGNC	protein_coding	OTTHUMT00000084741.2	C			150785761	-1	no_errors	ENST00000358595	ensembl	human	known	70_37	missense	SNP	1.000	T
ASTN2	23245	genome.wustl.edu	37	9	119495716	119495716	+	Missense_Mutation	SNP	A	A	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr9:119495716A>T	ENST00000313400.4	-	14	2583	c.2483T>A	c.(2482-2484)gTc>gAc	p.V828D	ASTN2_ENST00000361209.2_Missense_Mutation_p.V777D|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.V824D			O75129	ASTN2_HUMAN	astrotactin 2	828					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CTCGGAGAGGACCCCCCGGCA	0.612																																																	0													92.0	99.0	96.0					9																	119495716		2203	4300	6503	SO:0001583	missense	23245			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.2483T>A	9.37:g.119495716A>T	ENSP00000314038:p.Val828Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.V828D	ENST00000313400.4	37	c.2483		9	.	.	.	.	.	.	.	.	.	.	A	12.59	1.983026	0.34942	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	N	0.14661	0.345	0.80722	D	1	P;D;P	0.71674	0.885;0.998;0.745	B;D;P	0.63381	0.31;0.914;0.458	T	0.35599	-0.9782	9	.	.	.	-25.8396	14.3504	0.66697	1.0:0.0:0.0:0.0	.	777;828;824	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	D	828;824;551;777	ENSP00000314038:V828D;ENSP00000363108:V824D;ENSP00000363098:V551D;ENSP00000354504:V777D	.	V	-	2	0	ASTN2	118535537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.236000	0.78154	1.797000	0.52628	0.459000	0.35465	GTC	ASTN2	-	NULL		0.612	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		A	NM_014010		119495716	-1	no_errors	ENST00000313400	ensembl	human	known	70_37	missense	SNP	1.000	T
ATP11B	23200	genome.wustl.edu	37	3	182566281	182566281	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:182566281G>T	ENST00000323116.5	+	10	1047	c.787G>T	c.(787-789)Gga>Tga	p.G263*	ATP11B_ENST00000482794.1_3'UTR	NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	263					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			GGTATACACTGGAATGGAAAC	0.294																																																	0													59.0	61.0	60.0					3																	182566281		2203	4297	6500	SO:0001587	stop_gained	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.787G>T	3.37:g.182566281G>T	ENSP00000321195:p.Gly263*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96FN1|Q9UKK7	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.G263*	ENST00000323116.5	37	c.787	CCDS33896.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.619308	0.97709	.	.	ENSG00000058063	ENST00000323116	.	.	.	5.4	5.4	0.78164	.	0.055536	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2267	0.93820	0.0:0.0:1.0:0.0	.	.	.	.	X	263	.	ENSP00000321195:G263X	G	+	1	0	ATP11B	184048975	1.000000	0.71417	0.999000	0.59377	0.807000	0.45602	9.309000	0.96252	2.563000	0.86464	0.551000	0.68910	GGA	ATP11B	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl		0.294	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	HGNC	protein_coding	OTTHUMT00000350598.1	G	NM_014616		182566281	+1	no_errors	ENST00000323116	ensembl	human	known	70_37	nonsense	SNP	1.000	T
C17orf58	284018	genome.wustl.edu	37	17	65989227	65989227	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:65989227G>A	ENST00000449250.2	-	2	225	c.36C>T	c.(34-36)ttC>ttT	p.F12F	RP11-855A2.5_ENST00000580729.1_lincRNA|C17orf58_ENST00000334461.7_Silent_p.F12F|C17orf58_ENST00000536693.1_Silent_p.F12F			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58	12										lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGACTCGGAAGAAGAAGCCGT	0.577																																																	0													62.0	65.0	64.0					17																	65989227		1939	4127	6066	SO:0001819	synonymous_variant	284018			AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.36C>T	17.37:g.65989227G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MQV2	Silent	SNP	superfamily_TIMP-like_OB-fold	p.F12	ENST00000449250.2	37	c.36	CCDS45765.1	17																																																																																			C17orf58	-	superfamily_TIMP-like_OB-fold		0.577	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf58	HGNC	protein_coding	OTTHUMT00000448104.1	G	NM_181656		65989227	-1	no_errors	ENST00000449250	ensembl	human	known	70_37	silent	SNP	1.000	A
CALB1	793	genome.wustl.edu	37	8	91094283	91094283	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr8:91094283G>A	ENST00000265431.3	-	2	308	c.127C>T	c.(127-129)Ctc>Ttc	p.L43F	CALB1_ENST00000518457.1_5'Flank	NM_004929.2	NP_004920.1	P05937	CALB1_HUMAN	calbindin 1, 28kDa	43	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to organic substance (GO:0071310)|cytosolic calcium ion homeostasis (GO:0051480)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|metanephric collecting duct development (GO:0072205)|metanephric connecting tubule development (GO:0072286)|metanephric distal convoluted tubule development (GO:0072221)|metanephric part of ureteric bud development (GO:0035502)|regulation of synaptic plasticity (GO:0048167)|retina layer formation (GO:0010842)|short-term memory (GO:0007614)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(8)|pancreas(1)	11			BRCA - Breast invasive adenocarcinoma(11;0.00953)			GCCTGCTGGAGCTCCTGGATC	0.438																																					Melanoma(46;573 1182 27367 39727 48386)												0													115.0	121.0	119.0					8																	91094283		2203	4300	6503	SO:0001583	missense	793				CCDS6251.1	8q21.3	2013-01-10	2002-08-29		ENSG00000104327	ENSG00000104327		"""EF-hand domain containing"""	1434	protein-coding gene	gene with protein product		114050		CALB			Standard	NM_004929		Approved		uc003yel.1	P05937	OTTHUMG00000134314	ENST00000265431.3:c.127C>T	8.37:g.91094283G>A	ENSP00000265431:p.Leu43Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R696|B7Z9J4	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.L43F	ENST00000265431.3	37	c.127	CCDS6251.1	8	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637742	0.67130	.	.	ENSG00000104327	ENST00000265431	T	0.70749	-0.51	5.48	5.48	0.80851	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.69142	0.3078	M	0.75447	2.3	0.80722	D	1	B	0.14012	0.009	B	0.21151	0.033	T	0.65606	-0.6127	10	0.40728	T	0.16	-8.7259	10.7094	0.45973	0.0876:0.0:0.9124:0.0	.	43	P05937	CALB1_HUMAN	F	43	ENSP00000265431:L43F	ENSP00000265431:L43F	L	-	1	0	CALB1	91163459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.650000	0.54424	2.744000	0.94065	0.563000	0.77884	CTC	CALB1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.438	CALB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB1	HGNC	protein_coding	OTTHUMT00000259338.2	G	NM_004929		91094283	-1	no_errors	ENST00000265431	ensembl	human	known	70_37	missense	SNP	1.000	A
CAPN12	147968	genome.wustl.edu	37	19	39224992	39224992	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr19:39224992G>A	ENST00000328867.4	-	16	2090	c.1782C>T	c.(1780-1782)ctC>ctT	p.L594L	CAPN12_ENST00000601953.1_Silent_p.L445L	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	594	Domain IV.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CACAGGTCCTGAGCCCGATCT	0.607																																																	0													66.0	63.0	64.0					19																	39224992		2201	4296	6497	SO:0001819	synonymous_variant	147968			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1782C>T	19.37:g.39224992G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L594	ENST00000328867.4	37	c.1782	CCDS12519.1	19																																																																																			CAPN12	-	NULL		0.607	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	HGNC	protein_coding	OTTHUMT00000462151.1	G			39224992	-1	no_errors	ENST00000328867	ensembl	human	known	70_37	silent	SNP	1.000	A
CD47	961	genome.wustl.edu	37	3	107764455	107764455	+	IGR	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:107764455G>A	ENST00000361309.5	-	0	1285				CD47_ENST00000355354.7_3'UTR|CD47_ENST00000471694.1_5'UTR	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			AGTTTTCTGAGAGGCCTCAGC	0.353																																																	0																																										SO:0001628	intergenic_variant	961				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216		3.37:g.107764455G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K198|D3DN59|Q53Y71|Q96A60	RNA	SNP	-	NULL	ENST00000361309.5	37	NULL	CCDS43126.1	3																																																																																			CD47	-	-		0.353	CD47-004	KNOWN	basic|CCDS	protein_coding	CD47	HGNC	protein_coding	OTTHUMT00000102793.1	G	NM_001777		107764455	-1	no_errors	ENST00000471694	ensembl	human	known	70_37	rna	SNP	1.000	A
CEP19	84984	genome.wustl.edu	37	3	196434423	196434423	+	Silent	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:196434423C>T	ENST00000399942.4	-	2	680	c.386G>A	c.(385-387)tGa>tAa	p.*129*	CEP19_ENST00000409690.3_Silent_p.*168*|RNU6-646P_ENST00000364571.1_RNA			Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	0						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						TGTTTGGTATCAGAACTCATC	0.408																																																	0													84.0	81.0	82.0					3																	196434423		1934	4158	6092	SO:0001819	synonymous_variant	84984			BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000399942.4:c.386G>A	3.37:g.196434423C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA74|Q96I48	Silent	SNP	NULL	p.*168	ENST00000399942.4	37	c.503		3																																																																																			CEP19	-	NULL		0.408	CEP19-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CEP19	HGNC	protein_coding	OTTHUMT00000333081.1	C	NM_032898		196434423	-1	no_errors	ENST00000409690	ensembl	human	known	70_37	silent	SNP	1.000	T
CHD5	26038	genome.wustl.edu	37	1	6228322	6228323	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:6228322_6228323insCA	ENST00000262450.3	-	2	193_194	c.94_95insTG	c.(94-96)ggtfs	p.G32fs	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGCTTCAAGACCACCATCTTCT	0.52																																																	0																																										SO:0001589	frameshift_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.93_94dupTG	1.37:g.6228323_6228324dupCA	ENSP00000262450:p.Gly32fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Frame_Shift_Ins	INS	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G32fs	ENST00000262450.3	37	c.95_94	CCDS57.1	1																																																																																			CHD5	-	NULL		0.520	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	NM_015557		6228323	-1	no_errors	ENST00000262450	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	CA
CPSF4	10898	genome.wustl.edu	37	7	99036745	99036745	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr7:99036745G>A	ENST00000292476.5	+	1	50	c.40G>A	c.(40-42)Gac>Aac	p.D14N	PTCD1_ENST00000292478.4_5'Flank|CPSF4_ENST00000441580.1_5'Flank|ATP5J2-PTCD1_ENST00000413834.1_Intron|CPSF4_ENST00000451876.1_Missense_Mutation_p.D14N|PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000436336.2_Missense_Mutation_p.D14N|ATP5J2-PTCD1_ENST00000437572.1_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	14					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CATCAAGTTTGACTTGGAGAT	0.706																																																	0													21.0	26.0	25.0					7																	99036745		2202	4298	6500	SO:0001583	missense	10898				CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.40G>A	7.37:g.99036745G>A	ENSP00000292476:p.Asp14Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCCH,smart_Znf_CCHC,pfscan_Znf_CCHC	p.D14N	ENST00000292476.5	37	c.40	CCDS5664.1	7	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378293	0.61735	.	.	ENSG00000160917	ENST00000436336;ENST00000451876;ENST00000292476	T;T;T	0.25912	1.77;1.87;1.81	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.28067	0.0692	L	0.53249	1.67	0.80722	D	1	B;B;B	0.27316	0.011;0.175;0.02	B;B;B	0.27170	0.029;0.077;0.029	T	0.13602	-1.0503	10	0.48119	T	0.1	-10.4915	16.4633	0.84071	0.0:0.0:1.0:0.0	.	14;14;14	O95639-3;O95639;O95639-2	.;CPSF4_HUMAN;.	N	14	ENSP00000395311:D14N;ENSP00000396060:D14N;ENSP00000292476:D14N	ENSP00000292476:D14N	D	+	1	0	CPSF4	98874681	1.000000	0.71417	1.000000	0.80357	0.270000	0.26580	7.037000	0.76531	2.097000	0.63578	0.637000	0.83480	GAC	CPSF4	-	NULL		0.706	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPSF4	HGNC	protein_coding	OTTHUMT00000336254.1	G			99036745	+1	no_errors	ENST00000292476	ensembl	human	known	70_37	missense	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16945227	16945227	+	lincRNA	SNP	G	G	T	rs9728628	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:16945227G>T	ENST00000412962.1	-	0	2292				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CATTCTTACAGGCATTACCTT	0.373																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945227G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.373	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	G	NR_026752.1		16945227	-1	no_errors	ENST00000412962	ensembl	human	known	70_37	rna	SNP	0.004	T
CROCC	9696	genome.wustl.edu	37	1	17277294	17277294	+	Intron	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:17277294G>A	ENST00000375541.5	+	20	2905				CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ctgaggcccagagagggcaag	0.547																																																	0																																										SO:0001627	intron_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2837-154G>A	1.37:g.17277294G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000375541.5	37	NULL	CCDS30616.1	1																																																																																			CROCC	-	-		0.547	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	G	NM_014675		17277294	+1	no_errors	ENST00000488646	ensembl	human	known	70_37	rna	SNP	0.839	A
CYP4F29P	54055	genome.wustl.edu	37	21	15219144	15219145	+	RNA	INS	-	-	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr21:15219144_15219145insT	ENST00000428301.1	-	0	400_401					NR_026755.1|NR_047508.1				cytochrome P450, family 4, subfamily F, polypeptide 29, pseudogene																		ATCACTCCTGGGTGTCTTCTGA	0.554																																																	0																																												54055					21q11	2011-07-29	2011-07-29	2011-07-29	ENSG00000228314	ENSG00000228314		"""Cytochrome P450s"""	2647	pseudogene	pseudogene			"""cytochrome P450, subfamily IVF, polypeptide 3-like pseudogene"", ""chromosome 21 open reading frame 15"", ""cytochrome P450, family 4, subfamily F, polypeptide 3-like pseudogene"""	C21orf15, CYP4F3LP			Standard	NR_026755		Approved	CYP4F-se4[6:7:8]			OTTHUMG00000074229		21.37:g.15219144_15219145insT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000428301.1	37	NULL		21																																																																																			CYP4F29P	-	-		0.554	CYP4F29P-003	KNOWN	basic	processed_transcript	CYP4F29P	HGNC	pseudogene	OTTHUMT00000157746.1	-	NG_000927		15219145	-1	no_errors	ENST00000428301	ensembl	human	known	70_37	rna	INS	0.322:0.327	T
DNAI2	64446	genome.wustl.edu	37	17	72308204	72308204	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:72308204G>A	ENST00000311014.6	+	12	1624	c.1557G>A	c.(1555-1557)ctG>ctA	p.L519L	DNAI2_ENST00000446837.2_Silent_p.L519L|RP11-647F2.2_ENST00000585167.1_RNA|DNAI2_ENST00000582036.1_Silent_p.L507L|DNAI2_ENST00000307504.5_Silent_p.L376L|DNAI2_ENST00000579490.1_Silent_p.L576L			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	519					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGATGCGGCTGAAGGAGAAGG	0.647									Kartagener syndrome																																								0													61.0	53.0	56.0					17																	72308204		2203	4300	6503	SO:0001819	synonymous_variant	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1557G>A	17.37:g.72308204G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.L519	ENST00000311014.6	37	c.1557	CCDS11697.1	17																																																																																			DNAI2	-	NULL		0.647	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	G	NM_023036		72308204	+1	no_errors	ENST00000311014	ensembl	human	known	70_37	silent	SNP	1.000	A
DOLK	22845	genome.wustl.edu	37	9	131708526	131708526	+	Missense_Mutation	SNP	T	T	C			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr9:131708526T>C	ENST00000372586.3	-	1	1372	c.1057A>G	c.(1057-1059)Atc>Gtc	p.I353V	NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	353					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						CGGTCAAAGATGATACCTGGG	0.552																																																	0													125.0	139.0	134.0					9																	131708526		2203	4300	6503	SO:0001583	missense	22845			AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1057A>G	9.37:g.131708526T>C	ENSP00000361667:p.Ile353Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SRE6	Missense_Mutation	SNP	NULL	p.I353V	ENST00000372586.3	37	c.1057	CCDS6915.1	9	.	.	.	.	.	.	.	.	.	.	T	8.590	0.884301	0.17467	.	.	ENSG00000175283	ENST00000372586	T	0.50277	0.75	5.23	0.295	0.15752	.	0.210138	0.35349	N	0.003262	T	0.30510	0.0767	L	0.38953	1.18	0.36277	D	0.85552	B	0.06786	0.001	B	0.09377	0.004	T	0.08534	-1.0717	10	0.35671	T	0.21	-7.7623	5.2547	0.15540	0.0:0.3162:0.1462:0.5376	.	353	Q9UPQ8	DOLK_HUMAN	V	353	ENSP00000361667:I353V	ENSP00000361667:I353V	I	-	1	0	DOLK	130748347	0.533000	0.26354	0.996000	0.52242	0.995000	0.86356	0.329000	0.19698	0.019000	0.15079	0.379000	0.24179	ATC	DOLK	-	NULL		0.552	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOLK	HGNC	protein_coding	OTTHUMT00000054515.1	T	NM_014908		131708526	-1	no_errors	ENST00000372586	ensembl	human	known	70_37	missense	SNP	0.938	C
EHBP1L1	254102	genome.wustl.edu	37	11	65349326	65349326	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:65349326G>A	ENST00000309295.4	+	9	1448	c.1183G>A	c.(1183-1185)Gag>Aag	p.E395K		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	395						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGTGGACACTGAGCCAAGGTC	0.542																																																	0													75.0	88.0	84.0					11																	65349326		2142	4242	6384	SO:0001583	missense	254102			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1183G>A	11.37:g.65349326G>A	ENSP00000312671:p.Glu395Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E395K	ENST00000309295.4	37	c.1183	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855305	0.51376	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.81078	-0.13;-1.45	4.17	3.23	0.37069	.	0.710683	0.11610	N	0.546882	T	0.70124	0.3188	L	0.29908	0.895	0.80722	D	1	B;P	0.37466	0.281;0.596	B;B	0.35470	0.075;0.203	T	0.65533	-0.6145	10	0.48119	T	0.1	.	10.8082	0.46531	0.0:0.0:0.809:0.191	.	395;395	E9PIH6;Q8N3D4	.;EH1L1_HUMAN	K	395	ENSP00000312671:E395K;ENSP00000431996:E395K	ENSP00000312671:E395K	E	+	1	0	EHBP1L1	65105902	0.353000	0.24904	0.005000	0.12908	0.106000	0.19336	1.826000	0.39092	0.930000	0.37217	0.561000	0.74099	GAG	EHBP1L1	-	NULL		0.542	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1	G	XM_170658		65349326	+1	no_errors	ENST00000309295	ensembl	human	known	70_37	missense	SNP	0.219	A
EHD1	10938	genome.wustl.edu	37	11	64627702	64627702	+	Silent	SNP	C	C	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:64627702C>G	ENST00000320631.3	-	3	863	c.609G>C	c.(607-609)gtG>gtC	p.V203V	EHD1_ENST00000359393.2_Silent_p.V203V	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	203	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						GAGCCTTGATCACTTCCGAGA	0.587																																																	0													85.0	78.0	80.0					11																	64627702		2201	4297	6498	SO:0001819	synonymous_variant	10938			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.609G>C	11.37:g.64627702C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O14611|Q2M3Q4|Q9UNR3	Silent	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.V203	ENST00000320631.3	37	c.609	CCDS8084.1	11																																																																																			EHD1	-	pfam_Dynamin_GTPase		0.587	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	C	NM_006795		64627702	-1	no_errors	ENST00000320631	ensembl	human	known	70_37	silent	SNP	1.000	G
EHBP1L1	254102	genome.wustl.edu	37	11	65349660	65349660	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:65349660G>C	ENST00000309295.4	+	9	1782	c.1517G>C	c.(1516-1518)aGa>aCa	p.R506T		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	506						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGCCAGGAGAGAGAGGGTGCA	0.667																																																	0													18.0	21.0	20.0					11																	65349660		1958	4139	6097	SO:0001583	missense	254102			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1517G>C	11.37:g.65349660G>C	ENSP00000312671:p.Arg506Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R506T	ENST00000309295.4	37	c.1517	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268062	0.23136	.	.	ENSG00000173442	ENST00000309295	T	0.69561	-0.41	5.31	0.235	0.15431	.	0.268702	0.27064	N	0.021113	T	0.46249	0.1383	L	0.32530	0.975	0.25247	N	0.989701	B	0.12013	0.005	B	0.08055	0.003	T	0.37244	-0.9714	10	0.72032	D	0.01	.	1.8297	0.03127	0.2128:0.2638:0.3892:0.1343	.	506	Q8N3D4	EH1L1_HUMAN	T	506	ENSP00000312671:R506T	ENSP00000312671:R506T	R	+	2	0	EHBP1L1	65106236	0.071000	0.21146	0.582000	0.28627	0.706000	0.40770	0.185000	0.16958	0.362000	0.24319	0.561000	0.74099	AGA	EHBP1L1	-	NULL		0.667	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1	G	XM_170658		65349660	+1	no_errors	ENST00000309295	ensembl	human	known	70_37	missense	SNP	0.006	C
Unknown	0	genome.wustl.edu	37	5	68930125	68930125	+	IGR	SNP	T	T	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:68930125T>A								RP11-848G14.2 (10249 upstream) : GUSBP3 (5160 downstream)																							AGGCCCCACATCAACAGTGCA	0.622																																																	0																																										SO:0001628	intergenic_variant	0																															5.37:g.68930125T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.M164L		37	c.490		5																																																																																			AC139495.1	-	NULL	0	0.622					ENSG00000269208	Clone_based_ensembl_gene			T			68930125	-1	no_errors	ENST00000596065	ensembl	human	novel	70_37	missense	SNP	0.038	A
ENTPD4	9583	genome.wustl.edu	37	8	23292045	23292046	+	Intron	DEL	CA	CA	-	rs139348326		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr8:23292045_23292046delCA	ENST00000358689.4	-	12	1696				ENTPD4_ENST00000417069.2_Intron|ENTPD4_ENST00000521321.1_Intron|ENTPD4_ENST00000356206.6_Intron	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4						UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GTCAAGATGGcacacacacaca	0.545																																																	0																																										SO:0001627	intron_variant	9583			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1461-54TG>-	8.37:g.23292055_23292056delCA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSS3|O15092	RNA	DEL	-	NULL	ENST00000358689.4	37	NULL	CCDS6041.1	8																																																																																			ENTPD4	-	-		0.545	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	CA	NM_004901		23292046	-1	no_errors	ENST00000522913	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
EXTL1	2134	genome.wustl.edu	37	1	26355692	26355692	+	Missense_Mutation	SNP	G	G	T	rs140176340		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:26355692G>T	ENST00000374280.3	+	2	1655	c.788G>T	c.(787-789)cGc>cTc	p.R263L	EXTL1_ENST00000484339.1_3'UTR	NM_004455.2	NP_004446.2	Q92935	EXTL1_HUMAN	exostosin-like glycosyltransferase 1	263					protein glycosylation (GO:0006486)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|stomach(1)|urinary_tract(1)	23		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		AGGACCCAGCGCCAGGAGACG	0.637																																																	0													74.0	72.0	72.0					1																	26355692		2203	4300	6503	SO:0001583	missense	2134			U67191	CCDS271.1	1p36.1	2013-03-01	2013-03-01		ENSG00000158008	ENSG00000158008	2.4.1.224	"""Exostosin glycosyltransferase family"""	3515	protein-coding gene	gene with protein product	"""glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""alpha-N-acetylglucosaminyltransferase II"", ""glucuronyl-N-acetylglucosaminylproteoglycan alpha-1,4-N- acetylglucosaminyltransferase"", ""exostosin-L"""	601738	"""exostoses (multiple)-like 1"""			9037597	Standard	NM_004455		Approved	EXTL, MGC70794	uc001blf.3	Q92935	OTTHUMG00000007509	ENST00000374280.3:c.788G>T	1.37:g.26355692G>T	ENSP00000363398:p.Arg263Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GSC1	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.R263L	ENST00000374280.3	37	c.788	CCDS271.1	1	.	.	.	.	.	.	.	.	.	.	G	2.946	-0.217728	0.06101	.	.	ENSG00000158008	ENST00000374280	D	0.97505	-4.41	3.59	-0.874	0.10631	.	1.254510	0.05024	N	0.473444	D	0.89382	0.6699	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.81850	-0.0743	10	0.27082	T	0.32	-2.1791	1.6375	0.02745	0.3501:0.3468:0.1897:0.1134	.	263	Q92935	EXTL1_HUMAN	L	263	ENSP00000363398:R263L	ENSP00000363398:R263L	R	+	2	0	EXTL1	26228279	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.430000	0.21428	0.031000	0.15407	-1.195000	0.01675	CGC	EXTL1	-	pfam_Exostosin		0.637	EXTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL1	HGNC	protein_coding	OTTHUMT00000019749.1	G	NM_004455		26355692	+1	no_errors	ENST00000374280	ensembl	human	known	70_37	missense	SNP	0.043	T
FAT4	79633	genome.wustl.edu	37	4	126369744	126369744	+	Missense_Mutation	SNP	G	G	A	rs201007539		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr4:126369744G>A	ENST00000394329.3	+	9	7586	c.7573G>A	c.(7573-7575)Gcc>Acc	p.A2525T	FAT4_ENST00000335110.5_Missense_Mutation_p.A823T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2525	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CATTATGGCCGCCGGACCACT	0.418																																																	0													65.0	67.0	66.0					4																	126369744		2203	4299	6502	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7573G>A	4.37:g.126369744G>A	ENSP00000377862:p.Ala2525Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.A2525T	ENST00000394329.3	37	c.7573	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	14.78	2.639072	0.47153	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.48522	0.81;0.81	5.72	4.89	0.63831	Cadherin (4);Cadherin-like (1);	0.000000	0.34110	U	0.004241	T	0.40694	0.1127	L	0.37561	1.115	0.43338	D	0.995382	D;B;B	0.55605	0.972;0.004;0.003	P;B;B	0.45099	0.469;0.004;0.002	T	0.15521	-1.0434	10	0.15066	T	0.55	.	14.9437	0.71014	0.0685:0.0:0.9315:0.0	.	823;2525;2525	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	2525;823	ENSP00000377862:A2525T;ENSP00000335169:A823T	ENSP00000335169:A823T	A	+	1	0	FAT4	126589194	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.440000	0.52886	1.441000	0.47550	-0.143000	0.13931	GCC	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.418	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	G	NM_024582		126369744	+1	no_errors	ENST00000394329	ensembl	human	known	70_37	missense	SNP	1.000	A
FEM1B	10116	genome.wustl.edu	37	15	68582295	68582295	+	Missense_Mutation	SNP	T	T	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr15:68582295T>G	ENST00000306917.4	+	2	1214	c.599T>G	c.(598-600)aTa>aGa	p.I200R		NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	200					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						GCTGGGCACATAGATATTGTG	0.463																																																	0													79.0	72.0	74.0					15																	68582295		2200	4298	6498	SO:0001583	missense	10116				CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.599T>G	15.37:g.68582295T>G	ENSP00000307298:p.Ile200Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	O43146	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I200R	ENST00000306917.4	37	c.599	CCDS10228.1	15	.	.	.	.	.	.	.	.	.	.	T	14.45	2.540148	0.45176	.	.	ENSG00000169018	ENST00000306917	T	0.65178	-0.14	5.77	5.77	0.91146	Ankyrin repeat-containing domain (3);	0.196120	0.46442	D	0.000300	T	0.53769	0.1817	L	0.33624	1.015	0.80722	D	1	B	0.16166	0.016	B	0.13407	0.009	T	0.52245	-0.8601	10	0.72032	D	0.01	-15.5555	15.2704	0.73696	0.0:0.0:0.0:1.0	.	200	Q9UK73	FEM1B_HUMAN	R	200	ENSP00000307298:I200R	ENSP00000307298:I200R	I	+	2	0	FEM1B	66369349	0.976000	0.34144	1.000000	0.80357	0.998000	0.95712	6.073000	0.71245	2.194000	0.70268	0.454000	0.30748	ATA	FEM1B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt		0.463	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1B	HGNC	protein_coding	OTTHUMT00000257065.1	T			68582295	+1	no_errors	ENST00000306917	ensembl	human	known	70_37	missense	SNP	1.000	G
FEZF2	55079	genome.wustl.edu	37	3	62357289	62357289	+	Silent	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:62357289G>T	ENST00000283268.3	-	3	1200	c.906C>A	c.(904-906)gcC>gcA	p.A302A	PTPRG-AS1_ENST00000490916.1_RNA|FEZF2_ENST00000486811.1_Silent_p.A302A|FEZF2_ENST00000475839.1_Silent_p.A302A|PTPRG-AS1_ENST00000495542.1_RNA	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	302					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		CGAACGGTCTGGCTCCGGTGT	0.602																																					NSCLC(170;1772 2053 12525 15604 23984)												0													68.0	68.0	68.0					3																	62357289		2203	4300	6503	SO:0001819	synonymous_variant	55079			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.906C>A	3.37:g.62357289G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K349|Q9BZ91|Q9NWB9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A302	ENST00000283268.3	37	c.906	CCDS2897.1	3																																																																																			FEZF2	-	pfscan_Znf_C2H2		0.602	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	HGNC	protein_coding	OTTHUMT00000351813.1	G	NM_018008		62357289	-1	no_errors	ENST00000283268	ensembl	human	known	70_37	silent	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	GGC	-	rs71929261|rs140531536	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:240255569_240255571delGGC	ENST00000319653.9	+	1	390_392	c.160_162delGGC	c.(160-162)ggcdel	p.G59del		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	59					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.665														3539	0.706669	0.7821	0.7507	5008	,	,		10143	0.4514		0.7893	False		,,,				2504	0.7515																1	Deletion - In frame(1)	prostate(1)																																								SO:0001651	inframe_deletion	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.160_162delGGC	1.37:g.240255578_240255580delGGC	ENSP00000318884:p.Gly59del	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	In_Frame_Del	DEL	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.G57in_frame_del	ENST00000319653.9	37	c.160_162	CCDS31069.2	1																																																																																			FMN2	-	NULL		0.665	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	GGC	XM_371352		240255571	+1	no_errors	ENST00000319653	ensembl	human	known	70_37	in_frame_del	DEL	0.957:0.122:0.017	-
GAB3	139716	genome.wustl.edu	37	X	153944425	153944425	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chrX:153944425G>A	ENST00000369575.3	-	2	283	c.252C>T	c.(250-252)ttC>ttT	p.F84F	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Silent_p.F84F	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	84	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAATGAACACGAAATTATTCT	0.512																																																	0													167.0	147.0	154.0					X																	153944425		2203	4300	6503	SO:0001819	synonymous_variant	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.252C>T	X.37:g.153944425G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHF8|E9PB44	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F84	ENST00000369575.3	37	c.252	CCDS14760.1	X																																																																																			GAB3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.512	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	G	NM_001081573		153944425	-1	no_errors	ENST00000424127	ensembl	human	known	70_37	silent	SNP	0.403	A
GDF6	392255	genome.wustl.edu	37	8	97156955	97156955	+	Missense_Mutation	SNP	T	T	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr8:97156955T>G	ENST00000287020.5	-	2	1303	c.1204A>C	c.(1204-1206)Atc>Ctc	p.I402L		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	402					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GTCTGGATGATGGCGTGGTTG	0.617																																																	0													113.0	105.0	108.0					8																	97156955		2203	4300	6503	SO:0001583	missense	392255				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1204A>C	8.37:g.97156955T>G	ENSP00000287020:p.Ile402Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PI58	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.I402L	ENST00000287020.5	37	c.1204	CCDS34926.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.7|26.7	4.763048|4.763048	0.89932|0.89932	.|.	.|.	ENSG00000156466|ENSG00000156466	ENST00000435084|ENST00000287020	.|D	.|0.84298	.|-1.83	4.82|4.82	4.82|4.82	0.62117|0.62117	.|Transforming growth factor-beta, C-terminal (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91277|0.91277	0.7250|0.7250	M|M	0.62266|0.62266	1.93|1.93	0.54753|0.54753	D|D	0.999985|0.999985	.|P	.|0.39071	.|0.658	.|D	.|0.66847	.|0.947	D|D	0.91922|0.91922	0.5548|0.5548	6|10	0.15499|0.87932	T|D	0.54|0	.|.	13.5269|13.5269	0.61601|0.61601	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|402	.|Q6KF10	.|GDF6_HUMAN	P|L	318|402	.|ENSP00000287020:I402L	ENSP00000412749:H318P|ENSP00000287020:I402L	H|I	-|-	2|1	0|0	GDF6|GDF6	97226131|97226131	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.970000|4.970000	0.63742|0.63742	2.023000|2.023000	0.59567|0.59567	0.455000|0.455000	0.32223|0.32223	CAT|ATC	GDF6	-	pfam_TGF-b_C,smart_TGF-b_C		0.617	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF6	HGNC	protein_coding	OTTHUMT00000379862.2	T	NM_001001557		97156955	-1	no_errors	ENST00000287020	ensembl	human	known	70_37	missense	SNP	1.000	G
GPR110	266977	genome.wustl.edu	37	6	46967927	46967927	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr6:46967927G>C	ENST00000371253.2	-	0	2980				GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AGTTGTTCTGGAAATTTTTTC	0.348																																																	0													66.0	65.0	65.0					6																	46967927		2203	4299	6502	SO:0001624	3_prime_UTR_variant	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.*32C>G	6.37:g.46967927G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	RNA	SNP	-	NULL	ENST00000371253.2	37	NULL	CCDS34471.1	6																																																																																			GPR110	-	-		0.348	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	G	NM_153840		46967927	-1	no_errors	ENST00000449332	ensembl	human	known	70_37	rna	SNP	0.000	C
GPR110	266977	genome.wustl.edu	37	6	46967979	46967979	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr6:46967979G>C	ENST00000371253.2	-	15	2928	c.2713C>G	c.(2713-2715)Cag>Gag	p.Q905E	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.Q708E	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	905					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						GAGACAAACTGAGTTAGCATG	0.323																																																	0													94.0	94.0	94.0					6																	46967979		2203	4300	6503	SO:0001583	missense	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2713C>G	6.37:g.46967979G>C	ENSP00000360299:p.Gln905Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.Q905E	ENST00000371253.2	37	c.2713	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	G	4.906	0.168400	0.09339	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.32753	1.45;1.44	5.67	2.76	0.32466	.	0.591478	0.15313	N	0.268976	T	0.10551	0.0258	L	0.50333	1.59	0.24419	N	0.994628	B	0.14438	0.01	B	0.10450	0.005	T	0.20405	-1.0276	10	0.39692	T	0.17	0.1103	5.9341	0.19154	0.0807:0.132:0.6517:0.1356	.	905	Q5T601	GP110_HUMAN	E	905;708	ENSP00000360299:Q905E;ENSP00000283297:Q708E	ENSP00000283297:Q708E	Q	-	1	0	GPR110	47075938	1.000000	0.71417	0.993000	0.49108	0.019000	0.09904	1.302000	0.33459	0.878000	0.35920	-0.797000	0.03246	CAG	GPR110	-	NULL		0.323	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	G	NM_153840		46967979	-1	no_errors	ENST00000371253	ensembl	human	known	70_37	missense	SNP	0.974	C
GPT2	84706	genome.wustl.edu	37	16	46943752	46943752	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr16:46943752G>T	ENST00000340124.4	+	6	845	c.733G>T	c.(733-735)Gtg>Ttg	p.V245L	GPT2_ENST00000440783.2_Missense_Mutation_p.V145L	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	245					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	GGCGCTGAATGTGAATGAGCT	0.557																																																	0													94.0	86.0	89.0					16																	46943752		2203	4300	6503	SO:0001583	missense	84706				CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.733G>T	16.37:g.46943752G>T	ENSP00000345282:p.Val245Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N9E2	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.V245L	ENST00000340124.4	37	c.733	CCDS10725.1	16	.	.	.	.	.	.	.	.	.	.	G	11.53	1.667531	0.29604	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	D;D	0.90133	-2.62;-2.62	5.15	5.15	0.70609	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.123586	0.53938	D	0.000047	D	0.83510	0.5270	N	0.17674	0.51	0.45883	D	0.998731	B	0.10296	0.003	B	0.15052	0.012	T	0.77968	-0.2388	10	0.10111	T	0.7	.	18.8172	0.92081	0.0:0.0:1.0:0.0	.	245	Q8TD30	ALAT2_HUMAN	L	245;145	ENSP00000345282:V245L;ENSP00000413804:V145L	ENSP00000345282:V245L	V	+	1	0	GPT2	45501253	1.000000	0.71417	0.927000	0.36925	0.276000	0.26787	4.087000	0.57671	2.677000	0.91161	0.561000	0.74099	GTG	GPT2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom		0.557	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT2	HGNC	protein_coding	OTTHUMT00000255741.2	G			46943752	+1	no_errors	ENST00000340124	ensembl	human	known	70_37	missense	SNP	0.905	T
GSG2	83903	genome.wustl.edu	37	17	3627380	3627380	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:3627380G>A	ENST00000325418.4	+	1	170	c.151G>A	c.(151-153)Gac>Aac	p.D51N	CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000571185.1_5'Flank|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	51					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										CGGCAGCAGCGACGCCAGCAT	0.746																																																	0													7.0	11.0	10.0					17																	3627380		2099	4147	6246	SO:0001583	missense	83903			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.151G>A	17.37:g.3627380G>A	ENSP00000325290:p.Asp51Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	pfam_DUF3635,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.D51N	ENST00000325418.4	37	c.151	CCDS11036.1	17	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230423	0.39399	.	.	ENSG00000177602	ENST00000325418	T	0.12569	2.67	3.72	2.65	0.31530	.	0.539990	0.14775	N	0.299167	T	0.09247	0.0228	N	0.24115	0.695	0.22541	N	0.999008	B	0.15473	0.013	B	0.06405	0.002	T	0.25293	-1.0136	10	0.87932	D	0	.	7.4718	0.27353	0.2686:0.0:0.7314:0.0	.	51	Q8TF76	HASP_HUMAN	N	51	ENSP00000325290:D51N	ENSP00000325290:D51N	D	+	1	0	GSG2	3574129	0.000000	0.05858	0.319000	0.25293	0.295000	0.27426	0.363000	0.20301	0.727000	0.32360	0.467000	0.42956	GAC	GSG2	-	NULL		0.746	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG2	HGNC	protein_coding	OTTHUMT00000207391.1	G	NM_031965		3627380	+1	no_errors	ENST00000325418	ensembl	human	known	70_37	missense	SNP	0.903	A
JMY	133746	genome.wustl.edu	37	5	78596013	78596013	+	Missense_Mutation	SNP	G	G	A	rs531886847		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:78596013G>A	ENST00000396137.4	+	5	2027	c.1565G>A	c.(1564-1566)cGa>cAa	p.R522Q		NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	522	Interaction with p300/EP300. {ECO:0000250}.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		GCGATAGCACGATTGGATCAG	0.373																																																	0													128.0	119.0	122.0					5																	78596013		1870	4115	5985	SO:0001583	missense	133746			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.1565G>A	5.37:g.78596013G>A	ENSP00000379441:p.Arg522Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	pfscan_WH2_dom	p.R522Q	ENST00000396137.4	37	c.1565	CCDS4047.3	5	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430258	0.25726	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.07567	3.18	5.19	-0.836	0.10770	.	0.620426	0.16191	N	0.225396	T	0.07052	0.0179	L	0.55481	1.735	0.09310	N	1	B	0.21381	0.055	B	0.13407	0.009	T	0.28004	-1.0057	10	0.38643	T	0.18	.	4.543	0.12067	0.4812:0.0:0.266:0.2528	.	522	Q8N9B5	JMY_HUMAN	Q	522	ENSP00000379441:R522Q	ENSP00000282259:R522Q	R	+	2	0	JMY	78631769	0.000000	0.05858	0.023000	0.16930	0.919000	0.55068	0.138000	0.16016	0.022000	0.15160	0.557000	0.71058	CGA	JMY	-	NULL		0.373	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMY	HGNC	protein_coding	OTTHUMT00000254070.4	G	NM_152405		78596013	+1	no_errors	ENST00000396137	ensembl	human	known	70_37	missense	SNP	0.002	A
KAZN	23254	genome.wustl.edu	37	1	14925500	14925500	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:14925500G>A	ENST00000376030.2	+	1	301	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	KAZN_ENST00000422387.2_Missense_Mutation_p.E3K|KAZN_ENST00000503743.1_Missense_Mutation_p.E3K	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	3					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GAGCATGATGGAAGACAATAA	0.657																																																	0													38.0	42.0	41.0					1																	14925500		1969	4149	6118	SO:0001583	missense	23254			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.7G>A	1.37:g.14925500G>A	ENSP00000365198:p.Glu3Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E3K	ENST00000376030.2	37	c.7	CCDS152.2	1	.	.	.	.	.	.	.	.	.	.	G	19.10	3.760925	0.69763	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387	T;T;T	0.49432	0.78;0.78;0.78	3.98	3.98	0.46160	.	0.000000	0.49916	U	0.000124	T	0.45875	0.1364	L	0.44542	1.39	0.80722	D	1	P;D	0.53151	0.557;0.958	B;P	0.46629	0.117;0.522	T	0.52480	-0.8570	10	0.72032	D	0.01	-6.6089	13.4971	0.61432	0.0:0.0:1.0:0.0	.	3;3	Q674X7-2;Q674X7	.;KAZRN_HUMAN	K	3	ENSP00000365198:E3K;ENSP00000426015:E3K;ENSP00000391728:E3K	ENSP00000365198:E3K	E	+	1	0	KAZN	14798087	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.124000	0.71620	1.739000	0.51704	0.313000	0.20887	GAA	KAZN	-	NULL		0.657	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2	G	NM_001017999		14925500	+1	no_errors	ENST00000376030	ensembl	human	known	70_37	missense	SNP	1.000	A
KDM4C	23081	genome.wustl.edu	37	9	6893237	6893237	+	Intron	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr9:6893237G>T	ENST00000381309.3	+	8	1486				KDM4C_ENST00000543771.1_Intron|KDM4C_ENST00000536108.1_Intron|KDM4C_ENST00000535193.1_Intron|KDM4C_ENST00000381306.3_Intron|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000442236.2_Intron	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C						histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AAATTGGTAAGCTATGCCTCA	0.368																																																	0													85.0	86.0	86.0					9																	6893237		2203	4300	6503	SO:0001627	intron_variant	23081			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.921+5G>T	9.37:g.6893237G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	RNA	SNP	-	NULL	ENST00000381309.3	37	NULL	CCDS6471.1	9																																																																																			KDM4C	-	-		0.368	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	G	NM_015061		6893237	+1	no_errors	ENST00000476075	ensembl	human	known	70_37	rna	SNP	1.000	T
KIF5B	3799	genome.wustl.edu	37	10	32311953	32311953	+	Silent	SNP	T	T	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr10:32311953T>A	ENST00000302418.4	-	16	2194	c.1737A>T	c.(1735-1737)ggA>ggT	p.G579G	KIF5B_ENST00000493889.1_5'Flank	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	579					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				TCATGCCAGTTCCCTCAGGCT	0.328			T	"""RET, ALK"""	NSCLC																																			Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													89.0	79.0	83.0					10																	32311953		2203	4300	6503	SO:0001819	synonymous_variant	3799			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.1737A>T	10.37:g.32311953T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVB2|Q5VZ85	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G579	ENST00000302418.4	37	c.1737	CCDS7171.1	10																																																																																			KIF5B	-	NULL		0.328	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	T	NM_004521		32311953	-1	no_errors	ENST00000302418	ensembl	human	known	70_37	silent	SNP	0.998	A
LRPPRC	10128	genome.wustl.edu	37	2	44175557	44175557	+	Silent	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr2:44175557C>T	ENST00000260665.7	-	17	1893	c.1836G>A	c.(1834-1836)gaG>gaA	p.E612E		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	612					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GTACCATCTTCTCCAGCTGAT	0.398																																																	0													122.0	107.0	112.0					2																	44175557		2203	4300	6503	SO:0001819	synonymous_variant	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1836G>A	2.37:g.44175557C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.E612	ENST00000260665.7	37	c.1836	CCDS33189.1	2																																																																																			LRPPRC	-	NULL		0.398	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	C	NM_133259		44175557	-1	no_errors	ENST00000260665	ensembl	human	known	70_37	silent	SNP	1.000	T
LRPPRC	10128	genome.wustl.edu	37	2	44175581	44175581	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr2:44175581C>G	ENST00000260665.7	-	17	1869	c.1812G>C	c.(1810-1812)ttG>ttC	p.L604F		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	604					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AGTATTGTCTCAAATGCTCCT	0.398																																																	0													128.0	113.0	118.0					2																	44175581		2203	4300	6503	SO:0001583	missense	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1812G>C	2.37:g.44175581C>G	ENSP00000260665:p.Leu604Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.L604F	ENST00000260665.7	37	c.1812	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926404	0.52759	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.73575	-0.76	5.72	4.85	0.62838	.	0.072259	0.56097	D	0.000023	D	0.85212	0.5645	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	0.984;1.0	P;D	0.72075	0.833;0.976	D	0.83983	0.0333	10	0.25106	T	0.35	-9.5307	16.6523	0.85219	0.131:0.869:0.0:0.0	.	504;604	F5H4J6;P42704	.;LPPRC_HUMAN	F	504;604	ENSP00000260665:L604F	ENSP00000260665:L604F	L	-	3	2	LRPPRC	44029085	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.342000	0.59341	1.574000	0.49760	-0.127000	0.14921	TTG	LRPPRC	-	NULL		0.398	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	C	NM_133259		44175581	-1	no_errors	ENST00000260665	ensembl	human	known	70_37	missense	SNP	1.000	G
MANEAL	149175	genome.wustl.edu	37	1	38265771	38265771	+	Missense_Mutation	SNP	C	C	T	rs200095743		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:38265771C>T	ENST00000373045.6	+	4	1651	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	RP11-109P14.9_ENST00000433474.1_RNA|MANEAL_ENST00000329006.5_Missense_Mutation_p.R202C|MANEAL_ENST00000397631.3_3'UTR|MANEAL_ENST00000525897.1_Missense_Mutation_p.R230C	NM_001113482.1	NP_001106954.1	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like	424						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|liver(1)|lung(1)|prostate(3)	7	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GACACCCACCCGCCTGTATTT	0.582																																																	0													56.0	62.0	60.0					1																	38265771		2202	4300	6502	SO:0001583	missense	149175			AK055996	CCDS426.1, CCDS44110.1, CCDS44111.1	1p34.3	2008-02-05			ENSG00000185090	ENSG00000185090			26452	protein-coding gene	gene with protein product							Standard	NM_152496		Approved	FLJ31434	uc001cby.2	Q5VSG8	OTTHUMG00000004317	ENST00000373045.6:c.1270C>T	1.37:g.38265771C>T	ENSP00000362136:p.Arg424Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6DD86|Q6P497|Q8N5P8|Q96G55|Q96N42	Missense_Mutation	SNP	NULL	p.R424C	ENST00000373045.6	37	c.1270	CCDS44110.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276407	0.80580	.	.	ENSG00000185090	ENST00000373045;ENST00000525897;ENST00000329006	.	.	.	5.62	5.62	0.85841	.	0.047495	0.85682	D	0.000000	T	0.67097	0.2857	L	0.37630	1.12	0.80722	D	1	D;D	0.76494	0.999;0.998	P;D	0.65987	0.827;0.94	T	0.64305	-0.6439	9	0.38643	T	0.18	-15.6995	18.2155	0.89884	0.0:1.0:0.0:0.0	.	202;424	Q5VSG8-2;Q5VSG8	.;MANEL_HUMAN	C	424;230;202	.	ENSP00000328770:R202C	R	+	1	0	MANEAL	38038358	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	5.379000	0.66196	2.662000	0.90505	0.655000	0.94253	CGC	MANEAL	-	NULL		0.582	MANEAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEAL	HGNC	protein_coding	OTTHUMT00000012469.2	C	NM_152496		38265771	+1	no_errors	ENST00000373045	ensembl	human	known	70_37	missense	SNP	1.000	T
MIR3142	100422938	genome.wustl.edu	37	5	159901450	159901450	+	RNA	SNP	C	C	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:159901450C>A	ENST00000582487.1	+	0	42					NR_036095.1				microRNA 3142																		GCTGCTGAATCTTCAGAAAGG	0.448																																																	0																																												100422938					5	2011-09-12				ENSG00000265237		"""ncRNAs / Micro RNAs"""	38297	non-coding RNA	RNA, micro							Standard	NR_036095		Approved	hsa-mir-3142	uc021yhd.1				5.37:g.159901450C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000582487.1	37	NULL		5																																																																																			MIR3142	-	-		0.448	MIR3142-201	KNOWN	basic	miRNA	MIR3142	HGNC	miRNA		C	NR_036095		159901450	+1	no_errors	ENST00000582487	ensembl	human	known	70_37	rna	SNP	0.566	A
KMT2D	8085	genome.wustl.edu	37	12	49447821	49447821	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr12:49447821G>T	ENST00000301067.7	-	5	612	c.613C>A	c.(613-615)Cta>Ata	p.L205I		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	205					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TTCATGGATAGGAAGGAACCG	0.577																																																	0													62.0	64.0	64.0					12																	49447821		2032	4187	6219	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.613C>A	12.37:g.49447821G>T	ENSP00000301067:p.Leu205Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.L205I	ENST00000301067.7	37	c.613	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531203	0.27387	.	.	ENSG00000167548	ENST00000301067	T	0.70749	-0.51	4.92	1.13	0.20643	Zinc finger, RING-type (1);Zinc finger, PHD-type (1);	0.000000	0.26334	U	0.024973	T	0.60183	0.2249	L	0.37507	1.11	0.23930	N	0.99644	P	0.48589	0.912	P	0.45753	0.492	T	0.55186	-0.8180	10	0.87932	D	0	.	7.0845	0.25249	0.4019:0.0:0.5981:0.0	.	205	O14686	MLL2_HUMAN	I	205	ENSP00000301067:L205I	ENSP00000301067:L205I	L	-	1	2	MLL2	47734088	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.088000	0.50175	0.222000	0.20900	-0.379000	0.06801	CTA	MLL2	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49447821	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	T
MMP12	4321	genome.wustl.edu	37	11	102733875	102733875	+	RNA	SNP	G	G	T	rs201220046		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:102733875G>T	ENST00000532855.1	-	0	1464							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	TTGGTGATACGTTGGAGTAGG	0.308																																																	0													162.0	163.0	163.0					11																	102733875		1840	4080	5920			4321			L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102733875G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9X8|B7ZLF6|Q2M1L9	RNA	SNP	-	NULL	ENST00000532855.1	37	NULL		11																																																																																			MMP12	-	-		0.308	MMP12-001	KNOWN	basic	processed_transcript	MMP12	HGNC	processed_transcript	OTTHUMT00000386646.1	G	NM_002426		102733875	-1	no_errors	ENST00000326227	ensembl	human	known	70_37	rna	SNP	0.005	T
MYO15A	51168	genome.wustl.edu	37	17	18055214	18055214	+	Silent	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:18055214G>T	ENST00000205890.5	+	41	8180	c.7842G>T	c.(7840-7842)ctG>ctT	p.L2614L	MYO15A_ENST00000585180.1_5'Flank|MYO15A_ENST00000418233.3_5'Flank	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2614	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					AGGAGGCCCTGATGATCCTGA	0.592																																																	0													40.0	44.0	43.0					17																	18055214		1978	4160	6138	SO:0001819	synonymous_variant	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.7842G>T	17.37:g.18055214G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFC7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.L2614	ENST00000205890.5	37	c.7842	CCDS42271.1	17																																																																																			MYO15A	-	NULL		0.592	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	G	NM_016239		18055214	+1	no_errors	ENST00000205890	ensembl	human	known	70_37	silent	SNP	0.987	T
RECQL5	9400	genome.wustl.edu	37	17	73621254	73621254	+	IGR	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:73621254G>A	ENST00000317905.5	-	0	3704				RECQL5_ENST00000443199.2_5'Flank|MYO15B_ENST00000578382.2_3'UTR	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAAGGCAGACGCGCAGCTCGC	0.687								Other identified genes with known or suspected DNA repair function																																									0																																										SO:0001628	intergenic_variant	80022			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762			17.37:g.73621254G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom	p.A305T	ENST00000317905.5	37	c.913	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224085	0.22457	.	.	ENSG00000188126	ENST00000293201	T	0.78246	-1.16	4.81	1.73	0.24493	.	.	.	.	.	T	0.56934	0.2019	.	.	.	0.09310	N	1	B;B	0.29115	0.233;0.119	B;B	0.20955	0.029;0.032	T	0.37731	-0.9693	8	0.21540	T	0.41	-13.5022	4.017	0.09649	0.3434:0.1694:0.4871:0.0	.	305;279	Q9H614;Q8TCJ6	.;.	T	305	ENSP00000293201:A305T	ENSP00000293201:A305T	A	+	1	0	MYO15B	71132849	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.414000	0.07114	0.250000	0.21479	0.561000	0.74099	GCG	MYO15B	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.687	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MYO15B	HGNC	protein_coding	OTTHUMT00000448207.1	G	NM_004259		73621254	+1	no_errors	ENST00000293201	ensembl	human	known	70_37	missense	SNP	0.000	A
NFXL1	152518	genome.wustl.edu	37	4	47850303	47850303	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr4:47850303G>T	ENST00000507489.1	-	23	2789	c.2613C>A	c.(2611-2613)aaC>aaA	p.N871K	NFXL1_ENST00000381538.3_Missense_Mutation_p.N871K	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	871						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CTCTTTTCCTGTTCTTCTTCC	0.358																																																	0													167.0	157.0	161.0					4																	47850303		2203	4300	6503	SO:0001583	missense	152518			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2613C>A	4.37:g.47850303G>T	ENSP00000422037:p.Asn871Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	pfam_Znf_NFX1,smart_Znf_NFX1,pfscan_Znf_RING	p.N871K	ENST00000507489.1	37	c.2613	CCDS3478.2	4	.	.	.	.	.	.	.	.	.	.	G	8.316	0.823219	0.16678	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	T;T	0.20598	2.06;2.06	5.66	4.82	0.62117	.	0.156296	0.43579	D	0.000549	T	0.11153	0.0272	N	0.20401	0.57	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07790	-1.0754	10	0.02654	T	1	-11.1519	10.5156	0.44887	0.0748:0.1704:0.7547:0.0	.	871	Q6ZNB6	NFXL1_HUMAN	K	871	ENSP00000370949:N871K;ENSP00000422037:N871K	ENSP00000370949:N871K	N	-	3	2	NFXL1	47545060	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.593000	0.46180	1.395000	0.46643	0.650000	0.86243	AAC	NFXL1	-	NULL		0.358	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFXL1	HGNC	protein_coding	OTTHUMT00000361636.1	G	NM_152995		47850303	-1	no_errors	ENST00000381538	ensembl	human	known	70_37	missense	SNP	1.000	T
OGFRL1	79627	genome.wustl.edu	37	6	72011666	72011666	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr6:72011666G>A	ENST00000370435.4	+	7	1404	c.1270G>A	c.(1270-1272)Gag>Aag	p.E424K	RP11-154D6.1_ENST00000587036.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	424						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						TGTATCTCCTGAGAATAACGA	0.373																																																	0													95.0	104.0	101.0					6																	72011666		2203	4300	6503	SO:0001583	missense	79627				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.1270G>A	6.37:g.72011666G>A	ENSP00000359464:p.Glu424Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	pfam_OGF_rcpt	p.E424K	ENST00000370435.4	37	c.1270	CCDS34482.1	6	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752958	0.31046	.	.	ENSG00000119900	ENST00000370435	T	0.49720	0.77	5.38	5.38	0.77491	.	0.368951	0.23230	N	0.050479	T	0.26195	0.0639	M	0.61703	1.905	0.19300	N	0.999978	B	0.17852	0.024	B	0.12156	0.007	T	0.03717	-1.1010	10	0.30854	T	0.27	-5.6778	10.31	0.43704	0.1209:0.0:0.8791:0.0	.	424	Q5TC84	OGRL1_HUMAN	K	424	ENSP00000359464:E424K	ENSP00000359464:E424K	E	+	1	0	OGFRL1	72068387	0.995000	0.38212	0.038000	0.18304	0.027000	0.11550	2.572000	0.45999	2.520000	0.84964	0.563000	0.77884	GAG	OGFRL1	-	NULL		0.373	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFRL1	HGNC	protein_coding	OTTHUMT00000041153.2	G	NM_024576		72011666	+1	no_errors	ENST00000370435	ensembl	human	known	70_37	missense	SNP	0.275	A
OTOG	340990	genome.wustl.edu	37	11	17596370	17596370	+	Silent	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:17596370C>T	ENST00000399391.2	+	19	2433	c.2433C>T	c.(2431-2433)ggC>ggT	p.G811G	OTOG_ENST00000399397.1_Silent_p.G738G	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	811	TIL.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TTGATGGTGGCGATGACCTGA	0.652																																																	0																																										SO:0001819	synonymous_variant	340990			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.2433C>T	11.37:g.17596370C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.G811	ENST00000399391.2	37	c.2433	CCDS59225.1	11																																																																																			OTOG	-	pfam_TIL_dom,superfamily_TIL_dom		0.652	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		C			17596370	+1	no_errors	ENST00000399391	ensembl	human	known	70_37	silent	SNP	0.000	T
PCDHGA11	56105	genome.wustl.edu	37	5	140802665	140802665	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:140802665C>T	ENST00000398587.2	+	1	1904	c.1871C>T	c.(1870-1872)aCg>aTg	p.T624M	PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.T624M|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGAGCACACGGGCGAGGTG	0.672																																																	0													46.0	54.0	51.0					5																	140802665		2202	4300	6502	SO:0001583	missense	56105			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1871C>T	5.37:g.140802665C>T	ENSP00000381589:p.Thr624Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T624M	ENST00000398587.2	37	c.1871	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	c	10.90	1.482433	0.26598	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;D	0.95103	0.36;-3.61	5.37	5.37	0.77165	Cadherin (4);Cadherin-like (1);	0.452627	0.11810	U	0.527208	D	0.98239	0.9417	M	0.94063	3.49	0.24843	N	0.99245	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.99	D	0.93702	0.7016	10	0.87932	D	0	.	19.1082	0.93305	0.0:1.0:0.0:0.0	.	624;624;624	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	M	624	ENSP00000381589:T624M;ENSP00000428333:T624M	ENSP00000381589:T624M	T	+	2	0	PCDHGA11	140782849	0.000000	0.05858	0.974000	0.42286	0.071000	0.16799	-0.169000	0.09911	2.524000	0.85096	0.561000	0.74099	ACG	PCDHGA11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.672	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	C	NM_018914		140802665	+1	no_errors	ENST00000398587	ensembl	human	known	70_37	missense	SNP	0.950	T
PDIA6	10130	genome.wustl.edu	37	2	10925075	10925075	+	Missense_Mutation	SNP	G	G	T	rs148800384	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr2:10925075G>T	ENST00000272227.3	-	12	1386	c.1239C>A	c.(1237-1239)gaC>gaA	p.D413E	PDIA6_ENST00000381611.4_Missense_Mutation_p.D418E|PDIA6_ENST00000404371.2_Missense_Mutation_p.D465E|ATP6V1C2_ENST00000381661.3_3'UTR|PDIA6_ENST00000404824.2_Missense_Mutation_p.D461E|PDIA6_ENST00000540494.1_Missense_Mutation_p.D410E	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	413					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		CATCCCTGCCGTCCCAAGGCT	0.597																																					GBM(73;509 1219 34219 41343 41551)												0													34.0	29.0	31.0					2																	10925075		2201	4293	6494	SO:0001583	missense	10130			BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.1239C>A	2.37:g.10925075G>T	ENSP00000272227:p.Asp413Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Disulphide_isomerase	p.D418E	ENST00000272227.3	37	c.1254	CCDS1675.1	2	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483851	0.84854	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.08807	3.17;3.1;3.05;3.21;3.14	5.72	-10.4	0.00318	.	0.000000	0.85682	D	0.000000	T	0.28333	0.0700	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.997	D;D;D;D	0.91635	0.985;0.999;0.954;0.988	T	0.71441	-0.4592	10	0.87932	D	0	.	23.0656	0.99979	0.891:0.0:0.109:0.0	.	410;461;465;413	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	E	413;465;461;410;418	ENSP00000272227:D413E;ENSP00000385385:D465E;ENSP00000384459:D461E;ENSP00000438778:D410E;ENSP00000371024:D418E	ENSP00000272227:D413E	D	-	3	2	PDIA6	10842526	0.957000	0.32711	0.124000	0.21820	0.969000	0.65631	0.178000	0.16820	-2.445000	0.00547	-0.794000	0.03295	GAC	PDIA6	-	NULL		0.597	PDIA6-001	KNOWN	basic|CCDS	protein_coding	PDIA6	HGNC	protein_coding	OTTHUMT00000206933.1	G	NM_005742		10925075	-1	no_errors	ENST00000381611	ensembl	human	known	70_37	missense	SNP	0.757	T
PDZD2	23037	genome.wustl.edu	37	5	31799444	31799444	+	Missense_Mutation	SNP	C	C	T	rs200755574	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:31799444C>T	ENST00000438447.1	+	2	477	c.89C>T	c.(88-90)cCg>cTg	p.P30L	PDZD2_ENST00000282493.3_Missense_Mutation_p.P30L			O15018	PDZD2_HUMAN	PDZ domain containing 2	30					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGGGATGGGCCGGAGCAGCGG	0.627																																																	0													55.0	57.0	56.0					5																	31799444		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.89C>T	5.37:g.31799444C>T	ENSP00000402033:p.Pro30Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P30L	ENST00000438447.1	37	c.89	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576734	0.86645	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.63255	-0.03;-0.03	5.67	5.67	0.87782	.	0.000000	0.45606	D	0.000356	T	0.69333	0.3099	N	0.24115	0.695	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.72830	-0.4174	10	0.72032	D	0.01	.	17.2551	0.87053	0.0:1.0:0.0:0.0	.	30	O15018	PDZD2_HUMAN	L	30	ENSP00000402033:P30L;ENSP00000282493:P30L	ENSP00000282493:P30L	P	+	2	0	PDZD2	31835201	0.887000	0.30362	0.992000	0.48379	0.985000	0.73830	4.911000	0.63328	2.661000	0.90470	0.655000	0.94253	CCG	PDZD2	-	NULL		0.627	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	C			31799444	+1	no_errors	ENST00000282493	ensembl	human	known	70_37	missense	SNP	0.996	T
PHLPP1	23239	genome.wustl.edu	37	18	60645815	60645815	+	Silent	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr18:60645815C>T	ENST00000262719.5	+	17	4539	c.4305C>T	c.(4303-4305)agC>agT	p.S1435S	PHLPP1_ENST00000400316.4_Silent_p.S923S			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1435					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						GCGAGCTCAGCGCCGGTGGGG	0.632																																																	0													23.0	27.0	26.0					18																	60645815		2108	4231	6339	SO:0001819	synonymous_variant	23239			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4305C>T	18.37:g.60645815C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like,pfscan_Pleckstrin_homology	p.S1435	ENST00000262719.5	37	c.4305	CCDS45881.2	18																																																																																			PHLPP1	-	NULL		0.632	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	C	NM_194449		60645815	+1	no_errors	ENST00000262719	ensembl	human	known	70_37	silent	SNP	0.068	T
PNKP	11284	genome.wustl.edu	37	19	50364613	50364613	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr19:50364613G>A	ENST00000322344.3	-	17	1567	c.1458C>T	c.(1456-1458)ttC>ttT	p.F486F	AC018766.4_ENST00000596624.1_RNA|PNKP_ENST00000596014.1_Silent_p.F486F|PNKP_ENST00000600573.1_Silent_p.F455F|PNKP_ENST00000600910.1_Nonsense_Mutation_p.R450*|AC018766.5_ENST00000601893.1_RNA|AC018766.5_ENST00000593654.1_RNA|AC018766.5_ENST00000599259.1_RNA	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	486	Kinase. {ECO:0000250}.				dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TTGGGGCCTCGAACTGCTTCC	0.642								Other BER factors																																									0													86.0	84.0	85.0					19																	50364613		2203	4300	6503	SO:0001819	synonymous_variant	11284			AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.1458C>T	19.37:g.50364613G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Nonsense_Mutation	SNP	pfam_PNK3P,superfamily_HAD-like_dom,superfamily_SMAD_FHA_domain,tigrfam_PNK_3Pase_met,tigrfam_Polynucleotide_phosphatase,tigrfam_HAD-SF_hydro_IIIA	p.R450*	ENST00000322344.3	37	c.1348	CCDS12783.1	19																																																																																			PNKP	-	NULL		0.642	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNKP	HGNC	protein_coding	OTTHUMT00000465830.1	G	NM_007254		50364613	-1	no_errors	ENST00000600910	ensembl	human	novel	70_37	nonsense	SNP	0.993	A
PNLDC1	154197	genome.wustl.edu	37	6	160240108	160240108	+	Missense_Mutation	SNP	G	G	A	rs143586629		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr6:160240108G>A	ENST00000610273.1	+	17	1526	c.1355G>A	c.(1354-1356)cGa>cAa	p.R452Q	PNLDC1_ENST00000392167.3_Missense_Mutation_p.R463Q	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	452						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GATGTCAGGCGACTCACAAGA	0.527																																																	0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	89.0	90.0		1355	3.7	0.1	6	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense	PNLDC1	NM_173516.1	43	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	452/521	160240108	2,13004	2203	4300	6503	SO:0001583	missense	154197			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1355G>A	6.37:g.160240108G>A	ENSP00000476448:p.Arg452Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.R452Q	ENST00000610273.1	37	c.1355	CCDS5271.1	6	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918779	0.33908	2.27E-4	1.16E-4	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	4.57	3.67	0.42095	.	0.133611	0.34268	N	0.004109	T	0.29321	0.0730	L	0.27053	0.805	0.21355	N	0.999715	D;D	0.89917	1.0;0.998	D;P	0.65323	0.934;0.608	T	0.05784	-1.0864	9	0.18710	T	0.47	.	11.4611	0.50211	0.0862:0.0:0.9138:0.0	.	463;452	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	Q	452;463	.	ENSP00000275275:R452Q	R	+	2	0	PNLDC1	160160098	0.984000	0.35163	0.062000	0.19696	0.085000	0.17905	2.499000	0.45372	2.360000	0.80028	0.462000	0.41574	CGA	PNLDC1	-	NULL		0.527	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding		G	NM_173516		160240108	+1	no_errors	ENST00000275275	ensembl	human	known	70_37	missense	SNP	0.010	A
POTEE	445582	genome.wustl.edu	37	2	131976013	131976013	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr2:131976013C>T	ENST00000356920.5	+	1	132	c.38C>T	c.(37-39)tCt>tTt	p.S13F	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.S13F	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	13					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCTGCCTCTTCTGTGAAGAAG	0.542																																																	0													24.0	32.0	29.0					2																	131976013		2118	4248	6366	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.38C>T	2.37:g.131976013C>T	ENSP00000439189:p.Ser13Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.S13F	ENST00000356920.5	37	c.38	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	3.412	-0.119930	0.06838	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.80033	-1.33;1.4	.	.	.	.	.	.	.	.	T	0.59335	0.2186	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48969	-0.8987	7	0.48119	T	0.1	.	.	.	.	.	13	Q6S8J3	POTEE_HUMAN	F	13	ENSP00000439189:S13F;ENSP00000443049:S13F	ENSP00000439189:S13F	S	+	2	0	AC131180.1	131692483	0.000000	0.05858	0.049000	0.19019	0.049000	0.14656	-0.917000	0.04025	0.159000	0.19401	0.162000	0.16502	TCT	POTEE	-	NULL		0.542	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Uniprot_genename	protein_coding		C	NM_001083538		131976013	+1	no_errors	ENST00000356920	ensembl	human	known	70_37	missense	SNP	0.054	T
RNF219	79596	genome.wustl.edu	37	13	79190472	79190472	+	Missense_Mutation	SNP	G	G	T	rs184991036		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr13:79190472G>T	ENST00000282003.6	-	6	1482	c.1424C>A	c.(1423-1425)gCc>gAc	p.A475D	RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	475	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TAAGTTTTGGGCATAGCTTGT	0.353																																																	0													41.0	43.0	42.0					13																	79190472		2203	4300	6503	SO:0001583	missense	79596			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1424C>A	13.37:g.79190472G>T	ENSP00000282003:p.Ala475Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	pfscan_Znf_RING	p.A475D	ENST00000282003.6	37	c.1424	CCDS31997.1	13	.	.	.	.	.	.	.	.	.	.	G	9.312	1.055833	0.19907	.	.	ENSG00000152193	ENST00000282003	T	0.15017	2.46	6.07	3.41	0.39046	.	0.176843	0.40469	N	0.001082	T	0.13072	0.0317	L	0.44542	1.39	0.27946	N	0.93734	B	0.06786	0.001	B	0.06405	0.002	T	0.14448	-1.0472	10	0.33940	T	0.23	-19.0347	6.5807	0.22591	0.1337:0.0:0.6145:0.2518	.	475	Q5W0B1	RN219_HUMAN	D	475	ENSP00000282003:A475D	ENSP00000282003:A475D	A	-	2	0	RNF219	78088473	0.998000	0.40836	1.000000	0.80357	0.868000	0.49771	1.719000	0.38011	0.906000	0.36621	-0.136000	0.14681	GCC	RNF219	-	NULL		0.353	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF219	HGNC	protein_coding	OTTHUMT00000045363.1	G	NM_024546		79190472	-1	no_errors	ENST00000282003	ensembl	human	known	70_37	missense	SNP	0.999	T
RYR2	6262	genome.wustl.edu	37	1	237811805	237811805	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr1:237811805G>T	ENST00000366574.2	+	49	7721	c.7404G>T	c.(7402-7404)atG>atT	p.M2468I	RYR2_ENST00000360064.6_Missense_Mutation_p.M2466I|RYR2_ENST00000542537.1_Missense_Mutation_p.M2452I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2468	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGGCAGCCATGGTTTTATTCC	0.493																																																	0													105.0	98.0	100.0					1																	237811805		1912	4146	6058	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7404G>T	1.37:g.237811805G>T	ENSP00000355533:p.Met2468Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.M2466I	ENST00000366574.2	37	c.7398	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253483	0.80135	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.85411	-1.98;-1.98;-1.98	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.89543	0.6745	L	0.48174	1.505	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.86682	0.1917	10	0.24483	T	0.36	-23.0094	19.0066	0.92854	0.0:0.0:1.0:0.0	.	2468	Q92736	RYR2_HUMAN	I	2468;2466;2452	ENSP00000355533:M2468I;ENSP00000353174:M2466I;ENSP00000443798:M2452I	ENSP00000353174:M2466I	M	+	3	0	RYR2	235878428	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.563000	0.86464	0.655000	0.94253	ATG	RYR2	-	NULL		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	G	NM_001035		237811805	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	missense	SNP	1.000	T
SCUBE2	57758	genome.wustl.edu	37	11	9088340	9088340	+	Missense_Mutation	SNP	C	C	T	rs146308663	byFrequency	TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:9088340C>T	ENST00000309263.3	-	6	736	c.664G>A	c.(664-666)Ggt>Agt	p.G222S	RP11-467K18.2_ENST00000521394.2_RNA|SCUBE2_ENST00000457346.2_Missense_Mutation_p.G222S|SCUBE2_ENST00000450649.2_Missense_Mutation_p.G222S|SCUBE2_ENST00000520467.1_Missense_Mutation_p.G222S			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	222	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		TGGCACCCACCGTTCCCATGG	0.507																																																	0								C	SER/GLY,SER/GLY	0,4402		0,0,2201	104.0	74.0	85.0		664,664	5.9	0.7	11	dbSNP_134	85	8,8584	6.4+/-24.3	0,8,4288	yes	missense,missense	SCUBE2	NM_001170690.1,NM_020974.2	56,56	0,8,6489	TT,TC,CC		0.0931,0.0,0.0616	probably-damaging,probably-damaging	222/808,222/972	9088340	8,12986	2201	4296	6497	SO:0001583	missense	57758			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.664G>A	11.37:g.9088340C>T	ENSP00000310658:p.Gly222Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.G222S	ENST00000309263.3	37	c.664		11	.	.	.	.	.	.	.	.	.	.	C	36	5.733007	0.96856	0.0	9.31E-4	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	T;T;D;T	0.84442	-1.33;-1.41;-1.85;-1.49	5.95	5.95	0.96441	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.92446	0.7602	M	0.70903	2.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.92181	0.5751	10	0.72032	D	0.01	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	222;222;222	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	S	222	ENSP00000390481:G222S;ENSP00000310658:G222S;ENSP00000415187:G222S;ENSP00000429969:G222S	ENSP00000310658:G222S	G	-	1	0	SCUBE2	9044916	1.000000	0.71417	0.721000	0.30653	0.982000	0.71751	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	GGT	SCUBE2	-	smart_EGF-like_Ca-bd,smart_EG-like_dom		0.507	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	SCUBE2	HGNC	protein_coding	OTTHUMT00000385812.2	C	NM_020974		9088340	-1	no_errors	ENST00000457346	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC22A12	116085	genome.wustl.edu	37	11	64367308	64367308	+	Missense_Mutation	SNP	G	G	C	rs370100606		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr11:64367308G>C	ENST00000377574.1	+	7	1978	c.1231G>C	c.(1231-1233)Gca>Cca	p.A411P	SLC22A12_ENST00000377567.2_Missense_Mutation_p.A303P|SLC22A12_ENST00000336464.7_Missense_Mutation_p.A377P|SLC22A12_ENST00000473690.1_Missense_Mutation_p.A190P|SLC22A12_ENST00000377572.1_Missense_Mutation_p.A303P	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	411					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)	p.A411T(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	CACGCTGGCCGCATCCCTGTT	0.642																																																	1	Substitution - Missense(1)	endometrium(1)											30.0	29.0	30.0					11																	64367308		2197	4292	6489	SO:0001583	missense	116085			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1231G>C	11.37:g.64367308G>C	ENSP00000366797:p.Ala411Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A411P	ENST00000377574.1	37	c.1231	CCDS8075.1	11	.	.	.	.	.	.	.	.	.	.	G	17.08	3.298988	0.60195	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000473690;ENST00000336464	T;T;T;T;T	0.74632	-0.86;0.32;-0.86;-0.86;-0.86	4.72	-0.349	0.12609	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.821884	0.10721	N	0.641693	T	0.76385	0.3980	M	0.77486	2.375	0.09310	N	1	D;P;D	0.52996	0.957;0.924;0.957	P;P;P	0.54590	0.738;0.524;0.756	T	0.62737	-0.6791	10	0.36615	T	0.2	.	0.9386	0.01351	0.3398:0.1657:0.3453:0.1491	.	377;303;411	B5ME56;Q96S37-2;Q96S37	.;.;S22AC_HUMAN	P	303;411;303;190;377	ENSP00000366790:A303P;ENSP00000366797:A411P;ENSP00000366795:A303P;ENSP00000438437:A190P;ENSP00000336836:A377P	ENSP00000336836:A377P	A	+	1	0	SLC22A12	64123884	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.166000	0.16583	-0.399000	0.07668	-0.430000	0.05897	GCA	SLC22A12	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.642	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A12	HGNC	protein_coding	OTTHUMT00000104966.2	G	NM_144585		64367308	+1	no_errors	ENST00000377574	ensembl	human	known	70_37	missense	SNP	0.000	C
SLC35G2	80723	genome.wustl.edu	37	3	136573486	136573486	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:136573486delA	ENST00000446465.2	+	2	812	c.184delA	c.(184-186)aaafs	p.K64fs	SLC35G2_ENST00000393079.3_Frame_Shift_Del_p.K64fs|RP11-85F14.5_ENST00000461864.1_RNA|RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000470236.1_RNA	NM_025246.2	NP_079522.2			solute carrier family 35, member G2																		GAGTGAAATGAAAAAAAAAGG	0.413																																																	0													88.0	99.0	95.0					3																	136573486		2203	4300	6503	SO:0001589	frameshift_variant	80723			BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.184delA	3.37:g.136573486delA	ENSP00000400839:p.Lys64fs	Somatic		WXS	Illumina HiSeq	Phase_IV		Frame_Shift_Del	DEL	pfam_DMT	p.66fs	ENST00000446465.2	37	c.184	CCDS3091.1	3																																																																																			SLC35G2	-	NULL		0.413	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G2	HGNC	protein_coding	OTTHUMT00000357317.1	A	NM_025246		136573486	+1	no_errors	ENST00000393079	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
SNTG2	54221	genome.wustl.edu	37	2	1271336	1271336	+	Missense_Mutation	SNP	G	G	A	rs372191385		TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr2:1271336G>A	ENST00000308624.5	+	14	1406	c.1277G>A	c.(1276-1278)aGa>aAa	p.R426K	SNTG2_ENST00000407292.1_Missense_Mutation_p.R299K	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	426					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GAAGTTCAGAGAACCGGGGTA	0.527																																																	0								G	LYS/ARG	0,3892		0,0,1946	33.0	33.0	33.0		1277	4.6	0.2	2		33	1,8283		0,1,4141	no	missense	SNTG2	NM_018968.3	26	0,1,6087	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	426/540	1271336	1,12175	1946	4142	6088	SO:0001583	missense	54221			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1277G>A	2.37:g.1271336G>A	ENSP00000311837:p.Arg426Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R426K	ENST00000308624.5	37	c.1277	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905003	0.33628	0.0	1.21E-4	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.76839	-1.05;-1.05	4.61	4.61	0.57282	.	0.051875	0.64402	D	0.000001	D	0.82917	0.5141	L	0.46947	1.48	0.52501	D	0.999958	D;D	0.69078	0.996;0.997	D;D	0.76071	0.987;0.978	T	0.78738	-0.2087	10	0.13470	T	0.59	.	17.0422	0.86492	0.0:0.0:1.0:0.0	.	299;426	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	K	426;299	ENSP00000311837:R426K;ENSP00000385020:R299K	ENSP00000311837:R426K	R	+	2	0	SNTG2	1253917	1.000000	0.71417	0.206000	0.23566	0.006000	0.05464	9.007000	0.93597	2.076000	0.62316	0.655000	0.94253	AGA	SNTG2	-	NULL		0.527	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	G	NM_018968		1271336	+1	no_errors	ENST00000308624	ensembl	human	known	70_37	missense	SNP	1.000	A
SSH2	85464	genome.wustl.edu	37	17	27977704	27977704	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr17:27977704C>T	ENST00000269033.3	-	12	1264	c.1113G>A	c.(1111-1113)tgG>tgA	p.W371*	SSH2_ENST00000540801.1_Nonsense_Mutation_p.W398*|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	371	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAGTGTCATTCCAGTACGCCA	0.443																																																	0													231.0	199.0	210.0					17																	27977704		2203	4300	6503	SO:0001587	stop_gained	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.1113G>A	17.37:g.27977704C>T	ENSP00000269033:p.Trp371*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.W371*	ENST00000269033.3	37	c.1113	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.259192	0.97421	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	.	.	.	5.66	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5048	14.7885	0.69821	0.0:0.9309:0.0:0.0691	.	.	.	.	X	371;398;371	.	ENSP00000269033:W371X	W	-	3	0	SSH2	25001830	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.776000	0.85560	1.539000	0.49286	0.655000	0.94253	TGG	SSH2	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat		0.443	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	C	NM_033389		27977704	-1	no_errors	ENST00000269033	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113170065	113170065	+	Silent	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr9:113170065G>A	ENST00000401783.2	-	38	8151	c.7815C>T	c.(7813-7815)atC>atT	p.I2605I	SVEP1_ENST00000374469.1_Silent_p.I2582I|SVEP1_ENST00000297826.5_Silent_p.I531I	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2605	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TACATGTTGGGATGGAACTTG	0.468																																																	0													144.0	144.0	144.0					9																	113170065		1978	4170	6148	SO:0001819	synonymous_variant	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.7815C>T	9.37:g.113170065G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.I2605	ENST00000401783.2	37	c.7815	CCDS48004.1	9																																																																																			SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.468	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		G			113170065	-1	no_errors	ENST00000401783	ensembl	human	known	70_37	silent	SNP	0.198	A
TARS	6897	genome.wustl.edu	37	5	33467719	33467719	+	Missense_Mutation	SNP	A	A	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:33467719A>G	ENST00000265112.3	+	19	2389	c.2078A>G	c.(2077-2079)aAt>aGt	p.N693S	TARS_ENST00000541634.1_Missense_Mutation_p.N589S|TARS_ENST00000502553.1_Missense_Mutation_p.N693S|TARS_ENST00000455217.2_Missense_Mutation_p.N726S|TARS_ENST00000414361.2_Missense_Mutation_p.N572S	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	693					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	ACAAGAGACAATAAGGTCCAC	0.403																																																	0													73.0	69.0	70.0					5																	33467719		2203	4300	6503	SO:0001583	missense	6897			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.2078A>G	5.37:g.33467719A>G	ENSP00000265112:p.Asn693Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.N693S	ENST00000265112.3	37	c.2078	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	a	17.63	3.437379	0.62955	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	5.2	5.2	0.72013	Anticodon-binding (3);	0.000000	0.85682	D	0.000000	D	0.88097	0.6345	M	0.67700	2.07	0.80722	D	1	B;D;P;D	0.65815	0.097;0.995;0.917;0.99	B;D;P;D	0.72075	0.145;0.976;0.721;0.956	D	0.88757	0.3254	10	0.54805	T	0.06	-31.3738	15.0721	0.72046	1.0:0.0:0.0:0.0	.	572;726;589;693	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	S	693;693;589;726;572	ENSP00000424387:N693S;ENSP00000265112:N693S;ENSP00000438469:N589S;ENSP00000387710:N726S;ENSP00000394291:N572S	ENSP00000265112:N693S	N	+	2	0	TARS	33503476	1.000000	0.71417	0.571000	0.28486	0.917000	0.54804	9.211000	0.95120	1.958000	0.56883	0.455000	0.32223	AAT	TARS	-	pfam_Anticodon-bd,superfamily_Anticodon-bd,tigrfam_Thr-tRNA-ligase_IIa		0.403	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	A	NM_152295		33467719	+1	no_errors	ENST00000265112	ensembl	human	known	70_37	missense	SNP	1.000	G
TBX20	57057	genome.wustl.edu	37	7	35288353	35288353	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr7:35288353G>A	ENST00000408931.3	-	3	1007	c.481C>T	c.(481-483)Cgc>Tgc	p.R161C		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	161					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TAGGCGTAGCGGTACCTCTTG	0.577																																																	0													96.0	88.0	91.0					7																	35288353		2203	4300	6503	SO:0001583	missense	57057			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.481C>T	7.37:g.35288353G>A	ENSP00000386170:p.Arg161Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.R161C	ENST00000408931.3	37	c.481	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397768	0.83120	.	.	ENSG00000164532	ENST00000408931	D	0.90324	-2.65	5.87	4.95	0.65309	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96926	0.8996	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97340	0.9956	10	0.87932	D	0	.	13.9896	0.64357	0.0:0.0:0.7421:0.2579	.	161	Q9UMR3	TBX20_HUMAN	C	161	ENSP00000386170:R161C	ENSP00000386170:R161C	R	-	1	0	TBX20	35254878	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.047000	0.57383	2.941000	0.99782	0.655000	0.94253	CGC	TBX20	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box		0.577	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	G	NM_020417		35288353	-1	no_errors	ENST00000408931	ensembl	human	known	70_37	missense	SNP	1.000	A
TCTEX1D2	255758	genome.wustl.edu	37	3	196042995	196042995	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr3:196042995G>A	ENST00000325318.5	-	2	356	c.221C>T	c.(220-222)tCa>tTa	p.S74L	RP11-447L10.1_ENST00000431391.1_Missense_Mutation_p.S74L|TM4SF19-AS1_ENST00000444939.1_RNA|TM4SF19-AS1_ENST00000420226.1_RNA|TM4SF19-AS1_ENST00000452051.1_RNA|TM4SF19_ENST00000442633.1_3'UTR	NM_152773.4	NP_689986.2	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2	74										breast(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	7	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		AATGTTTTCTGATAAATGTTT	0.393																																																	0													119.0	110.0	113.0					3																	196042995		2203	4300	6503	SO:0001583	missense	255758			BC021177	CCDS33929.1	3q29	2010-07-19			ENSG00000213123	ENSG00000213123			28482	protein-coding gene	gene with protein product						12477932	Standard	NM_152773		Approved	MGC33212	uc003fwi.3	Q8WW35	OTTHUMG00000155672	ENST00000325318.5:c.221C>T	3.37:g.196042995G>A	ENSP00000324323:p.Ser74Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCN5	Missense_Mutation	SNP	pfam_Tctex	p.S74L	ENST00000325318.5	37	c.221	CCDS33929.1	3	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443109	0.83993	.	.	ENSG00000213123	ENST00000325318;ENST00000545438	T	0.28666	1.6	5.56	4.69	0.59074	.	0.120685	0.33753	U	0.004588	T	0.51109	0.1655	M	0.87682	2.9	0.80722	D	1	P	0.47253	0.892	P	0.52031	0.688	T	0.59434	-0.7455	10	0.72032	D	0.01	0.0105	12.076	0.53644	0.0834:0.0:0.9166:0.0	.	74	Q8WW35	TC1D2_HUMAN	L	74	ENSP00000324323:S74L	ENSP00000324323:S74L	S	-	2	0	TCTEX1D2	197527392	1.000000	0.71417	0.908000	0.35775	0.969000	0.65631	6.379000	0.73154	1.338000	0.45544	0.561000	0.74099	TCA	TCTEX1D2	-	pfam_Tctex		0.393	TCTEX1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D2	HGNC	protein_coding	OTTHUMT00000341166.1	G	NM_152773		196042995	-1	no_errors	ENST00000325318	ensembl	human	known	70_37	missense	SNP	1.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43700219	43700219	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr15:43700219delG	ENST00000263801.3	-	27	5905	c.5653delC	c.(5653-5655)ctgfs	p.L1885fs	TP53BP1_ENST00000450115.2_Frame_Shift_Del_p.L1888fs|TP53BP1_ENST00000382039.3_Frame_Shift_Del_p.L1840fs|TP53BP1_ENST00000382044.4_Frame_Shift_Del_p.L1890fs	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1885	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CAGAGCTCCAGGAAGTTCTGC	0.488								Other conserved DNA damage response genes																																									0													102.0	98.0	99.0					15																	43700219		2201	4298	6499	SO:0001589	frameshift_variant	7158			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5653delC	15.37:g.43700219delG	ENSP00000263801:p.Leu1885fs	Somatic		WXS	Illumina HiSeq	Phase_IV	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Frame_Shift_Del	DEL	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.L1890fs	ENST00000263801.3	37	c.5668	CCDS10096.1	15																																																																																			TP53BP1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.488	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	G			43700219	-1	no_errors	ENST00000382044	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
VAC14	55697	genome.wustl.edu	37	16	70726824	70726824	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr16:70726824C>G	ENST00000261776.5	-	18	2346	c.2086G>C	c.(2086-2088)Gcc>Ccc	p.A696P	VAC14_ENST00000536184.2_Missense_Mutation_p.A128P|VAC14_ENST00000571759.1_5'Flank	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	696					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				CCGTAGAGGGCCTTGATCAGG	0.652																																																	0													65.0	61.0	62.0					16																	70726824		2198	4300	6498	SO:0001583	missense	55697			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.2086G>C	16.37:g.70726824C>G	ENSP00000261776:p.Ala696Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.A696P	ENST00000261776.5	37	c.2086	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.512491	0.96402	.	.	ENSG00000103043	ENST00000261776;ENST00000536184	T	0.70164	-0.46	5.24	5.24	0.73138	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.83825	0.0249	10	0.62326	D	0.03	-20.1709	18.8226	0.92103	0.0:1.0:0.0:0.0	.	696	Q08AM6	VAC14_HUMAN	P	696;128	ENSP00000261776:A696P	ENSP00000261776:A696P	A	-	1	0	VAC14	69284325	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.677000	0.84024	2.436000	0.82500	0.561000	0.74099	GCC	VAC14	-	pfam_VAC14_Fig4p-bd,superfamily_ARM-type_fold		0.652	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	C	NM_018052		70726824	-1	no_errors	ENST00000261776	ensembl	human	known	70_37	missense	SNP	1.000	G
ZBTB45	84878	genome.wustl.edu	37	19	59027764	59027764	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr19:59027764G>A	ENST00000594051.1	-	2	1757	c.1277C>T	c.(1276-1278)tCg>tTg	p.S426L	ZBTB45_ENST00000600990.1_Missense_Mutation_p.S426L|ZBTB45_ENST00000354590.3_Missense_Mutation_p.S426L			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		TGGCTCACCCGAGTGGATGAA	0.572																																					NSCLC(164;1383 2017 5233 27540 46677)												0													63.0	61.0	62.0					19																	59027764		2203	4300	6503	SO:0001583	missense	84878			AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.1277C>T	19.37:g.59027764G>A	ENSP00000469089:p.Ser426Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S426L	ENST00000594051.1	37	c.1277	CCDS12984.1	19	.	.	.	.	.	.	.	.	.	.	g	18.21	3.573463	0.65765	.	.	ENSG00000119574	ENST00000354590	T	0.07800	3.16	3.22	3.22	0.36961	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000005	T	0.14227	0.0344	L	0.46819	1.47	0.39214	D	0.963378	D	0.61080	0.989	P	0.52386	0.697	T	0.03354	-1.1045	10	0.72032	D	0.01	.	12.7104	0.57086	0.0:0.0:1.0:0.0	.	426	Q96K62	ZBT45_HUMAN	L	426	ENSP00000346603:S426L	ENSP00000346603:S426L	S	-	2	0	ZBTB45	63719576	1.000000	0.71417	0.980000	0.43619	0.895000	0.52256	7.317000	0.79018	2.131000	0.65755	0.467000	0.42956	TCG	ZBTB45	-	pfscan_Znf_C2H2		0.572	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB45	HGNC	protein_coding	OTTHUMT00000467067.1	G	NM_032792		59027764	-1	no_errors	ENST00000354590	ensembl	human	known	70_37	missense	SNP	0.994	A
ZDHHC7	55625	genome.wustl.edu	37	16	85011579	85011579	+	Silent	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr16:85011579C>T	ENST00000313732.4	-	6	922	c.570G>A	c.(568-570)ctG>ctA	p.L190L	ZDHHC7_ENST00000564466.1_Silent_p.L227L|ZDHHC7_ENST00000569488.1_5'UTR	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	190					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						CACAAAGGATCAGAGCATGGA	0.423																																																	0													130.0	124.0	126.0					16																	85011579		2199	4300	6499	SO:0001819	synonymous_variant	55625			AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.570G>A	16.37:g.85011579C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUM1|Q8WV42|Q9NVD8	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L227	ENST00000313732.4	37	c.681	CCDS10950.1	16																																																																																			ZDHHC7	-	NULL		0.423	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC7	HGNC	protein_coding	OTTHUMT00000269087.1	C	NM_017740		85011579	-1	no_errors	ENST00000344861	ensembl	human	known	70_37	silent	SNP	0.002	T
ZNF474	133923	genome.wustl.edu	37	5	121488160	121488160	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr5:121488160C>T	ENST00000296600.4	+	2	858	c.475C>T	c.(475-477)Cag>Tag	p.Q159*	CTC-441N14.2_ENST00000504829.1_RNA|ZNF474_ENST00000514925.1_Intron|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	159							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		GGCTGCATTTCAGAGTGCCCA	0.537																																																	0													64.0	59.0	61.0					5																	121488160		2203	4300	6503	SO:0001587	stop_gained	133923			AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.475C>T	5.37:g.121488160C>T	ENSP00000296600:p.Gln159*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4M0|Q96M07	Nonsense_Mutation	SNP	pfscan_Znf_C2H2	p.Q159*	ENST00000296600.4	37	c.475	CCDS4130.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.040581	0.97226	.	.	ENSG00000164185	ENST00000296600	.	.	.	5.28	5.28	0.74379	.	1.720280	0.02735	N	0.115627	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-0.0063	9.4467	0.38701	0.1423:0.7837:0.0:0.074	.	.	.	.	X	159	.	ENSP00000296600:Q159X	Q	+	1	0	ZNF474	121516059	0.142000	0.22610	0.911000	0.35937	0.745000	0.42441	0.832000	0.27490	2.624000	0.88883	0.655000	0.94253	CAG	ZNF474	-	NULL		0.537	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF474	HGNC	protein_coding	OTTHUMT00000250883.2	C	NM_207317		121488160	+1	no_errors	ENST00000296600	ensembl	human	known	70_37	nonsense	SNP	0.845	T
ZNF614	80110	genome.wustl.edu	37	19	52521309	52521309	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LB-01A-11D-A243-09	TCGA-IR-A3LB-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8a67f3a7-427a-418d-b0bc-a6cdef6a5369	44a3f604-288d-419f-b3fe-cf02924d7cbe	g.chr19:52521309G>T	ENST00000270649.6	-	4	734	c.190C>A	c.(190-192)Caa>Aaa	p.Q64K	ZNF614_ENST00000356322.6_Missense_Mutation_p.Q64K	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CATGGTTCTTGTCCATGTGCC	0.408																																																	0													171.0	150.0	157.0					19																	52521309		2203	4300	6503	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.190C>A	19.37:g.52521309G>T	ENSP00000270649:p.Gln64Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q64K	ENST00000270649.6	37	c.190	CCDS12847.1	19	.	.	.	.	.	.	.	.	.	.	G	7.502	0.652817	0.14580	.	.	ENSG00000142556	ENST00000356322;ENST00000270649	T;T	0.05717	6.17;3.4	2.75	-2.83	0.05769	Krueppel-associated box (3);	.	.	.	.	T	0.02848	0.0085	N	0.10972	0.075	0.09310	N	1	B;B	0.15141	0.0;0.012	B;B	0.12837	0.0;0.008	T	0.45279	-0.9272	9	0.28530	T	0.3	.	4.6466	0.12575	0.0:0.4265:0.1937:0.3797	.	64;64	Q8N883;Q9BSN8	ZN614_HUMAN;.	K	64	ENSP00000348674:Q64K;ENSP00000270649:Q64K	ENSP00000270649:Q64K	Q	-	1	0	ZNF614	57213121	0.001000	0.12720	0.001000	0.08648	0.688000	0.40055	-0.022000	0.12480	-0.497000	0.06641	-0.282000	0.10007	CAA	ZNF614	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.408	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF614	HGNC	protein_coding	OTTHUMT00000462407.1	G	NM_025040		52521309	-1	no_errors	ENST00000270649	ensembl	human	known	70_37	missense	SNP	0.018	T
