#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AAMP	14	genome.wustl.edu	37	2	219134255	219134255	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:219134255C>T	ENST00000248450.4	-	2	294	c.124G>A	c.(124-126)Gac>Aac	p.D42N	AAMP_ENST00000444053.1_Missense_Mutation_p.D43N|PNKD_ENST00000273077.4_5'Flank|PNKD_ENST00000248451.3_5'Flank|AAMP_ENST00000420660.1_Missense_Mutation_p.D23N			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	42					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGGCCAGGTCATCTGCTTTG	0.602																																																	0													59.0	59.0	59.0					2																	219134255		2203	4300	6503	SO:0001583	missense	14			AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.124G>A	2.37:g.219134255C>T	ENSP00000248450:p.Asp42Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUJ9|Q96H92	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D42N	ENST00000248450.4	37	c.124	CCDS33378.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805540	0.90623	.	.	ENSG00000127837	ENST00000248450;ENST00000444053;ENST00000420660	T;T;T	0.58358	0.34;0.34;0.5	4.93	4.93	0.64822	.	0.051504	0.85682	D	0.000000	T	0.64692	0.2621	L	0.43923	1.385	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.72338	0.977;0.977;0.977	T	0.57974	-0.7718	10	0.22706	T	0.39	-13.6578	18.3504	0.90336	0.0:1.0:0.0:0.0	.	43;42;23	C9JEH3;Q13685;C9JG97	.;AAMP_HUMAN;.	N	42;43;23	ENSP00000248450:D42N;ENSP00000403343:D43N;ENSP00000416394:D23N	ENSP00000248450:D42N	D	-	1	0	AAMP	218842499	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.220000	0.78008	2.567000	0.86603	0.655000	0.94253	GAC	AAMP	-	NULL		0.602	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AAMP	HGNC	protein_coding	OTTHUMT00000338756.1	C	NM_001087		219134255	-1	no_errors	ENST00000248450	ensembl	human	known	70_37	missense	SNP	1.000	T
ABCA2	20	genome.wustl.edu	37	9	139912145	139912145	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:139912145C>T	ENST00000371605.3	-	16	2356		c.e16-1		ABCA2_ENST00000265662.5_Splice_Site|ABCA2_ENST00000341511.6_Splice_Site|ABCA2_ENST00000492260.1_5'Flank			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2						ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCTTCATCACCTGCGGGTGGG	0.701																																																	0													39.0	46.0	43.0					9																	139912145		1984	4141	6125	SO:0001630	splice_region_variant	20			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.2209-1G>A	9.37:g.139912145C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Splice_Site	SNP	-	e17-1	ENST00000371605.3	37	c.2212-1		9	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402130	0.62288	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	.	.	.	3.56	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6647	0.77221	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA2	139031966	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	6.860000	0.75473	1.996000	0.58369	0.313000	0.20887	.	ABCA2	-	-		0.701	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		C	NM_001606	Intron	139912145	-1	no_errors	ENST00000265662	ensembl	human	known	70_37	splice_site	SNP	1.000	T
ABCA7	10347	genome.wustl.edu	37	19	1043092	1043092	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:1043092G>A	ENST00000263094.6	+	8	863	c.632G>A	c.(631-633)cGa>cAa	p.R211Q	ABCA7_ENST00000433129.1_Missense_Mutation_p.R211Q|ABCA7_ENST00000435683.2_Missense_Mutation_p.R73Q	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	211					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAGACCCCGAGGGACCAGC	0.647																																																	0													33.0	38.0	36.0					19																	1043092		2201	4300	6501	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.632G>A	19.37:g.1043092G>A	ENSP00000263094:p.Arg211Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R211Q	ENST00000263094.6	37	c.632	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328026	0.24080	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86097	-2.07;-2.07	4.1	-7.21	0.01490	.	.	.	.	.	T	0.63698	0.2533	N	0.19112	0.55	0.09310	N	1	B;B	0.17465	0.022;0.001	B;B	0.06405	0.002;0.0	T	0.52109	-0.8619	9	0.17369	T	0.5	.	1.1829	0.01849	0.3945:0.2605:0.2143:0.1307	.	73;211	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	Q	211	ENSP00000263094:R211Q;ENSP00000414062:R211Q	ENSP00000263094:R211Q	R	+	2	0	ABCA7	994092	0.000000	0.05858	0.001000	0.08648	0.040000	0.13550	-2.347000	0.01095	-0.667000	0.05303	0.313000	0.20887	CGA	ABCA7	-	NULL		0.647	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	G	NM_019112		1043092	+1	no_errors	ENST00000263094	ensembl	human	known	70_37	missense	SNP	0.000	A
ACBD3	64746	genome.wustl.edu	37	1	226353582	226353582	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:226353582C>G	ENST00000366812.5	-	2	460	c.406G>C	c.(406-408)Gat>Cat	p.D136H		NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	136	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		CCCAACACATCAAAGAATCCA	0.388																																																	0													122.0	116.0	118.0					1																	226353582		2203	4300	6503	SO:0001583	missense	64746			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.406G>C	1.37:g.226353582C>G	ENSP00000355777:p.Asp136His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_GOLD,superfamily_Acyl-CoA-binding_protein,pfscan_GOLD	p.D136H	ENST00000366812.5	37	c.406	CCDS1551.1	1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999556	0.93227	.	.	ENSG00000182827	ENST00000366812	T	0.27402	1.67	5.9	5.9	0.94986	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (3);	0.000000	0.85682	D	0.000000	T	0.70360	0.3215	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78861	-0.2037	10	0.87932	D	0	-31.348	20.2704	0.98474	0.0:1.0:0.0:0.0	.	136	Q9H3P7	GCP60_HUMAN	H	136	ENSP00000355777:D136H	ENSP00000355777:D136H	D	-	1	0	ACBD3	224420205	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.023000	0.70848	2.793000	0.96121	0.591000	0.81541	GAT	ACBD3	-	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein		0.388	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD3	HGNC	protein_coding	OTTHUMT00000091528.1	C	NM_022735		226353582	-1	no_errors	ENST00000366812	ensembl	human	known	70_37	missense	SNP	1.000	G
ACIN1	22985	genome.wustl.edu	37	14	23548958	23548958	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:23548958G>C	ENST00000262710.1	-	6	2087	c.1760C>G	c.(1759-1761)tCc>tGc	p.S587C	ACIN1_ENST00000605057.1_Missense_Mutation_p.S529C|ACIN1_ENST00000457657.1_Missense_Mutation_p.S547C|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.S587C	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	587	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TCTAGAACTGGAGGAGGAAGA	0.512																																																	0													201.0	190.0	194.0					14																	23548958		2203	4300	6503	SO:0001583	missense	22985			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1760C>G	14.37:g.23548958G>C	ENSP00000262710:p.Ser587Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.S587C	ENST00000262710.1	37	c.1760	CCDS9587.1	14	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574468	0.65878	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.36340	1.27;1.42;1.26	5.42	5.42	0.78866	.	0.000000	0.40554	N	0.001066	T	0.46983	0.1421	L	0.27053	0.805	0.54753	D	0.999987	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.987;0.987	T	0.42498	-0.9448	10	0.62326	D	0.03	-3.4993	14.5948	0.68397	0.0:0.0:1.0:0.0	.	587;587;547	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	C	587;547;587	ENSP00000262710:S587C;ENSP00000405677:S547C;ENSP00000451328:S587C	ENSP00000262710:S587C	S	-	2	0	ACIN1	22618798	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.235000	0.58666	2.821000	0.97095	0.650000	0.86243	TCC	ACIN1	-	NULL		0.512	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACIN1	HGNC	protein_coding	OTTHUMT00000071707.3	G	NM_014977		23548958	-1	no_errors	ENST00000262710	ensembl	human	known	70_37	missense	SNP	1.000	C
ACO1	48	genome.wustl.edu	37	9	32418333	32418333	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:32418333C>T	ENST00000309951.6	+	6	620	c.482C>T	c.(481-483)tCc>tTc	p.S161F	ACO1_ENST00000379923.1_Missense_Mutation_p.S161F|ACO1_ENST00000541043.1_Missense_Mutation_p.S62F	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	161					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		CAGTGGGGTTCCCAGGCTTTT	0.483																																																	0													60.0	63.0	62.0					9																	32418333		2203	4300	6503	SO:0001583	missense	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.482C>T	9.37:g.32418333C>T	ENSP00000309477:p.Ser161Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.S161F	ENST00000309951.6	37	c.482	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	C	29.3	4.990646	0.93106	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.17528	2.27;2.27;2.27	6.08	6.08	0.98989	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.000000	0.85682	D	0.000000	T	0.57607	0.2065	H	0.96175	3.78	0.80722	D	1	D	0.59767	0.986	D	0.67548	0.952	T	0.70055	-0.4977	10	0.87932	D	0	-11.5189	19.4349	0.94788	0.0:1.0:0.0:0.0	.	161	P21399	ACOC_HUMAN	F	197;161;161;161;62	ENSP00000309477:S161F;ENSP00000369255:S161F;ENSP00000438733:S62F	ENSP00000309477:S161F	S	+	2	0	ACO1	32408333	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.811000	0.86092	2.894000	0.99253	0.655000	0.94253	TCC	ACO1	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2		0.483	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	HGNC	protein_coding	OTTHUMT00000051998.3	C	NM_002197		32418333	+1	no_errors	ENST00000309951	ensembl	human	known	70_37	missense	SNP	1.000	T
ACSBG1	23205	genome.wustl.edu	37	15	78486929	78486929	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:78486929G>C	ENST00000258873.4	-	3	577	c.372C>G	c.(370-372)ttC>ttG	p.F124L	ACSBG1_ENST00000558828.1_5'Flank|ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	124					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CCTGGCGCTTGAAGCCCAAAG	0.597																																																	0													136.0	129.0	131.0					15																	78486929		2196	4293	6489	SO:0001583	missense	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.372C>G	15.37:g.78486929G>C	ENSP00000258873:p.Phe124Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.F124L	ENST00000258873.4	37	c.372	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	G	6.696	0.497097	0.12762	.	.	ENSG00000103740	ENST00000258873	T	0.11385	2.78	5.12	5.12	0.69794	.	0.165039	0.50627	D	0.000103	T	0.12732	0.0309	L	0.50333	1.59	0.80722	D	1	B;B	0.22541	0.066;0.071	B;B	0.25987	0.041;0.065	T	0.09509	-1.0671	10	0.11794	T	0.64	-30.7276	17.1444	0.86762	0.0:0.0:1.0:0.0	.	124;124	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	L	124	ENSP00000258873:F124L	ENSP00000258873:F124L	F	-	3	2	ACSBG1	76273984	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	2.914000	0.48797	2.380000	0.81148	0.655000	0.94253	TTC	ACSBG1	-	NULL		0.597	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	G	NM_015162		78486929	-1	no_errors	ENST00000258873	ensembl	human	known	70_37	missense	SNP	1.000	C
ACVR1B	91	genome.wustl.edu	37	12	52387888	52387888	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:52387888G>A	ENST00000257963.4	+	9	1589	c.1512G>A	c.(1510-1512)aaG>aaA	p.K504K	ACVR1B_ENST00000541224.1_Silent_p.K545K|ACVR1B_ENST00000542485.1_Silent_p.K452K	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	504					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	AAGACGTGAAGATCTAACTGC	0.607																																																	0													152.0	126.0	135.0					12																	52387888		2203	4300	6503	SO:0001819	synonymous_variant	91				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1512G>A	12.37:g.52387888G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K504	ENST00000257963.4	37	c.1512	CCDS8816.1	12																																																																																			ACVR1B	-	NULL		0.607	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	G	NM_020328		52387888	+1	no_errors	ENST00000257963	ensembl	human	known	70_37	silent	SNP	1.000	A
ADAD1	132612	genome.wustl.edu	37	4	123317485	123317485	+	Missense_Mutation	SNP	A	A	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:123317485A>G	ENST00000296513.2	+	7	862	c.677A>G	c.(676-678)gAa>gGa	p.E226G	ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388724.2_Missense_Mutation_p.E226G|ADAD1_ENST00000388725.2_Missense_Mutation_p.E208G	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	226					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						AATCGTTCAGAATACCTGAAA	0.269																																																	0													52.0	58.0	56.0					4																	123317485		2201	4291	6492	SO:0001583	missense	132612			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.677A>G	4.37:g.123317485A>G	ENSP00000296513:p.Glu226Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.E226G	ENST00000296513.2	37	c.677	CCDS34058.1	4	.	.	.	.	.	.	.	.	.	.	A	16.14	3.038925	0.55003	.	.	ENSG00000164113	ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T	0.34275	1.4;1.39;1.37	5.9	5.9	0.94986	Adenosine deaminase/editase (1);	0.213266	0.47455	D	0.000235	T	0.37100	0.0991	L	0.53249	1.67	0.42535	D	0.99305	B;B	0.14012	0.007;0.009	B;B	0.15052	0.012;0.007	T	0.12243	-1.0555	10	0.48119	T	0.1	-3.0869	15.3185	0.74102	1.0:0.0:0.0:0.0	.	226;226	Q96M93-2;Q96M93	.;ADAD1_HUMAN	G	226;226;226;208	ENSP00000296513:E226G;ENSP00000373376:E226G;ENSP00000373377:E208G	ENSP00000296513:E226G	E	+	2	0	ADAD1	123536935	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	3.671000	0.54576	2.260000	0.74910	0.533000	0.62120	GAA	ADAD1	-	smart_A_deamin		0.269	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	A	NM_139243		123317485	+1	no_errors	ENST00000296513	ensembl	human	known	70_37	missense	SNP	1.000	G
ADAM10	102	genome.wustl.edu	37	15	58920052	58920052	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:58920052C>G	ENST00000260408.3	-	10	1650	c.1207G>C	c.(1207-1209)Gaa>Caa	p.E403Q	ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000396140.2_Missense_Mutation_p.E102Q|ADAM10_ENST00000561288.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	403	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TTCTTAGATTCTCCTGGTGTG	0.348																																																	0													108.0	97.0	101.0					15																	58920052		2192	4292	6484	SO:0001583	missense	102			AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1207G>C	15.37:g.58920052C>G	ENSP00000260408:p.Glu403Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DU28|Q10742|Q92650	Missense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.E403Q	ENST00000260408.3	37	c.1207	CCDS10167.1	15	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551834	0.86127	.	.	ENSG00000137845	ENST00000260408;ENST00000396136;ENST00000396140	T;T	0.29655	1.56;1.56	5.52	5.52	0.82312	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	L	0.45470	1.425	0.80722	D	1	D;D	0.71674	0.998;0.982	D;D	0.70227	0.968;0.925	T	0.18871	-1.0323	10	0.24483	T	0.36	-26.8263	19.434	0.94783	0.0:1.0:0.0:0.0	.	102;403	B4DU28;O14672	.;ADA10_HUMAN	Q	403;222;102	ENSP00000260408:E403Q;ENSP00000379444:E102Q	ENSP00000260408:E403Q	E	-	1	0	ADAM10	56707344	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.463000	0.80869	2.590000	0.87494	0.563000	0.77884	GAA	ADAM10	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.348	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM10	HGNC	protein_coding	OTTHUMT00000255880.2	C	NM_001110		58920052	-1	no_errors	ENST00000260408	ensembl	human	known	70_37	missense	SNP	1.000	G
ADAM9	8754	genome.wustl.edu	37	8	38883375	38883375	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:38883375C>G	ENST00000487273.2	+	10	1046	c.968C>G	c.(967-969)tCa>tGa	p.S323*		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	323	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			ACAGTGTGTTCAAGGAGCCAC	0.383																																																	0													219.0	195.0	203.0					8																	38883375		2203	4300	6503	SO:0001587	stop_gained	8754			U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.968C>G	8.37:g.38883375C>G	ENSP00000419446:p.Ser323*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLN7|Q10718|Q8NFM6	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.S323*	ENST00000487273.2	37	c.968	CCDS6112.1	8	.	.	.	.	.	.	.	.	.	.	C	38	6.921694	0.97936	.	.	ENSG00000168615	ENST00000487273	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.2907	0.94098	0.0:1.0:0.0:0.0	.	.	.	.	X	323	.	ENSP00000369249:S323X	S	+	2	0	ADAM9	39002532	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.440000	0.80464	2.575000	0.86900	0.655000	0.94253	TCA	ADAM9	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.383	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM9	HGNC	protein_coding	OTTHUMT00000357291.2	C			38883375	+1	no_errors	ENST00000487273	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ADAMTSL2	9719	genome.wustl.edu	37	9	136406068	136406068	+	Silent	SNP	C	C	T	rs143046395		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:136406068C>T	ENST00000354484.4	+	7	1184	c.627C>T	c.(625-627)gaC>gaT	p.D209D	ADAMTSL2_ENST00000393061.3_Silent_p.D318D|ADAMTSL2_ENST00000393060.1_Silent_p.D209D	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	209					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GCCAGGGGGACGGTAGCAGCT	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18798	0.0		0.0	False		,,,				2504	0.0																0								C	,	6,4400	9.9+/-24.2	0,6,2197	54.0	46.0	49.0		627,627	-0.3	1.0	9	dbSNP_134	49	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ADAMTSL2	NM_001145320.1,NM_014694.3	,	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	,	209/952,209/952	136406068	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	9719			AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.627C>T	9.37:g.136406068C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1B0D5|O60345	Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	p.D318	ENST00000354484.4	37	c.954	CCDS6976.1	9																																																																																			ADAMTSL2	-	prints_Peptidase_M12B_ADAM-TS		0.637	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL2	HGNC	protein_coding	OTTHUMT00000254619.1	C	NM_014694		136406068	+1	no_errors	ENST00000393061	ensembl	human	known	70_37	silent	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70890611	70890611	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:70890611G>A	ENST00000264436.4	-	16	2571	c.2127C>T	c.(2125-2127)ttC>ttT	p.F709F	ADD2_ENST00000407644.2_Silent_p.F709F	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	709	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						AGGGGGTTCGGAATTTCTTTT	0.527																																																	0													160.0	168.0	165.0					2																	70890611		2203	4300	6503	SO:0001819	synonymous_variant	119			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.2127C>T	2.37:g.70890611G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.F709	ENST00000264436.4	37	c.2127	CCDS1906.1	2																																																																																			ADD2	-	NULL		0.527	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	G	NM_001617		70890611	-1	no_errors	ENST00000264436	ensembl	human	known	70_37	silent	SNP	1.000	A
ADH6	130	genome.wustl.edu	37	4	100129809	100129809	+	Intron	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:100129809C>G	ENST00000237653.7	-	6	1213				ADH6_ENST00000407820.2_Intron|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Intron|ADH6_ENST00000394899.2_Intron|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000504257.1_5'UTR|RP11-696N14.1_ENST00000506454.1_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)						ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	AATTTTCACTCCAGAGGATTA	0.358																																																	0													97.0	104.0	101.0					4																	100129809		2203	4300	6503	SO:0001627	intron_variant	130			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.828+15G>C	4.37:g.100129809C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KS45|Q58F53	RNA	SNP	-	NULL	ENST00000237653.7	37	NULL	CCDS3647.1	4																																																																																			ADH6	-	-		0.358	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	HGNC	protein_coding	OTTHUMT00000253665.1	C	NM_000672		100129809	-1	no_errors	ENST00000504257	ensembl	human	putative	70_37	rna	SNP	0.000	G
ADH1B	125	genome.wustl.edu	37	4	100237074	100237074	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:100237074G>C	ENST00000305046.8	-	5	615	c.548C>G	c.(547-549)tCt>tGt	p.S183C	ADH1B_ENST00000504498.1_5'Flank|ADH1B_ENST00000394887.3_Missense_Mutation_p.S143C			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide	183					ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	GTTAACTGCAGACCCATAACC	0.478																																																	0													119.0	115.0	116.0					4																	100237074		2203	4300	6503	SO:0001583	missense	125			AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.548C>G	4.37:g.100237074G>C	ENSP00000306606:p.Ser183Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.S183C	ENST00000305046.8	37	c.548	CCDS34033.1	4	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869734	0.51588	.	.	ENSG00000196616	ENST00000305046;ENST00000394887;ENST00000412614	T;T	0.32753	1.44;1.44	3.96	3.1	0.35709	GroES-like (1);	0.052193	0.85682	D	0.000000	T	0.57036	0.2026	M	0.91972	3.26	0.43000	D	0.994518	B;P;P	0.44690	0.421;0.841;0.585	P;P;P	0.55112	0.659;0.769;0.64	T	0.66929	-0.5799	10	0.87932	D	0	-24.9955	13.3126	0.60388	0.0:0.1602:0.8397:0.0	.	170;143;183	F5HB16;A8MYN5;P00325	.;.;ADH1B_HUMAN	C	183;143;170	ENSP00000306606:S183C;ENSP00000378351:S143C	ENSP00000306606:S183C	S	-	2	0	ADH1B	100456097	1.000000	0.71417	0.956000	0.39512	0.611000	0.37282	8.876000	0.92379	0.598000	0.29829	0.561000	0.74099	TCT	ADH1B	-	superfamily_GroES-like,smart_PKS_ER		0.478	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH1B	HGNC	protein_coding	OTTHUMT00000364853.1	G	NM_000668		100237074	-1	no_errors	ENST00000305046	ensembl	human	known	70_37	missense	SNP	1.000	C
AEBP1	165	genome.wustl.edu	37	7	44149878	44149878	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:44149878G>C	ENST00000223357.3	+	11	1638	c.1333G>C	c.(1333-1335)Gag>Cag	p.E445Q	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_5'Flank	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	445	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCAGTGGATAGAGGTGGACAC	0.622																																																	0													120.0	102.0	108.0					7																	44149878		2203	4300	6503	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1333G>C	7.37:g.44149878G>C	ENSP00000223357:p.Glu445Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.E445Q	ENST00000223357.3	37	c.1333	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847125	0.32606	.	.	ENSG00000106624	ENST00000223357	D	0.97665	-4.48	5.11	5.11	0.69529	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.130424	0.52532	D	0.000076	D	0.91168	0.7218	N	0.01146	-0.985	0.80722	D	1	P	0.38223	0.623	P	0.44647	0.456	D	0.91507	0.5224	10	0.27082	T	0.32	-40.0163	14.6411	0.68726	0.0:0.1464:0.8536:0.0	.	445	Q8IUX7	AEBP1_HUMAN	Q	445	ENSP00000223357:E445Q	ENSP00000223357:E445Q	E	+	1	0	AEBP1	44116403	1.000000	0.71417	0.963000	0.40424	0.792000	0.44763	4.537000	0.60643	2.389000	0.81357	0.462000	0.41574	GAG	AEBP1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.622	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	G	NM_001129		44149878	+1	no_errors	ENST00000223357	ensembl	human	known	70_37	missense	SNP	0.974	C
AGTPBP1	23287	genome.wustl.edu	37	9	88190252	88190252	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:88190252C>G	ENST00000357081.3	-	25	3625	c.3481G>C	c.(3481-3483)Gaa>Caa	p.E1161Q	AGTPBP1_ENST00000376083.3_Missense_Mutation_p.E1121Q|AGTPBP1_ENST00000432218.1_Intron|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.E1173Q			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1161					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						CAGCTTGATTCAATTAAATCA	0.313																																																	0													75.0	78.0	77.0					9																	88190252		2203	4300	6503	SO:0001583	missense	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.3481G>C	9.37:g.88190252C>G	ENSP00000349592:p.Glu1161Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.E1173Q	ENST00000357081.3	37	c.3517		9	.	.	.	.	.	.	.	.	.	.	C	25.6	4.658576	0.88154	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109	T;T;T	0.22134	2.0;2.0;1.97	6.07	6.07	0.98685	.	0.201110	0.52532	D	0.000079	T	0.29684	0.0741	L	0.27053	0.805	0.80722	D	1	P;D;D	0.60575	0.931;0.98;0.988	P;P;P	0.54706	0.464;0.677;0.759	T	0.00379	-1.1777	10	0.33141	T	0.24	-30.1459	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1173;1161;1121	Q9UPW5-3;Q9UPW5;Q9UPW5-2	.;CBPC1_HUMAN;.	Q	1161;1121;1173	ENSP00000349592:E1161Q;ENSP00000365251:E1121Q;ENSP00000365277:E1173Q	ENSP00000349592:E1161Q	E	-	1	0	AGTPBP1	87380072	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.015000	0.76387	2.885000	0.99019	0.655000	0.94253	GAA	AGTPBP1	-	NULL		0.313	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	C	NM_015239		88190252	-1	no_errors	ENST00000376109	ensembl	human	known	70_37	missense	SNP	1.000	G
AHCTF1	25909	genome.wustl.edu	37	1	247002960	247002960	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:247002960C>T	ENST00000391829.2	-	0	8072				AHCTF1_ENST00000326225.3_3'UTR|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_3'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1						cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GCATATGCTTCACATTAAAAT	0.308																																					Colon(145;197 1800 4745 15099 26333)												0																																										SO:0001624	3_prime_UTR_variant	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.*1148G>A	1.37:g.247002960C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	RNA	SNP	-	NULL	ENST00000391829.2	37	NULL		1																																																																																			AHCTF1	-	-		0.308	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		C	NM_015446		247002960	-1	no_errors	ENST00000470300	ensembl	human	known	70_37	rna	SNP	0.003	T
AKAP7	9465	genome.wustl.edu	37	6	131466535	131466535	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:131466535G>C	ENST00000431975.2	+	2	228	c.130G>C	c.(130-132)Gat>Cat	p.D44H	AKAP7_ENST00000366358.2_3'UTR|AKAP7_ENST00000368123.4_Missense_Mutation_p.D22H|AKAP7_ENST00000541650.1_Missense_Mutation_p.D43H	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	44						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		TGCTACTGTAGATATTCAGGA	0.299																																																	0													153.0	152.0	152.0					6																	131466535		2203	4295	6498	SO:0001583	missense	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.130G>C	6.37:g.131466535G>C	ENSP00000405252:p.Asp44His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUC3|Q9HCZ8	Missense_Mutation	SNP	pfam_Kinase-A_anchor_nucl_local_sig,pfam_Kinase-A_anchor_RI-RII-bd_dom,superfamily_RNA_ligase/cNuc_Pdiesterase	p.D22H	ENST00000431975.2	37	c.64	CCDS5142.2	6	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542647	0.65198	.	.	ENSG00000118507	ENST00000431975;ENST00000541650;ENST00000368123	T;T;T	0.37411	1.27;1.22;1.2	5.15	4.28	0.50868	Protein kinase A anchor protein, nuclear localisation signal domain (1);	0.400747	0.25299	N	0.031675	T	0.28732	0.0712	L	0.32530	0.975	0.36601	D	0.874696	D	0.71674	0.998	P	0.58013	0.831	T	0.19289	-1.0310	10	0.87932	D	0	-6.2839	9.4943	0.38978	0.0949:0.0:0.9051:0.0	.	44	Q9P0M2	AKA7G_HUMAN	H	44;43;22	ENSP00000405252:D44H;ENSP00000441048:D43H;ENSP00000357105:D22H	ENSP00000357105:D22H	D	+	1	0	AKAP7	131508228	1.000000	0.71417	0.961000	0.40146	0.885000	0.51271	2.386000	0.44380	1.540000	0.49301	0.655000	0.94253	GAT	AKAP7	-	pfam_Kinase-A_anchor_nucl_local_sig		0.299	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AKAP7	HGNC	protein_coding	OTTHUMT00000042209.2	G	NM_004842		131466535	+1	no_errors	ENST00000368123	ensembl	human	known	70_37	missense	SNP	0.983	C
AKT1	207	genome.wustl.edu	37	14	105258937	105258937	+	Missense_Mutation	SNP	C	C	T	rs368797346		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:105258937C>T	ENST00000554581.1	-	1	1524	c.44G>A	c.(43-45)cGa>cAa	p.R15Q	AKT1_ENST00000349310.3_Missense_Mutation_p.R15Q|AKT1_ENST00000402615.2_Missense_Mutation_p.R15Q|AKT1_ENST00000554848.1_Missense_Mutation_p.R15Q|AKT1_ENST00000407796.2_Missense_Mutation_p.R15Q|AKT1_ENST00000555528.1_Missense_Mutation_p.R15Q			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	15	Inositol-(1,3,4,5)-tetrakisphosphate binding.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	GTACTAACCTCGTTTGTGCAG	0.677		1	Mis		"""breast, colorectal, ovarian, NSCLC"""																																			Dom	yes		14	14q32.32	207	v-akt murine thymoma viral oncogene homolog 1		E	0								C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	108.0	92.0	97.0		44,44,44	2.5	1.0	14		97	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	AKT1	NM_001014431.1,NM_001014432.1,NM_005163.2	43,43,43	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	15/481,15/481,15/481	105258937	1,13001	2203	4298	6501	SO:0001583	missense	207			M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.44G>A	14.37:g.105258937C>T	ENSP00000451828:p.Arg15Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAM5|B7Z5R1|Q9BWB6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.R15Q	ENST00000554581.1	37	c.44	CCDS9994.1	14	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531238	0.45073	0.0	1.16E-4	ENSG00000142208	ENST00000554581;ENST00000407796;ENST00000349310;ENST00000402615;ENST00000555528;ENST00000554848;ENST00000555926	T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	2.54	2.54	0.30619	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.239831	0.26052	N	0.026624	T	0.55449	0.1921	L	0.28608	0.87	0.53005	D	0.999965	P	0.36125	0.538	B	0.34452	0.183	T	0.51896	-0.8647	10	0.31617	T	0.26	.	5.3462	0.16010	0.0:0.8416:0.0:0.1584	.	15	P31749	AKT1_HUMAN	Q	15	ENSP00000451828:R15Q;ENSP00000384293:R15Q;ENSP00000270202:R15Q;ENSP00000385326:R15Q;ENSP00000450688:R15Q;ENSP00000451166:R15Q;ENSP00000451824:R15Q	ENSP00000270202:R15Q	R	-	2	0	AKT1	104329982	0.993000	0.37304	0.986000	0.45419	0.776000	0.43924	2.369000	0.44231	1.725000	0.51514	0.511000	0.50034	CGA	AKT1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.677	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKT1	HGNC	protein_coding	OTTHUMT00000410418.1	C	NM_005163		105258937	-1	no_errors	ENST00000349310	ensembl	human	known	70_37	missense	SNP	0.997	T
ANK3	288	genome.wustl.edu	37	10	61832718	61832718	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:61832718C>T	ENST00000280772.2	-	37	8112	c.7921G>A	c.(7921-7923)Gca>Aca	p.A2641T	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2641					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCATTGGATGCCAGCAGTTCT	0.537																																																	0													106.0	82.0	90.0					10																	61832718		2203	4300	6503	SO:0001583	missense	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7921G>A	10.37:g.61832718C>T	ENSP00000280772:p.Ala2641Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.A2641T	ENST00000280772.2	37	c.7921	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	4.338	0.062096	0.08339	.	.	ENSG00000151150	ENST00000280772	T	0.63096	-0.02	5.93	3.75	0.43078	.	0.350494	0.20655	N	0.088138	T	0.33000	0.0848	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.12553	-1.0543	10	0.12430	T	0.62	.	4.1976	0.10450	0.2404:0.5216:0.1177:0.1203	.	2641	Q12955	ANK3_HUMAN	T	2641	ENSP00000280772:A2641T	ENSP00000280772:A2641T	A	-	1	0	ANK3	61502724	0.000000	0.05858	0.790000	0.31976	0.009000	0.06853	0.654000	0.24918	1.507000	0.48752	0.561000	0.74099	GCA	ANK3	-	NULL		0.537	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	C	NM_020987		61832718	-1	no_errors	ENST00000280772	ensembl	human	known	70_37	missense	SNP	0.002	T
ANKRD13C	81573	genome.wustl.edu	37	1	70819990	70819990	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:70819990G>A	ENST00000370944.4	-	1	415	c.102C>T	c.(100-102)ctC>ctT	p.L34L	HHLA3_ENST00000361764.4_5'Flank|ANKRD13C_ENST00000262346.6_Silent_p.L34L|HHLA3_ENST00000359875.5_5'Flank|HHLA3_ENST00000531950.1_5'Flank|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000370940.5_5'Flank	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	34					protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						AGGTACCGCCGAGGGCAGCCG	0.607																																																	0													36.0	44.0	41.0					1																	70819990		2203	4299	6502	SO:0001819	synonymous_variant	81573				CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.102C>T	1.37:g.70819990G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Silent	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L34	ENST00000370944.4	37	c.102	CCDS648.2	1																																																																																			ANKRD13C	-	NULL		0.607	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13C	HGNC	protein_coding	OTTHUMT00000025903.1	G	NM_030816		70819990	-1	no_errors	ENST00000370944	ensembl	human	known	70_37	silent	SNP	1.000	A
ANKRD36	375248	genome.wustl.edu	37	2	97866212	97866212	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:97866212C>G	ENST00000461153.2	+	46	3051	c.2807C>G	c.(2806-2808)tCt>tGt	p.S936C	ANKRD36_ENST00000420699.2_Missense_Mutation_p.S936C			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	936										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GAGAAGGATTCTTTTTCGAAT	0.323																																																	0													134.0	135.0	135.0					2																	97866212		692	1591	2283	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2807C>G	2.37:g.97866212C>G	ENSP00000419530:p.Ser936Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S936C	ENST00000461153.2	37	c.2807	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	8.976	0.974152	0.18736	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.79352	-1.26;-1.26	0.85	-0.149	0.13420	.	.	.	.	.	T	0.73265	0.3565	L	0.42245	1.32	0.09310	N	1	D	0.62365	0.991	P	0.52710	0.707	T	0.62416	-0.6859	9	0.72032	D	0.01	.	3.1025	0.06330	0.0:0.6524:0.0:0.3476	.	936	A6QL64	AN36A_HUMAN	C	936;936;298	ENSP00000419530:S936C;ENSP00000391950:S936C	ENSP00000391950:S936C	S	+	2	0	ANKRD36	97229939	0.002000	0.14202	0.039000	0.18376	0.011000	0.07611	0.597000	0.24059	-0.068000	0.12953	0.162000	0.16502	TCT	ANKRD36	-	NULL		0.323	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	C			97866212	+1	no_errors	ENST00000420699	ensembl	human	known	70_37	missense	SNP	0.052	G
ANKRD36B	57730	genome.wustl.edu	37	2	98206253	98206253	+	RNA	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:98206253G>A	ENST00000443455.1	-	0	74							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		CGCCTCCGAAGAGCAACAACA	0.612																																																	0																																												57730			AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98206253G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	SNP	-	NULL	ENST00000443455.1	37	NULL		2																																																																																			ANKRD36B	-	-		0.612	ANKRD36B-003	KNOWN	basic	processed_transcript	ANKRD36B	HGNC	pseudogene	OTTHUMT00000328967.2	G	NM_025190		98206253	-1	no_errors	ENST00000419390	ensembl	human	known	70_37	rna	SNP	0.011	A
ANKRD40	91369	genome.wustl.edu	37	17	48784890	48784890	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:48784890G>C	ENST00000285243.6	-	1	395	c.126C>G	c.(124-126)gtC>gtG	p.V42V		NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	42										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			ACCAGCCGTTGACCTCATTTT	0.677																																																	0													123.0	104.0	110.0					17																	48784890		2203	4300	6503	SO:0001819	synonymous_variant	91369			BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.126C>G	17.37:g.48784890G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96E32	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V42	ENST00000285243.6	37	c.126	CCDS11572.1	17																																																																																			ANKRD40	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.677	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD40	HGNC	protein_coding	OTTHUMT00000368201.2	G	NM_052855		48784890	-1	no_errors	ENST00000285243	ensembl	human	known	70_37	silent	SNP	1.000	C
ANKRD44	91526	genome.wustl.edu	37	2	197964597	197964597	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:197964597C>T	ENST00000328737.2	-	10	1044	c.968G>A	c.(967-969)aGa>aAa	p.R323K	ANKRD44_ENST00000282272.8_Missense_Mutation_p.R340K|ANKRD44_ENST00000337207.5_Missense_Mutation_p.R323K|ANKRD44_ENST00000409919.1_Missense_Mutation_p.R348K|ANKRD44_ENST00000539527.1_Missense_Mutation_p.R276K|ANKRD44_ENST00000409153.1_Missense_Mutation_p.R348K|ANKRD44_ENST00000450567.1_Missense_Mutation_p.R323K			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	348										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATGACCGTATCTTGCAGCCAC	0.443																																																	0													159.0	145.0	150.0					2																	197964597		2203	4300	6503	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.968G>A	2.37:g.197964597C>T	ENSP00000331516:p.Arg323Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R323K	ENST00000328737.2	37	c.968		2	.	.	.	.	.	.	.	.	.	.	C	26.8	4.770196	0.90108	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886;ENST00000409153;ENST00000539527;ENST00000409919	T;T;T;T;T;T;T;T;T	0.65364	-0.1;-0.1;-0.15;-0.15;-0.15;-0.15;-0.1;-0.15;-0.15	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	L	0.31526	0.94	0.53005	D	0.999966	B;D;D	0.56035	0.318;0.974;0.974	B;D;D	0.72338	0.16;0.97;0.977	T	0.66329	-0.5951	10	0.29301	T	0.29	.	17.6819	0.88246	0.0:1.0:0.0:0.0	.	276;348;348	F5H682;Q8N8A2-3;Q8N8A2-2	.;.;.	K	145;340;323;323;323;46;348;276;348	ENSP00000403415:R145K;ENSP00000282272:R340K;ENSP00000331516:R323K;ENSP00000402420:R323K;ENSP00000338794:R323K;ENSP00000416319:R46K;ENSP00000387141:R348K;ENSP00000437825:R276K;ENSP00000387233:R348K	ENSP00000282272:R340K	R	-	2	0	ANKRD44	197672842	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.879000	0.69690	2.419000	0.82065	0.491000	0.48974	AGA	ANKRD44	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.443	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	HGNC	protein_coding	OTTHUMT00000335113.1	C	NM_153697		197964597	-1	no_errors	ENST00000328737	ensembl	human	known	70_37	missense	SNP	1.000	T
ANO2	57101	genome.wustl.edu	37	12	5908678	5908678	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:5908678G>A	ENST00000356134.5	-	11	1112	c.1041C>T	c.(1039-1041)ctC>ctT	p.L347L	ANO2_ENST00000327087.8_Silent_p.L346L|ANO2_ENST00000546188.1_Silent_p.L347L	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	351					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CTTACCTGATGAGGTCAATAG	0.413																																																	0													81.0	76.0	77.0					12																	5908678		1883	4109	5992	SO:0001819	synonymous_variant	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1041C>T	12.37:g.5908678G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C4N787|Q9H847	Silent	SNP	pfam_Anoctamin	p.L347	ENST00000356134.5	37	c.1041		12																																																																																			ANO2	-	NULL		0.413	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	G	NM_020373		5908678	-1	no_errors	ENST00000356134	ensembl	human	known	70_37	silent	SNP	1.000	A
ANO4	121601	genome.wustl.edu	37	12	101493441	101493441	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:101493441G>A	ENST00000392977.3	+	22	2302	c.2092G>A	c.(2092-2094)Gac>Aac	p.D698N	ANO4_ENST00000299222.9_Missense_Mutation_p.D218N|ANO4_ENST00000392979.3_Missense_Mutation_p.D663N|ANO4_ENST00000550015.1_Missense_Mutation_p.D218N			Q32M45	ANO4_HUMAN	anoctamin 4	698					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						ATGGGAAAAGGACTATAACCT	0.343										HNSCC(74;0.22)																																							0													98.0	98.0	98.0					12																	101493441		2203	4300	6503	SO:0001583	missense	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2092G>A	12.37:g.101493441G>A	ENSP00000376703:p.Asp698Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.D698N	ENST00000392977.3	37	c.2092		12	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641880	0.87859	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.79197	0.4405	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.77797	-0.2453	10	0.49607	T	0.09	.	20.0432	0.97601	0.0:0.0:1.0:0.0	.	218;698;663	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	N	663;218;698;218	ENSP00000376705:D663N;ENSP00000299222:D218N;ENSP00000376703:D698N;ENSP00000450192:D218N	ENSP00000299222:D218N	D	+	1	0	ANO4	100017572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.330000	0.96422	2.740000	0.93945	0.650000	0.86243	GAC	ANO4	-	pfam_Anoctamin		0.343	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	G	NM_178826		101493441	+1	no_errors	ENST00000392977	ensembl	human	known	70_37	missense	SNP	1.000	A
ANO9	338440	genome.wustl.edu	37	11	431747	431747	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:431747C>G	ENST00000332826.6	-	7	570	c.486G>C	c.(484-486)aaG>aaC	p.K162N		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	162					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						GCGCCCACGTCTTCTTCAGGC	0.672																																																	0													60.0	59.0	60.0					11																	431747		2203	4298	6501	SO:0001583	missense	338440			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.486G>C	11.37:g.431747C>G	ENSP00000332788:p.Lys162Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	pfam_Anoctamin	p.K162N	ENST00000332826.6	37	c.486	CCDS31326.1	11	.	.	.	.	.	.	.	.	.	.	C	6.361	0.434702	0.12045	.	.	ENSG00000185101	ENST00000332826	T	0.69040	-0.37	3.97	-5.88	0.02290	.	1.168980	0.06732	U	0.776742	T	0.44664	0.1304	N	0.20986	0.625	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.25502	-1.0130	10	0.36615	T	0.2	.	4.5712	0.12210	0.228:0.3781:0.0:0.3938	.	162	A1A5B4	ANO9_HUMAN	N	162	ENSP00000332788:K162N	ENSP00000332788:K162N	K	-	3	2	ANO9	421747	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.681000	0.05191	-0.922000	0.03789	-1.460000	0.01027	AAG	ANO9	-	NULL		0.672	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	C	NM_001012302		431747	-1	no_errors	ENST00000332826	ensembl	human	known	70_37	missense	SNP	0.000	G
APH1A	51107	genome.wustl.edu	37	1	150238976	150238976	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:150238976G>A	ENST00000369109.3	-	6	878	c.690C>T	c.(688-690)atC>atT	p.I230I	APH1A_ENST00000414276.2_Silent_p.I160I|APH1A_ENST00000461320.1_5'UTR|APH1A_ENST00000360244.4_Silent_p.I230I|C1orf54_ENST00000369102.1_5'Flank	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	230					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)	p.I230M(1)		breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCCAGCTGTGATGAAGGCCC	0.567																																																	1	Substitution - Missense(1)	urinary_tract(1)											60.0	66.0	64.0					1																	150238976		2031	4181	6212	SO:0001819	synonymous_variant	51107			AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.690C>T	1.37:g.150238976G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Silent	SNP	pfam_Aph-1	p.I230	ENST00000369109.3	37	c.690	CCDS41390.1	1																																																																																			APH1A	-	pfam_Aph-1		0.567	APH1A-002	KNOWN	basic|CCDS	protein_coding	APH1A	HGNC	protein_coding	OTTHUMT00000035048.1	G	NM_016022		150238976	-1	no_errors	ENST00000369109	ensembl	human	known	70_37	silent	SNP	1.000	A
ARHGEF12	23365	genome.wustl.edu	37	11	120350709	120350709	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:120350709G>A	ENST00000397843.2	+	38	3973	c.3807G>A	c.(3805-3807)ttG>ttA	p.L1269L	ARHGEF12_ENST00000532993.1_Silent_p.L1166L|ARHGEF12_ENST00000356641.3_Silent_p.L1250L	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1269					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AGCTAGGTTTGACTGAGAAGA	0.463			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													131.0	120.0	124.0					11																	120350709		1869	4100	5969	SO:0001819	synonymous_variant	23365			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.3807G>A	11.37:g.120350709G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O15086|Q6P526	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L1250	ENST00000397843.2	37	c.3750	CCDS41727.1	11																																																																																			ARHGEF12	-	NULL		0.463	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	G	NM_015313		120350709	+1	no_errors	ENST00000356641	ensembl	human	known	70_37	silent	SNP	0.352	A
ARL6IP1	23204	genome.wustl.edu	37	16	18804601	18804601	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:18804601G>C	ENST00000304414.7	-	6	796	c.585C>G	c.(583-585)ctC>ctG	p.L195L	ARL6IP1_ENST00000562819.1_Silent_p.L80L|ARL6IP1_ENST00000546206.2_Silent_p.L166L|RP11-1035H13.3_ENST00000567078.2_Intron|RPS15A_ENST00000322989.4_5'Flank|RPS15A_ENST00000563390.1_5'Flank	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	195					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						CTTTTTGTTTGAGAAGTTTGT	0.383																																																	0													79.0	78.0	78.0					16																	18804601		2197	4300	6497	SO:0001819	synonymous_variant	23204			BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.585C>G	16.37:g.18804601G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Reticulon	p.L195	ENST00000304414.7	37	c.585	CCDS10572.1	16																																																																																			ARL6IP1	-	NULL		0.383	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP1	HGNC	protein_coding	OTTHUMT00000254156.2	G	NM_015161		18804601	-1	no_errors	ENST00000304414	ensembl	human	known	70_37	silent	SNP	1.000	C
ARNTL	406	genome.wustl.edu	37	11	13399978	13399978	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:13399978C>T	ENST00000403290.1	+	17	1864	c.1509C>T	c.(1507-1509)atC>atT	p.I503I	ARNTL_ENST00000403510.3_Silent_p.I459I|ARNTL_ENST00000361003.4_Silent_p.I385I|ARNTL_ENST00000396441.3_Silent_p.I502I|ARNTL_ENST00000401424.1_Silent_p.I460I|ARNTL_ENST00000389708.3_3'UTR|ARNTL_ENST00000403482.3_Silent_p.I501I|ARNTL_ENST00000389707.4_Silent_p.I502I			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	503					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		CTGAGGAAATCATGGAAATCC	0.502																																																	0													60.0	61.0	61.0					11																	13399978		2200	4294	6494	SO:0001819	synonymous_variant	406			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1509C>T	11.37:g.13399978C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Silent	SNP	pfam_PAS_fold,pfam_PAS_fold_3,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.I503	ENST00000403290.1	37	c.1509		11																																																																																			ARNTL	-	NULL		0.502	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	ARNTL	HGNC	protein_coding	OTTHUMT00000319173.1	C	NM_001178		13399978	+1	no_errors	ENST00000403290	ensembl	human	known	70_37	silent	SNP	1.000	T
ART4	420	genome.wustl.edu	37	12	14993819	14993819	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:14993819C>G	ENST00000228936.4	-	2	794	c.413G>C	c.(412-414)aGa>aCa	p.R138T	RP11-233G1.4_ENST00000444324.2_RNA|C12orf60_ENST00000527783.1_Intron	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	138					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						GGCCATGGCTCTAGTAAAGTC	0.438																																																	0													134.0	131.0	132.0					12																	14993819		2203	4300	6503	SO:0001583	missense	420			X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.413G>C	12.37:g.14993819C>G	ENSP00000228936:p.Arg138Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BZ50|Q9BZ51|Q9HB06	Missense_Mutation	SNP	pfam_ART,prints_ART	p.R138T	ENST00000228936.4	37	c.413	CCDS8668.1	12	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.509573	0.00984	.	.	ENSG00000111339	ENST00000228936;ENST00000420600	T;T	0.08008	3.14;3.14	4.35	-3.62	0.04543	.	1.346560	0.04235	N	0.335933	T	0.09949	0.0244	L	0.46157	1.445	0.09310	N	1	B;B	0.18310	0.027;0.027	B;B	0.22152	0.038;0.038	T	0.40664	-0.9551	10	0.28530	T	0.3	-11.1506	12.8299	0.57740	0.0:0.2167:0.0:0.7833	.	138;138	A8K6J7;Q93070	.;NAR4_HUMAN	T	138;121	ENSP00000228936:R138T;ENSP00000405689:R121T	ENSP00000228936:R138T	R	-	2	0	ART4	14885086	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.589000	0.05767	-0.781000	0.04548	-0.253000	0.11424	AGA	ART4	-	pfam_ART		0.438	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART4	HGNC	protein_coding	OTTHUMT00000400859.1	C	NM_021071		14993819	-1	no_errors	ENST00000228936	ensembl	human	known	70_37	missense	SNP	0.000	G
ARV1	64801	genome.wustl.edu	37	1	231131561	231131561	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:231131561G>T	ENST00000310256.2	+	4	561	c.504G>T	c.(502-504)atG>atT	p.M168I	ARV1_ENST00000366658.2_Missense_Mutation_p.M128I|ARV1_ENST00000497753.1_3'UTR	NM_022786.1	NP_073623.1	Q9H2C2	ARV1_HUMAN	ARV1 homolog (S. cerevisiae)	168					bile acid metabolic process (GO:0008206)|cholesterol transport (GO:0030301)|regulation of cholesterol metabolic process (GO:0090181)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|large_intestine(2)|lung(2)	7	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		AACGGCCCATGACGGCAAAAA	0.383																																																	0													77.0	75.0	76.0					1																	231131561		2203	4300	6503	SO:0001583	missense	64801			AF271780	CCDS1589.1	1q42.2	2014-02-03	2006-04-04		ENSG00000173409	ENSG00000173409			29561	protein-coding gene	gene with protein product		611647	"""ARV1 homolog (yeast)"""			11063737, 12145310, 20663892	Standard	NM_022786		Approved		uc001huh.3	Q9H2C2	OTTHUMG00000037837	ENST00000310256.2:c.504G>T	1.37:g.231131561G>T	ENSP00000312458:p.Met168Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAI4|Q5VSN7|Q5VSN8|Q5VSN9|Q5VSP0|Q5VSP2|Q9H2H2|Q9H5V6|Q9UFF5	Missense_Mutation	SNP	pfam_Arv1	p.M168I	ENST00000310256.2	37	c.504	CCDS1589.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.885|1.885	-0.457020|-0.457020	0.04540|0.04540	.|.	.|.	ENSG00000173409|ENSG00000173409	ENST00000310256;ENST00000366658|ENST00000450711;ENST00000435927	T;T|.	0.41758|.	0.99;0.99|.	5.62|5.62	2.62|2.62	0.31277|0.31277	.|.	0.864310|.	0.10737|.	N|.	0.639931|.	T|.	0.23727|.	0.0574|.	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|.	0.19516|.	-1.0303|.	10|.	0.31617|.	T|.	0.26|.	-15.4635|-15.4635	5.9709|5.9709	0.19351|0.19351	0.2866:0.151:0.5624:0.0|0.2866:0.151:0.5624:0.0	.|.	168|.	Q9H2C2|.	ARV1_HUMAN|.	I|L	168;128|165;188	ENSP00000312458:M168I;ENSP00000355618:M128I|.	ENSP00000312458:M168I|.	M|X	+|+	3|2	0|2	ARV1|ARV1	229198184|229198184	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.432000|0.432000	0.31715|0.31715	0.869000|0.869000	0.27996|0.27996	0.790000|0.790000	0.33803|0.33803	0.650000|0.650000	0.86243|0.86243	ATG|TGA	ARV1	-	pfam_Arv1		0.383	ARV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARV1	HGNC	protein_coding	OTTHUMT00000092362.2	G	NM_022786		231131561	+1	no_errors	ENST00000310256	ensembl	human	known	70_37	missense	SNP	0.000	T
ASMTL	8623	genome.wustl.edu	37	X	1531692	1531692	+	Silent	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:1531692G>T	ENST00000381317.3	-	12	1610	c.1578C>A	c.(1576-1578)atC>atA	p.I526I	ASMTL_ENST00000416733.2_Silent_p.I450I|ASMTL_ENST00000534940.1_Silent_p.I468I|ASMTL-AS1_ENST00000419737.2_RNA|ASMTL-AS1_ENST00000425740.2_RNA|ASMTL-AS1_ENST00000602357.1_RNA|ASMTL_ENST00000381333.4_Silent_p.I510I|ASMTL-AS1_ENST00000420411.2_RNA	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	526	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGTCATGCAGGATCCGGCACA	0.542																																																	0													171.0	183.0	179.0					X																	1531692		2029	4184	6213	SO:0001819	synonymous_variant	8623			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1578C>A	X.37:g.1531692G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	pfam_Maf,pfam_O_MeTrfase_2,tigrfam_Maf	p.I526	ENST00000381317.3	37	c.1578	CCDS43917.1	X																																																																																			ASMTL	-	pfam_O_MeTrfase_2		0.542	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	HGNC	protein_coding	OTTHUMT00000055595.1	G	NM_004192		1531692	-1	no_errors	ENST00000381317	ensembl	human	known	70_37	silent	SNP	0.992	T
ASTN1	460	genome.wustl.edu	37	1	176853535	176853535	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:176853535C>G	ENST00000367654.3	-	19	3401	c.3190G>C	c.(3190-3192)Gat>Cat	p.D1064H	ASTN1_ENST00000361833.2_Missense_Mutation_p.D1056H|ASTN1_ENST00000424564.2_Missense_Mutation_p.D1056H|ASTN1_ENST00000367657.3_Missense_Mutation_p.D1056H	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1064	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGGAGGTAATCTACAATCTGC	0.542																																																	0													162.0	135.0	144.0					1																	176853535		2203	4300	6503	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3190G>C	1.37:g.176853535C>G	ENSP00000356626:p.Asp1064His	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.D1064H	ENST00000367654.3	37	c.3190		1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574459	0.86542	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.79	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	L	0.58101	1.795	0.80722	D	1	P;P	0.49783	0.928;0.739	P;B	0.46253	0.509;0.412	T	0.54200	-0.8329	10	0.87932	D	0	-19.005	15.8509	0.78930	0.137:0.863:0.0:0.0	.	1056;1056	O14525-2;B1AJS1	.;.	H	1056;1056;1064;1056;1056	ENSP00000356629:D1056H;ENSP00000354536:D1056H;ENSP00000356626:D1064H;ENSP00000395041:D1056H	ENSP00000354536:D1056H	D	-	1	0	ASTN1	175120158	1.000000	0.71417	0.884000	0.34674	0.991000	0.79684	7.223000	0.78033	1.430000	0.47334	-0.181000	0.13052	GAT	ASTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.542	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		C	NM_004319		176853535	-1	no_errors	ENST00000367654	ensembl	human	known	70_37	missense	SNP	0.999	G
ATAD1	84896	genome.wustl.edu	37	10	89552437	89552437	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:89552437G>A	ENST00000308448.7	-	3	616	c.238C>T	c.(238-240)Ctt>Ttt	p.L80F	ATAD1_ENST00000400215.3_Missense_Mutation_p.L22F|ATAD1_ENST00000541004.1_Missense_Mutation_p.L80F|ATAD1_ENST00000495903.1_5'UTR|ATAD1_ENST00000328142.3_Missense_Mutation_p.L80F	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	80					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		GGGTCTACAAGATGAGCAGCA	0.348																																																	0													131.0	129.0	130.0					10																	89552437		2203	4300	6503	SO:0001583	missense	84896			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.238C>T	10.37:g.89552437G>A	ENSP00000339017:p.Leu80Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.L80F	ENST00000308448.7	37	c.238	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308328	0.60305	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.96745	-3.54;-3.54;-4.11;-3.82	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.95092	0.8410	L	0.49778	1.585	0.80722	D	1	B;P	0.46142	0.443;0.873	B;P	0.46975	0.38;0.533	D	0.93747	0.7055	9	.	.	.	-10.4649	13.2282	0.59927	0.0729:0.0:0.9271:0.0	.	22;80	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	F	80;80;22;80	ENSP00000339017:L80F;ENSP00000339016:L80F;ENSP00000412968:L22F;ENSP00000445500:L80F	.	L	-	1	0	ATAD1	89542417	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	4.725000	0.61979	2.798000	0.96311	0.650000	0.86243	CTT	ATAD1	-	NULL		0.348	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	HGNC	protein_coding	OTTHUMT00000049235.1	G	NM_032810		89552437	-1	no_errors	ENST00000308448	ensembl	human	known	70_37	missense	SNP	1.000	A
ATAD2	29028	genome.wustl.edu	37	8	124382145	124382145	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:124382145C>T	ENST00000287394.5	-	7	954	c.847G>A	c.(847-849)Gaa>Aaa	p.E283K	ATAD2_ENST00000534257.1_5'Flank|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	283	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ccatcttcttcatcttcatca	0.363																																																	0													279.0	215.0	237.0					8																	124382145		2203	4300	6503	SO:0001583	missense	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.847G>A	8.37:g.124382145C>T	ENSP00000287394:p.Glu283Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.E283K	ENST00000287394.5	37	c.847	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427961	0.25726	.	.	ENSG00000156802	ENST00000287394	T	0.09163	3.01	4.27	4.27	0.50696	.	1.535050	0.03153	N	0.168234	T	0.07052	0.0179	N	0.08118	0	0.80722	D	1	B;B	0.16396	0.006;0.017	B;B	0.14023	0.01;0.004	T	0.30179	-0.9987	10	0.15952	T	0.53	-0.3671	8.8631	0.35269	0.0:0.8925:0.0:0.1075	.	113;283	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	K	283	ENSP00000287394:E283K	ENSP00000287394:E283K	E	-	1	0	ATAD2	124451326	0.857000	0.29778	0.573000	0.28510	0.208000	0.24298	1.859000	0.39418	2.327000	0.79052	0.561000	0.74099	GAA	ATAD2	-	NULL		0.363	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	C	NM_014109		124382145	-1	no_errors	ENST00000287394	ensembl	human	known	70_37	missense	SNP	0.994	T
ATAD3B	83858	genome.wustl.edu	37	1	1425767	1425767	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:1425767G>A	ENST00000308647.7	+	14	1584	c.1468G>A	c.(1468-1470)Gac>Aac	p.D490N		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	490						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ACTGCATTTTGACAACTGTGT	0.592																																																	0													81.0	68.0	72.0					1																	1425767		2203	4299	6502	SO:0001583	missense	83858			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1468G>A	1.37:g.1425767G>A	ENSP00000311766:p.Asp490Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.D490N	ENST00000308647.7	37	c.1468	CCDS30.1	1	.	.	.	.	.	.	.	.	.	.	.	10.39	1.335793	0.24253	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.94687	-3.49	2.07	2.07	0.26955	.	0.000000	0.85682	D	0.000000	D	0.91171	0.7219	L	0.58669	1.825	0.80722	D	1	P;P	0.39181	0.663;0.533	B;B	0.37943	0.261;0.134	D	0.87911	0.2697	10	0.25106	T	0.35	.	11.3902	0.49809	0.0:0.0:1.0:0.0	.	444;490	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	N	293;490	ENSP00000311766:D490N	ENSP00000311766:D490N	D	+	1	0	ATAD3B	1415630	1.000000	0.71417	0.955000	0.39395	0.007000	0.05969	7.515000	0.81761	1.139000	0.42245	0.205000	0.17691	GAC	ATAD3B	-	NULL		0.592	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	G	NM_031921		1425767	+1	no_errors	ENST00000308647	ensembl	human	known	70_37	missense	SNP	1.000	A
ATM	472	genome.wustl.edu	37	11	108153542	108153542	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:108153542G>A	ENST00000452508.2	+	26	3871	c.3682G>A	c.(3682-3684)Gaa>Aaa	p.E1228K	ATM_ENST00000278616.4_Missense_Mutation_p.E1228K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1228					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCAAGATACTGAATACAACTT	0.274			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													73.0	75.0	74.0					11																	108153542		2199	4292	6491	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3682G>A	11.37:g.108153542G>A	ENSP00000388058:p.Glu1228Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E1228K	ENST00000452508.2	37	c.3682	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	6.125	0.391373	0.11581	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.70631	-0.5;-0.5;-0.5	5.27	4.35	0.52113	Armadillo-type fold (1);	0.404705	0.29328	N	0.012468	T	0.52141	0.1716	N	0.14661	0.345	0.25038	N	0.991229	B	0.02656	0.0	B	0.04013	0.001	T	0.26052	-1.0114	10	0.15952	T	0.53	.	14.2286	0.65875	0.0732:0.0:0.9268:0.0	.	1228	Q13315	ATM_HUMAN	K	1228	ENSP00000435747:E1228K;ENSP00000278616:E1228K;ENSP00000388058:E1228K	ENSP00000278616:E1228K	E	+	1	0	ATM	107658752	1.000000	0.71417	0.843000	0.33291	0.952000	0.60782	4.102000	0.57776	1.211000	0.43351	0.591000	0.81541	GAA	ATM	-	superfamily_ARM-type_fold		0.274	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	G	NM_000051		108153542	+1	no_errors	ENST00000278616	ensembl	human	known	70_37	missense	SNP	0.994	A
ATP12A	479	genome.wustl.edu	37	13	25262603	25262603	+	Silent	SNP	C	C	G	rs544490511		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:25262603C>G	ENST00000381946.3	+	4	542	c.375C>G	c.(373-375)ctC>ctG	p.L125L	ATP12A_ENST00000218548.6_Silent_p.L125L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	125					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GCGCCTTTCTCTGTTGGATTG	0.572																																					Pancreas(156;1582 1935 18898 22665 26498)												0													226.0	230.0	228.0					13																	25262603		2203	4300	6503	SO:0001819	synonymous_variant	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.375C>G	13.37:g.25262603C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.L125	ENST00000381946.3	37	c.375	CCDS31948.1	13																																																																																			ATP12A	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_cation-ex_asu_euk		0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	C	NM_001676		25262603	+1	no_errors	ENST00000218548	ensembl	human	known	70_37	silent	SNP	0.975	G
ATP5C1	509	genome.wustl.edu	37	10	7842008	7842008	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:7842008G>A	ENST00000356708.7	+	6	670	c.591G>A	c.(589-591)aaG>aaA	p.K197K	ATP5C1_ENST00000541227.1_Silent_p.K150K|ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000335698.4_Silent_p.K197K	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	197					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						TCTCCTATAAGACAGAAGAAA	0.299																																					Melanoma(143;1012 1820 16249 30920 33158)												0													109.0	116.0	113.0					10																	7842008		2203	4300	6503	SO:0001819	synonymous_variant	509			D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.591G>A	10.37:g.7842008G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Silent	SNP	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,prints_ATPase_F1-cplx_gsu,tigrfam_ATPase_F1-cplx_gsu	p.K197	ENST00000356708.7	37	c.591	CCDS31142.1	10																																																																																			ATP5C1	-	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,prints_ATPase_F1-cplx_gsu,tigrfam_ATPase_F1-cplx_gsu		0.299	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP5C1	HGNC	protein_coding	OTTHUMT00000046708.1	G	NM_005174		7842008	+1	no_errors	ENST00000356708	ensembl	human	known	70_37	silent	SNP	1.000	A
ATP6V1A	523	genome.wustl.edu	37	3	113513779	113513779	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:113513779C>G	ENST00000273398.3	+	9	1157	c.1049C>G	c.(1048-1050)tCt>tGt	p.S350C	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.S317C	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	350					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	ATGGCTGACTCTACCTCTAGA	0.418																																																	0													122.0	125.0	124.0					3																	113513779		2203	4300	6503	SO:0001583	missense	523			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1049C>G	3.37:g.113513779C>G	ENSP00000273398:p.Ser350Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.S350C	ENST00000273398.3	37	c.1049	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807806	0.90623	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	D;D	0.83837	-1.77;-1.77	5.62	5.62	0.85841	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95239	0.8456	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96834	0.9613	10	0.87932	D	0	-16.5117	19.6753	0.95930	0.0:1.0:0.0:0.0	.	350	P38606	VATA_HUMAN	C	67;350;317	ENSP00000273398:S350C;ENSP00000439874:S317C	ENSP00000273398:S350C	S	+	2	0	ATP6V1A	114996469	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.648000	0.89879	0.563000	0.77884	TCT	ATP6V1A	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_V1-cplx_asu		0.418	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	HGNC	protein_coding	OTTHUMT00000354457.1	C	NM_001690		113513779	+1	no_errors	ENST00000273398	ensembl	human	known	70_37	missense	SNP	1.000	G
AUNIP	79000	genome.wustl.edu	37	1	26161667	26161667	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:26161667G>A	ENST00000374298.3	-	3	945	c.891C>T	c.(889-891)gtC>gtT	p.V297V	AUNIP_ENST00000538789.1_Silent_p.V297V|AUNIP_ENST00000481602.1_Intron	NM_024037.1	NP_076942.1	Q9H7T9	AUNIP_HUMAN	aurora kinase A and ninein interacting protein	297	Interaction with AURKA.				spindle organization (GO:0007051)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)											TGTGGGCAATGACCCGCTGGC	0.478																																																	0													136.0	144.0	141.0					1																	26161667		2203	4300	6503	SO:0001819	synonymous_variant	79000				CCDS266.1, CCDS72731.1	1p36.11	2012-08-07	2012-08-07	2012-08-07	ENSG00000127423	ENSG00000127423			28363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 135"""	C1orf135		20596670	Standard	NM_001287490		Approved	MGC2603, AIBp	uc001bkw.1	Q9H7T9	OTTHUMG00000007372	ENST00000374298.3:c.891C>T	1.37:g.26161667G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9EI59|Q53F70	Silent	SNP	NULL	p.V297	ENST00000374298.3	37	c.891	CCDS266.1	1																																																																																			AUNIP	-	NULL		0.478	AUNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUNIP	HGNC	protein_coding	OTTHUMT00000019309.2	G	NM_024037		26161667	-1	no_errors	ENST00000538789	ensembl	human	known	70_37	silent	SNP	1.000	A
ATPIF1	93974	genome.wustl.edu	37	1	28562944	28562944	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:28562944G>A	ENST00000335514.5	+	2	211	c.160G>A	c.(160-162)Gaa>Aaa	p.E54K	ATPIF1_ENST00000468425.2_Missense_Mutation_p.E54K|ATPIF1_ENST00000497986.1_Missense_Mutation_p.E54K|ATPIF1_ENST00000465645.1_Missense_Mutation_p.E54K	NM_016311.4	NP_057395.1	Q9UII2	ATIF1_HUMAN	ATPase inhibitory factor 1	54					angiogenesis (GO:0001525)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of nucleotide metabolic process (GO:0045980)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|reactive oxygen species metabolic process (GO:0072593)	cell surface (GO:0009986)|mitochondrion (GO:0005739)	angiostatin binding (GO:0043532)|ATPase binding (GO:0051117)|ATPase inhibitor activity (GO:0042030)|calmodulin binding (GO:0005516)|enzyme inhibitor activity (GO:0004857)|protein homodimerization activity (GO:0042803)			lung(4)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|BRCA - Breast invasive adenocarcinoma(304;0.00574)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGAGCAGGCTGAAGAGGAACG	0.607																																																	0													66.0	70.0	69.0					1																	28562944		2203	4300	6503	SO:0001583	missense	93974			AL050386	CCDS319.1, CCDS320.1, CCDS44096.1	1p35.3	2011-07-04			ENSG00000130770	ENSG00000130770		"""Mitochondrial respiratory chain complex / Complex V"""	871	protein-coding gene	gene with protein product	"""ATPase inhibitor protein"", ""ATP synthase inhibitor protein"""	614981				10664857, 19559621	Standard	NM_016311		Approved	ATPI, IP, ATPIP, MGC1167, MGC8898	uc001bpq.3	Q9UII2	OTTHUMG00000003533	ENST00000335514.5:c.160G>A	1.37:g.28562944G>A	ENSP00000335203:p.Glu54Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JXL8|Q6IAQ7|Q9BSL9	Missense_Mutation	SNP	pfam_ATPase_inhibitor_IATP_mt	p.E54K	ENST00000335514.5	37	c.160	CCDS319.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.322814	0.97471	.	.	ENSG00000130770	ENST00000497986;ENST00000335514;ENST00000468425;ENST00000465645	D	0.92249	-3.0	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.95076	0.8405	L	0.53617	1.68	0.58432	D	0.999997	D;D	0.89917	0.998;1.0	D;D	0.87578	0.974;0.998	D	0.94883	0.8041	10	0.66056	D	0.02	-29.0523	17.8559	0.88762	0.0:0.0:1.0:0.0	.	54;54	Q9UII2;Q9UII2-2	ATIF1_HUMAN;.	K	54	ENSP00000335203:E54K	ENSP00000335203:E54K	E	+	1	0	ATPIF1	28435531	1.000000	0.71417	0.975000	0.42487	0.993000	0.82548	5.448000	0.66612	2.894000	0.99253	0.655000	0.94253	GAA	ATPIF1	-	pfam_ATPase_inhibitor_IATP_mt		0.607	ATPIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPIF1	HGNC	protein_coding	OTTHUMT00000009841.1	G	NM_016311		28562944	+1	no_errors	ENST00000335514	ensembl	human	known	70_37	missense	SNP	0.998	A
B3GNTL1	146712	genome.wustl.edu	37	17	80972369	80972369	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:80972369C>T	ENST00000320865.3	-	5	382	c.369G>A	c.(367-369)gtG>gtA	p.V123V	B3GNTL1_ENST00000576599.1_5'UTR|B3GNTL1_ENST00000571954.1_5'UTR	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	123							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GTTGCAGCCTCACCCGCTGGG	0.473																																																	0													123.0	95.0	104.0					17																	80972369		2202	4300	6502	SO:0001819	synonymous_variant	146712			AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.369G>A	17.37:g.80972369C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GV30|Q8WUT3	Silent	SNP	pfam_Glyco_trans_2	p.V123	ENST00000320865.3	37	c.369	CCDS32778.1	17																																																																																			B3GNTL1	-	pfam_Glyco_trans_2		0.473	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	HGNC	protein_coding	OTTHUMT00000438949.1	C	NM_001009905		80972369	-1	no_errors	ENST00000320865	ensembl	human	known	70_37	silent	SNP	1.000	T
BAAT	570	genome.wustl.edu	37	9	104124827	104124827	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:104124827C>G	ENST00000395051.3	-	3	1210	c.1140G>C	c.(1138-1140)ttG>ttC	p.L380F	BAAT_ENST00000259407.2_Missense_Mutation_p.L380F			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	380					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	AGTGTAACCTCAAATCGTGGG	0.537																																																	0													167.0	146.0	153.0					9																	104124827		2203	4300	6503	SO:0001583	missense	570			L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.1140G>C	9.37:g.104124827C>G	ENSP00000378491:p.Leu380Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3B7W9|Q96L31	Missense_Mutation	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	p.L380F	ENST00000395051.3	37	c.1140	CCDS6752.1	9	.	.	.	.	.	.	.	.	.	.	C	11.50	1.658485	0.29425	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.29142	1.58;1.58	4.86	-9.71	0.00518	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	3.343970	0.01211	N	0.007832	T	0.15869	0.0382	L	0.28115	0.83	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.10730	-1.0617	10	0.39692	T	0.17	6.0613	1.6147	0.02701	0.4166:0.2003:0.2258:0.1574	.	380	Q14032	BAAT_HUMAN	F	380	ENSP00000259407:L380F;ENSP00000378491:L380F	ENSP00000259407:L380F	L	-	3	2	BAAT	103164648	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.682000	0.00836	-2.094000	0.00854	-0.165000	0.13383	TTG	BAAT	-	pfam_BAAT_C,pirsf_Acyl-CoA_thioEstase_long-chain		0.537	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAAT	HGNC	protein_coding	OTTHUMT00000053433.1	C			104124827	-1	no_errors	ENST00000259407	ensembl	human	known	70_37	missense	SNP	0.000	G
BEND2	139105	genome.wustl.edu	37	X	18183237	18183237	+	Silent	SNP	G	G	A	rs367620811		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:18183237G>A	ENST00000380033.4	-	14	2424	c.2292C>T	c.(2290-2292)gaC>gaT	p.D764D		NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	764	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CCCTTCTGACGTCATGTCTAA	0.537																																																	0								G		1,3834		0,1,1631,571	188.0	165.0	173.0		2292	0.5	0.0	X		173	0,6728		0,0,2428,1872	no	coding-synonymous	BEND2	NM_153346.4		0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095		764/800	18183237	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	139105			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2292C>T	X.37:g.18183237G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PFY2|Q4V9S2|Q5JXE5	Silent	SNP	pfam_BEN_domain	p.D764	ENST00000380033.4	37	c.2292	CCDS14184.1	X																																																																																			BEND2	-	NULL		0.537	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	G	NM_153346		18183237	-1	no_errors	ENST00000380033	ensembl	human	known	70_37	silent	SNP	0.000	A
BMP4	652	genome.wustl.edu	37	14	54417513	54417513	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:54417513G>C	ENST00000245451.4	-	4	857	c.464C>G	c.(463-465)tCt>tGt	p.S155C	MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000417573.1_Missense_Mutation_p.S155C|BMP4_ENST00000558984.1_Missense_Mutation_p.S155C|BMP4_ENST00000559087.1_Missense_Mutation_p.S155C	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	155					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						AAGCTCTGCAGAGGAGATCAC	0.527																																																	0													42.0	40.0	41.0					14																	54417513		2203	4300	6503	SO:0001583	missense	652			AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.464C>G	14.37:g.54417513G>C	ENSP00000245451:p.Ser155Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UM80	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.S155C	ENST00000245451.4	37	c.464	CCDS9715.1	14	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760095	0.69763	.	.	ENSG00000125378	ENST00000245451;ENST00000417573	T;T	0.67698	-0.28;-0.28	5.2	5.2	0.72013	Transforming growth factor-beta, N-terminal (1);	0.053140	0.85682	D	0.000000	D	0.82728	0.5100	M	0.80982	2.52	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.84892	0.0837	10	0.87932	D	0	.	17.9063	0.88919	0.0:0.0:1.0:0.0	.	155	P12644	BMP4_HUMAN	C	155	ENSP00000245451:S155C;ENSP00000394165:S155C	ENSP00000245451:S155C	S	-	2	0	BMP4	53487263	1.000000	0.71417	0.806000	0.32338	0.987000	0.75469	9.648000	0.98483	2.711000	0.92665	0.655000	0.94253	TCT	BMP4	-	pfam_TGF-b_N		0.527	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP4	HGNC	protein_coding	OTTHUMT00000276894.2	G	NM_001202		54417513	-1	no_errors	ENST00000245451	ensembl	human	known	70_37	missense	SNP	0.996	C
BTN3A3	10384	genome.wustl.edu	37	6	26446130	26446130	+	Missense_Mutation	SNP	G	G	C	rs140844974		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:26446130G>C	ENST00000244519.2	+	5	875	c.632G>C	c.(631-633)aGa>aCa	p.R211T	BTN3A3_ENST00000339789.4_Missense_Mutation_p.R169T|BTN3A3_ENST00000361232.3_Missense_Mutation_p.R169T	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	211	Ig-like V-type 2.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						GTGATCATGAGAGGCAGCTCT	0.557																																																	0								G	,THR/ARG,THR/ARG	0,4406		0,0,2203	159.0	151.0	154.0		,632,506	-1.7	0.0	6	dbSNP_134	154	2,8598	2.2+/-6.3	0,2,4298	yes	intron,missense,missense	BTN3A3	NM_001242803.1,NM_006994.4,NM_197974.2	,71,71	0,2,6501	CC,CG,GG		0.0233,0.0,0.0154	,benign,benign	,211/585,169/536	26446130	2,13004	2203	4300	6503	SO:0001583	missense	10384			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.632G>C	6.37:g.26446130G>C	ENSP00000244519:p.Arg211Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.R211T	ENST00000244519.2	37	c.632	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	G	9.566	1.119764	0.20877	0.0	2.33E-4	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232;ENST00000496719;ENST00000476281;ENST00000487272	T;T;T;T;T	0.75260	3.43;3.43;3.43;-0.92;-0.92	3.06	-1.69	0.08186	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37320	0.0999	L	0.29908	0.895	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.14023	0.01;0.01	T	0.31558	-0.9939	9	0.45353	T	0.12	.	6.6539	0.22977	0.5331:0.0:0.4669:0.0	.	169;211	E9PCP5;O00478	.;BT3A3_HUMAN	T	211;169;169;211;117;169	ENSP00000244519:R211T;ENSP00000344968:R169T;ENSP00000355238:R169T;ENSP00000420147:R211T;ENSP00000419445:R169T	ENSP00000244519:R211T	R	+	2	0	BTN3A3	26554109	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-1.250000	0.02885	-0.244000	0.09639	0.456000	0.33151	AGA	BTN3A3	-	pfscan_Ig-like		0.557	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2	G	NM_006994		26446130	+1	no_errors	ENST00000244519	ensembl	human	known	70_37	missense	SNP	0.000	C
C10orf71	118461	genome.wustl.edu	37	10	50534536	50534536	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:50534536G>A	ENST00000374144.3	+	3	4234	c.3946G>A	c.(3946-3948)Gag>Aag	p.E1316K	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1316										endometrium(1)	1						CCCGTCCTCCGAGGGGGCCTC	0.632																																																	0													3.0	3.0	3.0					10																	50534536		621	1449	2070	SO:0001583	missense	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3946G>A	10.37:g.50534536G>A	ENSP00000363259:p.Glu1316Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVL8	Missense_Mutation	SNP	NULL	p.E1316K	ENST00000374144.3	37	c.3946	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	g	14.22	2.469364	0.43839	.	.	ENSG00000177354	ENST00000374144	T	0.45276	0.9	5.65	4.75	0.60458	.	0.634090	0.12999	U	0.421793	T	0.48909	0.1526	L	0.54323	1.7	0.24619	N	0.993685	.	.	.	.	.	.	T	0.43925	-0.9361	8	0.66056	D	0.02	.	11.4358	0.50068	0.1441:0.0:0.8559:0.0	.	.	.	.	K	1316	ENSP00000363259:E1316K	ENSP00000363259:E1316K	E	+	1	0	C10orf71	50204542	0.988000	0.35896	0.070000	0.20053	0.394000	0.30568	1.957000	0.40392	1.402000	0.46780	0.298000	0.19748	GAG	C10orf71	-	NULL		0.632	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	G	NM_199459		50534536	+1	no_errors	ENST00000374144	ensembl	human	known	70_37	missense	SNP	0.077	A
C19orf68	374920	genome.wustl.edu	37	19	48685724	48685724	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:48685724C>T	ENST00000328759.7	+	3	320	c.288C>T	c.(286-288)ccC>ccT	p.P96P	CARD8_ENST00000600800.1_5'UTR|ZNF114_ENST00000597695.1_Intron			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68	96					hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											CTCCCCAGCCCGGCTGCCCCG	0.612																																																	0																																										SO:0001819	synonymous_variant	374920			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.288C>T	19.37:g.48685724C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.P96	ENST00000328759.7	37	c.288		19																																																																																			C19orf68	-	NULL		0.612	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	C19orf68	HGNC	protein_coding	OTTHUMT00000465598.1	C	XM_001713770		48685724	+1	no_errors	ENST00000328759	ensembl	human	known	70_37	silent	SNP	0.974	T
C1RL	51279	genome.wustl.edu	37	12	7252370	7252370	+	Intron	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:7252370G>A	ENST00000266542.4	-	5	709				C1RL_ENST00000544702.1_Missense_Mutation_p.S217L|C1RL_ENST00000504702.2_5'Flank|C1RL_ENST00000545280.1_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGGCGTAAATGAGGAGAGGCA	0.547																																																	0													56.0	44.0	48.0					12																	7252370		2203	4300	6503	SO:0001627	intron_variant	51279			AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.617-14C>T	12.37:g.7252370G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53GX9	Missense_Mutation	SNP	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	p.S217L	ENST00000266542.4	37	c.650	CCDS8573.1	12	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040825	0.35989	.	.	ENSG00000139178	ENST00000544702	T	0.34275	1.37	3.66	3.66	0.41972	.	.	.	.	.	T	0.34803	0.0910	.	.	.	0.37087	D	0.899265	P	0.46784	0.884	P	0.45377	0.478	T	0.29941	-0.9995	7	.	.	.	.	11.1829	0.48638	0.0:0.0:1.0:0.0	.	217	F5GWF3	.	L	217	ENSP00000441885:S217L	.	S	-	2	0	C1RL	7143512	0.003000	0.15002	0.018000	0.16275	0.042000	0.13812	1.167000	0.31847	2.336000	0.79503	0.462000	0.41574	TCA	C1RL	-	NULL		0.547	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1RL	HGNC	protein_coding	OTTHUMT00000398367.1	G	NM_016546		7252370	-1	no_errors	ENST00000544702	ensembl	human	putative	70_37	missense	SNP	0.022	A
TANGO2	128989	genome.wustl.edu	37	22	20052087	20052087	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:20052087G>A	ENST00000327374.4	+	9	911	c.733G>A	c.(733-735)Gat>Aat	p.D245N	AC006547.13_ENST00000608610.1_RNA|AC006547.13_ENST00000600617.1_RNA|TANGO2_ENST00000398042.2_Missense_Mutation_p.D183N|AC006547.13_ENST00000609644.1_RNA|AC006547.13_ENST00000601746.1_RNA|TANGO2_ENST00000401833.1_Missense_Mutation_p.D286N|TANGO2_ENST00000432883.1_Missense_Mutation_p.D183N|AC006547.13_ENST00000600937.1_RNA|AC006547.13_ENST00000598339.1_RNA|AC006547.13_ENST00000609191.1_RNA|AC006547.13_ENST00000596334.1_RNA|TANGO2_ENST00000401886.1_Missense_Mutation_p.D183N|AC006547.13_ENST00000415503.1_RNA|AC006547.15_ENST00000600090.1_RNA|TANGO2_ENST00000434570.2_Silent_p.*199*|TANGO2_ENST00000456048.1_Missense_Mutation_p.D250N|AC006547.13_ENST00000595864.1_RNA|TANGO2_ENST00000447208.2_Missense_Mutation_p.D245N|TANGO2_ENST00000420290.2_Missense_Mutation_p.D147N	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	245			D -> E (in dbSNP:rs16982614).														CATCCTGGTAGATGCGGACGG	0.567																																																	0													141.0	108.0	119.0					22																	20052087		2203	4300	6503	SO:0001583	missense	128989				CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.733G>A	22.37:g.20052087G>A	ENSP00000332721:p.Asp245Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	pfam_DUF833	p.D250N	ENST00000327374.4	37	c.748	CCDS13772.1	22	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742539	0.69418	.	.	ENSG00000183597	ENST00000401886;ENST00000447208;ENST00000398042;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000420290;ENST00000456048	T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	4.64	4.64	0.57946	.	0.097074	0.64402	D	0.000002	T	0.50222	0.1603	M	0.77820	2.39	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.998;0.998;1.0	D;D;D;D;D	0.97110	1.0;0.936;0.973;0.951;1.0	T	0.49799	-0.8901	10	0.45353	T	0.12	-33.6807	12.9661	0.58485	0.0:0.0:1.0:0.0	.	147;286;250;245;183	B7Z583;B7WNV6;C9JC99;Q6ICL3;Q6ICL3-2	.;.;.;CV025_HUMAN;.	N	183;245;183;245;183;286;147;250	ENSP00000385662:D183N;ENSP00000389797:D245N;ENSP00000381122:D183N;ENSP00000332721:D245N;ENSP00000402926:D183N;ENSP00000384827:D286N;ENSP00000396182:D147N;ENSP00000403645:D250N	ENSP00000332721:D245N	D	+	1	0	C22orf25	18432087	1.000000	0.71417	0.910000	0.35882	0.036000	0.12997	6.696000	0.74598	2.424000	0.82194	0.549000	0.68633	GAT	C22orf25	-	pfam_DUF833		0.567	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf25	HGNC	protein_coding	OTTHUMT00000318689.2	G	NM_152906		20052087	+1	no_errors	ENST00000456048	ensembl	human	known	70_37	missense	SNP	0.996	A
C5orf34	375444	genome.wustl.edu	37	5	43506470	43506470	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:43506470C>T	ENST00000306862.2	-	4	687	c.312G>A	c.(310-312)gtG>gtA	p.V104V	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	104										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					TGGGCCATCTCACTTCTGTTA	0.393																																																	0													86.0	77.0	80.0					5																	43506470		2203	4300	6503	SO:0001819	synonymous_variant	375444			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.312G>A	5.37:g.43506470C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.V104	ENST00000306862.2	37	c.312	CCDS3946.1	5																																																																																			C5orf34	-	NULL		0.393	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf34	HGNC	protein_coding	OTTHUMT00000253843.1	C	NM_198566		43506470	-1	no_errors	ENST00000306862	ensembl	human	known	70_37	silent	SNP	0.012	T
DCANP1	140947	genome.wustl.edu	37	5	134782257	134782257	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:134782257G>A	ENST00000503143.2	-	1	781	c.542C>T	c.(541-543)tCa>tTa	p.S181L	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN		181	Ser-rich.					nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCATGGATCTGATGATTTCAG	0.493																																																	0													99.0	100.0	100.0					5																	134782257		2203	4300	6503	SO:0001583	missense	140947																														ENST00000503143.2:c.542C>T	5.37:g.134782257G>A	ENSP00000421871:p.Ser181Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S181L	ENST00000503143.2	37	c.542	CCDS4186.1	5	.	.	.	.	.	.	.	.	.	.	G	7.730	0.698989	0.15106	.	.	ENSG00000251380	ENST00000503143	T	0.38401	1.14	3.45	0.389	0.16269	.	.	.	.	.	T	0.16471	0.0396	N	0.08118	0	0.09310	N	0.999997	B	0.16603	0.018	B	0.16289	0.015	T	0.21314	-1.0249	9	0.87932	D	0	.	2.9884	0.05975	0.3066:0.2356:0.4579:0.0	.	181	Q8TF63	DCNP1_HUMAN	L	181	ENSP00000421871:S181L	ENSP00000421871:S181L	S	-	2	0	C5orf20	134810156	0.001000	0.12720	0.002000	0.10522	0.084000	0.17831	0.165000	0.16564	0.063000	0.16370	0.491000	0.48974	TCA	C5orf20	-	NULL		0.493	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf20	HGNC	protein_coding	OTTHUMT00000372531.1	G			134782257	-1	no_errors	ENST00000503143	ensembl	human	known	70_37	missense	SNP	0.002	A
C8orf34	116328	genome.wustl.edu	37	8	69537880	69537880	+	Intron	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:69537880C>T	ENST00000539993.1	+	8	1396				C8orf34_ENST00000518698.1_Intron|C8orf34_ENST00000337103.4_Intron|C8orf34_ENST00000325233.3_Silent_p.S23S			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			tgcatctcagcggtgggaaag	0.473																																																	0																																										SO:0001627	intron_variant	116328			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.848-14731C>T	8.37:g.69537880C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Silent	SNP	NULL	p.S23	ENST00000539993.1	37	c.69		8																																																																																			C8orf34	-	NULL		0.473	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		C	NM_052958		69537880	+1	no_errors	ENST00000325233	ensembl	human	known	70_37	silent	SNP	0.381	T
MROH6	642475	genome.wustl.edu	37	8	144654698	144654698	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:144654698C>T	ENST00000398882.3	-	1	443	c.187G>A	c.(187-189)Gcc>Acc	p.A63T	MROH6_ENST00000533679.1_5'Flank|NAPRT1_ENST00000460623.1_5'Flank|RP11-661A12.9_ENST00000531730.1_RNA	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	63																	TCAGAGGGGGCGGTGAGTGCC	0.706																																																	0													16.0	20.0	19.0					8																	144654698		1981	4147	6128	SO:0001583	missense	642475			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.187G>A	8.37:g.144654698C>T	ENSP00000381857:p.Ala63Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWB1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A63T	ENST00000398882.3	37	c.187	CCDS47928.1	8	.	.	.	.	.	.	.	.	.	.	c	9.824	1.186637	0.21870	.	.	ENSG00000204839	ENST00000398882;ENST00000529971	T;T	0.24151	4.17;1.87	2.79	-5.57	0.02521	.	.	.	.	.	T	0.08447	0.0210	N	0.08118	0	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.37572	-0.9700	9	0.08599	T	0.76	.	5.0843	0.14673	0.0:0.3796:0.2885:0.3319	.	63;63	E9PPP7;A6NGR9	.;CH073_HUMAN	T	63	ENSP00000381857:A63T;ENSP00000436959:A63T	ENSP00000381857:A63T	A	-	1	0	C8orf73	144725841	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.165000	0.03132	-1.150000	0.02840	-1.593000	0.00842	GCC	C8orf73	-	NULL		0.706	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf73	HGNC	protein_coding	OTTHUMT00000382330.3	C	NM_001100878		144654698	-1	no_errors	ENST00000398882	ensembl	human	known	70_37	missense	SNP	0.000	T
CACNA1H	8912	genome.wustl.edu	37	16	1262079	1262079	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:1262079C>T	ENST00000348261.5	+	25	4948	c.4700C>T	c.(4699-4701)gCg>gTg	p.A1567V	CACNA1H_ENST00000358590.4_Missense_Mutation_p.A1567V|CACNA1H_ENST00000565831.1_Missense_Mutation_p.A1567V	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1567					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CACCAGGAGGCGGAGGAGGCG	0.657																																																	0													118.0	123.0	121.0					16																	1262079		2143	4239	6382	SO:0001583	missense	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4700C>T	16.37:g.1262079C>T	ENSP00000334198:p.Ala1567Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.A1567V	ENST00000348261.5	37	c.4700	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	C	17.27	3.345911	0.61073	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96651	-4.08;-4.02	4.13	4.13	0.48395	.	0.206590	0.40469	N	0.001083	D	0.92996	0.7771	N	0.14661	0.345	0.37608	D	0.920811	D;P;B;P;B	0.67145	0.996;0.792;0.449;0.744;0.274	P;B;B;B;B	0.50082	0.63;0.126;0.029;0.119;0.177	D	0.92697	0.6171	10	0.23302	T	0.38	.	15.9029	0.79397	0.0:1.0:0.0:0.0	.	308;308;308;1567;1567	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	V	1567	ENSP00000334198:A1567V;ENSP00000351401:A1567V	ENSP00000334198:A1567V	A	+	2	0	CACNA1H	1202080	1.000000	0.71417	0.941000	0.38009	0.961000	0.63080	5.702000	0.68332	2.285000	0.76669	0.467000	0.42956	GCG	CACNA1H	-	prints_VDCC_T_a1su		0.657	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	C	NM_001005407		1262079	+1	no_errors	ENST00000348261	ensembl	human	known	70_37	missense	SNP	0.991	T
CACNA1I	8911	genome.wustl.edu	37	22	40068993	40068993	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:40068993C>G	ENST00000402142.3	+	28	4689	c.4689C>G	c.(4687-4689)gtC>gtG	p.V1563V	CACNA1I_ENST00000400164.3_Silent_p.V1528V|CACNA1I_ENST00000404898.1_Silent_p.V1528V|CACNA1I_ENST00000336649.4_Silent_p.V1569V|CACNA1I_ENST00000407673.1_Silent_p.V1528V|CACNA1I_ENST00000401624.1_Silent_p.V1563V	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1563					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TACTGTCAGTCATGGGCATCA	0.592																																																	0													83.0	86.0	85.0					22																	40068993		2143	4245	6388	SO:0001819	synonymous_variant	8911			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4689C>G	22.37:g.40068993C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.V1569	ENST00000402142.3	37	c.4707	CCDS46710.1	22																																																																																			CACNA1I	-	pfam_Ion_trans_dom		0.592	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	C	NM_001003406		40068993	+1	no_errors	ENST00000336649	ensembl	human	known	70_37	silent	SNP	1.000	G
CALB2	794	genome.wustl.edu	37	16	71408656	71408656	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:71408656G>C	ENST00000302628.4	+	3	257	c.180G>C	c.(178-180)aaG>aaC	p.K60N	CALB2_ENST00000349553.5_Missense_Mutation_p.K60N	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2	60					cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				AGATGTCAAAGAGTGACAACT	0.453																																																	0													76.0	70.0	72.0					16																	71408656		2198	4300	6498	SO:0001583	missense	794			X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.180G>C	16.37:g.71408656G>C	ENSP00000307508:p.Lys60Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4Y1|Q53HD2|Q96BK4	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.K60N	ENST00000302628.4	37	c.180	CCDS10899.1	16	.	.	.	.	.	.	.	.	.	.	G	8.286	0.816634	0.16607	.	.	ENSG00000172137	ENST00000349553;ENST00000302628	D;D	0.81908	-1.55;-1.54	5.49	4.53	0.55603	EF-hand-like domain (1);	0.171042	0.51477	D	0.000094	T	0.72930	0.3522	N	0.25647	0.755	0.31339	N	0.683919	P;B	0.41080	0.737;0.326	B;B	0.40782	0.34;0.222	T	0.70234	-0.4928	10	0.21540	T	0.41	-33.453	11.4132	0.49937	0.1581:0.0:0.8419:0.0	.	60;60	A6NER6;P22676	.;CALB2_HUMAN	N	60	ENSP00000340294:K60N;ENSP00000307508:K60N	ENSP00000307508:K60N	K	+	3	2	CALB2	69966157	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	2.439000	0.44846	0.691000	0.31592	-0.797000	0.03246	AAG	CALB2	-	NULL		0.453	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB2	HGNC	protein_coding	OTTHUMT00000268988.1	G	NM_001740		71408656	+1	no_errors	ENST00000302628	ensembl	human	known	70_37	missense	SNP	1.000	C
CAPRIN2	65981	genome.wustl.edu	37	12	30863277	30863277	+	Silent	SNP	T	T	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:30863277T>A	ENST00000298892.5	-	17	3543	c.2793A>T	c.(2791-2793)gcA>gcT	p.A931A	CAPRIN2_ENST00000395805.2_3'UTR|CAPRIN2_ENST00000417045.1_3'UTR|CAPRIN2_ENST00000251071.5_Silent_p.A981A|CAPRIN2_ENST00000308433.5_Silent_p.A647A	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GTATGGTGGCTGCTGGATTTG	0.542																																																	0													193.0	195.0	195.0					12																	30863277		2203	4300	6503	SO:0001819	synonymous_variant	65981			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2793A>T	12.37:g.30863277T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Caprin-1_C,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.A981	ENST00000298892.5	37	c.2943	CCDS8720.1	12																																																																																			CAPRIN2	-	NULL		0.542	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAPRIN2	HGNC	protein_coding	OTTHUMT00000402778.1	T	NM_023925		30863277	-1	no_errors	ENST00000251071	ensembl	human	known	70_37	silent	SNP	0.972	A
CASP8	841	genome.wustl.edu	37	2	202151270	202151270	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:202151270C>T	ENST00000432109.2	+	10	1582	c.1393C>T	c.(1393-1395)Cag>Tag	p.Q465*	CASP8_ENST00000264274.9_Nonsense_Mutation_p.Q381*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.Q450*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.Q524*|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264275.5_Nonsense_Mutation_p.Q482*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	465					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.Q482*(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ACAGATGCCTCAGCCTACTTT	0.373										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												1	Substitution - Nonsense(1)	breast(1)											205.0	182.0	190.0					2																	202151270		2203	4300	6503	SO:0001587	stop_gained	841			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1393C>T	2.37:g.202151270C>T	ENSP00000412523:p.Gln465*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.Q524*	ENST00000432109.2	37	c.1570	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833399	0.50951	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	.	.	.	5.86	5.86	0.93980	.	0.478710	0.24200	N	0.040632	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	20.1818	0.98206	0.0:1.0:0.0:0.0	.	.	.	.	X	450;381;465;482;524;450;244	.	ENSP00000264274:Q381X	Q	+	1	0	CASP8	201859515	0.797000	0.28877	0.987000	0.45799	0.013000	0.08279	1.536000	0.36072	2.759000	0.94783	0.650000	0.86243	CAG	CASP8	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_p10		0.373	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	C	NM_001228		202151270	+1	no_errors	ENST00000358485	ensembl	human	known	70_37	nonsense	SNP	0.996	T
CATSPER4	378807	genome.wustl.edu	37	1	26526400	26526400	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:26526400G>C	ENST00000456354.2	+	7	905	c.838G>C	c.(838-840)Gag>Cag	p.E280Q		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	280					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		ATATGCAATGGAGATTGGGGG	0.512																																																	0													109.0	82.0	91.0					1																	26526400		2203	4300	6503	SO:0001583	missense	378807			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.838G>C	1.37:g.26526400G>C	ENSP00000390423:p.Glu280Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4W6|Q5VY71	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.E280Q	ENST00000456354.2	37	c.838	CCDS30645.1	1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.868140	0.51588	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.98567	-5.0;-5.0	4.95	3.97	0.46021	Ion transport (1);	0.116764	0.38492	N	0.001662	D	0.96620	0.8897	N	0.17082	0.46	0.31688	N	0.642308	D;P	0.57899	0.981;0.946	P;P	0.60345	0.873;0.586	D	0.94821	0.7987	10	0.42905	T	0.14	-31.5328	10.7535	0.46223	0.0:0.1928:0.8072:0.0	.	280;264	Q7RTX7;Q7RTX7-2	CTSR4_HUMAN;.	Q	280	ENSP00000341006:E280Q;ENSP00000390423:E280Q	ENSP00000341006:E280Q	E	+	1	0	CATSPER4	26398987	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	1.482000	0.35486	2.462000	0.83206	0.467000	0.42956	GAG	CATSPER4	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.512	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER4	HGNC	protein_coding	OTTHUMT00000019849.2	G	NM_198137		26526400	+1	no_errors	ENST00000456354	ensembl	human	known	70_37	missense	SNP	0.998	C
CATSPERD	257062	genome.wustl.edu	37	19	5751739	5751739	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:5751739C>T	ENST00000381624.3	+	12	1130	c.1069C>T	c.(1069-1071)Cgt>Tgt	p.R357C	CATSPERD_ENST00000381614.2_Missense_Mutation_p.R15C	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	357					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											GACCCCACTGCGTGACACAGC	0.498																																																	0													60.0	57.0	58.0					19																	5751739		1870	4119	5989	SO:0001583	missense	257062			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1069C>T	19.37:g.5751739C>T	ENSP00000371037:p.Arg357Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRP1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.R357C	ENST00000381624.3	37	c.1069	CCDS12149.2	19	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683721	0.47991	.	.	ENSG00000174898	ENST00000394548;ENST00000381624;ENST00000381614	T;T	0.24350	1.86;1.86	3.53	-1.51	0.08664	.	3.533280	0.01196	U	0.007448	T	0.23249	0.0562	L	0.29908	0.895	0.09310	N	1	D;D	0.61697	0.976;0.99	B;P	0.47744	0.36;0.556	T	0.14755	-1.0461	10	0.51188	T	0.08	-0.3038	4.0321	0.09713	0.0:0.3932:0.3666:0.2402	.	283;357	B7WNK5;Q86XM0	.;TM146_HUMAN	C	283;357;15	ENSP00000371037:R357C;ENSP00000371027:R15C	ENSP00000371027:R15C	R	+	1	0	TMEM146	5702739	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.155000	0.03163	-0.259000	0.09432	0.453000	0.30009	CGT	CATSPERD	-	NULL		0.498	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CATSPERD	HGNC	protein_coding	OTTHUMT00000286953.2	C	NM_152784		5751739	+1	no_errors	ENST00000381624	ensembl	human	known	70_37	missense	SNP	0.000	T
CCDC168	643677	genome.wustl.edu	37	13	103384590	103384590	+	Missense_Mutation	SNP	G	G	A	rs574263368		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:103384590G>A	ENST00000322527.2	-	1	4569	c.4570C>T	c.(4570-4572)Cgt>Tgt	p.R1524C		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1524																	TGAGGTGAACGCATGATGGAA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		18614	0.001		0.0	False		,,,				2504	0.0																0													134.0	100.0	110.0					13																	103384590		692	1591	2283	SO:0001583	missense	643677				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.4570C>T	13.37:g.103384590G>A	ENSP00000320232:p.Arg1524Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.R1524C	ENST00000322527.2	37	c.4570		13	.	.	.	.	.	.	.	.	.	.	G	11.58	1.679586	0.29783	.	.	ENSG00000175820	ENST00000322527	T	0.03745	3.82	3.75	-1.91	0.07641	.	.	.	.	.	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	D	0.58268	0.982	P	0.45881	0.496	T	0.46965	-0.9153	9	0.62326	D	0.03	.	6.1216	0.20155	0.0:0.1037:0.5119:0.3844	.	1524	Q8NDH2	CC168_HUMAN	C	1524	ENSP00000320232:R1524C	ENSP00000320232:R1524C	R	-	1	0	CCDC168	102182591	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.369000	0.20416	-0.300000	0.08895	-1.404000	0.01136	CGT	CCDC168	-	NULL		0.348	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		G	NM_001146197		103384590	-1	no_errors	ENST00000322527	ensembl	human	known	70_37	missense	SNP	0.000	A
CCDC58	131076	genome.wustl.edu	37	3	122087074	122087074	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:122087074C>G	ENST00000291458.5	-	3	279	c.273G>C	c.(271-273)aaG>aaC	p.K91N	CCDC58_ENST00000479899.1_Missense_Mutation_p.K77N|CCDC58_ENST00000466854.1_5'Flank|CCDC58_ENST00000497726.1_Intron	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	91						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		CGTCCAAATTCTTTTCTCTCT	0.358																																																	0													91.0	92.0	91.0					3																	122087074		2203	4300	6503	SO:0001583	missense	131076			AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.273G>C	3.37:g.122087074C>G	ENSP00000291458:p.Lys91Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32LY6	Missense_Mutation	SNP	pfam_Caffeine_induced_death_Cid2	p.K91N	ENST00000291458.5	37	c.273	CCDS33838.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.51|14.51	2.557130|2.557130	0.45590|0.45590	.|.	.|.	ENSG00000160124|ENSG00000160124	ENST00000479414|ENST00000291458;ENST00000479899	.|.	.|.	.|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.043747	.|0.85682	.|D	.|0.000000	T|T	0.58821|0.58821	0.2149|0.2149	M|M	0.66939|0.66939	2.045|2.045	0.49213|0.49213	D|D	0.999769|0.999769	.|B	.|0.18968	.|0.032	.|B	.|0.21917	.|0.037	T|T	0.54456|0.54456	-0.8291|-0.8291	5|9	.|0.29301	.|T	.|0.29	.|.	11.2942|11.2942	0.49269|0.49269	0.0:0.9177:0.0:0.0823|0.0:0.9177:0.0:0.0823	.|.	.|91	.|Q4VC31	.|CCD58_HUMAN	Q|N	88|91;77	.|.	.|ENSP00000291458:K91N	E|K	-|-	1|3	0|2	CCDC58|CCDC58	123569764|123569764	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.519000|1.519000	0.35888|0.35888	2.692000|2.692000	0.91855|0.91855	0.655000|0.655000	0.94253|0.94253	GAA|AAG	CCDC58	-	pfam_Caffeine_induced_death_Cid2		0.358	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC58	HGNC	protein_coding	OTTHUMT00000355754.1	C	NM_001017928		122087074	-1	no_errors	ENST00000291458	ensembl	human	known	70_37	missense	SNP	1.000	G
CCNE1	898	genome.wustl.edu	37	19	30314669	30314669	+	Silent	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:30314669G>T	ENST00000262643.3	+	12	1497	c.1218G>T	c.(1216-1218)ggG>ggT	p.G406G	CCNE1_ENST00000357943.5_Silent_p.G363G|CCNE1_ENST00000444983.2_Silent_p.G391G	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	406					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			AGAGCAGCGGGCCGGAAATGG	0.587			A		serous ovarian																																			Dom	yes		19	19q12	898	cyclin E1		E	0													76.0	75.0	75.0					19																	30314669		2203	4300	6503	SO:0001819	synonymous_variant	898			M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.1218G>T	19.37:g.30314669G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Silent	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.G406	ENST00000262643.3	37	c.1218	CCDS12419.1	19																																																																																			CCNE1	-	NULL		0.587	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE1	HGNC	protein_coding	OTTHUMT00000438138.1	G	NM_001238		30314669	+1	no_errors	ENST00000262643	ensembl	human	known	70_37	silent	SNP	0.110	T
CCDC9	26093	genome.wustl.edu	37	19	47764056	47764056	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:47764056C>T	ENST00000221922.6	+	5	644	c.422C>T	c.(421-423)tCt>tTt	p.S141F		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	141	Gly-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		CCTCACCTCTCTGGAGCTGGA	0.647																																																	0													36.0	37.0	36.0					19																	47764056		2203	4297	6500	SO:0001583	missense	26093			AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.422C>T	19.37:g.47764056C>T	ENSP00000221922:p.Ser141Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S141F	ENST00000221922.6	37	c.422	CCDS12698.1	19	.	.	.	.	.	.	.	.	.	.	N	11.22	1.574970	0.28092	.	.	ENSG00000105321	ENST00000221922	T	0.23950	1.88	3.32	2.27	0.28462	.	0.763113	0.11531	N	0.554709	T	0.20536	0.0494	L	0.44542	1.39	0.26392	N	0.976562	P	0.44429	0.835	B	0.40066	0.318	T	0.10520	-1.0626	10	0.46703	T	0.11	-5.0365	6.2642	0.20917	0.0:0.8567:0.0:0.1433	.	141	Q9Y3X0	CCDC9_HUMAN	F	141	ENSP00000221922:S141F	ENSP00000221922:S141F	S	+	2	0	CCDC9	52455896	0.014000	0.17966	0.994000	0.49952	0.788000	0.44548	0.758000	0.26447	0.735000	0.32537	0.431000	0.28591	TCT	CCDC9	-	NULL		0.647	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC9	HGNC	protein_coding	OTTHUMT00000466917.1	C	NM_015603		47764056	+1	no_errors	ENST00000221922	ensembl	human	known	70_37	missense	SNP	0.997	T
CCR7	1236	genome.wustl.edu	37	17	38711120	38711120	+	Silent	SNP	G	G	C	rs142089801	byFrequency	TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:38711120G>C	ENST00000246657.2	-	3	1073	c.1011C>G	c.(1009-1011)ctC>ctG	p.L337L	CCR7_ENST00000579344.1_Silent_p.L331L	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	337				L -> I (in Ref. 1; AAA58615). {ECO:0000305}.	activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				AGAGCTTGAAGAGATCGTTGC	0.612																																																	0													105.0	94.0	97.0					17																	38711120		2203	4300	6503	SO:0001819	synonymous_variant	1236				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.1011C>G	17.37:g.38711120G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR7,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11	p.L337	ENST00000246657.2	37	c.1011	CCDS11369.1	17																																																																																			CCR7	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Chemokine_rcpt		0.612	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	G			38711120	-1	no_errors	ENST00000246657	ensembl	human	known	70_37	silent	SNP	0.991	C
CCR7	1236	genome.wustl.edu	37	17	38711534	38711534	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:38711534G>C	ENST00000246657.2	-	3	659	c.597C>G	c.(595-597)ctC>ctG	p.L199L	CCR7_ENST00000579344.1_Silent_p.L193L	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	199					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				TGCTCCTCTGGAGGTCACTGT	0.577																																																	0													65.0	57.0	60.0					17																	38711534		2203	4300	6503	SO:0001819	synonymous_variant	1236				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.597C>G	17.37:g.38711534G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR7,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11	p.L199	ENST00000246657.2	37	c.597	CCDS11369.1	17																																																																																			CCR7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR7		0.577	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	G			38711534	-1	no_errors	ENST00000246657	ensembl	human	known	70_37	silent	SNP	0.197	C
CD58	965	genome.wustl.edu	37	1	117087104	117087104	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:117087104C>G	ENST00000369489.5	-	2	259	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q	CD58_ENST00000457047.2_Missense_Mutation_p.E65Q|CD58_ENST00000369487.3_Missense_Mutation_p.E65Q	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	65	Ig-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		TTTTCCAGTTCTGCAACTTTA	0.348																																																	0													79.0	79.0	79.0					1																	117087104		2203	4300	6503	SO:0001583	missense	965			BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.193G>C	1.37:g.117087104C>G	ENSP00000358501:p.Glu65Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	NULL	p.E65Q	ENST00000369489.5	37	c.193	CCDS888.1	1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250670	0.39797	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000526981;ENST00000369487	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	3.86	0.715	0.18186	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.939745	0.08870	N	0.881707	T	0.15652	0.0377	L	0.58810	1.83	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.996	T	0.07868	-1.0750	10	0.41790	T	0.15	-7.1961	2.313	0.04191	0.1982:0.4975:0.1926:0.1117	.	65;65;65	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	Q	65;65;37;65	ENSP00000358501:E65Q;ENSP00000409080:E65Q;ENSP00000433648:E37Q;ENSP00000358499:E65Q	ENSP00000358499:E65Q	E	-	1	0	CD58	116888627	0.001000	0.12720	0.000000	0.03702	0.062000	0.15995	0.114000	0.15520	0.038000	0.15604	0.561000	0.74099	GAA	CD58	-	NULL		0.348	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD58	HGNC	protein_coding	OTTHUMT00000059036.1	C	NM_001779		117087104	-1	no_errors	ENST00000369489	ensembl	human	known	70_37	missense	SNP	0.000	G
CD72	971	genome.wustl.edu	37	9	35610239	35610239	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:35610239G>C	ENST00000396757.1	-	0	1325				CD72_ENST00000490239.1_5'UTR|MIR4667_ENST00000578933.1_RNA|CD72_ENST00000259633.4_3'UTR			P21854	CD72_HUMAN	CD72 molecule						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGATGGTCTGAGGAACCCCA	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	971				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.*81C>G	9.37:g.35610239G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000396757.1	37	NULL	CCDS6581.1	9																																																																																			CD72	-	-		0.552	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	G	NM_001782		35610239	-1	no_errors	ENST00000490239	ensembl	human	known	70_37	rna	SNP	0.000	C
CDC42EP4	23580	genome.wustl.edu	37	17	71281696	71281696	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:71281696G>A	ENST00000335793.3	-	2	1338	c.944C>T	c.(943-945)tCa>tTa	p.S315L	CDC42EP4_ENST00000439510.2_Missense_Mutation_p.S245L|CDC42EP4_ENST00000581014.1_Silent_p.L47L			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	315					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			CAGGATGCCTGAGGTGCAGCT	0.687																																																	0													33.0	39.0	37.0					17																	71281696		2203	4299	6502	SO:0001583	missense	23580			AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.944C>T	17.37:g.71281696G>A	ENSP00000338258:p.Ser315Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUS7|O95828|Q96FT3	Missense_Mutation	SNP	pfam_PAK_box_Rho-bd,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	p.S315L	ENST00000335793.3	37	c.944	CCDS11695.1	17	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835767	0.71373	.	.	ENSG00000179604	ENST00000335793;ENST00000439510	T;T	0.56103	0.61;0.48	4.91	3.87	0.44632	.	0.587064	0.14927	N	0.290302	T	0.66723	0.2818	M	0.63428	1.95	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64144	0.922;0.922	T	0.65265	-0.6210	10	0.40728	T	0.16	-7.2456	14.2806	0.66208	0.0:0.1498:0.8502:0.0	.	245;315	B3KUS7;Q9H3Q1	.;BORG4_HUMAN	L	315;245	ENSP00000338258:S315L;ENSP00000404270:S245L	ENSP00000338258:S315L	S	-	2	0	CDC42EP4	68793291	1.000000	0.71417	0.992000	0.48379	0.278000	0.26855	7.024000	0.76443	2.287000	0.76781	0.484000	0.47621	TCA	CDC42EP4	-	NULL		0.687	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP4	HGNC	protein_coding	OTTHUMT00000441898.1	G	NM_012121		71281696	-1	no_errors	ENST00000335793	ensembl	human	known	70_37	missense	SNP	1.000	A
CDH10	1008	genome.wustl.edu	37	5	24487903	24487903	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:24487903C>T	ENST00000264463.4	-	12	2743	c.2236G>A	c.(2236-2238)Gaa>Aaa	p.E746K	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	746					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CTCAGAGATTCAGCAATGGAA	0.438										HNSCC(23;0.051)																																							0													142.0	141.0	142.0					5																	24487903		2203	4300	6503	SO:0001583	missense	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2236G>A	5.37:g.24487903C>T	ENSP00000264463:p.Glu746Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E746K	ENST00000264463.4	37	c.2236	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	C	17.74	3.465057	0.63513	.	.	ENSG00000040731	ENST00000264463	T	0.77489	-1.1	5.92	5.06	0.68205	Cadherin, cytoplasmic domain (1);	0.086900	0.85682	N	0.000000	D	0.84840	0.5561	M	0.90082	3.085	0.49687	D	0.999816	P	0.42584	0.784	P	0.46208	0.507	D	0.87255	0.2275	10	0.62326	D	0.03	.	13.9819	0.64310	0.0:0.928:0.0:0.072	.	746	Q9Y6N8	CAD10_HUMAN	K	746	ENSP00000264463:E746K	ENSP00000264463:E746K	E	-	1	0	CDH10	24523660	1.000000	0.71417	0.208000	0.23602	0.994000	0.84299	5.983000	0.70540	1.517000	0.48917	0.655000	0.94253	GAA	CDH10	-	pfam_Cadherin_cytoplasmic-dom		0.438	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	C	NM_006727		24487903	-1	no_errors	ENST00000264463	ensembl	human	known	70_37	missense	SNP	0.998	T
CDH10	1008	genome.wustl.edu	37	5	24511436	24511436	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:24511436C>T	ENST00000264463.4	-	6	1509	c.1002G>A	c.(1000-1002)aaG>aaA	p.K334K		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	334	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TGCTGTGCACCTTTTTCACAG	0.403										HNSCC(23;0.051)																																							0													218.0	174.0	189.0					5																	24511436		2203	4300	6503	SO:0001630	splice_region_variant	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1002+1G>A	5.37:g.24511436C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULB3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K334	ENST00000264463.4	37	c.1002	CCDS3892.1	5																																																																																			CDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.403	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	C	NM_006727	Silent	24511436	-1	no_errors	ENST00000264463	ensembl	human	known	70_37	silent	SNP	1.000	T
CDK14	5218	genome.wustl.edu	37	7	90338784	90338784	+	Intron	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:90338784C>T	ENST00000380050.3	+	3	254				CDK14_ENST00000406263.1_5'Flank|CDK14_ENST00000496279.1_3'UTR|CDK14_ENST00000436577.2_5'Flank|CDK14_ENST00000265741.3_5'UTR			O94921	CDK14_HUMAN	cyclin-dependent kinase 14						cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CTGTATTCTTCTGAAGCAGCC	0.408																																					GBM(83;1228 1256 8311 16577 31299)												0																																										SO:0001627	intron_variant	5218				CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.124-17097C>T	7.37:g.90338784C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	RNA	SNP	-	NULL	ENST00000380050.3	37	NULL		7																																																																																			CDK14	-	-		0.408	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	C	NM_012395		90338784	+1	no_errors	ENST00000496279	ensembl	human	known	70_37	rna	SNP	0.993	T
CDK18	5129	genome.wustl.edu	37	1	205501487	205501487	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:205501487G>A	ENST00000360066.2	+	0	2707				CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CTCAGCTCCCGAAGGCTCGCA	0.647																																					Pancreas(180;489 2072 28461 40831 44265)												0																																										SO:0001624	3_prime_UTR_variant	5129			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.*981G>A	1.37:g.205501487G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	-	NULL	ENST00000360066.2	37	NULL	CCDS44300.1	1																																																																																			CDK18	-	-		0.647	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	G	NM_002596		205501487	+1	no_errors	ENST00000509056	ensembl	human	known	70_37	rna	SNP	0.000	A
CECR2	27443	genome.wustl.edu	37	22	17983929	17983929	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:17983929G>C	ENST00000400585.2	+	7	700	c.262G>C	c.(262-264)Gag>Cag	p.E88Q	CECR2_ENST00000342247.5_Missense_Mutation_p.E209Q|CECR2_ENST00000400573.5_Missense_Mutation_p.E229Q|CECR2_ENST00000262608.8_Missense_Mutation_p.E210Q			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	251					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CCAGACAGAAGAGGAATGGAG	0.542																																																	0													101.0	106.0	104.0					22																	17983929		1931	4119	6050	SO:0001583	missense	27443			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.262G>C	22.37:g.17983929G>C	ENSP00000383428:p.Glu88Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.E229Q	ENST00000400585.2	37	c.685		22	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891719	0.33442	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.35	3.18	0.36537	.	0.232106	0.29551	N	0.011822	T	0.33789	0.0875	N	0.25647	0.755	0.42862	D	0.994116	B;B;B;B	0.32653	0.087;0.087;0.141;0.379	B;B;B;B	0.26517	0.033;0.018;0.028;0.07	T	0.11155	-1.0599	10	0.39692	T	0.17	-14.0423	15.4509	0.75271	0.0:0.3966:0.6034:0.0	.	251;88;251;229	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	Q	209;88;229;210	ENSP00000341219:E209Q;ENSP00000383428:E88Q;ENSP00000383417:E229Q;ENSP00000262608:E210Q	ENSP00000262608:E210Q	E	+	1	0	CECR2	16363929	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	3.636000	0.54317	0.696000	0.31696	0.655000	0.94253	GAG	CECR2	-	NULL		0.542	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	G	NM_031413		17983929	+1	no_errors	ENST00000400573	ensembl	human	novel	70_37	missense	SNP	1.000	C
CENPE	1062	genome.wustl.edu	37	4	104067180	104067180	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:104067180C>A	ENST00000265148.3	-	30	4308	c.4219G>T	c.(4219-4221)Gag>Tag	p.E1407*	CENPE_ENST00000380026.3_Nonsense_Mutation_p.E1382*	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1407					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.E1407*(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGAATTGCTCCATCTCACTC	0.348																																																	1	Substitution - Nonsense(1)	lung(1)											158.0	141.0	147.0					4																	104067180		2203	4300	6503	SO:0001587	stop_gained	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4219G>T	4.37:g.104067180C>A	ENSP00000265148:p.Glu1407*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1407*	ENST00000265148.3	37	c.4219	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	43	9.902241	0.99292	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	.	.	.	4.75	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	11.4131	0.49937	0.0:0.9136:0.0:0.0864	.	.	.	.	X	1407;1407;1382	.	ENSP00000265148:E1407X	E	-	1	0	CENPE	104286629	0.075000	0.21258	0.269000	0.24586	0.750000	0.42670	1.686000	0.37669	1.118000	0.41863	0.643000	0.83706	GAG	CENPE	-	NULL		0.348	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		C			104067180	-1	no_errors	ENST00000265148	ensembl	human	known	70_37	nonsense	SNP	0.995	A
CENPT	80152	genome.wustl.edu	37	16	67863860	67863860	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:67863860C>G	ENST00000562787.1	-	12	1542	c.994G>C	c.(994-996)Gag>Cag	p.E332Q	CENPT_ENST00000440851.2_Missense_Mutation_p.E332Q|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000564817.1_Missense_Mutation_p.E332Q|CENPT_ENST00000219172.3_Missense_Mutation_p.E332Q	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	332	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		TTCTCTGCCTCTTCAACTCCA	0.527																																																	0													256.0	255.0	255.0					16																	67863860		2065	4215	6280	SO:0001583	missense	80152			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.994G>C	16.37:g.67863860C>G	ENSP00000457810:p.Glu332Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	superfamily_Histone-fold	p.E332Q	ENST00000562787.1	37	c.994	CCDS42182.1	16	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532863	0.64972	.	.	ENSG00000102901	ENST00000440851;ENST00000436104;ENST00000219172	T;T	0.48836	0.8;0.8	4.36	-0.0208	0.13954	.	0.784106	0.11010	N	0.609546	T	0.38134	0.1029	M	0.63428	1.95	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.18561	0.022;0.008;0.008	T	0.31833	-0.9929	10	0.21014	T	0.42	1.3842	4.4229	0.11490	0.0:0.4934:0.1919:0.3147	.	90;332;332	F5H5A6;Q96BT3;B3KPB2	.;CENPT_HUMAN;.	Q	332;90;332	ENSP00000400140:E332Q;ENSP00000219172:E332Q	ENSP00000219172:E332Q	E	-	1	0	CENPT	66421361	0.010000	0.17322	0.000000	0.03702	0.570000	0.35934	0.440000	0.21592	-0.169000	0.10834	0.563000	0.77884	GAG	CENPT	-	NULL		0.527	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPT	HGNC	protein_coding	OTTHUMT00000422020.1	C	NM_025082		67863860	-1	no_errors	ENST00000219172	ensembl	human	known	70_37	missense	SNP	0.000	G
CEP128	145508	genome.wustl.edu	37	14	80971314	80971314	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:80971314G>A	ENST00000555265.1	-	24	3497	c.3122C>T	c.(3121-3123)tCa>tTa	p.S1041L	CEP128_ENST00000281129.3_Missense_Mutation_p.S1041L|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	1041						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CCAAGAGGATGAGTGATCTAA	0.408																																																	0													71.0	68.0	69.0					14																	80971314		2203	4300	6503	SO:0001583	missense	145508			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.3122C>T	14.37:g.80971314G>A	ENSP00000451162:p.Ser1041Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.S1041L	ENST00000555265.1	37	c.3122	CCDS32130.1	14	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134136	0.56828	.	.	ENSG00000100629	ENST00000281129;ENST00000555265	T;T	0.51071	0.72;0.72	5.32	4.4	0.53042	.	0.000000	0.56097	D	0.000036	T	0.32585	0.0834	L	0.27053	0.805	0.21762	N	0.999552	B	0.33612	0.419	B	0.33690	0.168	T	0.16988	-1.0384	10	0.32370	T	0.25	.	10.1288	0.42665	0.0925:0.0:0.9075:0.0	.	1041	Q6ZU80	CE128_HUMAN	L	1041	ENSP00000281129:S1041L;ENSP00000451162:S1041L	ENSP00000281129:S1041L	S	-	2	0	CEP128	80041067	0.909000	0.30893	0.227000	0.23927	0.311000	0.27955	2.371000	0.44248	2.757000	0.94681	0.650000	0.86243	TCA	CEP128	-	NULL		0.408	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	G	NM_152446		80971314	-1	no_errors	ENST00000281129	ensembl	human	known	70_37	missense	SNP	0.012	A
CLCC1	23155	genome.wustl.edu	37	1	109482749	109482749	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:109482749G>T	ENST00000369971.2	-	8	941	c.812C>A	c.(811-813)tCa>tAa	p.S271*	AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000369970.3_Nonsense_Mutation_p.S221*|CLCC1_ENST00000348264.2_Intron|CLCC1_ENST00000369969.2_Nonsense_Mutation_p.S150*|CLCC1_ENST00000415331.1_Nonsense_Mutation_p.S221*|CLCC1_ENST00000302500.4_Nonsense_Mutation_p.S150*|CLCC1_ENST00000482889.1_5'UTR|CLCC1_ENST00000356970.2_Nonsense_Mutation_p.S271*|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000369968.2_Intron	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	271						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		ATAGGTCCATGAACTTCTAAA	0.358																																																	0													66.0	61.0	63.0					1																	109482749		2203	4300	6503	SO:0001587	stop_gained	23155			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.812C>A	1.37:g.109482749G>T	ENSP00000358988:p.Ser271*	Somatic		WXS	Illumina HiSeq	Phase_IV	O94861|Q8WYP8|Q8WYP9|Q9BU25	Nonsense_Mutation	SNP	pfam_Chloride_chnl_CLIC-like	p.S271*	ENST00000369971.2	37	c.812	CCDS41362.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.570223	0.97671	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369970;ENST00000302500	.	.	.	5.52	3.63	0.41609	.	0.677816	0.15021	N	0.285005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4223	9.6383	0.39824	0.0674:0.0:0.681:0.2515	.	.	.	.	X	271;271;221;150;221;150	.	ENSP00000306552:S150X	S	-	2	0	CLCC1	109284272	0.990000	0.36364	0.997000	0.53966	0.969000	0.65631	3.063000	0.49978	0.678000	0.31325	0.585000	0.79938	TCA	CLCC1	-	pfam_Chloride_chnl_CLIC-like		0.358	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCC1	HGNC	protein_coding	OTTHUMT00000032405.1	G	NM_015127		109482749	-1	no_errors	ENST00000356970	ensembl	human	known	70_37	nonsense	SNP	0.964	T
CGN	57530	genome.wustl.edu	37	1	151491314	151491314	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:151491314C>T	ENST00000271636.7	+	2	452	c.319C>T	c.(319-321)Cag>Tag	p.Q107*		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	101	Head.|Interacts with ZO-2.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCCCTACTCTCAGGTCAAGGG	0.587																																																	0													33.0	36.0	35.0					1																	151491314		2203	4300	6503	SO:0001587	stop_gained	57530			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.319C>T	1.37:g.151491314C>T	ENSP00000271636:p.Gln107*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8L3|A7MD22|Q5T386|Q9NR25	Nonsense_Mutation	SNP	pfam_Myosin_tail	p.Q107*	ENST00000271636.7	37	c.319	CCDS999.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265407	0.80358	.	.	ENSG00000143375	ENST00000505188;ENST00000502442;ENST00000427934;ENST00000271636	.	.	.	4.84	3.93	0.45458	.	1.250170	0.05220	N	0.508348	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-4.7461	8.3491	0.32292	0.0:0.7516:0.1607:0.0877	.	.	.	.	X	107	.	ENSP00000271636:Q107X	Q	+	1	0	CGN	149757938	0.032000	0.19561	0.953000	0.39169	0.938000	0.57974	0.947000	0.29082	2.691000	0.91804	0.655000	0.94253	CAG	CGN	-	NULL		0.587	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	C	NM_020770		151491314	+1	no_errors	ENST00000271636	ensembl	human	known	70_37	nonsense	SNP	0.238	T
CLEC14A	161198	genome.wustl.edu	37	14	38724060	38724060	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:38724060G>A	ENST00000342213.2	-	1	1514	c.1168C>T	c.(1168-1170)Cag>Tag	p.Q390*		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	390						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCGAAAGCCTGAGGAGTGGCA	0.498																																																	0													56.0	51.0	53.0					14																	38724060		2203	4300	6503	SO:0001587	stop_gained	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1168C>T	14.37:g.38724060G>A	ENSP00000353013:p.Gln390*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q695G9|Q6PWT6|Q8N5V5	Nonsense_Mutation	SNP	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.Q390*	ENST00000342213.2	37	c.1168	CCDS9667.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.945322	0.97134	.	.	ENSG00000176435	ENST00000342213;ENST00000546356	.	.	.	3.94	3.03	0.35002	.	0.483471	0.17320	N	0.178525	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-7.0391	8.9854	0.35990	0.0:0.0:0.7794:0.2206	.	.	.	.	X	390;155	.	ENSP00000353013:Q390X	Q	-	1	0	CLEC14A	37793811	0.017000	0.18338	0.010000	0.14722	0.088000	0.18126	1.673000	0.37534	1.218000	0.43458	0.563000	0.77884	CAG	CLEC14A	-	NULL		0.498	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	HGNC	protein_coding	OTTHUMT00000276729.1	G	NM_175060		38724060	-1	no_errors	ENST00000342213	ensembl	human	known	70_37	nonsense	SNP	0.010	A
CLPTM1	1209	genome.wustl.edu	37	19	45493813	45493813	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:45493813C>G	ENST00000337392.5	+	10	1443	c.1293C>G	c.(1291-1293)ctC>ctG	p.L431L	CLPTM1_ENST00000546079.1_Silent_p.L329L|CLPTM1_ENST00000541297.2_Silent_p.L417L	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	431					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TCATCGACCTCTGGAAGATCA	0.602																																																	0													99.0	95.0	96.0					19																	45493813		2203	4300	6503	SO:0001819	synonymous_variant	1209			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1293C>G	19.37:g.45493813C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	pfam_CLPTM1	p.L431	ENST00000337392.5	37	c.1293	CCDS12651.1	19																																																																																			CLPTM1	-	pfam_CLPTM1		0.602	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	HGNC	protein_coding	OTTHUMT00000453267.1	C	NM_001294		45493813	+1	no_errors	ENST00000337392	ensembl	human	known	70_37	silent	SNP	1.000	G
CLTC	1213	genome.wustl.edu	37	17	57742163	57742163	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:57742163G>A	ENST00000269122.3	+	10	1811	c.1537G>A	c.(1537-1539)Gat>Aat	p.D513N	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.D513N	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	513	Flexible linker.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATACACTCCAGATTGGATATT	0.363			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													121.0	123.0	122.0					17																	57742163		2203	4300	6503	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1537G>A	17.37:g.57742163G>A	ENSP00000269122:p.Asp513Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.D513N	ENST00000269122.3	37	c.1537	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.305878	0.95629	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.23950	1.88;1.88	5.27	5.27	0.74061	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53302	0.1788	M	0.76002	2.32	0.80722	D	1	D;P	0.64830	0.994;0.95	D;P	0.80764	0.994;0.888	T	0.51148	-0.8742	10	0.45353	T	0.12	.	19.2399	0.93877	0.0:0.0:1.0:0.0	.	513;513	Q00610;Q00610-2	CLH1_HUMAN;.	N	513	ENSP00000269122:D513N;ENSP00000376763:D513N	ENSP00000269122:D513N	D	+	1	0	CLTC	55096945	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.813000	0.99286	2.618000	0.88619	0.563000	0.77884	GAT	CLTC	-	superfamily_ARM-type_fold,pirsf_Clathrin_heavy_chain		0.363	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	G	NM_004859		57742163	+1	no_errors	ENST00000269122	ensembl	human	known	70_37	missense	SNP	1.000	A
CNNM2	54805	genome.wustl.edu	37	10	104679239	104679239	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:104679239C>G	ENST00000369878.4	+	1	1190	c.1002C>G	c.(1000-1002)ctC>ctG	p.L334L	CNNM2_ENST00000433628.2_Silent_p.L334L|CNNM2_ENST00000369875.3_Silent_p.L334L	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	334	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCATCCTGCTCGACGACATCG	0.647																																																	0													69.0	60.0	63.0					10																	104679239		2203	4299	6502	SO:0001819	synonymous_variant	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1002C>G	10.37:g.104679239C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.L334	ENST00000369878.4	37	c.1002	CCDS44474.1	10																																																																																			CNNM2	-	pfam_DUF21		0.647	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	C	NM_017649		104679239	+1	no_errors	ENST00000457502	ensembl	human	known	70_37	silent	SNP	1.000	G
CNTNAP2	26047	genome.wustl.edu	37	7	147844759	147844759	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:147844759G>A	ENST00000361727.3	+	17	3247	c.2731G>A	c.(2731-2733)Gaa>Aaa	p.E911K	CNTNAP2_ENST00000538075.1_5'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	911	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGCCCCAACAGAAGGCCACAC	0.552										HNSCC(39;0.1)																																							0													63.0	61.0	62.0					7																	147844759		2203	4300	6503	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2731G>A	7.37:g.147844759G>A	ENSP00000354778:p.Glu911Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E911K	ENST00000361727.3	37	c.2731	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	19.64	3.864714	0.71949	.	.	ENSG00000174469	ENST00000361727	T	0.79247	-1.25	5.49	5.49	0.81192	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.060596	0.64402	D	0.000002	T	0.66025	0.2748	N	0.25485	0.75	0.80722	D	1	B	0.21452	0.056	B	0.25405	0.06	T	0.60311	-0.7288	10	0.17832	T	0.49	.	13.6997	0.62602	0.0:0.1545:0.8455:0.0	.	911	Q9UHC6	CNTP2_HUMAN	K	911	ENSP00000354778:E911K	ENSP00000354778:E911K	E	+	1	0	CNTNAP2	147475692	1.000000	0.71417	0.649000	0.29536	0.959000	0.62525	4.780000	0.62382	2.583000	0.87209	0.561000	0.74099	GAA	CNTNAP2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.552	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	G			147844759	+1	no_errors	ENST00000361727	ensembl	human	known	70_37	missense	SNP	0.982	A
CNTNAP4	85445	genome.wustl.edu	37	16	76311603	76311604	+	Splice_Site	INS	-	-	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:76311603_76311604insC	ENST00000307431.8	+	2	427		c.e2-1		CNTNAP4_ENST00000377504.4_Splice_Site|CNTNAP4_ENST00000469589.1_3'UTR	NM_033401.3	NP_207837.2	Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4						cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GCTACTTCTGTATCTACTCAAA	0.46																																																	0																																										SO:0001630	splice_region_variant	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000307431.8:c.43-1->C	16.37:g.76311603_76311604insC		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PFZ6|Q86YZ7	Splice_Site	INS	-	e1+1	ENST00000307431.8	37	c.42+1_42+1		16																																																																																			CNTNAP4	-	-		0.460	CNTNAP4-201	KNOWN	basic|appris_principal	protein_coding	CNTNAP4	HGNC	protein_coding		-	NM_033401	Intron	76311604	+1	no_errors	ENST00000307431	ensembl	human	known	70_37	splice_site_ins	INS	0.944:0.963	C
CNTNAP4	85445	genome.wustl.edu	37	16	76486529	76486529	+	Missense_Mutation	SNP	G	G	A	rs570306162		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:76486529G>A	ENST00000476707.1	+	7	1344	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.R398Q|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.R350Q|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.R326Q			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	399	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.R374Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TTTCAATTTCGAACTTGGAAT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		16483	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	ovary(1)											99.0	98.0	99.0					16																	76486529		2198	4300	6498	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1205G>A	16.37:g.76486529G>A	ENSP00000417628:p.Arg402Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R398Q	ENST00000476707.1	37	c.1193		16	.	.	.	.	.	.	.	.	.	.	G	34	5.397475	0.96009	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34435	N	0.003965	D	0.91788	0.7402	.	.	.	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.998;1.0;0.996	D;D;D;D	0.78314	0.988;0.949;0.991;0.957	D	0.92081	0.5672	9	0.87932	D	0	.	19.6434	0.95767	0.0:0.0:1.0:0.0	.	326;402;374;399	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	Q	398;350;326;402	ENSP00000306893:R398Q;ENSP00000439733:R350Q;ENSP00000418741:R326Q;ENSP00000417628:R402Q	ENSP00000306893:R398Q	R	+	2	0	CNTNAP4	75044030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.240000	0.95396	2.880000	0.98712	0.655000	0.94253	CGA	CNTNAP4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.463	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	G	NM_033401		76486529	+1	no_errors	ENST00000307431	ensembl	human	known	70_37	missense	SNP	1.000	A
COL15A1	1306	genome.wustl.edu	37	9	101765855	101765855	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:101765855G>A	ENST00000375001.3	+	8	1609	c.1186G>A	c.(1186-1188)Gaa>Aaa	p.E396K		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	396	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAACCCAGAGGAAGGGGTCAC	0.617																																																	0													53.0	56.0	55.0					9																	101765855		2203	4300	6503	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1186G>A	9.37:g.101765855G>A	ENSP00000364140:p.Glu396Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.E396K	ENST00000375001.3	37	c.1186	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298720	0.23650	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.91521	-2.86	3.77	2.86	0.33363	.	1.486600	0.04897	N	0.450657	D	0.83848	0.5343	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.67345	-0.5694	10	0.07482	T	0.82	-15.6714	7.6202	0.28181	0.1184:0.0:0.8816:0.0	.	396	P39059	COFA1_HUMAN	K	396;366	ENSP00000364140:E396K	ENSP00000364140:E396K	E	+	1	0	COL15A1	100805676	0.506000	0.26139	0.010000	0.14722	0.383000	0.30230	1.570000	0.36439	1.131000	0.42111	0.561000	0.74099	GAA	COL15A1	-	NULL		0.617	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	G	NM_001855		101765855	+1	no_errors	ENST00000375001	ensembl	human	known	70_37	missense	SNP	0.012	A
COL17A1	1308	genome.wustl.edu	37	10	105815621	105815621	+	Missense_Mutation	SNP	C	C	T	rs373205740		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:105815621C>T	ENST00000353479.5	-	18	1896	c.1606G>A	c.(1606-1608)Gac>Aac	p.D536N	COL17A1_ENST00000369733.3_Missense_Mutation_p.D536N|COL17A1_ENST00000480127.1_5'UTR	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	536	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCAATTTTGTCCAGGTCTGCT	0.567																																																	0								C	ASN/ASP	0,4406		0,0,2203	96.0	94.0	94.0		1606	2.2	0.0	10		94	2,8598	3.0+/-9.4	0,2,4298	no	missense	COL17A1	NM_000494.3	23	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	536/1498	105815621	2,13004	2203	4300	6503	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1606G>A	10.37:g.105815621C>T	ENSP00000340937:p.Asp536Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.D536N	ENST00000353479.5	37	c.1606	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	12.30	1.895887	0.33442	0.0	2.33E-4	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872	D;D	0.90955	-2.76;-2.76	5.1	2.22	0.28083	.	0.645425	0.13354	N	0.394208	D	0.82582	0.5068	N	0.22421	0.69	0.09310	N	0.999995	B;B	0.19817	0.034;0.039	B;B	0.25291	0.059;0.018	T	0.69194	-0.5209	10	0.35671	T	0.21	-0.0085	7.4618	0.27300	0.0:0.6531:0.0:0.3469	.	536;536	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	N	536;536;520	ENSP00000340937:D536N;ENSP00000358748:D536N	ENSP00000340937:D536N	D	-	1	0	COL17A1	105805611	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.795000	0.26972	0.183000	0.20059	-0.379000	0.06801	GAC	COL17A1	-	NULL		0.567	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	C	NM_130778, NM_000494		105815621	-1	no_errors	ENST00000353479	ensembl	human	known	70_37	missense	SNP	0.001	T
COL6A5	256076	genome.wustl.edu	37	3	130107629	130107629	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:130107629G>C	ENST00000432398.2	+	6	2562	c.2068G>C	c.(2068-2070)Gaa>Caa	p.E690Q	COL6A5_ENST00000265379.6_Missense_Mutation_p.E690Q	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	690	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TACACAGCAAGAAATTTCTGA	0.363																																																	0													53.0	46.0	48.0					3																	130107629		692	1590	2282	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2068G>C	3.37:g.130107629G>C	ENSP00000390895:p.Glu690Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E690Q	ENST00000432398.2	37	c.2068		3	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053977	0.36277	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.84370	-1.84;-1.84	5.46	5.46	0.80206	.	.	.	.	.	D	0.88833	0.6544	L	0.49699	1.58	0.36598	D	0.874494	P	0.49635	0.926	P	0.58210	0.835	D	0.89542	0.3793	9	0.36615	T	0.2	.	18.0925	0.89479	0.0:0.0:1.0:0.0	.	690	A8TX70-2	.	Q	690	ENSP00000390895:E690Q;ENSP00000265379:E690Q	ENSP00000265379:E690Q	E	+	1	0	COL6A5	131590319	1.000000	0.71417	0.323000	0.25347	0.374000	0.29953	6.277000	0.72608	2.563000	0.86464	0.557000	0.71058	GAA	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.363	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		G	NM_153264		130107629	+1	no_errors	ENST00000265379	ensembl	human	known	70_37	missense	SNP	0.909	C
CREB5	9586	genome.wustl.edu	37	7	28843919	28843919	+	Missense_Mutation	SNP	C	C	T	rs565546192		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:28843919C>T	ENST00000357727.2	+	8	1196	c.806C>T	c.(805-807)aCg>aTg	p.T269M	CREB5_ENST00000396299.2_Missense_Mutation_p.T236M|CREB5_ENST00000396300.2_Missense_Mutation_p.T262M|CREB5_ENST00000409603.1_Missense_Mutation_p.T236M|CREB5_ENST00000396298.2_Missense_Mutation_p.T130M	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	269					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						CAGGACCAGACGccacaccat	0.582																																																	0													462.0	293.0	351.0					7																	28843919		2203	4300	6503	SO:0001583	missense	9586			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.806C>T	7.37:g.28843919C>T	ENSP00000350359:p.Thr269Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pirsf_TF_cAMP-dep,pfscan_Znf_C2H2,pfscan_bZIP	p.T269M	ENST00000357727.2	37	c.806	CCDS5417.1	7	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655786	0.67586	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603;ENST00000426500;ENST00000396298	T;T;T;T;T	0.64438	-0.09;-0.09;-0.08;-0.09;-0.1	5.63	5.63	0.86233	.	0.145224	0.64402	D	0.000009	T	0.59088	0.2168	L	0.36672	1.1	0.50813	D	0.999897	D;D	0.61080	0.989;0.989	B;B	0.44315	0.446;0.446	T	0.62172	-0.6910	10	0.51188	T	0.08	-12.9965	19.7368	0.96210	0.0:1.0:0.0:0.0	.	130;269	B4DU13;Q02930	.;CREB5_HUMAN	M	236;269;262;236;95;130	ENSP00000379593:T236M;ENSP00000350359:T269M;ENSP00000379594:T262M;ENSP00000387197:T236M;ENSP00000379592:T130M	ENSP00000350359:T269M	T	+	2	0	CREB5	28810444	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.089000	0.50183	2.679000	0.91253	0.549000	0.68633	ACG	CREB5	-	pirsf_TF_cAMP-dep		0.582	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB5	HGNC	protein_coding	OTTHUMT00000214204.4	C	NM_004904		28843919	+1	no_errors	ENST00000357727	ensembl	human	known	70_37	missense	SNP	1.000	T
CRHR2	1395	genome.wustl.edu	37	7	30704803	30704803	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:30704803C>T	ENST00000471646.1	-	5	843	c.426G>A	c.(424-426)cgG>cgA	p.R142R	CRHR2_ENST00000341843.4_Splice_Site_p.R128R|CRHR2_ENST00000506074.2_Splice_Site_p.R142R|CRHR2_ENST00000348438.4_Splice_Site_p.R169R	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	142					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGCGAATGCTCCTGTGGGAGG	0.577																																																	0													85.0	69.0	74.0					7																	30704803		2203	4300	6503	SO:0001630	splice_region_variant	1395				CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.426-1G>A	7.37:g.30704803C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt	p.R169	ENST00000471646.1	37	c.507	CCDS5429.1	7																																																																																			CRHR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like		0.577	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	C		Silent	30704803	-1	no_errors	ENST00000348438	ensembl	human	known	70_37	silent	SNP	1.000	T
YBX3	8531	genome.wustl.edu	37	12	10854632	10854632	+	Missense_Mutation	SNP	C	C	A	rs140201332		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:10854632C>A	ENST00000228251.4	-	8	1180	c.980G>T	c.(979-981)cGt>cTt	p.R327L	YBX3_ENST00000546164.1_5'UTR|YBX3_ENST00000279550.7_Missense_Mutation_p.R258L	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	327					3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)										CCGGTATCCACGGCGAACAGA	0.582																																																	0													153.0	139.0	144.0					12																	10854632		2203	4300	6503	SO:0001583	missense	8531			L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.980G>T	12.37:g.10854632C>A	ENSP00000228251:p.Arg327Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBW6|Q14121|Q969N6|Q96B76	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot,prints_CSP_DNA-bd	p.R327L	ENST00000228251.4	37	c.980	CCDS8630.1	12	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515307	0.64634	.	.	ENSG00000060138	ENST00000279550;ENST00000228251	T;T	0.35048	1.4;1.33	4.88	3.98	0.46160	.	0.078689	0.56097	D	0.000036	T	0.40094	0.1103	M	0.64997	1.995	0.46113	D	0.998879	P;P	0.51449	0.932;0.945	P;B	0.45971	0.499;0.387	T	0.35773	-0.9775	10	0.66056	D	0.02	.	10.823	0.46617	0.0:0.9058:0.0:0.0942	.	258;327	P16989-2;P16989	.;DBPA_HUMAN	L	258;327	ENSP00000279550:R258L;ENSP00000228251:R327L	ENSP00000228251:R327L	R	-	2	0	CSDA	10745899	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.872000	0.63050	1.034000	0.39945	0.655000	0.94253	CGT	CSDA	-	NULL		0.582	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSDA	HGNC	protein_coding	OTTHUMT00000399628.1	C	NM_003651		10854632	-1	no_errors	ENST00000228251	ensembl	human	known	70_37	missense	SNP	1.000	A
CSH1	1442	genome.wustl.edu	37	17	61972547	61972547	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:61972547C>G	ENST00000316193.8	-	5	630	c.489G>C	c.(487-489)caG>caC	p.Q163H	CSH1_ENST00000453363.3_Missense_Mutation_p.Q68H|CSH1_ENST00000329882.8_Missense_Mutation_p.D248H	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)	163						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						GCTTGAGGATCTGCCCAGTCC	0.552									Russell-Silver syndrome																																								0													157.0	136.0	143.0					17																	61972547		2194	4300	6494	SO:0001583	missense	1442	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.489G>C	17.37:g.61972547C>G	ENSP00000316416:p.Gln163His	Somatic		WXS	Illumina HiSeq	Phase_IV	P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.Q163H	ENST00000316193.8	37	c.489	CCDS11649.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	3.521|3.521	-0.097823|-0.097823	0.07010|0.07010	.|.	.|.	ENSG00000136488|ENSG00000136488	ENST00000329882|ENST00000316193;ENST00000453363	D|D;D	0.89415|0.89050	-2.51|-2.32;-2.46	2.56|2.56	2.56|2.56	0.30785|0.30785	.|.	.|.	.|.	.|.	.|.	D|D	0.86502|0.86502	0.5948|0.5948	M|M	0.69358|0.69358	2.11|2.11	0.19300|0.19300	N|N	0.999971|0.999971	D|B;B	0.53312|0.11235	0.959|0.002;0.004	P|B;B	0.46543|0.15870	0.52|0.014;0.003	T|T	0.79624|0.79624	-0.1726|-0.1726	8|9	.|0.66056	.|D	.|0.02	.|.	8.65|8.65	0.34029|0.34029	0.0:0.7625:0.2375:0.0|0.0:0.7625:0.2375:0.0	.|.	248|68;163	A6NFB4|B1A4H2;Q6PF11	.|.;.	H|H	248|163;68	ENSP00000333268:D248H|ENSP00000316416:Q163H;ENSP00000402517:Q68H	.|ENSP00000316416:Q163H	D|Q	-|-	1|3	0|2	CSH1|CSH1	59326279|59326279	0.842000|0.842000	0.29525|0.29525	0.996000|0.996000	0.52242|0.52242	0.015000|0.015000	0.08874|0.08874	1.368000|1.368000	0.34216|0.34216	1.422000|1.422000	0.47177|0.47177	0.313000|0.313000	0.20887|0.20887	GAT|CAG	CSH1	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core		0.552	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSH1	HGNC	protein_coding	OTTHUMT00000416040.1	C	NM_001317		61972547	-1	no_errors	ENST00000316193	ensembl	human	known	70_37	missense	SNP	0.392	G
ARFGEF1	10565	genome.wustl.edu	37	8	68107771	68107771	+	IGR	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:68107771G>C	ENST00000262215.3	-	0	7225				ARFGEF1_ENST00000517955.1_5'Flank|CSPP1_ENST00000412460.1_Missense_Mutation_p.Q858H|CSPP1_ENST00000262210.5_Missense_Mutation_p.Q1203H|ARFGEF1_ENST00000520381.1_Intron	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)						endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AGCAGCAGCAGATTCCTGGAA	0.517																																																	0													65.0	67.0	66.0					8																	68107771		1986	4175	6161	SO:0001628	intergenic_variant	79848			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626		8.37:g.68107771G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	NULL	p.Q1203H	ENST00000262215.3	37	c.3609	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649663	0.29336	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.31510	1.49;1.5;1.5	4.42	2.64	0.31445	.	0.637987	0.14553	N	0.312546	T	0.31765	0.0807	L	0.36672	1.1	0.80722	D	1	P;D;P	0.55605	0.911;0.972;0.899	P;P;P	0.52386	0.465;0.697;0.568	T	0.04796	-1.0926	10	0.51188	T	0.08	-2.1958	7.0428	0.25029	0.2023:0.0:0.7977:0.0	.	858;1203;1238	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;CSPP1_HUMAN	H	1203;1238;858;858	ENSP00000262210:Q1203H;ENSP00000415782:Q858H;ENSP00000430092:Q858H	ENSP00000262210:Q1203H	Q	+	3	2	CSPP1	68270325	0.004000	0.15560	0.998000	0.56505	0.611000	0.37282	-0.174000	0.09839	0.813000	0.34350	-0.145000	0.13849	CAG	CSPP1	-	NULL		0.517	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379441.4	G	NM_006421		68107771	+1	no_errors	ENST00000262210	ensembl	human	known	70_37	missense	SNP	0.996	C
CSMD3	114788	genome.wustl.edu	37	8	113301615	113301615	+	Missense_Mutation	SNP	C	C	T	rs138442191		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:113301615C>T	ENST00000297405.5	-	57	9371	c.9127G>A	c.(9127-9129)Gga>Aga	p.G3043R	CSMD3_ENST00000455883.2_Missense_Mutation_p.G2874R|CSMD3_ENST00000352409.3_Missense_Mutation_p.G2973R|CSMD3_ENST00000343508.3_Missense_Mutation_p.G3003R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3043	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGTTGTGATCCACTCCAATGG	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								C	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	138.0	133.0	135.0		8620,9127,9007	6.2	1.0	8	dbSNP_134	135	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	CSMD3	NM_052900.2,NM_198123.1,NM_198124.1	125,125,125	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	2874/3539,3043/3708,3003/3668	113301615	1,13003	2203	4299	6502	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9127G>A	8.37:g.113301615C>T	ENSP00000297405:p.Gly3043Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G3043R	ENST00000297405.5	37	c.9127	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472261	0.84533	0.0	1.16E-4	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	6.17	6.17	0.99709	Complement control module (2);Sushi/SCR/CCP (3);	0.078034	0.50627	D	0.000107	D	0.89469	0.6724	M	0.91872	3.25	0.46499	D	0.999077	D;D;D	0.61080	0.987;0.989;0.964	D;D;P	0.67900	0.923;0.954;0.828	D	0.89101	0.3489	10	0.49607	T	0.09	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2874;3043;3003	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	3003;3043;2313;2874;2973	ENSP00000345799:G3003R;ENSP00000297405:G3043R;ENSP00000341558:G2313R;ENSP00000412263:G2874R;ENSP00000343124:G2973R	ENSP00000297405:G3043R	G	-	1	0	CSMD3	113370791	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.724000	0.61972	2.941000	0.99782	0.655000	0.94253	GGA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.398	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	C	NM_052900		113301615	-1	no_errors	ENST00000297405	ensembl	human	known	70_37	missense	SNP	1.000	T
CSRNP2	81566	genome.wustl.edu	37	12	51470431	51470431	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:51470431C>T	ENST00000228515.1	-	2	212		c.e2-1		CSRNP2_ENST00000550461.1_Splice_Site	NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2						apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CATTAGGATTCTGCCCAGGGA	0.517																																																	0																																										SO:0001630	splice_region_variant	81566			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.86-1G>A	12.37:g.51470431C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	e1-1	ENST00000228515.1	37	c.1-1	CCDS8807.1	12																																																																																			CSRNP2	-	-		0.517	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP2	HGNC	protein_coding	OTTHUMT00000404893.1	C		Intron	51470431	-1	no_errors	ENST00000228515	ensembl	human	known	70_37	splice_site	SNP	1.000	T
CXCR2P1	3580	genome.wustl.edu	37	2	218924939	218924939	+	RNA	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:218924939C>T	ENST00000439871.1	-	0	1441					NR_002712.1				chemokine (C-X-C motif) receptor 2 pseudogene 1																		TCCTCTGCTTCCTGCGACCAC	0.527																																																	0																																												3580			M98335		2q35	2012-05-02	2010-04-14	2010-04-14	ENSG00000229754	ENSG00000229754			6028	pseudogene	pseudogene			"""interleukin 8 receptor, beta pseudogene"", ""chemokine (C-X-C motif) receptor 2 pseudogene"""	IL8RBP, CXCR2P		1427896, 1303245	Standard	NR_002712		Approved		uc002vgx.3		OTTHUMG00000155244		2.37:g.218924939C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000439871.1	37	NULL		2																																																																																			CXCR2P1	-	-		0.527	CXCR2P1-002	KNOWN	basic	processed_transcript	CXCR2P1	HGNC	pseudogene	OTTHUMT00000338985.1	C	NR_002712		218924939	-1	no_errors	ENST00000439871	ensembl	human	known	70_37	rna	SNP	0.095	T
CXorf30	645090	genome.wustl.edu	37	X	36337408	36337408	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:36337408C>T	ENST00000378657.4	+	11	1415	c.767C>T	c.(766-768)cCg>cTg	p.P256L		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	256										breast(1)|lung(2)|stomach(1)	4						TTTAGTTCTCCGAGTGAAATA	0.353																																																	0													192.0	145.0	159.0					X																	36337408		692	1591	2283	SO:0001583	missense	645090				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.767C>T	X.37:g.36337408C>T	ENSP00000367926:p.Pro256Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.P256L	ENST00000378657.4	37	c.767	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	C	2.598	-0.293616	0.05568	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.21734	1.99;2.0	4.32	-1.17	0.09648	.	3.775070	0.00822	N	0.001597	T	0.08313	0.0207	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26608	-1.0098	10	0.25751	T	0.34	4.4714	8.3663	0.32389	0.0:0.309:0.0:0.691	.	256	A6PW82	CX030_HUMAN	L	541;256	ENSP00000367922:P541L;ENSP00000367926:P256L	ENSP00000367922:P541L	P	+	2	0	CXorf30	36247329	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.270000	0.18607	-0.394000	0.07727	-1.163000	0.01768	CCG	CXorf30	-	NULL		0.353	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		C	NP_001092313		36337408	+1	no_errors	ENST00000378657	ensembl	human	known	70_37	missense	SNP	0.000	T
DACT1	51339	genome.wustl.edu	37	14	59113006	59113006	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:59113006C>T	ENST00000335867.4	+	4	1689	c.1665C>T	c.(1663-1665)gtC>gtT	p.V555V	DACT1_ENST00000395153.3_Silent_p.V518V|DACT1_ENST00000541264.2_Silent_p.V274V|DACT1_ENST00000556859.1_Silent_p.V274V			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	555					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CGCACCTGGTCAAGGCCCAGT	0.632																																																	0													35.0	40.0	38.0					14																	59113006		2203	4300	6503	SO:0001819	synonymous_variant	51339			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1665C>T	14.37:g.59113006C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYJ2|Q86TY0	Silent	SNP	NULL	p.V555	ENST00000335867.4	37	c.1665	CCDS9736.1	14																																																																																			DACT1	-	NULL		0.632	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	C	NM_016651		59113006	+1	no_errors	ENST00000335867	ensembl	human	known	70_37	silent	SNP	0.657	T
DCC	1630	genome.wustl.edu	37	18	49867236	49867236	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:49867236C>T	ENST00000442544.2	+	1	695	c.79C>T	c.(79-81)Ctt>Ttt	p.L27F	RP11-25O3.1_ENST00000582700.1_lincRNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	27	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CAGCGCGCATCTTCAAGTAAC	0.498																																																	0													191.0	170.0	177.0					18																	49867236		2203	4300	6503	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.79C>T	18.37:g.49867236C>T	ENSP00000389140:p.Leu27Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L27F	ENST00000442544.2	37	c.79	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490600	0.44249	.	.	ENSG00000187323	ENST00000442544	T	0.52295	0.67	5.73	5.73	0.89815	Immunoglobulin-like (1);	0.167338	0.28895	N	0.013797	T	0.36026	0.0952	N	0.16903	0.455	0.80722	D	1	B	0.12630	0.006	B	0.06405	0.002	T	0.07366	-1.0776	10	0.37606	T	0.19	.	18.6711	0.91512	0.0:1.0:0.0:0.0	.	27	P43146	DCC_HUMAN	F	27	ENSP00000389140:L27F	ENSP00000389140:L27F	L	+	1	0	DCC	48121234	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.676000	0.61627	2.709000	0.92574	0.561000	0.74099	CTT	DCC	-	pfscan_Ig-like		0.498	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	C	NM_005215		49867236	+1	no_errors	ENST00000442544	ensembl	human	known	70_37	missense	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6650967	6650967	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:6650967G>C	ENST00000299441.3	-	11	5382	c.4971C>G	c.(4969-4971)ctC>ctG	p.L1657L	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1657	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTCACGCAAGAGGACGCTGT	0.632																																																	0													39.0	39.0	39.0					11																	6650967		2201	4296	6497	SO:0001819	synonymous_variant	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4971C>G	11.37:g.6650967G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1657	ENST00000299441.3	37	c.4971	CCDS7771.1	11																																																																																			DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.632	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	G	NM_003737		6650967	-1	no_errors	ENST00000299441	ensembl	human	known	70_37	silent	SNP	0.488	C
DDX10	1662	genome.wustl.edu	37	11	108811173	108811173	+	3'UTR	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:108811173C>A	ENST00000322536.3	+	0	2780				DDX10_ENST00000534221.1_3'UTR	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10						metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		CCTGCCTTCTCCTTGAAACCT	0.463			T	NUP98	AML*																																			Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	0													49.0	44.0	46.0					11																	108811173		2201	4298	6499	SO:0001624	3_prime_UTR_variant	1662			U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.*23C>A	11.37:g.108811173C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCQ3|Q5BJD8	RNA	SNP	-	NULL	ENST00000322536.3	37	NULL	CCDS8342.1	11																																																																																			DDX10	-	-		0.463	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX10	HGNC	protein_coding	OTTHUMT00000390343.1	C	NM_004398		108811173	+1	no_errors	ENST00000524979	ensembl	human	putative	70_37	rna	SNP	0.001	A
DDX42	11325	genome.wustl.edu	37	17	61894305	61894305	+	Silent	SNP	G	G	A	rs370567643		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:61894305G>A	ENST00000578681.1	+	18	2692	c.2091G>A	c.(2089-2091)acG>acA	p.T697T	DDX42_ENST00000389924.2_Silent_p.T697T|DDX42_ENST00000583590.1_Silent_p.T697T|DDX42_ENST00000457800.2_Silent_p.T697T|DDX42_ENST00000359353.5_Silent_p.T578T	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	697					protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						ATCGACTAACGGCAATGAAAG	0.413																																																	0								G	,	0,4406		0,0,2203	70.0	65.0	67.0		2091,2091	-8.9	0.9	17		67	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DDX42	NM_007372.2,NM_203499.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	697/939,697/939	61894305	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11325			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2091G>A	17.37:g.61894305G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.T697	ENST00000578681.1	37	c.2091	CCDS32704.1	17																																																																																			DDX42	-	NULL		0.413	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX42	HGNC	protein_coding	OTTHUMT00000444368.1	G	NM_007372		61894305	+1	no_errors	ENST00000389924	ensembl	human	known	70_37	silent	SNP	0.885	A
DENND2A	27147	genome.wustl.edu	37	7	140301267	140301267	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:140301267G>A	ENST00000275884.6	-	2	1348	c.931C>T	c.(931-933)Ccc>Tcc	p.P311S	DENND2A_ENST00000537639.1_Missense_Mutation_p.P311S|DENND2A_ENST00000496613.1_Missense_Mutation_p.P311S|DENND2A_ENST00000492720.1_Missense_Mutation_p.P311S			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	311					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P311T(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					gaaggtgggggagaggagggc	0.592																																																	1	Substitution - Missense(1)	lung(1)											45.0	49.0	48.0					7																	140301267		1978	4152	6130	SO:0001583	missense	27147			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.931C>T	7.37:g.140301267G>A	ENSP00000275884:p.Pro311Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.P311S	ENST00000275884.6	37	c.931	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	G	15.61	2.884481	0.51908	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.12569	3.4;3.4;3.4;2.67	4.85	4.85	0.62838	.	0.068945	0.64402	D	0.000013	T	0.34658	0.0905	M	0.76574	2.34	0.58432	D	0.999997	D;B	0.62365	0.991;0.112	P;B	0.61722	0.893;0.082	T	0.03957	-1.0989	10	0.27082	T	0.32	-13.5724	18.1513	0.89675	0.0:0.0:1.0:0.0	.	311;311	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	S	311	ENSP00000275884:P311S;ENSP00000442245:P311S;ENSP00000419654:P311S;ENSP00000419464:P311S	ENSP00000275884:P311S	P	-	1	0	DENND2A	139947736	1.000000	0.71417	0.946000	0.38457	0.939000	0.58152	7.471000	0.80985	2.519000	0.84933	0.462000	0.41574	CCC	DENND2A	-	NULL		0.592	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	G	NM_015689		140301267	-1	no_errors	ENST00000275884	ensembl	human	known	70_37	missense	SNP	1.000	A
DHX58	79132	genome.wustl.edu	37	17	40255628	40255628	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:40255628G>C	ENST00000251642.3	-	12	1974	c.1752C>G	c.(1750-1752)ttC>ttG	p.F584L		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	584	RNA-binding.|Repressor domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGTCTCACGAGAAGTTGGGGT	0.567																																																	0													39.0	33.0	35.0					17																	40255628		2203	4300	6503	SO:0001583	missense	79132			BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.1752C>G	17.37:g.40255628G>C	ENSP00000251642:p.Phe584Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HAM6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F584L	ENST00000251642.3	37	c.1752	CCDS11416.1	17	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481153	0.63849	.	.	ENSG00000108771	ENST00000251642	T	0.55930	0.49	5.72	5.72	0.89469	C-terminal domain of RIG-I (1);	0.053380	0.85682	D	0.000000	T	0.72590	0.3479	M	0.84326	2.69	0.54753	D	0.999983	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.984	T	0.72754	-0.4198	10	0.39692	T	0.17	.	12.3729	0.55263	0.0795:0.0:0.9205:0.0	.	577;584	B7Z455;Q96C10	.;DHX58_HUMAN	L	584	ENSP00000251642:F584L	ENSP00000251642:F584L	F	-	3	2	DHX58	37509154	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	1.715000	0.37971	2.705000	0.92388	0.555000	0.69702	TTC	DHX58	-	pfam_RIG-I_C-RD		0.567	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX58	HGNC	protein_coding	OTTHUMT00000257396.1	G	NM_024119		40255628	-1	no_errors	ENST00000251642	ensembl	human	known	70_37	missense	SNP	1.000	C
DMD	1756	genome.wustl.edu	37	X	31645828	31645828	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:31645828C>T	ENST00000357033.4	-	55	8385	c.8179G>A	c.(8179-8181)Gac>Aac	p.D2727N	DMD_ENST00000343523.2_Missense_Mutation_p.D267N|DMD_ENST00000359836.1_Missense_Mutation_p.D267N|DMD_ENST00000541735.1_Missense_Mutation_p.D267N|DMD_ENST00000474231.1_Missense_Mutation_p.D267N|DMD_ENST00000378677.2_Missense_Mutation_p.D2723N|DMD_ENST00000378707.3_Missense_Mutation_p.D267N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2727					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCCTTGGAGTCTTCTAGGAGC	0.463																																																	0													95.0	82.0	86.0					X																	31645828		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8179G>A	X.37:g.31645828C>T	ENSP00000354923:p.Asp2727Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.D2727N	ENST00000357033.4	37	c.8179	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.69|15.69	2.909098|2.909098	0.52439|0.52439	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.58060|.	0.85;0.36;0.36;0.36;0.36;0.36;0.36;0.36|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.183530|.	0.24557|.	N|.	0.037514|.	T|T	0.62539|0.62539	0.2436|0.2436	L|L	0.41236|0.41236	1.265|1.265	0.34246|0.34246	D|D	0.678247|0.678247	P;P;P;B;B;B;B;B;B;B|.	0.42203|.	0.773;0.476;0.476;0.122;0.122;0.001;0.002;0.004;0.0;0.0|.	P;B;B;B;B;B;B;B;B;B|.	0.45377|.	0.478;0.145;0.145;0.039;0.039;0.006;0.026;0.061;0.001;0.0|.	T|T	0.67213|0.67213	-0.5727|-0.5727	10|5	0.51188|.	T|.	0.08|.	.|.	19.1018|19.1018	0.93276|0.93276	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2719;2727;2723;1386;1383;267;267;267;267;267|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	N|K	2719;1386;1383;423;2723;2727;267;267;2727;2604;267;267;267|455	ENSP00000350765:D423N;ENSP00000367948:D2723N;ENSP00000354923:D2727N;ENSP00000352894:D267N;ENSP00000340057:D267N;ENSP00000367979:D267N;ENSP00000444119:D267N;ENSP00000417123:D267N|.	ENSP00000340057:D267N|.	D|R	-|-	1|2	0|0	DMD|DMD	31555749|31555749	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	4.829000|4.829000	0.62737|0.62737	2.461000|2.461000	0.83175|0.83175	0.508000|0.508000	0.49915|0.49915	GAC|AGA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.463	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	C	NM_004006		31645828	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJA1	3301	genome.wustl.edu	37	9	33038806	33038806	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:33038806G>A	ENST00000330899.4	+	9	1282	c.1099G>A	c.(1099-1101)Gat>Aat	p.D367N	DNAJA1_ENST00000544625.1_Missense_Mutation_p.D210N	NM_001539.2	NP_001530.1	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1	367					androgen receptor signaling pathway (GO:0030521)|DNA damage response, detection of DNA damage (GO:0042769)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of apoptotic process (GO:0043065)|protein folding (GO:0006457)|protein localization to mitochondrion (GO:0070585)|regulation of protein transport (GO:0051223)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasmic side of endoplasmic reticulum membrane (GO:0098554)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|G-protein coupled receptor binding (GO:0001664)|Hsp70 protein binding (GO:0030544)|low-density lipoprotein particle receptor binding (GO:0050750)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(2)|ovary(1)|skin(3)	6			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		GGTGGACTTTGATCCAAATCA	0.473																																																	0													106.0	96.0	99.0					9																	33038806		2203	4300	6503	SO:0001583	missense	3301			L08069	CCDS6533.1	9p13.3	2011-09-02			ENSG00000086061	ENSG00000086061		"""Heat shock proteins / DNAJ (HSP40)"""	5229	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 7"""	602837		HSJ2		8334160, 11147971	Standard	NM_001539		Approved	HSPF4, hdj-2, dj-2, NEDD7	uc003zsd.1	P31689	OTTHUMG00000019760	ENST00000330899.4:c.1099G>A	9.37:g.33038806G>A	ENSP00000369127:p.Asp367Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T7Q0|Q86TL9	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_N,pfscan_DnaJ_N,pfscan_HSP_DnaJ_Cys-rich_dom,prints_Hsp_DnaJ	p.D367N	ENST00000330899.4	37	c.1099	CCDS6533.1	9	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334767	0.24253	.	.	ENSG00000086061	ENST00000330899;ENST00000539152;ENST00000544625	T;T	0.61627	0.09;1.44	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.47154	0.1430	L	0.35793	1.09	0.80722	D	1	B	0.17852	0.024	B	0.19946	0.027	T	0.37549	-0.9701	10	0.13470	T	0.59	-26.3545	15.8625	0.79035	0.0:0.0:1.0:0.0	.	367	P31689	DNJA1_HUMAN	N	367;210;210	ENSP00000369127:D367N;ENSP00000439010:D210N	ENSP00000369127:D367N	D	+	1	0	DNAJA1	33028806	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	8.694000	0.91293	2.422000	0.82143	0.557000	0.71058	GAT	DNAJA1	-	NULL		0.473	DNAJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJA1	HGNC	protein_coding	OTTHUMT00000052031.1	G			33038806	+1	no_errors	ENST00000330899	ensembl	human	known	70_37	missense	SNP	1.000	A
DUS3L	56931	genome.wustl.edu	37	19	5789420	5789420	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:5789420C>T	ENST00000309061.7	-	3	794	c.698G>A	c.(697-699)cGc>cAc	p.R233H	DUS3L_ENST00000320699.8_Intron|DUS3L_ENST00000590681.1_5'UTR	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	233							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						GCTGAACCGGCGCAGGGCCTG	0.726																																																	0													7.0	10.0	9.0					19																	5789420		2149	4189	6338	SO:0001583	missense	56931				CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.698G>A	19.37:g.5789420C>T	ENSP00000311977:p.Arg233His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	pfam_tRNA_hU_synthase	p.R233H	ENST00000309061.7	37	c.698	CCDS32880.1	19	.	.	.	.	.	.	.	.	.	.	C	13.83	2.354375	0.41700	.	.	ENSG00000141994	ENST00000309061	T	0.18338	2.22	4.53	-7.28	0.01456	.	1.282520	0.05166	N	0.498643	T	0.16342	0.0393	M	0.62723	1.935	0.09310	N	1	B	0.18013	0.025	B	0.13407	0.009	T	0.42632	-0.9440	10	0.72032	D	0.01	-31.2271	7.5637	0.27866	0.1141:0.265:0.0:0.6208	.	233	Q96G46	DUS3L_HUMAN	H	233	ENSP00000311977:R233H	ENSP00000311977:R233H	R	-	2	0	DUS3L	5740420	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.025000	0.12413	-1.326000	0.02266	-0.189000	0.12847	CGC	DUS3L	-	NULL		0.726	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS3L	HGNC	protein_coding	OTTHUMT00000451870.2	C	NM_020175		5789420	-1	no_errors	ENST00000309061	ensembl	human	known	70_37	missense	SNP	0.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103041002	103041002	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:103041002G>T	ENST00000375735.2	+	33	5278	c.5134G>T	c.(5134-5136)Gtc>Ttc	p.V1712F	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.V1712F|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1712	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ACAAGTTTTAGTCTTTAATTG	0.333																																																	0													52.0	50.0	51.0					11																	103041002		1814	4081	5895	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.5134G>T	11.37:g.103041002G>T	ENSP00000364887:p.Val1712Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.V1712F	ENST00000375735.2	37	c.5134	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738229	0.89573	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.14640	2.49;2.49	5.54	5.54	0.83059	ATPase, AAA+ type, core (1);	0.000000	0.29383	U	0.012303	T	0.54271	0.1848	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.69818	-0.5042	10	0.87932	D	0	.	19.4742	0.94979	0.0:0.0:1.0:0.0	.	1712;1712	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	F	1712	ENSP00000364887:V1712F;ENSP00000381167:V1712F	ENSP00000364887:V1712F	V	+	1	0	DYNC2H1	102546212	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.014000	0.88676	2.602000	0.87976	0.585000	0.79938	GTC	DYNC2H1	-	smart_AAA+_ATPase		0.333	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	G	XM_370652		103041002	+1	no_errors	ENST00000398093	ensembl	human	known	70_37	missense	SNP	1.000	T
DYRK1A	1859	genome.wustl.edu	37	21	38862616	38862616	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:38862616G>C	ENST00000398960.2	+	6	879	c.804G>C	c.(802-804)caG>caC	p.Q268H	DYRK1A_ENST00000321219.8_Missense_Mutation_p.Q268H|DYRK1A_ENST00000338785.3_Missense_Mutation_p.Q268H|DYRK1A_ENST00000339659.4_Missense_Mutation_p.Q259H|DYRK1A_ENST00000451934.1_Missense_Mutation_p.Q268H|DYRK1A_ENST00000455387.2_Missense_Mutation_p.Q40H|DYRK1A_ENST00000398956.2_Missense_Mutation_p.Q268H	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTGCGCAACAGATGTGCACTG	0.423																																					Melanoma(114;464 1602 31203 43785 45765)												0													105.0	96.0	99.0					21																	38862616		2203	4299	6502	SO:0001583	missense	1859			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.804G>C	21.37:g.38862616G>C	ENSP00000381932:p.Gln268His	Somatic		WXS	Illumina HiSeq	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q268H	ENST00000398960.2	37	c.804	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953911	0.73902	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.91	4.12	0.48240	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.90922	3.16	0.80722	D	1	D;D;D;D;D	0.76494	0.997;0.997;0.999;0.998;0.997	D;D;D;D;D	0.72338	0.971;0.971;0.977;0.961;0.971	T	0.69643	-0.5090	10	0.87932	D	0	.	12.565	0.56304	0.1534:0.0:0.8466:0.0	.	268;268;268;259;268	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	H	268;259;268;268;268;268;40	ENSP00000342690:Q268H;ENSP00000340373:Q259H;ENSP00000319032:Q268H;ENSP00000416089:Q268H;ENSP00000381932:Q268H;ENSP00000381929:Q268H;ENSP00000407854:Q40H	ENSP00000319032:Q268H	Q	+	3	2	DYRK1A	37784486	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.931000	0.48932	0.848000	0.35191	0.573000	0.79308	CAG	DYRK1A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.423	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	G	NM_001396		38862616	+1	no_errors	ENST00000398960	ensembl	human	known	70_37	missense	SNP	1.000	C
CRACR2A	84766	genome.wustl.edu	37	12	3757688	3757688	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:3757688G>C	ENST00000252322.1	-	11	1606	c.1138C>G	c.(1138-1140)Cct>Gct	p.P380A	EFCAB4B_ENST00000444507.1_Intron|EFCAB4B_ENST00000440314.2_Intron	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		380					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			CTCAGCACAGGCCAGTGCCCA	0.607																																																	0													68.0	60.0	62.0					12																	3757688		2203	4300	6503	SO:0001583	missense	84766																														ENST00000252322.1:c.1138C>G	12.37:g.3757688G>C	ENSP00000252322:p.Pro380Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1X0|B9EK63	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.P380A	ENST00000252322.1	37	c.1138	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	g	0.917	-0.717295	0.03182	.	.	ENSG00000130038	ENST00000252322	T	0.17691	2.26	2.34	-3.49	0.04724	.	4.384240	0.00953	N	0.002981	T	0.07863	0.0197	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26395	-1.0104	10	0.87932	D	0	.	0.0968	0.00045	0.3137:0.232:0.2252:0.2291	.	380	Q9BSW2	EFC4B_HUMAN	A	380	ENSP00000252322:P380A	ENSP00000252322:P380A	P	-	1	0	EFCAB4B	3627949	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.292000	0.19011	-0.891000	0.03940	-0.513000	0.04457	CCT	EFCAB4B	-	NULL		0.607	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398673.1	G			3757688	-1	no_errors	ENST00000252322	ensembl	human	known	70_37	missense	SNP	0.000	C
EIF4A1	1973	genome.wustl.edu	37	17	7480675	7480675	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:7480675C>T	ENST00000293831.8	+	7	654	c.638C>T	c.(637-639)tCa>tTa	p.S213L	EIF4A1_ENST00000582746.1_Missense_Mutation_p.S213L|SNORA67_ENST00000384423.1_RNA|EIF4A1_ENST00000577269.1_Missense_Mutation_p.S213L|CD68_ENST00000250092.6_5'Flank|SNORA48_ENST00000386847.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000380498.6_5'Flank|SNORD10_ENST00000459579.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	213	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GTTTTGCTGTCAGCCACAATG	0.498																																					Melanoma(120;278 1668 15796 27423 46368)												0													87.0	93.0	91.0					17																	7480675		2203	4300	6503	SO:0001583	missense	1973			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.638C>T	17.37:g.7480675C>T	ENSP00000293831:p.Ser213Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S213L	ENST00000293831.8	37	c.638	CCDS11113.1	17	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593750	0.46214	.	.	ENSG00000161960	ENST00000293831;ENST00000396527	T	0.12774	2.65	5.41	5.41	0.78517	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	H	0.99197	4.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.99;0.99;0.996	T	0.77480	-0.2572	10	0.87932	D	0	-26.2341	16.6961	0.85336	0.0:1.0:0.0:0.0	.	213;213;213	A8K7F6;A8K088;P60842	.;.;IF4A1_HUMAN	L	213;36	ENSP00000293831:S213L	ENSP00000293831:S213L	S	+	2	0	EIF4A1	7421399	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.368000	0.79567	2.540000	0.85666	0.591000	0.81541	TCA	EIF4A1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.498	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A1	HGNC	protein_coding	OTTHUMT00000226952.6	C	NM_001416		7480675	+1	no_errors	ENST00000293831	ensembl	human	known	70_37	missense	SNP	1.000	T
EIF4A2	1974	genome.wustl.edu	37	3	186502834	186502834	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:186502834G>T	ENST00000323963.5	+	4	356	c.292G>T	c.(292-294)Gag>Tag	p.E98*	EIF4A2_ENST00000356531.5_Intron|SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|EIF4A2_ENST00000440191.2_Nonsense_Mutation_p.E99*|SNORA63_ENST00000363548.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	98	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GTTGGAGATTGAGTTCAAGGA	0.443			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0													180.0	169.0	173.0					3																	186502834		2203	4300	6503	SO:0001587	stop_gained	1974			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.292G>T	3.37:g.186502834G>T	ENSP00000326381:p.Glu98*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E99*	ENST00000323963.5	37	c.295	CCDS3282.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.796724	0.96952	.	.	ENSG00000156976	ENST00000445596;ENST00000323963;ENST00000440191	.	.	.	4.7	4.7	0.59300	.	0.105526	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-0.2573	15.5195	0.75854	0.0:0.0:1.0:0.0	.	.	.	.	X	98;98;99	.	ENSP00000326381:E98X	E	+	1	0	EIF4A2	187985528	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.109000	0.94291	2.592000	0.87571	0.585000	0.79938	GAG	EIF4A2	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.443	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	HGNC	protein_coding	OTTHUMT00000344609.1	G	NM_001967		186502834	+1	no_errors	ENST00000440191	ensembl	human	known	70_37	nonsense	SNP	1.000	T
EMC1	23065	genome.wustl.edu	37	1	19549250	19549250	+	Missense_Mutation	SNP	C	C	T	rs371524055	byFrequency	TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:19549250C>T	ENST00000477853.1	-	20	2497	c.2455G>A	c.(2455-2457)Gcc>Acc	p.A819T	EMC1_ENST00000375208.3_Missense_Mutation_p.A797T|EMC1_ENST00000480380.1_5'Flank|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Missense_Mutation_p.A818T	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	819						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											AAGGCGGTGGCGTTGTATTGC	0.602													C|||	4	0.000798722	0.003	0.0	5008	,	,		18529	0.0		0.0	False		,,,				2504	0.0																0								C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	121.0	107.0	111.0		2455	6.0	1.0	1		111	0,8600		0,0,4300	no	missense	KIAA0090	NM_015047.1	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	819/994	19549250	1,13005	2203	4300	6503	SO:0001583	missense	23065				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2455G>A	1.37:g.19549250C>T	ENSP00000420608:p.Ala819Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like	p.A819T	ENST00000477853.1	37	c.2455	CCDS190.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.93|14.93	2.680976|2.680976	0.47886|0.47886	2.27E-4|2.27E-4	0.0|0.0	ENSG00000127463|ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208;ENST00000486405|ENST00000375197	T;T;T|.	0.24723|.	1.84;1.84;1.84|.	5.98|5.98	5.98|5.98	0.97165|0.97165	Domain of unknown function DUF1620 (1);|.	0.085825|.	0.85682|.	D|.	0.000000|.	T|T	0.51856|0.51856	0.1699|0.1699	N|N	0.26092|0.26092	0.79|0.79	0.80722|0.80722	D|D	1|1	B;B;P;P|.	0.39520|.	0.334;0.101;0.625;0.676|.	B;B;B;B|.	0.32289|.	0.063;0.063;0.088;0.143|.	T|T	0.45160|0.45160	-0.9280|-0.9280	10|5	0.21014|.	T|.	0.42|.	-26.1445|-26.1445	12.3448|12.3448	0.55114|0.55114	0.0:0.9228:0.0:0.0772|0.0:0.9228:0.0:0.0772	.|.	797;818;818;819|.	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766|.	.;.;.;K0090_HUMAN|.	T|H	819;818;797;64|552	ENSP00000420608:A819T;ENSP00000364345:A818T;ENSP00000364354:A797T|.	ENSP00000364345:A818T|.	A|R	-|-	1|2	0|0	KIAA0090|KIAA0090	19421837|19421837	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.732000|0.732000	0.41865|0.41865	5.405000|5.405000	0.66351|0.66351	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	GCC|CGC	EMC1	-	pfam_DUF1620		0.602	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	C	NM_015047		19549250	-1	no_errors	ENST00000477853	ensembl	human	known	70_37	missense	SNP	1.000	T
EMR4P	326342	genome.wustl.edu	37	19	6963770	6963770	+	RNA	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:6963770G>A	ENST00000600751.1	-	0	1327					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)										TGACGGTGAGGAAGAGGTGCA	0.562																																																	0																																												326342			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6963770G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SP1	RNA	SNP	-	NULL	ENST00000600751.1	37	NULL		19																																																																																			EMR4P	-	-		0.562	EMR4P-002	KNOWN	basic	processed_transcript	EMR4P	HGNC	pseudogene	OTTHUMT00000436007.1	G	NR_024075		6963770	-1	no_errors	ENST00000600751	ensembl	human	known	70_37	rna	SNP	1.000	A
ENKD1	84080	genome.wustl.edu	37	16	67697103	67697103	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:67697103G>C	ENST00000243878.4	-	7	1323	c.1002C>G	c.(1000-1002)atC>atG	p.I334M	ENKD1_ENST00000602644.1_3'UTR|ACD_ENST00000219251.8_5'Flank|ACD_ENST00000393919.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	334	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											GCCGAGAAAAGATCTTGATGG	0.597																																																	0													96.0	79.0	85.0					16																	67697103		2198	4300	6498	SO:0001583	missense	84080			BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.1002C>G	16.37:g.67697103G>C	ENSP00000243878:p.Ile334Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWD7	Missense_Mutation	SNP	NULL	p.I334M	ENST00000243878.4	37	c.1002	CCDS10844.1	16	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930490	0.52866	.	.	ENSG00000124074	ENST00000243878	.	.	.	5.38	2.38	0.29361	.	0.000000	0.85682	D	0.000000	T	0.70482	0.3229	M	0.82823	2.61	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.66752	-0.5844	9	0.34782	T	0.22	0.0053	4.2784	0.10820	0.2299:0.0:0.5098:0.2603	.	334;216	Q9H0I2;Q9H0I2-2	CP048_HUMAN;.	M	334	.	ENSP00000243878:I334M	I	-	3	3	C16orf48	66254604	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	0.726000	0.25984	0.650000	0.30769	-0.254000	0.11334	ATC	ENKD1	-	NULL		0.597	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENKD1	HGNC	protein_coding	OTTHUMT00000268884.1	G	NM_032140		67697103	-1	no_errors	ENST00000243878	ensembl	human	known	70_37	missense	SNP	0.999	C
ENPP6	133121	genome.wustl.edu	37	4	185074749	185074749	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:185074749G>A	ENST00000296741.2	-	2	520	c.379C>T	c.(379-381)Ctg>Ttg	p.L127L		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	127					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GCCTTGGTCAGAGTGACCCAC	0.488																																																	0													134.0	113.0	120.0					4																	185074749		2203	4300	6503	SO:0001819	synonymous_variant	133121			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.379C>T	4.37:g.185074749G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4W5Q1|Q96M57	Silent	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L127	ENST00000296741.2	37	c.379	CCDS3834.1	4																																																																																			ENPP6	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.488	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP6	HGNC	protein_coding	OTTHUMT00000361428.1	G	NM_153343		185074749	-1	no_errors	ENST00000296741	ensembl	human	known	70_37	silent	SNP	0.997	A
RP11-24M17.5	0	genome.wustl.edu	37	15	76069745	76069745	+	RNA	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:76069745G>A	ENST00000395215.3	+	0	179																											GAGTGAAGATGAAAAAGAAAA	0.512																																																	0																																												0																															15.37:g.76069745G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000395215.3	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	1.071	-0.669975	0.03403	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.822	-1.64	0.08318	.	.	.	.	.	T	0.32556	0.0833	.	.	.	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.19386	-1.0307	6	0.66056	D	0.02	.	5.0836	0.14671	0.557:0.0:0.443:0.0	.	46	B4DZE6	.	I	46	.	ENSP00000378641:M46I	M	+	3	0	AC019294.2	73856800	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	0.299000	0.19138	-0.819000	0.04323	-0.929000	0.02709	ATG	RP11-24M17.5	-	-		0.512	RP11-24M17.5-001	KNOWN	basic	processed_transcript	ENSG00000187812	Clone_based_vega_gene	pseudogene	OTTHUMT00000420501.1	G			76069745	+1	no_errors	ENST00000395215	ensembl	human	known	70_37	rna	SNP	0.803	A
ZNF727	442319	genome.wustl.edu	37	7	63505960	63505960	+	5'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:63505960G>A	ENST00000550760.3	+	0	140				RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						GGTACTGGGAGATCCATAGGG	0.572																																																	0													151.0	152.0	151.0					7																	63505960		692	1591	2283	SO:0001623	5_prime_UTR_variant	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.-40G>A	7.37:g.63505960G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000550760.3	37	NULL	CCDS55113.1	7																																																																																			RP11-3N2.13	-	-		0.572	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214652	Clone_based_vega_gene	protein_coding		G	NM_001159522		63505960	+1	no_errors	ENST00000445978	ensembl	human	known	70_37	rna	SNP	0.002	A
LOC728715	728715	genome.wustl.edu	37	12	9713515	9713515	+	RNA	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:9713515G>T	ENST00000520314.1	+	0	710																											CAAGCCAACAGAAAACAAGCG	0.428																																																	0																																												0																															12.37:g.9713515G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000520314.1	37	NULL		12																																																																																			RP11-726G1.1	-	-		0.428	RP11-726G1.1-002	KNOWN	basic	processed_transcript	ENSG00000214776	Clone_based_vega_gene	pseudogene	OTTHUMT00000381543.1	G			9713515	+1	no_errors	ENST00000520314	ensembl	human	known	70_37	rna	SNP	0.948	T
NPAS2	4862	genome.wustl.edu	37	2	101611823	101611823	+	Intron	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:101611823C>A	ENST00000335681.5	+	21	2577				NPAS2_ENST00000542504.1_Intron|AC016738.4_ENST00000452364.1_RNA	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAGCGGACATCAGAACCACCT	0.527																																																	0													72.0	68.0	69.0					2																	101611823		2203	4300	6503	SO:0001627	intron_variant	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.2293-39C>A	2.37:g.101611823C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	RNA	SNP	-	NULL	ENST00000335681.5	37	NULL	CCDS2048.1	2																																																																																			AC016738.4	-	-		0.527	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000223947	Clone_based_vega_gene	protein_coding	OTTHUMT00000253168.3	C			101611823	-1	no_errors	ENST00000452364	ensembl	human	known	70_37	rna	SNP	0.000	A
AMZ1	155185	genome.wustl.edu	37	7	2758276	2758276	+	IGR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:2758276G>A	ENST00000312371.4	+	0	5516				AMZ1_ENST00000489665.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		TTCAGCAGCAGAAGGCAGTGG	0.607																																																	0																																										SO:0001628	intergenic_variant	0			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111		7.37:g.2758276G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRS0|Q8TF51	RNA	SNP	-	NULL	ENST00000312371.4	37	NULL	CCDS34589.1	7																																																																																			AC006028.9	-	-		0.607	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228246	Clone_based_vega_gene	protein_coding	OTTHUMT00000325244.1	G	NM_133463		2758276	-1	no_errors	ENST00000412266	ensembl	human	known	70_37	rna	SNP	0.000	A
PTGES2	80142	genome.wustl.edu	37	9	130890938	130890938	+	5'Flank	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:130890938G>A	ENST00000338961.6	-	0	0				AL590708.2_ENST00000443493.1_Silent_p.T51T|PTGES2_ENST00000277462.5_5'Flank|PTGES2_ENST00000483625.1_5'Flank	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2						cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						CGGTGAAGACGAGAGCGGAAG	0.672																																																	0																																										SO:0001631	upstream_gene_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730		9.37:g.130890938G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Silent	SNP	NULL	p.T51	ENST00000338961.6	37	c.153	CCDS6891.1	9																																																																																			AL590708.2	-	NULL		0.672	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232850	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000054339.1	G			130890938	+1	no_errors	ENST00000443493	ensembl	human	known	70_37	silent	SNP	0.000	A
PTGES2	80142	genome.wustl.edu	37	9	130890945	130890945	+	5'Flank	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:130890945G>A	ENST00000338961.6	-	0	0				AL590708.2_ENST00000443493.1_Missense_Mutation_p.E54K|PTGES2_ENST00000277462.5_5'Flank|PTGES2_ENST00000483625.1_5'Flank	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2						cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						GACGAGAGCGGAAGGCGAGGA	0.672																																																	0																																										SO:0001631	upstream_gene_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730		9.37:g.130890945G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	NULL	p.E54K	ENST00000338961.6	37	c.160	CCDS6891.1	9	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720067	0.30503	.	.	ENSG00000232850	ENST00000443493	.	.	.	3.26	-1.15	0.09709	.	.	.	.	.	T	0.30135	0.0755	.	.	.	.	.	.	B	0.28178	0.202	B	0.31614	0.133	T	0.35325	-0.9793	6	0.87932	D	0	.	3.4367	0.07448	0.3961:0.2029:0.401:0.0	.	54	Q8N1Y9	YI025_HUMAN	K	54	.	ENSP00000410261:E54K	E	+	1	0	AL590708.2	129930766	0.000000	0.05858	0.034000	0.17996	0.058000	0.15608	-0.330000	0.07925	-0.398000	0.07679	0.561000	0.74099	GAA	AL590708.2	-	NULL		0.672	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232850	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000054339.1	G			130890945	+1	no_errors	ENST00000443493	ensembl	human	known	70_37	missense	SNP	0.045	A
PTGES2	80142	genome.wustl.edu	37	9	130891140	130891140	+	5'Flank	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:130891140G>C	ENST00000338961.6	-	0	0				AL590708.2_ENST00000443493.1_Missense_Mutation_p.E119Q|PTGES2_ENST00000277462.5_5'Flank|PTGES2_ENST00000483625.1_5'Flank	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2						cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						GAGCACCCGCGAGCGGGTAAC	0.627																																																	0																																										SO:0001631	upstream_gene_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730		9.37:g.130891140G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	NULL	p.E119Q	ENST00000338961.6	37	c.355	CCDS6891.1	9	.	.	.	.	.	.	.	.	.	.	G	7.394	0.631347	0.14322	.	.	ENSG00000232850	ENST00000443493	.	.	.	2.52	0.00736	0.14071	.	.	.	.	.	T	0.56352	0.1979	.	.	.	.	.	.	D	0.71674	0.998	D	0.67103	0.949	T	0.57825	-0.7744	6	0.87932	D	0	.	1.8969	0.03259	0.2736:0.0:0.434:0.2923	.	119	Q8N1Y9	YI025_HUMAN	Q	119	.	ENSP00000410261:E119Q	E	+	1	0	AL590708.2	129930961	0.000000	0.05858	0.006000	0.13384	0.102000	0.19082	-0.375000	0.07475	-0.005000	0.14395	-0.314000	0.08810	GAG	AL590708.2	-	NULL		0.627	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232850	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000054339.1	G			130891140	+1	no_errors	ENST00000443493	ensembl	human	known	70_37	missense	SNP	0.007	C
PTGES2	80142	genome.wustl.edu	37	9	130891158	130891158	+	5'Flank	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:130891158G>C	ENST00000338961.6	-	0	0				AL590708.2_ENST00000443493.1_Missense_Mutation_p.V125L|PTGES2_ENST00000277462.5_5'Flank|PTGES2_ENST00000483625.1_5'Flank	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2						cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						AACcagtcccgtgagagctgc	0.627																																																	0																																										SO:0001631	upstream_gene_variant	0			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730		9.37:g.130891158G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	NULL	p.V125L	ENST00000338961.6	37	c.373	CCDS6891.1	9	.	.	.	.	.	.	.	.	.	.	G	5.981	0.364855	0.11296	.	.	ENSG00000232850	ENST00000443493	.	.	.	2.47	-1.49	0.08718	.	.	.	.	.	T	0.25005	0.0607	.	.	.	.	.	.	B	0.09022	0.002	B	0.09377	0.004	T	0.31280	-0.9949	6	0.87932	D	0	.	0.3446	0.00339	0.2212:0.1444:0.2312:0.4031	.	125	Q8N1Y9	YI025_HUMAN	L	125	.	ENSP00000410261:V125L	V	+	1	0	AL590708.2	129930979	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.492000	0.02300	-0.323000	0.08602	-1.756000	0.00673	GTG	AL590708.2	-	NULL		0.627	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232850	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000054339.1	G			130891158	+1	no_errors	ENST00000443493	ensembl	human	known	70_37	missense	SNP	0.000	C
LINC00620	285375	genome.wustl.edu	37	3	13779617	13779617	+	RNA	SNP	G	G	T	rs552242951		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:13779617G>T	ENST00000419618.1	+	0	602				LINC00620_ENST00000438915.1_RNA|AC093611.1_ENST00000408341.2_RNA	NR_027103.1				long intergenic non-protein coding RNA 620																		aagcatcaaagcacaggctga	0.403																																																	0																																												0			BC039529		3p25.1	2013-03-14			ENSG00000224514	ENSG00000224514		"""Long non-coding RNAs"""	44223	non-coding RNA	RNA, long non-coding						23478628, 21368711	Standard	NR_027103		Approved		uc003byd.1		OTTHUMG00000155508		3.37:g.13779617G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000419618.1	37	NULL		3																																																																																			AC093611.1	-	-		0.403	LINC00620-001	KNOWN	basic	antisense	ENSG00000238827	Clone_based_ensembl_gene	antisense	OTTHUMT00000340428.1	G	NR_027103		13779617	-1	no_errors	ENST00000408341	ensembl	human	novel	70_37	rna	SNP	0.218	T
FRMD4A	55691	genome.wustl.edu	37	10	13685712	13685712	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:13685712C>T	ENST00000357447.2	-	0	6814				FRMD4A_ENST00000358621.4_3'UTR|RP11-295P9.3_ENST00000610032.1_3'UTR|RP11-295P9.3_ENST00000596044.1_Intron	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A						establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GGGATCTTTTCATTTTGAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.*3326G>A	10.37:g.13685712C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y3|Q5T377	RNA	SNP	-	NULL	ENST00000357447.2	37	NULL	CCDS7101.1	10																																																																																			RP11-295P9.3	-	-		0.353	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000239665	Clone_based_vega_gene	protein_coding	OTTHUMT00000046889.1	C	NM_018027		13685712	+1	no_errors	ENST00000600249	ensembl	human	known	70_37	rna	SNP	1.000	T
RNF8	9025	genome.wustl.edu	37	6	37329002	37329002	+	Intron	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:37329002G>C	ENST00000373479.4	+	2	433				RNF8_ENST00000479516.1_Intron|RNF8_ENST00000469731.1_Intron|RNF8_ENST00000394443.4_Intron|RN7SL273P_ENST00000481561.2_RNA	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						aactactggagaagctgaggc	0.463																																																	0																																										SO:0001627	intron_variant	0			AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.240+652G>C	6.37:g.37329002G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	RNA	SNP	-	NULL	ENST00000373479.4	37	NULL	CCDS4834.1	6																																																																																			Metazoa_SRP	-	-		0.463	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000239953	RFAM	protein_coding	OTTHUMT00000040403.2	G			37329002	+1	no_errors	ENST00000481561	ensembl	human	novel	70_37	rna	SNP	0.004	C
LRBA	987	genome.wustl.edu	37	4	151500760	151500760	+	Intron	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:151500760G>A	ENST00000357115.3	-	41	6607				LRBA_ENST00000535741.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_Intron|MAB21L2_ENST00000317605.4_5'Flank|LRBA_ENST00000510413.1_Intron	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TAAAAGTGGAGAAGCGTAGGG	0.483																																																	0																																										SO:0001627	intron_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6363+8439C>T	4.37:g.151500760G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	RNA	SNP	-	NULL	ENST00000357115.3	37	NULL	CCDS3773.1	4																																																																																			RP11-1336O20.2	-	-		0.483	LRBA-002	KNOWN	basic|CCDS	protein_coding	ENSG00000249690	Clone_based_vega_gene	protein_coding	OTTHUMT00000364939.1	G			151500760	+1	no_errors	ENST00000507934	ensembl	human	known	70_37	rna	SNP	0.001	A
CCL15	6359	genome.wustl.edu	37	17	34328559	34328559	+	5'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:34328559G>A	ENST00000354059.4	-	0	525				RP11-104J23.1_ENST00000590192.1_RNA|CCL15-CCL14_ENST00000481427.2_5'UTR|CCL14_ENST00000536149.1_5'UTR	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGGCTGGCCGAGGACTCCTG	0.602																																																	0													48.0	37.0	41.0					17																	34328559		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.-28C>T	17.37:g.34328559G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU34|E1P651|Q9UM74	RNA	SNP	-	NULL	ENST00000354059.4	37	NULL	CCDS11304.1	17																																																																																			RP11-104J23.1	-	-		0.602	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267566	Clone_based_vega_gene	protein_coding	OTTHUMT00000256584.2	G	NM_004167		34328559	+1	no_errors	ENST00000590192	ensembl	human	known	70_37	rna	SNP	0.028	A
DNAH17	8632	genome.wustl.edu	37	17	76481128	76481128	+	Intron	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:76481128G>A	ENST00000585328.1	-	48	7593				RP11-559N14.5_ENST00000588565.1_RNA|RP11-559N14.5_ENST00000585969.1_RNA|DNAH17_ENST00000389840.5_Intron|DNAH17_ENST00000586052.1_Intron	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGAGAGGGCAGAGGGTCAGCT	0.632																																																	0													29.0	31.0	30.0					17																	76481128		1949	4157	6106	SO:0001627	intron_variant	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.7469-13C>T	17.37:g.76481128G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	RNA	SNP	-	NULL	ENST00000585328.1	37	NULL		17																																																																																			RP11-559N14.5	-	-		0.632	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	ENSG00000267432	Clone_based_vega_gene	protein_coding	OTTHUMT00000318962.2	G	NM_173628		76481128	+1	no_errors	ENST00000585969	ensembl	human	known	70_37	rna	SNP	0.000	A
EOGT	285203	genome.wustl.edu	37	3	69054378	69054378	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:69054378G>A	ENST00000383701.3	-	7	1170	c.428C>T	c.(427-429)tCa>tTa	p.S143L	EOGT_ENST00000540764.1_Missense_Mutation_p.S42L|EOGT_ENST00000295571.5_Missense_Mutation_p.S143L|EOGT_ENST00000540955.1_5'UTR	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	143					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)										CACCAGACTTGAGTCACTCTG	0.423																																																	0													119.0	117.0	118.0					3																	69054378		2203	4300	6503	SO:0001583	missense	285203			AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.428C>T	3.37:g.69054378G>A	ENSP00000373206:p.Ser143Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	pfam_Glycosyltransferase_AER61	p.S143L	ENST00000383701.3	37	c.428		3	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610388	0.66558	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000540764	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	M	0.75264	2.295	0.80722	D	1	P;D	0.76494	0.593;0.999	B;D	0.80764	0.267;0.994	T	0.81675	-0.0825	9	0.62326	D	0.03	.	17.9497	0.89048	0.0:0.0:1.0:0.0	.	143;143	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	L	143;143;42	.	ENSP00000295571:S143L	S	-	2	0	C3orf64	69137068	1.000000	0.71417	0.976000	0.42696	0.835000	0.47333	7.322000	0.79097	2.413000	0.81919	0.585000	0.79938	TCA	EOGT	-	NULL		0.423	EOGT-002	KNOWN	basic|appris_principal	protein_coding	EOGT	HGNC	protein_coding	OTTHUMT00000343722.1	G	NM_173654		69054378	-1	no_errors	ENST00000383701	ensembl	human	known	70_37	missense	SNP	0.997	A
EPHB3	2049	genome.wustl.edu	37	3	184297318	184297318	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:184297318G>A	ENST00000330394.2	+	10	2307	c.1855G>A	c.(1855-1857)Gag>Aag	p.E619K	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	619					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GGACCCTAATGAGGCTGTTCG	0.547																																																	0													83.0	78.0	80.0					3																	184297318		2203	4300	6503	SO:0001583	missense	2049			X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.1855G>A	3.37:g.184297318G>A	ENSP00000332118:p.Glu619Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z740	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E619K	ENST00000330394.2	37	c.1855	CCDS3268.1	3	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901636	0.92035	.	.	ENSG00000182580	ENST00000330394	T	0.11063	2.81	4.81	4.81	0.61882	Protein kinase-like domain (1);	0.054833	0.64402	D	0.000001	T	0.24661	0.0598	M	0.83483	2.645	0.80722	D	1	P	0.47762	0.9	P	0.46419	0.516	T	0.08351	-1.0726	10	0.54805	T	0.06	.	17.2655	0.87085	0.0:0.0:1.0:0.0	.	619	P54753	EPHB3_HUMAN	K	619	ENSP00000332118:E619K	ENSP00000332118:E619K	E	+	1	0	EPHB3	185780012	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.859000	0.99545	2.393000	0.81446	0.551000	0.68910	GAG	EPHB3	-	superfamily_Kinase-like_dom,pirsf_Tyr_kinase_ephrin_rcpt		0.547	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB3	HGNC	protein_coding	OTTHUMT00000345413.1	G	NM_004443		184297318	+1	no_errors	ENST00000330394	ensembl	human	known	70_37	missense	SNP	1.000	A
EPHX2	2053	genome.wustl.edu	37	8	27373884	27373884	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:27373884G>A	ENST00000521400.1	+	8	1309	c.879G>A	c.(877-879)atG>atA	p.M293I	EPHX2_ENST00000518379.1_Missense_Mutation_p.M261I|EPHX2_ENST00000517536.1_Missense_Mutation_p.M110I|EPHX2_ENST00000380476.3_Missense_Mutation_p.M240I|EPHX2_ENST00000521780.1_Missense_Mutation_p.M227I	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	293	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		CTATGGACATGAAAGGCTATG	0.567											OREG0018668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													364.0	306.0	326.0					8																	27373884		2203	4300	6503	SO:0001583	missense	2053			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.879G>A	8.37:g.27373884G>A	ENSP00000430269:p.Met293Ile	Somatic	793	WXS	Illumina HiSeq	Phase_IV	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,prints_Epox_hydrolase-like,prints_Haloacid_DH/epoxide_hydro,prints_AB_hydrolase_1,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA_v3	p.M293I	ENST00000521400.1	37	c.879	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766603	0.90020	.	.	ENSG00000120915	ENST00000521400;ENST00000517536;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T;T	0.03889	3.77;3.77;3.77;3.77;3.77	5.67	5.67	0.87782	Alpha/beta hydrolase fold-1 (2);	0.033201	0.85682	D	0.000000	T	0.20659	0.0497	M	0.77313	2.365	0.80722	D	1	P;D;D	0.60575	0.831;0.988;0.964	P;P;P	0.61592	0.793;0.836;0.891	T	0.00045	-1.2218	10	0.54805	T	0.06	-0.0048	17.2762	0.87116	0.0:0.0:1.0:0.0	.	261;293;293	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	I	293;110;227;240;297;261	ENSP00000430269:M293I;ENSP00000428875:M110I;ENSP00000430302:M227I;ENSP00000369843:M240I;ENSP00000427956:M261I	ENSP00000369843:M240I	M	+	3	0	EPHX2	27429801	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.314000	0.78988	2.677000	0.91161	0.561000	0.74099	ATG	EPHX2	-	pfam_AB_hydrolase_1,prints_Epox_hydrolase-like,prints_AB_hydrolase_1		0.567	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	HGNC	protein_coding	OTTHUMT00000219954.4	G			27373884	+1	no_errors	ENST00000521400	ensembl	human	known	70_37	missense	SNP	1.000	A
EPS15	2060	genome.wustl.edu	37	1	51869122	51869122	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:51869122G>C	ENST00000371733.3	-	17	1856	c.1760C>G	c.(1759-1761)tCt>tGt	p.S587C	EPS15_ENST00000371730.2_Missense_Mutation_p.S453C|EPS15_ENST00000493793.1_5'UTR|EPS15_ENST00000396122.4_Missense_Mutation_p.S264C	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	587					cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						GTCGAGTTCAGAACAAACTTT	0.368			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											111.0	109.0	110.0					1																	51869122		2203	4300	6503	SO:0001583	missense	2060			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1760C>G	1.37:g.51869122G>C	ENSP00000360798:p.Ser587Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.S587C	ENST00000371733.3	37	c.1760	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229570	0.39399	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000396122	T;T;T	0.26223	1.75;1.89;2.69	4.6	4.6	0.57074	.	0.558279	0.13577	N	0.377646	T	0.19208	0.0461	N	0.08118	0	0.36276	D	0.855453	P;P;P	0.46277	0.875;0.786;0.504	B;B;B	0.43754	0.43;0.224;0.318	T	0.32587	-0.9901	10	0.56958	D	0.05	.	17.2132	0.86936	0.0:0.0:1.0:0.0	.	453;587;273	B1AUU8;P42566;P42566-2	.;EPS15_HUMAN;.	C	453;587;264	ENSP00000360795:S453C;ENSP00000360798:S587C;ENSP00000379428:S264C	ENSP00000360795:S453C	S	-	2	0	EPS15	51641710	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	1.407000	0.34657	2.847000	0.97988	0.591000	0.81541	TCT	EPS15	-	NULL		0.368	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	G	NM_001981		51869122	-1	no_errors	ENST00000371733	ensembl	human	known	70_37	missense	SNP	1.000	C
EPS15L1	58513	genome.wustl.edu	37	19	16524625	16524625	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:16524625C>T	ENST00000248070.6	-	13	1364	c.1225G>A	c.(1225-1227)Gaa>Aaa	p.E409K	EPS15L1_ENST00000535753.2_Missense_Mutation_p.E409K|EPS15L1_ENST00000602009.1_Missense_Mutation_p.E255K|EPS15L1_ENST00000594975.1_Missense_Mutation_p.E409K|EPS15L1_ENST00000455140.2_Missense_Mutation_p.E409K|EPS15L1_ENST00000597937.1_Missense_Mutation_p.E409K	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	409					endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TCTTCCTTTTCTCGAATGTCT	0.403																																																	0													222.0	180.0	194.0					19																	16524625		2203	4300	6503	SO:0001583	missense	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1225G>A	19.37:g.16524625C>T	ENSP00000248070:p.Glu409Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.E409K	ENST00000248070.6	37	c.1225	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761485	0.89932	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	D;D;D	0.83837	-1.77;-1.77;-1.77	4.62	4.62	0.57501	.	0.118236	0.56097	D	0.000030	T	0.77961	0.4209	L	0.59436	1.845	0.52501	D	0.99995	P;B;P;P;P;P	0.44986	0.594;0.212;0.722;0.847;0.615;0.716	B;B;B;B;B;B	0.39185	0.164;0.137;0.114;0.293;0.114;0.228	T	0.76844	-0.2809	10	0.08179	T	0.78	.	16.8399	0.85965	0.0:1.0:0.0:0.0	.	409;409;408;409;409;409	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	K	409	ENSP00000393313:E409K;ENSP00000248070:E409K;ENSP00000440103:E409K	ENSP00000248070:E409K	E	-	1	0	EPS15L1	16385625	1.000000	0.71417	0.979000	0.43373	0.926000	0.56050	4.744000	0.62118	2.285000	0.76669	0.561000	0.74099	GAA	EPS15L1	-	NULL		0.403	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	C	NM_021235		16524625	-1	no_errors	ENST00000455140	ensembl	human	known	70_37	missense	SNP	1.000	T
ERBB2IP	55914	genome.wustl.edu	37	5	65371026	65371026	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:65371026C>T	ENST00000284037.5	+	23	4320	c.3931C>T	c.(3931-3933)Cct>Tct	p.P1311S	ERBB2IP_ENST00000380939.2_Missense_Mutation_p.P1259S|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.P1270S|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.P1270S|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.P1270S|ERBB2IP_ENST00000508515.1_Intron|ERBB2IP_ENST00000503913.1_Intron|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.P509S|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.P1266S|ERBB2IP_ENST00000380935.1_Intron|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.P1318S	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	1311					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CCATTGTTCTCCTAGACAAGG	0.398																																																	0													100.0	102.0	101.0					5																	65371026		2203	4300	6503	SO:0001583	missense	55914				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.3931C>T	5.37:g.65371026C>T	ENSP00000284037:p.Pro1311Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.P1311S	ENST00000284037.5	37	c.3931	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729819	0.69074	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000512354	T;T;T;T;T;T;T;T	0.38240	1.26;1.22;1.22;1.15;1.62;1.18;1.22;1.28	5.57	0.181	0.15073	PDZ/DHR/GLGF (1);	0.185133	0.47852	N	0.000211	T	0.22475	0.0542	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B;B;B	0.09022	0.0;0.002;0.001;0.002;0.001;0.001;0.001	B;B;B;B;B;B;B	0.11329	0.0;0.006;0.003;0.004;0.001;0.003;0.004	T	0.06162	-1.0842	10	0.72032	D	0.01	.	9.5771	0.39465	0.0:0.4325:0.4355:0.1319	.	509;1270;1318;1318;1266;1311;1270	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.	S	1311;1270;509;1259;1270;1270;1266;1318;148	ENSP00000284037:P1311S;ENSP00000370330:P1270S;ENSP00000397833:P509S;ENSP00000370326:P1259S;ENSP00000370323:P1270S;ENSP00000370325:P1270S;ENSP00000422766:P1266S;ENSP00000426632:P1318S	ENSP00000284037:P1311S	P	+	1	0	ERBB2IP	65406782	0.998000	0.40836	0.998000	0.56505	0.999000	0.98932	0.608000	0.24223	-0.022000	0.13986	0.650000	0.86243	CCT	ERBB2IP	-	superfamily_PDZ		0.398	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	C	NM_018695		65371026	+1	no_errors	ENST00000284037	ensembl	human	known	70_37	missense	SNP	0.998	T
ERCC6L	54821	genome.wustl.edu	37	X	71427447	71427447	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:71427447G>C	ENST00000334463.3	-	2	1305	c.1170C>G	c.(1168-1170)atC>atG	p.I390M	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Missense_Mutation_p.I267M	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	390					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					GCAACTCCTTGATATGATCTA	0.413																																																	0													92.0	86.0	88.0					X																	71427447		2203	4300	6503	SO:0001583	missense	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1170C>G	X.37:g.71427447G>C	ENSP00000334675:p.Ile390Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I390M	ENST00000334463.3	37	c.1170	CCDS35329.1	X	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459934	0.43736	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.92911	-3.13;-3.13	5.82	5.82	0.92795	.	.	.	.	.	D	0.91277	0.7250	N	0.17312	0.475	0.47584	D	0.999461	D	0.89917	1.0	D	0.77004	0.989	D	0.91017	0.4854	9	0.51188	T	0.08	-10.099	9.8807	0.41231	0.0936:0.0:0.9064:0.0	.	390	Q2NKX8	ERC6L_HUMAN	M	267;390	ENSP00000362761:I267M;ENSP00000334675:I390M	ENSP00000334675:I390M	I	-	3	3	ERCC6L	71344172	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.143000	0.42187	2.458000	0.83093	0.600000	0.82982	ATC	ERCC6L	-	NULL		0.413	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2	G	NM_017669		71427447	-1	no_errors	ENST00000334463	ensembl	human	known	70_37	missense	SNP	1.000	C
ESRP1	54845	genome.wustl.edu	37	8	95686546	95686546	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:95686546C>T	ENST00000433389.2	+	12	1653	c.1463C>T	c.(1462-1464)tCa>tTa	p.S488L	ESRP1_ENST00000423620.2_Missense_Mutation_p.S488L|ESRP1_ENST00000454170.2_Missense_Mutation_p.S488L|ESRP1_ENST00000358397.5_Missense_Mutation_p.S488L	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	488	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						GGCCGCCCATCAGGAGATGCC	0.423																																																	0													79.0	80.0	80.0					8																	95686546		1893	4106	5999	SO:0001583	missense	54845			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1463C>T	8.37:g.95686546C>T	ENSP00000405738:p.Ser488Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,smart_RRM_dom,pfscan_RRM_dom	p.S488L	ENST00000433389.2	37	c.1463	CCDS47897.1	8	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175445	0.78564	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610	T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06	5.54	4.67	0.58626	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.062992	0.64402	D	0.000002	T	0.32102	0.0818	M	0.83223	2.63	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;1.0	D;D;D;D;D;D	0.97110	0.997;0.998;0.966;0.99;0.982;1.0	T	0.18745	-1.0327	10	0.87932	D	0	-14.13	14.8095	0.69982	0.0:0.9305:0.0:0.0695	.	488;488;488;488;488;488	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;.;ESRP1_HUMAN	L	488;488;488;488;347	ENSP00000407349:S488L;ENSP00000405738:S488L;ENSP00000351168:S488L;ENSP00000402766:S488L;ENSP00000429125:S347L	ENSP00000351168:S488L	S	+	2	0	ESRP1	95755722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	1.475000	0.48197	0.655000	0.94253	TCA	ESRP1	-	smart_RRM_dom		0.423	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	C	NM_017697		95686546	+1	no_errors	ENST00000433389	ensembl	human	known	70_37	missense	SNP	1.000	T
ESYT3	83850	genome.wustl.edu	37	3	138193129	138193129	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:138193129G>C	ENST00000389567.4	+	20	2589	c.2403G>C	c.(2401-2403)agG>agC	p.R801S	ESYT3_ENST00000460133.1_3'UTR	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	801	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Required for phosphatidylinositol 4,5- bisphosphate-dependent location at the cell membrane. {ECO:0000250}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						TGCCAGAAAGGAAGTGGGCAT	0.488																																																	0													152.0	155.0	154.0					3																	138193129		1985	4156	6141	SO:0001583	missense	83850			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2403G>C	3.37:g.138193129G>C	ENSP00000374218:p.Arg801Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.R801S	ENST00000389567.4	37	c.2403	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883024	0.72410	.	.	ENSG00000158220	ENST00000389567	T	0.69306	-0.39	4.95	3.12	0.35913	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.277486	0.30134	N	0.010331	T	0.70815	0.3267	L	0.45352	1.415	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.70651	-0.4813	10	0.72032	D	0.01	-12.2674	9.5793	0.39477	0.1744:0.0:0.8256:0.0	.	801	A0FGR9	ESYT3_HUMAN	S	801	ENSP00000374218:R801S	ENSP00000374218:R801S	R	+	3	2	ESYT3	139675819	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.741000	0.38238	0.647000	0.30713	0.655000	0.94253	AGG	ESYT3	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.488	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	G	NM_031913		138193129	+1	no_errors	ENST00000389567	ensembl	human	known	70_37	missense	SNP	1.000	C
ESYT3	83850	genome.wustl.edu	37	3	138195122	138195122	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:138195122G>A	ENST00000389567.4	+	21	2712	c.2526G>A	c.(2524-2526)gtG>gtA	p.V842V	ESYT3_ENST00000460133.1_3'UTR	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	842	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						ATGTTGCAGTGAAAAATAGTA	0.353																																																	0													125.0	118.0	120.0					3																	138195122		1841	4096	5937	SO:0001819	synonymous_variant	83850			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2526G>A	3.37:g.138195122G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.V842	ENST00000389567.4	37	c.2526	CCDS3101.2	3																																																																																			ESYT3	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.353	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	G	NM_031913		138195122	+1	no_errors	ENST00000389567	ensembl	human	known	70_37	silent	SNP	0.998	A
ETHE1	23474	genome.wustl.edu	37	19	44012939	44012939	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:44012939G>A	ENST00000292147.2	-	5	649	c.583C>T	c.(583-585)Cac>Tac	p.H195Y	ETHE1_ENST00000600651.1_Missense_Mutation_p.H195Y	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	195					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				TGGTAATCGTGAGCAGGGTAG	0.493																																																	0													98.0	76.0	83.0					19																	44012939		2203	4300	6503	SO:0001583	missense	23474				CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.583C>T	19.37:g.44012939G>A	ENSP00000292147:p.His195Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96HR0|Q9H001	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.H195Y	ENST00000292147.2	37	c.583	CCDS12622.1	19	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605679	0.87157	.	.	ENSG00000105755	ENST00000292147	D	0.93076	-3.16	5.13	5.13	0.70059	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	H	0.99847	4.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99402	1.0928	10	0.87932	D	0	-17.1399	16.5143	0.84295	0.0:0.0:1.0:0.0	.	168;195	B2RCZ7;O95571	.;ETHE1_HUMAN	Y	195	ENSP00000292147:H195Y	ENSP00000292147:H195Y	H	-	1	0	ETHE1	48704779	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.861000	0.87004	2.578000	0.87016	0.650000	0.86243	CAC	ETHE1	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like		0.493	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETHE1	HGNC	protein_coding	OTTHUMT00000463184.1	G	NM_014297		44012939	-1	no_errors	ENST00000292147	ensembl	human	known	70_37	missense	SNP	1.000	A
EVC2	132884	genome.wustl.edu	37	4	5624319	5624319	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:5624319C>T	ENST00000344408.5	-	14	2499	c.2446G>A	c.(2446-2448)Gag>Aag	p.E816K	EVC2_ENST00000344938.1_Missense_Mutation_p.E816K|EVC2_ENST00000310917.2_Missense_Mutation_p.E736K	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	816					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GTCACGGCCTCAGGAGCGTCA	0.637																																																	0													83.0	51.0	62.0					4																	5624319		2203	4300	6503	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2446G>A	4.37:g.5624319C>T	ENSP00000342144:p.Glu816Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.E816K	ENST00000344408.5	37	c.2446	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657740	0.47467	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.75704	-0.96;-0.96;-0.96	5.44	5.44	0.79542	.	1.420270	0.03805	N	0.264989	T	0.76307	0.3969	L	0.51422	1.61	0.43896	D	0.996522	P	0.48503	0.911	P	0.46362	0.514	T	0.63404	-0.6645	10	0.30078	T	0.28	-34.549	11.6772	0.51436	0.0:0.9193:0.0:0.0807	.	816	Q86UK5	LBN_HUMAN	K	816;736;816	ENSP00000339954:E816K;ENSP00000311683:E736K;ENSP00000342144:E816K	ENSP00000311683:E736K	E	-	1	0	EVC2	5675220	0.979000	0.34478	0.917000	0.36280	0.003000	0.03518	2.935000	0.48963	2.549000	0.85964	0.462000	0.41574	GAG	EVC2	-	NULL		0.637	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	C	NM_147127		5624319	-1	no_errors	ENST00000344408	ensembl	human	known	70_37	missense	SNP	0.973	T
EVC	2121	genome.wustl.edu	37	4	5755658	5755658	+	Missense_Mutation	SNP	G	G	A	rs146232611		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:5755658G>A	ENST00000264956.6	+	10	1646	c.1462G>A	c.(1462-1464)Gag>Aag	p.E488K	EVC_ENST00000509451.1_Missense_Mutation_p.E488K|EVC_ENST00000382674.2_Missense_Mutation_p.E488K	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	488					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				AAAGTTTCTCGAGGTGACTCA	0.592													A|||	1	0.000199681	0.0	0.0	5008	,	,		18621	0.0		0.0	False		,,,				2504	0.001																0								A	LYS/GLU	0,4406		0,0,2203	50.0	50.0	50.0		1462	-0.1	0.9	4	dbSNP_134	50	1,8599	819.2+/-406.8	0,1,4299	no	missense	EVC	NM_153717.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	488/993	5755658	1,13005	2203	4300	6503	SO:0001583	missense	2121			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1462G>A	4.37:g.5755658G>A	ENSP00000264956:p.Glu488Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E488K	ENST00000264956.6	37	c.1462	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	A	0.067	-1.211044	0.01555	0.0	1.16E-4	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.39592	1.07;1.07;1.12	4.94	-0.104	0.13605	.	0.206604	0.39759	N	0.001263	T	0.09113	0.0225	N	0.00483	-1.445	0.54753	D	0.999983	B	0.02656	0.0	B	0.01281	0.0	T	0.39761	-0.9598	10	0.02654	T	1	.	6.7386	0.23422	0.3587:0.4668:0.1745:0.0	.	488	P57679	EVC_HUMAN	K	488	ENSP00000264956:E488K;ENSP00000372120:E488K;ENSP00000426774:E488K	ENSP00000264956:E488K	E	+	1	0	EVC	5806559	0.198000	0.23374	0.860000	0.33809	0.041000	0.13682	0.321000	0.19558	-0.257000	0.09459	-0.361000	0.07541	GAG	EVC	-	NULL		0.592	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	G			5755658	+1	no_errors	ENST00000264956	ensembl	human	known	70_37	missense	SNP	0.304	A
FAM118B	79607	genome.wustl.edu	37	11	126120401	126120401	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:126120401C>T	ENST00000533050.1	+	5	833	c.340C>T	c.(340-342)Cgt>Tgt	p.R114C	FAM118B_ENST00000529731.1_Intron|FAM118B_ENST00000360194.4_Splice_Site_p.R114C|FAM118B_ENST00000525728.1_3'UTR	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	114										breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		CCCTCCTCAGCGTACCAGTAA	0.343																																																	0													78.0	78.0	78.0					11																	126120401		2201	4299	6500	SO:0001630	splice_region_variant	79607			BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.340-1C>T	11.37:g.126120401C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H7B0	Missense_Mutation	SNP	NULL	p.R114C	ENST00000533050.1	37	c.340	CCDS8470.1	11	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028341	0.75390	.	.	ENSG00000197798	ENST00000533050;ENST00000528985;ENST00000360194;ENST00000530043	T;T;T;T	0.57907	1.19;1.2;1.2;0.37	6.17	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.60818	0.2298	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.982	T	0.60000	-0.7348	9	.	.	.	-28.9724	17.0867	0.86612	0.1279:0.8721:0.0:0.0	.	114;114	E9PMJ2;Q9BPY3	.;F118B_HUMAN	C	114	ENSP00000433343:R114C;ENSP00000434952:R114C;ENSP00000353321:R114C;ENSP00000437285:R114C	.	R	+	1	0	FAM118B	125625611	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.400000	0.44504	1.610000	0.50200	0.655000	0.94253	CGT	FAM118B	-	NULL		0.343	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM118B	HGNC	protein_coding	OTTHUMT00000386346.1	C	NM_024556	Missense_Mutation	126120401	+1	no_errors	ENST00000533050	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM129A	116496	genome.wustl.edu	37	1	184764821	184764821	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:184764821C>T	ENST00000367511.3	-	14	2270	c.2077G>A	c.(2077-2079)Gaa>Aaa	p.E693K	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	693	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						GCGGGTTCTTCATCCTCAAGG	0.577																																																	0													60.0	53.0	55.0					1																	184764821		2203	4300	6503	SO:0001583	missense	116496			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2077G>A	1.37:g.184764821C>T	ENSP00000356481:p.Glu693Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.E693K	ENST00000367511.3	37	c.2077	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	C	9.104	1.004891	0.19199	.	.	ENSG00000135842	ENST00000367511	T	0.10382	2.88	5.58	-1.24	0.09435	.	1.559240	0.03472	N	0.213847	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35001	-0.9806	10	0.07030	T	0.85	0.2624	7.0278	0.24950	0.0:0.3911:0.352:0.257	.	693	Q9BZQ8	NIBAN_HUMAN	K	693	ENSP00000356481:E693K	ENSP00000356481:E693K	E	-	1	0	FAM129A	183031444	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.294000	0.08309	-0.246000	0.09611	0.491000	0.48974	GAA	FAM129A	-	NULL		0.577	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	C			184764821	-1	no_errors	ENST00000367511	ensembl	human	known	70_37	missense	SNP	0.000	T
FAM129C	199786	genome.wustl.edu	37	19	17664206	17664206	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:17664206C>T	ENST00000335393.4	+	16	2066	c.1928C>T	c.(1927-1929)gCt>gTt	p.A643V	FAM129C_ENST00000449408.2_Missense_Mutation_p.A369V|COLGALT1_ENST00000252599.4_5'Flank|FAM129C_ENST00000601861.1_Missense_Mutation_p.A612V	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	643										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						AAGTCATCTGCTAACTGGATA	0.502																																																	0													128.0	125.0	126.0					19																	17664206		2203	4300	6503	SO:0001583	missense	199786			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1928C>T	19.37:g.17664206C>T	ENSP00000335040:p.Ala643Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.A643V	ENST00000335393.4	37	c.1928	CCDS12362.1	19	.	.	.	.	.	.	.	.	.	.	C	0.084	-1.178824	0.01633	.	.	ENSG00000167483	ENST00000335393;ENST00000449408	T;T	0.28255	1.98;1.62	2.18	-0.0116	0.13991	.	.	.	.	.	T	0.15739	0.0379	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22521	-1.0214	9	0.66056	D	0.02	.	4.3096	0.10964	0.0:0.3873:0.0:0.6127	.	643	Q86XR2	NIBL2_HUMAN	V	643;369	ENSP00000335040:A643V;ENSP00000394929:A369V	ENSP00000335040:A643V	A	+	2	0	FAM129C	17525206	0.074000	0.21230	0.050000	0.19076	0.187000	0.23431	0.730000	0.26043	-0.054000	0.13266	0.306000	0.20318	GCT	FAM129C	-	NULL		0.502	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM129C	HGNC	protein_coding	OTTHUMT00000464206.1	C	NM_173544		17664206	+1	no_errors	ENST00000335393	ensembl	human	known	70_37	missense	SNP	0.057	T
FAM135B	51059	genome.wustl.edu	37	8	139164862	139164862	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:139164862C>T	ENST00000395297.1	-	13	2026	c.1856G>A	c.(1855-1857)gGa>gAa	p.G619E		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	619										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TATTCCCTTTCCTAGAGTACT	0.478										HNSCC(54;0.14)																																							0													132.0	129.0	130.0					8																	139164862		1888	4126	6014	SO:0001583	missense	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1856G>A	8.37:g.139164862C>T	ENSP00000378710:p.Gly619Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.G619E	ENST00000395297.1	37	c.1856	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	C	8.902	0.956548	0.18507	.	.	ENSG00000147724	ENST00000395297	T	0.14391	2.51	5.35	4.42	0.53409	.	0.632905	0.16098	N	0.229727	T	0.13457	0.0326	L	0.57536	1.79	0.09310	N	1	P;P;B	0.50528	0.936;0.834;0.142	P;P;B	0.46320	0.512;0.512;0.021	T	0.12344	-1.0551	10	0.02654	T	1	-19.7817	6.852	0.24020	0.0:0.6953:0.1529:0.1518	.	619;619;619	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	E	619	ENSP00000378710:G619E	ENSP00000276737:G619E	G	-	2	0	FAM135B	139234044	0.002000	0.14202	0.057000	0.19452	0.009000	0.06853	0.342000	0.19926	2.678000	0.91216	0.655000	0.94253	GGA	FAM135B	-	NULL		0.478	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	C	NM_015912		139164862	-1	no_errors	ENST00000395297	ensembl	human	known	70_37	missense	SNP	0.001	T
FAM155A	728215	genome.wustl.edu	37	13	108518440	108518440	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:108518440C>A	ENST00000375915.2	-	1	643	c.505G>T	c.(505-507)Gag>Tag	p.E169*		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	169						integral component of membrane (GO:0016021)		p.E169K(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						TAACAAGTCTCCAGGCGCCAC	0.697																																																	1	Substitution - Missense(1)	urinary_tract(1)											24.0	30.0	28.0					13																	108518440		2184	4262	6446	SO:0001587	stop_gained	728215			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.505G>T	13.37:g.108518440C>A	ENSP00000365080:p.Glu169*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUV1|B7Z334	Nonsense_Mutation	SNP	NULL	p.E169*	ENST00000375915.2	37	c.505	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.924158	0.97940	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.45	4.6	0.57074	.	0.473409	0.20704	N	0.087209	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.667	0.68915	0.1463:0.8537:0.0:0.0	.	.	.	.	X	169	.	ENSP00000365080:E169X	E	-	1	0	FAM155A	107316441	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	6.745000	0.74860	1.283000	0.44513	-0.314000	0.08810	GAG	FAM155A	-	NULL		0.697	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	C	NM_001080396		108518440	-1	no_errors	ENST00000375915	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FAM166B	730112	genome.wustl.edu	37	9	35562970	35562970	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:35562970G>T	ENST00000399742.2	-	3	464	c.394C>A	c.(394-396)Cta>Ata	p.L132I	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	132										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						TCCTTTGGTAGCTCTTCACTC	0.572																																																	0													79.0	76.0	77.0					9																	35562970		2017	4172	6189	SO:0001583	missense	730112			BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.394C>A	9.37:g.35562970G>T	ENSP00000382646:p.Leu132Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3B2|B7ZBJ0	Missense_Mutation	SNP	pfam_UPF0573/UPF0605	p.L132I	ENST00000399742.2	37	c.394	CCDS56572.1	9	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753995	0.49362	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	.	.	.	5.39	1.05	0.20165	.	6.977050	0.01461	U	0.015894	T	0.52821	0.1758	M	0.68317	2.08	0.09310	N	1	P;D;P;D	0.59767	0.908;0.976;0.78;0.986	B;P;B;P	0.55713	0.368;0.609;0.197;0.782	T	0.27673	-1.0067	9	0.25106	T	0.35	0.3231	4.4724	0.11719	0.1855:0.0:0.5678:0.2467	.	132;132;132;132	B7ZW33;B7ZW26;A8MTA8;A8MTA8-2	.;.;F166B_HUMAN;.	I	132	.	ENSP00000382646:L132I	L	-	1	2	FAM166B	35552970	0.001000	0.12720	0.005000	0.12908	0.065000	0.16274	0.523000	0.22925	0.642000	0.30620	0.563000	0.77884	CTA	FAM166B	-	NULL		0.572	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM166B	HGNC	protein_coding	OTTHUMT00000336563.1	G	NM_001099951		35562970	-1	no_errors	ENST00000447837	ensembl	human	known	70_37	missense	SNP	0.006	T
FAM189A2	9413	genome.wustl.edu	37	9	71986460	71986460	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:71986460C>G	ENST00000257515.8	+	3	478	c.58C>G	c.(58-60)Cta>Gta	p.L20V	FAM189A2_ENST00000455972.1_Missense_Mutation_p.L20V|FAM189A2_ENST00000303068.7_Intron	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	20						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CCTCTTAAATCTAGCTGGATT	0.463																																																	0													231.0	206.0	214.0					9																	71986460		2203	4300	6503	SO:0001583	missense	9413			L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.58C>G	9.37:g.71986460C>G	ENSP00000257515:p.Leu20Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	pfam_CD20-like	p.L20V	ENST00000257515.8	37	c.58	CCDS6629.1	9	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699617	0.30142	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000377225	T;T	0.03330	3.97;3.97	5.72	2.87	0.33458	.	0.000000	0.64402	D	0.000008	T	0.13457	0.0326	L	0.61218	1.895	0.53688	D	0.999978	D	0.76494	0.999	D	0.87578	0.998	T	0.00115	-1.2039	10	0.87932	D	0	-16.665	10.4491	0.44511	0.0:0.8305:0.0:0.1695	.	20	Q15884	F1892_HUMAN	V	20;20;19	ENSP00000395675:L20V;ENSP00000257515:L20V	ENSP00000257515:L20V	L	+	1	2	FAM189A2	71176280	1.000000	0.71417	0.307000	0.25127	0.236000	0.25371	1.053000	0.30442	0.325000	0.23359	0.655000	0.94253	CTA	FAM189A2	-	pfam_CD20-like		0.463	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A2	HGNC	protein_coding	OTTHUMT00000052576.2	C	NM_004816		71986460	+1	no_errors	ENST00000257515	ensembl	human	known	70_37	missense	SNP	1.000	G
FAM26D	221301	genome.wustl.edu	37	6	116875494	116875494	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:116875494C>T	ENST00000368596.3	+	1	582	c.538C>T	c.(538-540)Ctg>Ttg	p.L180L	FAM26D_ENST00000416171.2_Silent_p.L36L|FAM26D_ENST00000405399.1_Silent_p.L37L|FAM26D_ENST00000368597.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	180					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		AATAGCTCTTCTGCACAGATA	0.413																																																	0																																										SO:0001819	synonymous_variant	221301			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.538C>T	6.37:g.116875494C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Silent	SNP	NULL	p.L180	ENST00000368596.3	37	c.538		6																																																																																			FAM26D	-	NULL		0.413	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	C	NM_153036		116875494	+1	no_errors	ENST00000368596	ensembl	human	known	70_37	silent	SNP	1.000	T
FAM47C	442444	genome.wustl.edu	37	X	37027059	37027059	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:37027059G>A	ENST00000358047.3	+	1	628	c.576G>A	c.(574-576)gaG>gaA	p.E192E		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	192										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GGCCTCCCGAGACTCGGGTGT	0.647																																																	0													29.0	31.0	30.0					X																	37027059		2202	4299	6501	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.576G>A	X.37:g.37027059G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZU46	Silent	SNP	NULL	p.E192	ENST00000358047.3	37	c.576	CCDS35227.1	X																																																																																			FAM47C	-	NULL		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	G	NM_001013736		37027059	+1	no_errors	ENST00000358047	ensembl	human	known	70_37	silent	SNP	0.706	A
FAM49B	51571	genome.wustl.edu	37	8	130883699	130883699	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:130883699C>T	ENST00000519824.2	-	4	390	c.117G>A	c.(115-117)gtG>gtA	p.V39V	FAM49B_ENST00000518879.1_Intron|FAM49B_ENST00000519110.1_Silent_p.V39V|FAM49B_ENST00000519540.1_Silent_p.V39V|FAM49B_ENST00000522250.1_5'UTR|FAM49B_ENST00000517654.1_Silent_p.V39V|SNORA25_ENST00000363205.1_RNA|FAM49B_ENST00000401979.2_Silent_p.V39V|FAM49B_ENST00000522746.1_Silent_p.V39V|FAM49B_ENST00000523509.1_Silent_p.V39V|FAM49B_ENST00000522941.1_5'UTR	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	39						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			ATACTACATTCACCTGATTAT	0.378																																																	0													92.0	89.0	90.0					8																	130883699		2203	4300	6503	SO:0001819	synonymous_variant	51571			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.117G>A	8.37:g.130883699C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AZ5|Q9NW21|Q9NZE7	Silent	SNP	pfam_DUF1394	p.V39	ENST00000519824.2	37	c.117	CCDS6361.1	8																																																																																			FAM49B	-	pfam_DUF1394		0.378	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	C	NM_016623		130883699	-1	no_errors	ENST00000401979	ensembl	human	known	70_37	silent	SNP	1.000	T
FAM49B	51571	genome.wustl.edu	37	8	130883722	130883722	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:130883722C>T	ENST00000519824.2	-	4	367	c.94G>A	c.(94-96)Gag>Aag	p.E32K	FAM49B_ENST00000518879.1_Intron|FAM49B_ENST00000519110.1_Missense_Mutation_p.E32K|FAM49B_ENST00000519540.1_Missense_Mutation_p.E32K|FAM49B_ENST00000522250.1_5'UTR|FAM49B_ENST00000517654.1_Missense_Mutation_p.E32K|SNORA25_ENST00000363205.1_RNA|FAM49B_ENST00000401979.2_Missense_Mutation_p.E32K|FAM49B_ENST00000522746.1_Missense_Mutation_p.E32K|FAM49B_ENST00000523509.1_Missense_Mutation_p.E32K|FAM49B_ENST00000522941.1_5'UTR	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	32						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			ATTTCCTTCTCAGACTCTGTA	0.378																																																	0													72.0	70.0	71.0					8																	130883722		2203	4300	6503	SO:0001583	missense	51571			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.94G>A	8.37:g.130883722C>T	ENSP00000429150:p.Glu32Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	pfam_DUF1394	p.E32K	ENST00000519824.2	37	c.94	CCDS6361.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.558341	0.96514	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000519142;ENST00000520204;ENST00000518283;ENST00000523993;ENST00000520254;ENST00000519020;ENST00000518167;ENST00000517672;ENST00000519070;ENST00000522361	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.79233	0.4411	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82725	-0.0315	10	0.87932	D	0	-13.3457	19.1142	0.93331	0.0:1.0:0.0:0.0	.	32	Q9NUQ9	FA49B_HUMAN	K	32	ENSP00000428117:E32K;ENSP00000429802:E32K;ENSP00000384880:E32K;ENSP00000429078:E32K;ENSP00000429150:E32K;ENSP00000430674:E32K;ENSP00000429499:E32K;ENSP00000430806:E32K;ENSP00000429051:E32K;ENSP00000430694:E32K;ENSP00000429074:E32K;ENSP00000430127:E32K;ENSP00000429659:E32K;ENSP00000427994:E32K;ENSP00000430434:E32K;ENSP00000429860:E32K;ENSP00000430412:E32K	ENSP00000384880:E32K	E	-	1	0	FAM49B	130952904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.749000	0.94314	0.655000	0.94253	GAG	FAM49B	-	pfam_DUF1394		0.378	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49B	HGNC	protein_coding	OTTHUMT00000380390.2	C	NM_016623		130883722	-1	no_errors	ENST00000401979	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM81B	153643	genome.wustl.edu	37	5	94727215	94727215	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:94727215C>T	ENST00000283357.5	+	1	168	c.122C>T	c.(121-123)tCa>tTa	p.S41L		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	41						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		ATCATGAGTTCAGGTACTTAT	0.303																																																	0													65.0	64.0	64.0					5																	94727215		1811	4078	5889	SO:0001583	missense	153643				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.122C>T	5.37:g.94727215C>T	ENSP00000283357:p.Ser41Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S41L	ENST00000283357.5	37	c.122	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912944	0.52439	.	.	ENSG00000153347	ENST00000283357	T	0.23552	1.9	4.83	4.83	0.62350	.	0.190069	0.26478	N	0.024144	T	0.11110	0.0271	N	0.01267	-0.92	0.24522	N	0.994157	B	0.32829	0.386	B	0.34242	0.178	T	0.23619	-1.0183	10	0.87932	D	0	25.3118	13.6124	0.62088	0.0:1.0:0.0:0.0	.	41	Q96LP2	FA81B_HUMAN	L	41	ENSP00000283357:S41L	ENSP00000283357:S41L	S	+	2	0	FAM81B	94752971	0.987000	0.35691	0.991000	0.47740	0.221000	0.24807	3.189000	0.50965	2.658000	0.90341	0.563000	0.77884	TCA	FAM81B	-	NULL		0.303	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	HGNC	protein_coding	OTTHUMT00000370690.1	C	NM_152548		94727215	+1	no_errors	ENST00000283357	ensembl	human	known	70_37	missense	SNP	0.995	T
FBXL16	146330	genome.wustl.edu	37	16	744329	744329	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:744329G>A	ENST00000397621.1	-	6	1717	c.1386C>T	c.(1384-1386)ccC>ccT	p.P462P	LA16c-313D11.12_ENST00000566927.1_RNA|FBXL16_ENST00000562585.1_5'Flank|FBXL16_ENST00000562563.1_Silent_p.P250P|FBXL16_ENST00000324361.5_Silent_p.P462P	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	462										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				TGAAGAGCTCGGGGGTGGCCC	0.711																																																	0													8.0	11.0	10.0					16																	744329		2127	4187	6314	SO:0001819	synonymous_variant	146330			BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.1386C>T	16.37:g.744329G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Silent	SNP	superfamily_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp	p.P462	ENST00000397621.1	37	c.1386	CCDS10421.1	16																																																																																			FBXL16	-	NULL		0.711	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL16	HGNC	protein_coding	OTTHUMT00000206851.2	G	NM_153350		744329	-1	no_errors	ENST00000324361	ensembl	human	known	70_37	silent	SNP	0.944	A
FBXL19	54620	genome.wustl.edu	37	16	30937143	30937143	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:30937143G>A	ENST00000380310.2	+	2	286	c.128G>A	c.(127-129)cGg>cAg	p.R43Q	FBXL19_ENST00000565690.1_Missense_Mutation_p.R23Q|FBXL19-AS1_ENST00000563777.1_RNA|FBXL19_ENST00000338343.4_Missense_Mutation_p.R23Q|FBXL19_ENST00000471231.2_5'UTR|FBXL19_ENST00000562319.1_Missense_Mutation_p.R23Q	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	43	Arg-rich.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						CGCCGCTGCCGGGCCTGTGTG	0.716																																																	0													6.0	8.0	7.0					16																	30937143		1858	4029	5887	SO:0001583	missense	54620			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.128G>A	16.37:g.30937143G>A	ENSP00000369666:p.Arg43Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.R43Q	ENST00000380310.2	37	c.128	CCDS45465.1	16	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861966	0.71949	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.20881	2.04;2.36	5.15	3.19	0.36642	Zinc finger, CXXC-type (2);	0.422740	0.18638	U	0.135367	T	0.12433	0.0302	N	0.19112	0.55	0.22330	N	0.999191	B	0.19331	0.035	B	0.10450	0.005	T	0.20140	-1.0284	10	0.49607	T	0.09	-4.0721	6.8583	0.24052	0.3577:0.0:0.6423:0.0	.	43	Q6PCT2	FXL19_HUMAN	Q	23;43	ENSP00000339712:R23Q;ENSP00000369666:R43Q	ENSP00000339712:R23Q	R	+	2	0	FBXL19	30844644	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.091000	0.71406	0.560000	0.29169	0.462000	0.41574	CGG	FBXL19	-	pfam_Znf_CXXC,pfscan_Znf_CXXC		0.716	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL19	HGNC	protein_coding		G	NM_019085		30937143	+1	no_errors	ENST00000380310	ensembl	human	known	70_37	missense	SNP	1.000	A
FBXL20	84961	genome.wustl.edu	37	17	37421664	37421664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:37421664G>A	ENST00000264658.6	-	13	1236	c.976C>T	c.(976-978)Cga>Tga	p.R326*	FBXL20_ENST00000577399.1_Nonsense_Mutation_p.R328*|FBXL20_ENST00000394294.3_Nonsense_Mutation_p.R294*|FBXL20_ENST00000583610.1_Nonsense_Mutation_p.R326*	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	326					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			ACTTGAAGTCGAGGACAGTGT	0.338																																																	0													117.0	108.0	111.0					17																	37421664		2203	4300	6503	SO:0001587	stop_gained	84961			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.976C>T	17.37:g.37421664G>A	ENSP00000264658:p.Arg326*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K729|Q38J52	Nonsense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.R326*	ENST00000264658.6	37	c.976	CCDS32640.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.355243	0.97498	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	.	.	.	5.61	4.56	0.56223	.	0.121655	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1147	0.72392	0.0:0.0:0.7713:0.2287	.	.	.	.	X	326;294	.	ENSP00000264658:R326X	R	-	1	2	FBXL20	34675190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.863000	0.56016	2.646000	0.89796	0.563000	0.77884	CGA	FBXL20	-	smart_Leu-rich_rpt_Cys-con_subtyp		0.338	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL20	HGNC	protein_coding	OTTHUMT00000444315.2	G	NM_032875		37421664	-1	no_errors	ENST00000264658	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FBXO46	23403	genome.wustl.edu	37	19	46216131	46216131	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:46216131C>T	ENST00000317683.3	-	2	756	c.623G>A	c.(622-624)gGa>gAa	p.G208E		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	208										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CTTGGCCGGTCCACCTTGCTC	0.682																																																	0													18.0	22.0	21.0					19																	46216131		1993	4135	6128	SO:0001583	missense	23403			BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.623G>A	19.37:g.46216131C>T	ENSP00000410007:p.Gly208Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.G208E	ENST00000317683.3	37	c.623	CCDS46116.1	19	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.302804	0.01353	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.04	2.91	0.33838	.	.	.	.	.	T	0.20700	0.0498	N	0.22421	0.69	0.09310	N	1	P	0.42518	0.782	B	0.37304	0.246	T	0.03017	-1.1082	8	0.08179	T	0.78	-12.6023	11.6251	0.51139	0.0:0.8182:0.1818:0.0	.	208	Q6PJ61	FBX46_HUMAN	E	208	.	ENSP00000410007:G208E	G	-	2	0	FBXO46	50907971	0.000000	0.05858	0.926000	0.36857	0.137000	0.21094	0.473000	0.22132	2.278000	0.76064	0.563000	0.77884	GGA	FBXO46	-	NULL		0.682	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO46	HGNC	protein_coding	OTTHUMT00000459661.1	C	XM_371179		46216131	-1	no_errors	ENST00000317683	ensembl	human	known	70_37	missense	SNP	0.133	T
FEN1	2237	genome.wustl.edu	37	11	61563334	61563334	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:61563334G>A	ENST00000305885.2	+	2	914	c.501G>A	c.(499-501)gtG>gtA	p.V167V	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1											endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						CTGCCCTGGTGAAGGCTGGCA	0.562								Editing and processing nucleases																																									0													62.0	63.0	63.0					11																	61563334		2202	4298	6500	SO:0001819	synonymous_variant	2237			L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.501G>A	11.37:g.61563334G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_XPG_DNA_repair_N,pfam_XPG/RAD2_endonuclease,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.V167	ENST00000305885.2	37	c.501	CCDS8010.1	11																																																																																			FEN1	-	pfam_XPG/RAD2_endonuclease,smart_XPG/RAD2_endonuclease,prints_XPGC_Rad_DNA_repair		0.562	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEN1	HGNC	protein_coding	OTTHUMT00000398526.1	G	NM_004111		61563334	+1	no_errors	ENST00000305885	ensembl	human	known	70_37	silent	SNP	1.000	A
FHOD1	29109	genome.wustl.edu	37	16	67264035	67264035	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:67264035G>T	ENST00000258201.4	-	20	3395	c.3148C>A	c.(3148-3150)Cat>Aat	p.H1050N		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1050					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ATACTAGCATGACTGTCAGCA	0.617																																																	0													91.0	93.0	92.0					16																	67264035		2198	4300	6498	SO:0001583	missense	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.3148C>A	16.37:g.67264035G>T	ENSP00000258201:p.His1050Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.H1050N	ENST00000258201.4	37	c.3148	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680807	0.29872	.	.	ENSG00000135723	ENST00000258201	T	0.37584	1.19	5.09	4.09	0.47781	Actin-binding FH2/DRF autoregulatory (1);	0.048302	0.85682	D	0.000000	T	0.41442	0.1159	M	0.73598	2.24	0.25719	N	0.985399	B	0.29301	0.241	B	0.32533	0.147	T	0.45220	-0.9276	10	0.62326	D	0.03	.	13.3481	0.60587	0.0:0.1719:0.8281:0.0	.	1050	Q9Y613	FHOD1_HUMAN	N	1050	ENSP00000258201:H1050N	ENSP00000258201:H1050N	H	-	1	0	FHOD1	65821536	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.007000	0.57093	2.656000	0.90262	0.561000	0.74099	CAT	FHOD1	-	smart_Actin-bd_FH2/DRF_autoreg		0.617	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	G			67264035	-1	no_errors	ENST00000258201	ensembl	human	known	70_37	missense	SNP	0.055	T
FHOD1	29109	genome.wustl.edu	37	16	67264118	67264118	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:67264118G>C	ENST00000258201.4	-	20	3312	c.3065C>G	c.(3064-3066)tCa>tGa	p.S1022*		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1022					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AGCCACACCTGAGAACTTCTC	0.582																																																	0													43.0	48.0	46.0					16																	67264118		2197	4300	6497	SO:0001587	stop_gained	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.3065C>G	16.37:g.67264118G>C	ENSP00000258201:p.Ser1022*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Nonsense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.S1022*	ENST00000258201.4	37	c.3065	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	G	41	8.998185	0.99031	.	.	ENSG00000135723	ENST00000258201	.	.	.	5.85	4.89	0.63831	.	0.122937	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	13.4068	0.60917	0.0:0.0:0.8426:0.1574	.	.	.	.	X	1022	.	ENSP00000258201:S1022X	S	-	2	0	FHOD1	65821619	1.000000	0.71417	0.983000	0.44433	0.984000	0.73092	4.212000	0.58514	1.449000	0.47699	0.561000	0.74099	TCA	FHOD1	-	smart_Actin-bd_FH2/DRF_autoreg		0.582	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	G			67264118	-1	no_errors	ENST00000258201	ensembl	human	known	70_37	nonsense	SNP	0.541	C
FLG2	388698	genome.wustl.edu	37	1	152327738	152327738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:152327738G>A	ENST00000388718.5	-	3	2596	c.2524C>T	c.(2524-2526)Cag>Tag	p.Q842*	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	842	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGCTGGACTGATGTGATCTA	0.512																																																	0													343.0	327.0	332.0					1																	152327738		2203	4300	6503	SO:0001587	stop_gained	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2524C>T	1.37:g.152327738G>A	ENSP00000373370:p.Gln842*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H4U1	Nonsense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Q842*	ENST00000388718.5	37	c.2524	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.782678	0.96937	.	.	ENSG00000143520	ENST00000388718	.	.	.	3.78	2.8	0.32819	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	10.2718	0.43487	0.0:0.0:0.8022:0.1977	.	.	.	.	X	842	.	ENSP00000373370:Q842X	Q	-	1	0	FLG2	150594362	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	0.128000	0.15810	1.675000	0.50919	0.586000	0.80456	CAG	FLG2	-	NULL		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	G	NM_001014342		152327738	-1	no_errors	ENST00000388718	ensembl	human	known	70_37	nonsense	SNP	0.056	A
FLNC	2318	genome.wustl.edu	37	7	128475570	128475570	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:128475570C>T	ENST00000325888.8	+	2	804	c.543C>T	c.(541-543)ttC>ttT	p.F181F	FLNC_ENST00000346177.6_Silent_p.F181F	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	181	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TCACCAACTTCAACCGTGACT	0.627																																																	0													50.0	59.0	56.0					7																	128475570		2161	4273	6434	SO:0001819	synonymous_variant	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.543C>T	7.37:g.128475570C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F181	ENST00000325888.8	37	c.543	CCDS43644.1	7																																																																																			FLNC	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	C			128475570	+1	no_errors	ENST00000325888	ensembl	human	known	70_37	silent	SNP	1.000	T
FLRT2	23768	genome.wustl.edu	37	14	86089523	86089523	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:86089523G>A	ENST00000330753.4	+	2	2432	c.1665G>A	c.(1663-1665)ctG>ctA	p.L555L	FLRT2_ENST00000554746.1_Silent_p.L555L	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	555					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TATTTGTGCTGGTGGTCTTGC	0.577																																																	0													76.0	81.0	79.0					14																	86089523		2203	4300	6503	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1665G>A	14.37:g.86089523G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV84|B7ZLP3	Silent	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.L555	ENST00000330753.4	37	c.1665	CCDS9877.1	14																																																																																			FLRT2	-	NULL		0.577	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	G			86089523	+1	no_errors	ENST00000330753	ensembl	human	known	70_37	silent	SNP	0.045	A
FLT1	2321	genome.wustl.edu	37	13	29041146	29041146	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:29041146C>G	ENST00000282397.4	-	3	533	c.282G>C	c.(280-282)ttG>ttC	p.L94F	FLT1_ENST00000541932.1_Missense_Mutation_p.L94F|FLT1_ENST00000539099.1_Missense_Mutation_p.L94F	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	94	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGCTGTGTTCAAGGTTAAAG	0.403																																																	0													225.0	207.0	213.0					13																	29041146		2203	4300	6503	SO:0001583	missense	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.282G>C	13.37:g.29041146C>G	ENSP00000282397:p.Leu94Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR1_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.L94F	ENST00000282397.4	37	c.282	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	C	16.54	3.153048	0.57259	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000450836;ENST00000539099	T;T;T	0.32753	1.44;1.44;1.44	5.81	4.92	0.64577	Immunoglobulin subtype (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.186676	0.35291	N	0.003304	T	0.60612	0.2282	M	0.87682	2.9	0.47862	D	0.999539	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.83275	0.992;0.992;0.995;0.989;0.996	T	0.66799	-0.5832	10	0.87932	D	0	.	14.7469	0.69494	0.0:0.8561:0.1438:0.0	.	94;94;94;94;94	P17948-4;P17948-3;B5A924;P17948-2;P17948	.;.;.;.;VGFR1_HUMAN	F	94	ENSP00000282397:L94F;ENSP00000437631:L94F;ENSP00000442630:L94F	ENSP00000282397:L94F	L	-	3	2	FLT1	27939146	0.996000	0.38824	0.982000	0.44146	0.437000	0.31866	2.727000	0.47311	2.755000	0.94549	0.650000	0.86243	TTG	FLT1	-	smart_Ig_sub,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N		0.403	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	C			29041146	-1	no_errors	ENST00000282397	ensembl	human	known	70_37	missense	SNP	0.991	G
FMOD	2331	genome.wustl.edu	37	1	203316711	203316711	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:203316711G>C	ENST00000354955.4	-	2	1151	c.688C>G	c.(688-690)Ctg>Gtg	p.L230V	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	230					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			TTATAACTCAGGTCCAGCAAG	0.562																																																	0													91.0	88.0	89.0					1																	203316711		2203	4300	6503	SO:0001583	missense	2331			U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.688C>G	1.37:g.203316711G>C	ENSP00000347041:p.Leu230Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15331|Q8IV47	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.L230V	ENST00000354955.4	37	c.688	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	G	9.165	1.019662	0.19355	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.74842	-0.88	5.18	3.16	0.36331	.	0.411877	0.25932	N	0.027376	T	0.69088	0.3072	M	0.71871	2.18	0.37101	D	0.899915	B	0.20780	0.048	B	0.22601	0.04	T	0.65672	-0.6111	10	0.46703	T	0.11	-21.4206	6.1796	0.20463	0.0936:0.0:0.5894:0.317	.	230	Q06828	FMOD_HUMAN	V	217;230	ENSP00000347041:L230V	ENSP00000347041:L230V	L	-	1	2	FMOD	201583334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.361000	0.34136	0.473000	0.27368	0.655000	0.94253	CTG	FMOD	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.562	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	HGNC	protein_coding	OTTHUMT00000087472.1	G	NM_002023		203316711	-1	no_errors	ENST00000354955	ensembl	human	known	70_37	missense	SNP	0.998	C
FOLH1	2346	genome.wustl.edu	37	11	49228337	49228337	+	Intron	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:49228337C>G	ENST00000256999.2	-	2	379				FOLH1_ENST00000533034.1_Missense_Mutation_p.E22D|FOLH1_ENST00000356696.3_Intron|FOLH1_ENST00000340334.7_Missense_Mutation_p.E22D|FOLH1_ENST00000343844.4_Intron	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1						folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TACCCAGCCTCTCTGCCAGAC	0.453																																																	0																																										SO:0001627	intron_variant	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.119-613G>C	11.37:g.49228337C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.E22D	ENST00000256999.2	37	c.66	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	5.669	0.308079	0.10733	.	.	ENSG00000086205	ENST00000340334;ENST00000533034	T;T	0.38560	1.13;1.15	3.67	1.76	0.24704	.	.	.	.	.	T	0.18759	0.0450	N	0.08118	0	0.09310	N	1	B;B;B	0.22003	0.026;0.063;0.002	B;B;B	0.21360	0.03;0.034;0.008	T	0.24261	-1.0165	9	0.19147	T	0.46	.	4.3649	0.11220	0.2232:0.6589:0.0:0.1179	.	22;22;22	Q04609-9;Q04609-7;A4UU13	.;.;.	D	22	ENSP00000344131:E22D;ENSP00000431463:E22D	ENSP00000344131:E22D	E	-	3	2	FOLH1	49184913	0.000000	0.05858	0.046000	0.18839	0.384000	0.30261	-0.275000	0.08525	0.521000	0.28445	0.609000	0.83330	GAG	FOLH1	-	NULL		0.453	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	C	NM_004476		49228337	-1	no_errors	ENST00000340334	ensembl	human	putative	70_37	missense	SNP	0.059	G
FOLH1B	219595	genome.wustl.edu	37	11	89424627	89424627	+	RNA	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:89424627C>G	ENST00000532352.1	+	0	1790							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TCACTTTTTTCTGCAGTAAAA	0.318																																																	0													60.0	62.0	61.0					11																	89424627		2198	4293	6491			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89424627C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			FOLH1B	-	-		0.318	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	C	NM_153696		89424627	+1	no_errors	ENST00000525540	ensembl	human	known	70_37	rna	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79343130	79343130	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:79343130G>A	ENST00000325942.6	+	34	5094	c.4654G>A	c.(4654-4656)Gag>Aag	p.E1552K	FRAS1_ENST00000264895.6_Missense_Mutation_p.E1552K	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1552					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CCACCTCCAGGAGCTCATGGC	0.582																																																	0													116.0	128.0	124.0					4																	79343130		2061	4186	6247	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4654G>A	4.37:g.79343130G>A	ENSP00000326330:p.Glu1552Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.E1552K	ENST00000325942.6	37	c.4654	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.634536	0.96682	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.56776	0.44;0.44	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.73613	0.3609	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.937;0.998	T	0.75056	-0.3452	10	0.72032	D	0.01	.	19.4277	0.94751	0.0:0.0:1.0:0.0	.	1552;1552	E9PHH6;A2RRR8	.;.	K	1552	ENSP00000326330:E1552K;ENSP00000264895:E1552K	ENSP00000264895:E1552K	E	+	1	0	FRAS1	79562154	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.329000	0.90017	2.686000	0.91538	0.591000	0.81541	GAG	FRAS1	-	NULL		0.582	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	G			79343130	+1	no_errors	ENST00000264895	ensembl	human	known	70_37	missense	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186661203	186661203	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:186661203G>A	ENST00000424728.1	+	16	9340	c.9340G>A	c.(9340-9342)Gag>Aag	p.E3114K	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.E3203K|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3114										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CATATTGAAAGAGAACATTGT	0.348																																																	0																																										SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.9340G>A	2.37:g.186661203G>A	ENSP00000401306:p.Glu3114Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.E3203K	ENST00000424728.1	37	c.9607		2	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402760	0.42613	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.57595	0.39;0.4	5.32	5.32	0.75619	.	0.000000	0.56097	D	0.000030	T	0.56277	0.1974	L	0.43152	1.355	0.32255	N	0.570892	.	.	.	.	.	.	T	0.65409	-0.6175	8	0.52906	T	0.07	.	14.3872	0.66953	0.0:0.0:1.0:0.0	.	.	.	.	K	3203;3114;3114	ENSP00000344403:E3203K;ENSP00000401306:E3114K	ENSP00000321903:E3114K	E	+	1	0	FSIP2	186369448	1.000000	0.71417	0.971000	0.41717	0.449000	0.32228	4.613000	0.61176	2.767000	0.95098	0.557000	0.71058	GAG	FSIP2	-	NULL		0.348	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	G	NM_173651		186661203	+1	no_errors	ENST00000343098	ensembl	human	known	70_37	missense	SNP	0.993	A
FSTL5	56884	genome.wustl.edu	37	4	162380377	162380377	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:162380377G>A	ENST00000306100.5	-	14	2139	c.1703C>T	c.(1702-1704)tCa>tTa	p.S568L	FSTL5_ENST00000427802.2_Missense_Mutation_p.S558L|FSTL5_ENST00000536695.1_Missense_Mutation_p.S567L|FSTL5_ENST00000379164.4_Missense_Mutation_p.S567L	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	568						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TAGTGTTGGTGATGTCTTCTC	0.373																																																	0													136.0	124.0	128.0					4																	162380377		2203	4300	6503	SO:0001583	missense	56884			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1703C>T	4.37:g.162380377G>A	ENSP00000305334:p.Ser568Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal-type_dom,pfam_Ig_V-set,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.S568L	ENST00000306100.5	37	c.1703	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	g	11.05	1.524263	0.27299	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);	0.253509	0.40064	N	0.001190	T	0.27205	0.0667	L	0.47716	1.5	0.32058	N	0.596096	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.09377	0.001;0.004;0.001	T	0.16305	-1.0407	10	0.23302	T	0.38	.	13.4386	0.61099	0.0783:0.0:0.9217:0.0	.	558;567;568	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	L	568;567;558;567	ENSP00000305334:S568L;ENSP00000368462:S567L;ENSP00000389270:S558L;ENSP00000440409:S567L	ENSP00000305334:S568L	S	-	2	0	FSTL5	162599827	1.000000	0.71417	0.554000	0.28268	0.829000	0.46940	4.032000	0.57274	2.567000	0.86603	0.645000	0.84053	TCA	FSTL5	-	NULL		0.373	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	G	NM_020116		162380377	-1	no_errors	ENST00000306100	ensembl	human	known	70_37	missense	SNP	0.857	A
GALNT4	8693	genome.wustl.edu	37	12	89917415	89917415	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:89917415G>C	ENST00000529983.2	-	1	1168	c.912C>G	c.(910-912)atC>atG	p.I304M	POC1B-GALNT4_ENST00000547474.1_3'UTR|POC1B_ENST00000393179.4_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000549035.1_Intron|GALNT4_ENST00000413530.1_Missense_Mutation_p.I132M|POC1B_ENST00000541909.1_Intron|POC1B-GALNT4_ENST00000548729.1_Missense_Mutation_p.I301M|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000549504.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	304	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						TAGGTGATCTGATGGGGTCAA	0.483																																																	0													110.0	109.0	109.0					12																	89917415		1950	4151	6101	SO:0001583	missense	8693			Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.912C>G	12.37:g.89917415G>C	ENSP00000436604:p.Ile304Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R775|B4DMX6|O00208	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.I304M	ENST00000529983.2	37	c.912	CCDS53817.1	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957467	0.73902	.	.	ENSG00000259075;ENSG00000259075;ENSG00000257594	ENST00000548729;ENST00000413530;ENST00000529983	T;D;T	0.83673	0.03;-1.75;0.03	5.72	5.72	0.89469	Glycosyl transferase, family 2 (1);	.	.	.	.	D	0.92328	0.7566	M	0.89287	3.02	0.54753	D	0.999987	P;P	0.50710	0.917;0.938	P;D	0.63703	0.865;0.917	D	0.92741	0.6208	9	0.59425	D	0.04	.	18.8611	0.92271	0.0:0.0:1.0:0.0	.	301;304	F8VUJ3;Q8N4A0	.;GALT4_HUMAN	M	301;132;304	ENSP00000447852:I301M;ENSP00000389686:I132M;ENSP00000436604:I304M	ENSP00000436604:I304M	I	-	3	3	GALNT4;RP11-1109F11.4	88441546	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	3.251000	0.51453	2.699000	0.92147	0.561000	0.74099	ATC	GALNT4	-	pfam_Glyco_trans_2		0.483	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT4	HGNC	protein_coding	OTTHUMT00000388973.2	G	NM_003774		89917415	-1	no_errors	ENST00000529983	ensembl	human	known	70_37	missense	SNP	1.000	C
GAS2L2	246176	genome.wustl.edu	37	17	34072551	34072551	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:34072551G>A	ENST00000254466.6	-	6	1992	c.1965C>T	c.(1963-1965)atC>atT	p.I655I	GAS2L2_ENST00000587565.1_Silent_p.I639I	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	655					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCAGTTCTTGGATGGCTTTGT	0.632																																																	0													80.0	93.0	88.0					17																	34072551		2203	4300	6503	SO:0001819	synonymous_variant	246176			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1965C>T	17.37:g.34072551G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NHY4	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.I655	ENST00000254466.6	37	c.1965	CCDS11298.1	17																																																																																			GAS2L2	-	NULL		0.632	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	G	NM_139285		34072551	-1	no_errors	ENST00000254466	ensembl	human	known	70_37	silent	SNP	0.994	A
GBF1	8729	genome.wustl.edu	37	10	104129049	104129049	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:104129049C>T	ENST00000369983.3	+	24	3312	c.3052C>T	c.(3052-3054)Cgt>Tgt	p.R1018C		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1018					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TTTGGCCCATCGTCATGGTGA	0.498																																																	0													143.0	132.0	136.0					10																	104129049		2203	4300	6503	SO:0001583	missense	8729			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.3052C>T	10.37:g.104129049C>T	ENSP00000359000:p.Arg1018Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.R1018C	ENST00000369983.3	37	c.3052	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889260	0.72524	.	.	ENSG00000107862	ENST00000369983	T	0.69040	-0.37	6.17	5.27	0.74061	.	0.044496	0.85682	N	0.000000	T	0.78704	0.4325	M	0.80183	2.485	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.008	P;P;B	0.61722	0.893;0.891;0.002	T	0.80650	-0.1288	10	0.56958	D	0.05	-5.0549	10.1515	0.42796	0.1363:0.7962:0.0:0.0675	.	1018;1018;1018	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	C	1018	ENSP00000359000:R1018C	ENSP00000359000:R1018C	R	+	1	0	GBF1	104119039	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.510000	0.45468	1.630000	0.50440	0.655000	0.94253	CGT	GBF1	-	NULL		0.498	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	C			104129049	+1	no_errors	ENST00000369983	ensembl	human	known	70_37	missense	SNP	1.000	T
GCLM	2730	genome.wustl.edu	37	1	94367192	94367192	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:94367192G>A	ENST00000370238.3	-	3	472	c.226C>T	c.(226-228)Cat>Tat	p.H76Y	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	76					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TCTACTGCATGAGATACAGTG	0.289																																																	0													77.0	79.0	78.0					1																	94367192		2202	4300	6502	SO:0001583	missense	2730			L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.226C>T	1.37:g.94367192G>A	ENSP00000359258:p.His76Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.H76Y	ENST00000370238.3	37	c.226	CCDS746.1	1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134276	0.56828	.	.	ENSG00000023909	ENST00000370238	T	0.23552	1.9	6.16	6.16	0.99307	NADP-dependent oxidoreductase domain (1);	0.145145	0.64402	D	0.000005	T	0.11750	0.0286	N	0.08118	0	0.43890	D	0.996518	P	0.36483	0.555	B	0.38655	0.278	T	0.14117	-1.0484	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	76	P48507	GSH0_HUMAN	Y	76	ENSP00000359258:H76Y	ENSP00000359258:H76Y	H	-	1	0	GCLM	94139780	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.506000	0.60428	2.937000	0.99478	0.650000	0.86243	CAT	GCLM	-	pfam_NADP_OxRdtase_dom		0.289	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLM	HGNC	protein_coding	OTTHUMT00000029169.1	G	NM_002061		94367192	-1	no_errors	ENST00000370238	ensembl	human	known	70_37	missense	SNP	1.000	A
GCNT3	9245	genome.wustl.edu	37	15	59911592	59911592	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:59911592C>T	ENST00000396065.1	+	3	1603	c.1155C>T	c.(1153-1155)atC>atT	p.I385I	GCNT3_ENST00000560585.1_Silent_p.I385I	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	385					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCTCTGGAATCCACCAGCGGG	0.507																																																	0													140.0	133.0	135.0					15																	59911592		2190	4290	6480	SO:0001819	synonymous_variant	9245			AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.1155C>T	15.37:g.59911592C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Glyco_trans_14	p.I385	ENST00000396065.1	37	c.1155	CCDS10172.1	15																																																																																			GCNT3	-	pfam_Glyco_trans_14		0.507	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT3	HGNC	protein_coding	OTTHUMT00000256068.1	C	NM_004751		59911592	+1	no_errors	ENST00000396065	ensembl	human	known	70_37	silent	SNP	0.962	T
GLG1	2734	genome.wustl.edu	37	16	74537580	74537580	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:74537580C>T	ENST00000422840.2	-	4	622	c.623G>A	c.(622-624)cGa>cAa	p.R208Q	GLG1_ENST00000205061.5_Missense_Mutation_p.R208Q|GLG1_ENST00000447066.2_Missense_Mutation_p.R197Q	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	208					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GATGTTGCCTCGGTGATCCAC	0.413																																																	0													194.0	168.0	176.0					16																	74537580		2198	4300	6498	SO:0001583	missense	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.623G>A	16.37:g.74537580C>T	ENSP00000405984:p.Arg208Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.R208Q	ENST00000422840.2	37	c.623	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.620247	0.96660	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.77018	0.4069	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.996	D;P;P	0.66979	0.948;0.749;0.788	T	0.76623	-0.2891	9	0.48119	T	0.1	-5.3672	19.27	0.94004	0.0:1.0:0.0:0.0	.	208;208;197	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	Q	208;197;208	.	ENSP00000205061:R208Q	R	-	2	0	GLG1	73095081	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.723000	0.84788	2.546000	0.85860	0.591000	0.81541	CGA	GLG1	-	pfam_Cys-rich_GLG1_repeat		0.413	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	C	NM_012201		74537580	-1	no_errors	ENST00000205061	ensembl	human	known	70_37	missense	SNP	1.000	T
GNA15	2769	genome.wustl.edu	37	19	3162819	3162819	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:3162819G>C	ENST00000262958.3	+	7	1185	c.927G>C	c.(925-927)aaG>aaC	p.K309N		NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	309					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		AGGCAGCCAAGAGGTTCATCC	0.632											OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													69.0	53.0	58.0					19																	3162819		2203	4300	6503	SO:0001583	missense	2769				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.927G>C	19.37:g.3162819G>C	ENSP00000262958:p.Lys309Asn	Somatic	609	WXS	Illumina HiSeq	Phase_IV	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q	p.K309N	ENST00000262958.3	37	c.927	CCDS12104.1	19	.	.	.	.	.	.	.	.	.	.	g	16.99	3.274134	0.59649	.	.	ENSG00000060558	ENST00000262958	D	0.88586	-2.4	4.42	3.38	0.38709	.	0.137856	0.45606	D	0.000344	D	0.93161	0.7822	M	0.84156	2.68	0.40657	D	0.982097	D	0.63046	0.992	D	0.65684	0.937	D	0.92278	0.5831	10	0.45353	T	0.12	.	10.1538	0.42809	0.1009:0.0:0.8991:0.0	.	309	P30679	GNA15_HUMAN	N	309	ENSP00000262958:K309N	ENSP00000262958:K309N	K	+	3	2	GNA15	3113819	0.612000	0.27000	0.818000	0.32626	0.947000	0.59692	2.514000	0.45503	0.837000	0.34925	-0.258000	0.10820	AAG	GNA15	-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su,prints_Gprotein_alpha_Q		0.632	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA15	HGNC	protein_coding	OTTHUMT00000452320.2	G	NM_002068		3162819	+1	no_errors	ENST00000262958	ensembl	human	known	70_37	missense	SNP	0.953	C
GNPNAT1	64841	genome.wustl.edu	37	14	53250150	53250150	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:53250150G>T	ENST00000216410.3	-	3	395	c.208C>A	c.(208-210)Caa>Aaa	p.Q70K	RN7SL588P_ENST00000583393.1_RNA|GNPNAT1_ENST00000554230.1_5'UTR	NM_198066.3	NP_932332.1	Q96EK6	GNA1_HUMAN	glucosamine-phosphate N-acetyltransferase 1	70	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|glucosamine metabolic process (GO:0006041)|liver development (GO:0001889)|N-acetylglucosamine metabolic process (GO:0006044)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|membrane (GO:0016020)	glucosamine 6-phosphate N-acetyltransferase activity (GO:0004343)|monosaccharide binding (GO:0048029)			liver(1)|lung(1)|prostate(1)|skin(1)	4	Breast(41;0.176)					CTCATAAATTGTTCAGGGCTG	0.348																																																	0													69.0	69.0	69.0					14																	53250150		2203	4299	6502	SO:0001583	missense	64841			AK001469	CCDS9712.1	14q22.1	2011-11-16			ENSG00000100522	ENSG00000100522	2.3.1.4		19980	protein-coding gene	gene with protein product							Standard	NM_198066		Approved	Gpnat1, FLJ10607	uc001xab.3	Q96EK6	OTTHUMG00000152334	ENST00000216410.3:c.208C>A	14.37:g.53250150G>T	ENSP00000216410:p.Gln70Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.Q70K	ENST00000216410.3	37	c.208	CCDS9712.1	14	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339839	0.60963	.	.	ENSG00000100522	ENST00000216410;ENST00000557604	.	.	.	5.37	5.37	0.77165	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	L	0.46614	1.455	0.80722	D	1	P	0.40360	0.714	B	0.29267	0.1	T	0.48258	-0.9051	9	0.25106	T	0.35	-10.0235	19.466	0.94939	0.0:0.0:1.0:0.0	.	70	Q96EK6	GNA1_HUMAN	K	70	.	ENSP00000216410:Q70K	Q	-	1	0	GNPNAT1	52319900	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.941000	0.87700	2.661000	0.90470	0.460000	0.39030	CAA	GNPNAT1	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom		0.348	GNPNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPNAT1	HGNC	protein_coding	OTTHUMT00000276898.1	G			53250150	-1	no_errors	ENST00000216410	ensembl	human	known	70_37	missense	SNP	1.000	T
GOLGA4	2803	genome.wustl.edu	37	3	37343796	37343796	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:37343796G>T	ENST00000361924.2	+	10	1581	c.1207G>T	c.(1207-1209)Gaa>Taa	p.E403*	GOLGA4_ENST00000356847.4_Nonsense_Mutation_p.E425*|GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	403	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GGAATTACGGGAACAGAAAGA	0.388																																																	0													56.0	59.0	58.0					3																	37343796		2203	4300	6503	SO:0001587	stop_gained	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1207G>T	3.37:g.37343796G>T	ENSP00000354486:p.Glu403*	Somatic		WXS	Illumina HiSeq	Phase_IV	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Nonsense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.E403*	ENST00000361924.2	37	c.1207	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.696451	0.98918	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000450863;ENST00000437131	.	.	.	5.89	5.89	0.94794	.	0.000000	0.35179	N	0.003394	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	15.7106	0.77623	0.0:0.136:0.864:0.0	.	.	.	.	X	403;425;408;274	.	ENSP00000349305:E425X	E	+	1	0	GOLGA4	37318800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.884000	0.87274	2.793000	0.96121	0.655000	0.94253	GAA	GOLGA4	-	NULL		0.388	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	G	NM_002078		37343796	+1	no_errors	ENST00000361924	ensembl	human	known	70_37	nonsense	SNP	1.000	T
GOLGB1	2804	genome.wustl.edu	37	3	121383432	121383432	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:121383432G>C	ENST00000340645.5	-	22	9800	c.9675C>G	c.(9673-9675)gtC>gtG	p.V3225V	GOLGB1_ENST00000393667.3_Silent_p.V3235V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	3225					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GTGAACGCAGGACTCGCTTCC	0.483																																																	0													90.0	85.0	87.0					3																	121383432		2203	4300	6503	SO:0001819	synonymous_variant	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.9675C>G	3.37:g.121383432G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Silent	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.V3225	ENST00000340645.5	37	c.9675	CCDS3004.1	3																																																																																			GOLGB1	-	NULL		0.483	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	G	NM_004487		121383432	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	silent	SNP	0.885	C
GON4L	54856	genome.wustl.edu	37	1	155744901	155744901	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:155744901G>C	ENST00000368331.1	-	17	2290	c.2242C>G	c.(2242-2244)Cag>Gag	p.Q748E	GON4L_ENST00000271883.5_Missense_Mutation_p.Q748E|GON4L_ENST00000437809.1_Missense_Mutation_p.Q748E|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Missense_Mutation_p.Q748E	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	748					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AACAGGGTCTGAAACTTGGGG	0.458																																																	0													75.0	76.0	75.0					1																	155744901		2203	4292	6495	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2242C>G	1.37:g.155744901G>C	ENSP00000357315:p.Gln748Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.Q748E	ENST00000368331.1	37	c.2242		1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534946	0.64972	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040;ENST00000368327	T;T;T;T	0.11495	2.96;2.96;2.96;2.77	4.57	4.57	0.56435	.	0.304031	0.32015	N	0.006719	T	0.17238	0.0414	L	0.45581	1.43	0.35925	D	0.832072	B;D;D;D;D	0.64830	0.01;0.961;0.994;0.989;0.994	B;P;D;P;D	0.73708	0.029;0.721;0.981;0.84;0.923	T	0.00870	-1.1533	10	0.52906	T	0.07	.	15.3124	0.74045	0.0:0.0:1.0:0.0	.	528;748;748;748;748	Q6PHZ4;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;GON4L_HUMAN;.	E	748;748;748;748;748;198	ENSP00000396117:Q748E;ENSP00000357315:Q748E;ENSP00000271883:Q748E;ENSP00000354322:Q748E	ENSP00000271883:Q748E	Q	-	1	0	GON4L	154011525	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.615000	0.61190	2.373000	0.80994	0.484000	0.47621	CAG	GON4L	-	NULL		0.458	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		G	NM_032292		155744901	-1	no_errors	ENST00000368331	ensembl	human	known	70_37	missense	SNP	1.000	C
GON4L	54856	genome.wustl.edu	37	1	155744925	155744925	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:155744925G>A	ENST00000368331.1	-	17	2266	c.2218C>T	c.(2218-2220)Cac>Tac	p.H740Y	GON4L_ENST00000271883.5_Missense_Mutation_p.H740Y|GON4L_ENST00000437809.1_Missense_Mutation_p.H740Y|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Missense_Mutation_p.H740Y	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	740					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TACTGATGGTGAAGGGCGATG	0.453																																																	0													79.0	81.0	80.0					1																	155744925		2203	4297	6500	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2218C>T	1.37:g.155744925G>A	ENSP00000357315:p.His740Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.H740Y	ENST00000368331.1	37	c.2218		1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504306	0.64410	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040;ENST00000368327	T;T;T;T	0.12984	2.82;2.82;2.82;2.63	4.57	4.57	0.56435	.	0.197271	0.38548	N	0.001655	T	0.19248	0.0462	M	0.63843	1.955	0.26077	N	0.981144	P;D;D;D;D	0.71674	0.622;0.975;0.998;0.981;0.989	P;P;D;P;P	0.65010	0.506;0.743;0.931;0.656;0.814	T	0.01352	-1.1377	10	0.54805	T	0.06	.	12.1269	0.53922	0.0:0.1728:0.8272:0.0	.	520;740;740;740;740	Q6PHZ4;A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;.;GON4L_HUMAN;.	Y	740;740;740;740;740;190	ENSP00000396117:H740Y;ENSP00000357315:H740Y;ENSP00000271883:H740Y;ENSP00000354322:H740Y	ENSP00000271883:H740Y	H	-	1	0	GON4L	154011549	1.000000	0.71417	0.971000	0.41717	0.986000	0.74619	3.504000	0.53347	2.373000	0.80994	0.484000	0.47621	CAC	GON4L	-	NULL		0.453	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		G	NM_032292		155744925	-1	no_errors	ENST00000368331	ensembl	human	known	70_37	missense	SNP	0.994	A
GRAMD1B	57476	genome.wustl.edu	37	11	123484181	123484181	+	Missense_Mutation	SNP	C	C	T	rs369825461		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:123484181C>T	ENST00000529750.1	+	15	1940	c.1613C>T	c.(1612-1614)aCg>aTg	p.T538M	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.T538M|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.T545M|GRAMD1B_ENST00000450171.2_Missense_Mutation_p.T229M	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	538						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CTGGCCAAAACGGAGAGCACT	0.532																																																	0								C	MET/THR	0,4362		0,0,2181	38.0	42.0	40.0		1613	3.6	1.0	11		40	1,8555		0,1,4277	no	missense	GRAMD1B	NM_020716.1	81	0,1,6458	TT,TC,CC		0.0117,0.0,0.0077	benign	538/739	123484181	1,12917	2181	4278	6459	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1613C>T	11.37:g.123484181C>T	ENSP00000436500:p.Thr538Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UW85|Q9ULL9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.T538M	ENST00000529750.1	37	c.1613	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745392	0.30955	0.0	1.17E-4	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000450171	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.46	3.6	0.41247	.	0.349953	0.30620	N	0.009228	T	0.10252	0.0251	N	0.04508	-0.205	0.31068	N	0.713351	B;B;B;B	0.33494	0.067;0.414;0.04;0.061	B;B;B;B	0.18263	0.011;0.021;0.004;0.007	T	0.07616	-1.0763	10	0.32370	T	0.25	.	11.9303	0.52843	0.0:0.859:0.0:0.141	.	498;229;538;545	B7Z4N9;Q3KR37-3;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	M	545;545;538;538;498;229	ENSP00000402457:T545M;ENSP00000325628:T538M;ENSP00000436500:T538M;ENSP00000432987:T498M;ENSP00000388458:T229M	ENSP00000325628:T538M	T	+	2	0	GRAMD1B	122989391	0.972000	0.33761	0.965000	0.40720	0.869000	0.49853	2.227000	0.42972	0.695000	0.31675	-0.258000	0.10820	ACG	GRAMD1B	-	NULL		0.532	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	C	XM_370660		123484181	+1	no_errors	ENST00000322282	ensembl	human	known	70_37	missense	SNP	0.996	T
GRID2	2895	genome.wustl.edu	37	4	94145869	94145869	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:94145869C>G	ENST00000282020.4	+	7	1326	c.1068C>G	c.(1066-1068)atC>atG	p.I356M	GRID2_ENST00000510992.1_Missense_Mutation_p.I261M	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	356					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGTCATGTATCAGAAAGAACT	0.428																																																	0													73.0	72.0	72.0					4																	94145869		2203	4300	6503	SO:0001583	missense	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1068C>G	4.37:g.94145869C>G	ENSP00000282020:p.Ile356Met	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I356M	ENST00000282020.4	37	c.1068	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184455	0.38609	.	.	ENSG00000152208	ENST00000282020;ENST00000510992;ENST00000512631	T;T	0.12984	2.69;2.63	5.53	4.68	0.58851	Extracellular ligand-binding receptor (1);	0.055575	0.64402	D	0.000001	T	0.22085	0.0532	N	0.16903	0.455	0.58432	D	0.999992	D;D;D	0.69078	0.985;0.985;0.997	P;P;D	0.68621	0.883;0.883;0.959	T	0.06917	-1.0800	10	0.56958	D	0.05	.	15.7514	0.77989	0.1375:0.8625:0.0:0.0	.	261;356;261	E9PH24;O43424;Q4KKU8	.;GRID2_HUMAN;.	M	356;261;37	ENSP00000282020:I356M;ENSP00000421257:I261M	ENSP00000282020:I356M	I	+	3	3	GRID2	94364892	1.000000	0.71417	0.991000	0.47740	0.684000	0.39900	1.308000	0.33528	1.312000	0.45043	-0.182000	0.12963	ATC	GRID2	-	pfam_ANF_lig-bd_rcpt		0.428	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	C			94145869	+1	no_errors	ENST00000282020	ensembl	human	known	70_37	missense	SNP	1.000	G
GRIK5	2901	genome.wustl.edu	37	19	42526474	42526474	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:42526474G>A	ENST00000262895.3	-	12	1505	c.1506C>T	c.(1504-1506)atC>atT	p.I502I	GRIK5_ENST00000593562.1_Silent_p.I502I|GRIK5_ENST00000301218.4_Silent_p.I502I	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	502					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GCTCAGCTGTGATGGTGAAGG	0.592																																																	0													84.0	66.0	72.0					19																	42526474		2203	4300	6503	SO:0001819	synonymous_variant	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1506C>T	19.37:g.42526474G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWG8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I502	ENST00000262895.3	37	c.1506	CCDS12595.1	19																																																																																			GRIK5	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.592	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	G			42526474	-1	no_errors	ENST00000301218	ensembl	human	known	70_37	silent	SNP	1.000	A
GSTO1	9446	genome.wustl.edu	37	10	106014929	106014929	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:106014929C>A	ENST00000369713.5	+	2	237	c.43C>A	c.(43-45)Ccc>Acc	p.P15T	GSTO1_ENST00000539281.1_5'UTR|GSTO1_ENST00000493946.1_3'UTR|GSTO1_ENST00000369710.4_Missense_Mutation_p.P15T	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	15					cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	AGGAAGCGCGCCCCCGGGGCC	0.677																																																	0													26.0	32.0	30.0					10																	106014929		2201	4297	6498	SO:0001583	missense	9446			AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.43C>A	10.37:g.106014929C>A	ENSP00000358727:p.Pro15Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Missense_Mutation	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_omega	p.P15T	ENST00000369713.5	37	c.43	CCDS7555.1	10	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605693	0.46527	.	.	ENSG00000148834	ENST00000369710;ENST00000369713	T;T	0.09163	3.01;3.59	4.85	3.92	0.45320	Thioredoxin-like fold (2);	0.196419	0.52532	D	0.000076	T	0.14056	0.0340	M	0.71581	2.175	0.80722	D	1	B	0.21225	0.053	B	0.23150	0.044	T	0.04413	-1.0953	10	0.17369	T	0.5	-5.8562	13.4822	0.61342	0.0:0.5004:0.4996:0.0	.	15	P78417	GSTO1_HUMAN	T	15	ENSP00000358724:P15T;ENSP00000358727:P15T	ENSP00000358724:P15T	P	+	1	0	GSTO1	106004919	0.998000	0.40836	1.000000	0.80357	0.981000	0.71138	2.780000	0.47742	1.211000	0.43351	0.491000	0.48974	CCC	GSTO1	-	superfamily_Thioredoxin-like_fold		0.677	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTO1	HGNC	protein_coding	OTTHUMT00000050193.1	C	NM_004832		106014929	+1	no_errors	ENST00000369713	ensembl	human	known	70_37	missense	SNP	1.000	A
GTF2A2	2958	genome.wustl.edu	37	15	59934407	59934407	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:59934407C>T	ENST00000396060.2	-	4	413	c.232G>A	c.(232-234)Gat>Aat	p.D78N	GTF2A2_ENST00000484743.1_Missense_Mutation_p.D43N|GTF2A2_ENST00000396061.1_Missense_Mutation_p.D78N|GTF2A2_ENST00000267869.4_5'UTR|GTF2A2_ENST00000396063.1_Missense_Mutation_p.D78N|GTF2A2_ENST00000396064.3_Intron|AC092755.4_ENST00000441746.1_RNA	NM_004492.2	NP_004483.1	P52657	T2AG_HUMAN	general transcription factor IIA, 2, 12kDa	78					gene expression (GO:0010467)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(2)|kidney(2)|lung(1)	5						AATTCAACATCATTCAGTACA	0.353																																																	0													146.0	140.0	142.0					15																	59934407		2190	4289	6479	SO:0001583	missense	2958			BC001919	CCDS10173.1	15q21.3	2010-03-23	2002-08-29		ENSG00000140307	ENSG00000140307		"""General transcription factors"""	4647	protein-coding gene	gene with protein product		600519	"""general transcription factor IIA, 2 (12kD subunit)"""			7958899	Standard	NM_004492		Approved	TFIIA, HsT18745	uc002agg.3	P52657	OTTHUMG00000132725	ENST00000396060.2:c.232G>A	15.37:g.59934407C>T	ENSP00000379372:p.Asp78Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYQ7|Q6FGB5	Missense_Mutation	SNP	pfam_TFIIA_gsu_C,pfam_TFIIA_gsu_N,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pirsf_TFIIA_gsu	p.D78N	ENST00000396060.2	37	c.232	CCDS10173.1	15	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046169	0.55110	.	.	ENSG00000140307	ENST00000396060;ENST00000396063;ENST00000396061;ENST00000484743	.	.	.	5.48	5.48	0.80851	Transcription initiation factor IIA, gamma subunit, C-terminal (1);Transcription factor IIA, beta-barrel (2);	0.000000	0.85682	D	0.000000	T	0.48333	0.1494	N	0.16903	0.455	0.80722	D	1	B	0.12013	0.005	B	0.22880	0.042	T	0.41574	-0.9501	9	0.11182	T	0.66	-0.3836	19.717	0.96124	0.0:1.0:0.0:0.0	.	78	P52657	T2AG_HUMAN	N	78;78;78;43	.	ENSP00000379372:D78N	D	-	1	0	GTF2A2	57721699	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.744000	0.68664	2.745000	0.94114	0.484000	0.47621	GAT	GTF2A2	-	pfam_TFIIA_gsu_C,superfamily_TFIIA_b-brl,pirsf_TFIIA_gsu		0.353	GTF2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A2	HGNC	protein_coding	OTTHUMT00000256067.2	C	NM_004492		59934407	-1	no_errors	ENST00000396060	ensembl	human	known	70_37	missense	SNP	1.000	T
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72663974	72663974	+	RNA	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:72663974G>T	ENST00000425256.1	-	0	926									GTF2I repeat domain containing 2 pseudogene 1																		CCTCCTCATGGAACTGATTTC	0.507																																																	0																																												401375			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663974G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-		0.507	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	G	NR_002164		72663974	-1	no_errors	ENST00000425256	ensembl	human	known	70_37	rna	SNP	1.000	T
GTF3C1	2975	genome.wustl.edu	37	16	27480781	27480781	+	Silent	SNP	C	C	T	rs11551766		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:27480781C>T	ENST00000356183.4	-	32	4920	c.4905G>A	c.(4903-4905)gtG>gtA	p.V1635V	GTF3C1_ENST00000561623.1_Silent_p.V1635V	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1635					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCGCAGGTTTCACCTCCATGC	0.602																																																	0													172.0	135.0	147.0					16																	27480781		2197	4300	6497	SO:0001819	synonymous_variant	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4905G>A	16.37:g.27480781C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	pfam_TFIIIC_Bblock-bd	p.V1635	ENST00000356183.4	37	c.4905	CCDS32414.1	16																																																																																			GTF3C1	-	NULL		0.602	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	C	NM_001520		27480781	-1	no_errors	ENST00000356183	ensembl	human	known	70_37	silent	SNP	1.000	T
SMARCA5	8467	genome.wustl.edu	37	4	144481029	144481029	+	IGR	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:144481029C>G	ENST00000283131.3	+	0	7923				GUSBP5_ENST00000510805.1_RNA	NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					ACTCCTATGCCATCGTGTGGG	0.587																																																	0													127.0	130.0	129.0					4																	144481029		692	1591	2283	SO:0001628	intergenic_variant	441046			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474		4.37:g.144481029C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000283131.3	37	NULL	CCDS3761.1	4																																																																																			GUSBP5	-	-		0.587	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUSBP5	HGNC	protein_coding	OTTHUMT00000365077.3	C			144481029	+1	no_errors	ENST00000509369	ensembl	human	known	70_37	rna	SNP	0.972	G
GVINP1	387751	genome.wustl.edu	37	11	6738144	6738144	+	RNA	SNP	T	T	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:6738144T>C	ENST00000526769.3	-	0	5060					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCTAATGACATCACTGAAGCA	0.483																																																	0																																												387751			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6738144T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-		0.483	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	T	NR_003945		6738144	-1	no_errors	ENST00000526769	ensembl	human	known	70_37	rna	SNP	1.000	C
HDGF	3068	genome.wustl.edu	37	1	156712760	156712760	+	3'UTR	SNP	G	G	A	rs574912091	byFrequency	TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:156712760G>A	ENST00000357325.5	-	0	1518				HDGF_ENST00000537739.1_3'UTR|HDGF_ENST00000416666.2_3'UTR|HDGF_ENST00000465180.1_5'UTR|MRPL24_ENST00000368211.4_5'Flank|HDGF_ENST00000368209.5_3'UTR|MRPL24_ENST00000361531.2_5'Flank	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		GAAGGAGGCCGCCCTCCTGTG	0.597													G|||	19	0.00379393	0.0129	0.0029	5008	,	,		15412	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	3068			D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295	ENST00000357325.5:c.*481C>T	1.37:g.156712760G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	RNA	SNP	-	NULL	ENST00000357325.5	37	NULL	CCDS1156.1	1																																																																																			HDGF	-	-		0.597	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGF	HGNC	protein_coding	OTTHUMT00000098946.1	G	NM_004494		156712760	-1	no_errors	ENST00000465180	ensembl	human	known	70_37	rna	SNP	0.000	A
HEATR5A	25938	genome.wustl.edu	37	14	31782183	31782183	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:31782183G>A	ENST00000389961.3	-	27	4413	c.4414C>T	c.(4414-4416)Cct>Tct	p.P1472S	HEATR5A_ENST00000439348.1_Missense_Mutation_p.P1472S|AL136418.1_ENST00000582500.1_RNA|HEATR5A_ENST00000543095.2_Missense_Mutation_p.P1478S|HEATR5A_ENST00000439727.1_Missense_Mutation_p.P1185S			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1472										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CCTTCAGCAGGAAGTTGGGAG	0.378																																																	0													72.0	68.0	69.0					14																	31782183		1886	4125	6011	SO:0001583	missense	25938			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.4414C>T	14.37:g.31782183G>A	ENSP00000374611:p.Pro1472Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P1472S	ENST00000389961.3	37	c.4414		14	.	.	.	.	.	.	.	.	.	.	G	17.92	3.505811	0.64410	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	4.87	4.87	0.63330	.	0.054671	0.64402	D	0.000001	T	0.68412	0.2998	M	0.84948	2.725	0.80722	D	1	D	0.71674	0.998	D	0.67900	0.954	T	0.75283	-0.3372	10	0.87932	D	0	.	18.3958	0.90497	0.0:0.0:1.0:0.0	.	1472	Q86XA9-2	.	S	1472;1472;1185;1478	ENSP00000374611:P1472S;ENSP00000405407:P1472S;ENSP00000408681:P1185S;ENSP00000437968:P1478S	ENSP00000374611:P1472S	P	-	1	0	HEATR5A	30851934	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.433000	0.80362	2.417000	0.82017	0.561000	0.74099	CCT	HEATR5A	-	superfamily_ARM-type_fold		0.378	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		G	NM_015473		31782183	-1	no_errors	ENST00000389961	ensembl	human	known	70_37	missense	SNP	1.000	A
HIP1	3092	genome.wustl.edu	37	7	75221789	75221789	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:75221789G>C	ENST00000336926.6	-	3	254	c.228C>G	c.(226-228)ttC>ttG	p.F76L	HIP1_ENST00000434438.2_Missense_Mutation_p.F76L	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	76	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CAACAGACCAGAAGGTCTGTG	0.577			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													77.0	61.0	67.0					7																	75221789		2203	4300	6503	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.228C>G	7.37:g.75221789G>C	ENSP00000336747:p.Phe76Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	pfam_ANTH,pfam_ILWEQ,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ,pfscan_Epsin-like_N,pfscan_ILWEQ	p.F76L	ENST00000336926.6	37	c.228	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460801	0.84317	.	.	ENSG00000127946	ENST00000336926;ENST00000434438;ENST00000420909	T;T;T	0.33865	1.39;1.39;1.39	5.61	-6.17	0.02091	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.56702	0.2003	M	0.79258	2.445	0.53688	D	0.999978	D	0.89917	1.0	D	0.97110	1.0	T	0.66208	-0.5981	10	0.54805	T	0.06	-17.2123	19.539	0.95267	0.1502:0.0:0.8498:0.0	.	76	O00291	HIP1_HUMAN	L	76;76;47	ENSP00000336747:F76L;ENSP00000410300:F76L;ENSP00000414280:F47L	ENSP00000336747:F76L	F	-	3	2	HIP1	75059725	1.000000	0.71417	0.782000	0.31804	0.958000	0.62258	0.947000	0.29082	-1.276000	0.02414	-1.031000	0.02408	TTC	HIP1	-	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N		0.577	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	G	NM_005338		75221789	-1	no_errors	ENST00000336926	ensembl	human	known	70_37	missense	SNP	0.994	C
HIPK4	147746	genome.wustl.edu	37	19	40895684	40895684	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:40895684G>C	ENST00000291823.2	-	1	410	c.126C>G	c.(124-126)ctC>ctG	p.L42L		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	42	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CGTCATTCTTGAGGATCTTGA	0.607																																																	0													146.0	120.0	129.0					19																	40895684		2203	4300	6503	SO:0001819	synonymous_variant	147746			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.126C>G	19.37:g.40895684G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K863|Q96M54	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L42	ENST00000291823.2	37	c.126	CCDS12555.1	19																																																																																			HIPK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.607	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIPK4	HGNC	protein_coding	OTTHUMT00000462593.1	G	NM_144685		40895684	-1	no_errors	ENST00000291823	ensembl	human	known	70_37	silent	SNP	1.000	C
HIST1H1E	3008	genome.wustl.edu	37	6	26157092	26157092	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:26157092G>A	ENST00000304218.3	+	1	534	c.474G>A	c.(472-474)gcG>gcA	p.A158A	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	158					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						CAAAGAAGGCGAAGAAGCCGG	0.617																																																	0													14.0	21.0	18.0					6																	26157092		2191	4285	6476	SO:0001819	synonymous_variant	3008			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.474G>A	6.37:g.26157092G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VB25	Silent	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5,prints_Histone_H5	p.A158	ENST00000304218.3	37	c.474	CCDS4586.1	6																																																																																			HIST1H1E	-	NULL		0.617	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1	G	NM_005321		26157092	+1	no_errors	ENST00000304218	ensembl	human	known	70_37	silent	SNP	0.001	A
HIST1H2BF	8343	genome.wustl.edu	37	6	26199793	26199793	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:26199793G>A	ENST00000359985.1	+	1	46	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	HIST1H3D_ENST00000377831.5_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				TATCATGCCTGAACCTGCTAA	0.488																																																	0													86.0	84.0	85.0					6																	26199793		2203	4300	6503	SO:0001583	missense	8343			Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.7G>A	6.37:g.26199793G>A	ENSP00000353074:p.Glu3Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E3K	ENST00000359985.1	37	c.7	CCDS4592.1	6	.	.	.	.	.	.	.	.	.	.	.	15.30	2.792729	0.50102	.	.	ENSG00000197846	ENST00000359985	T	0.17691	2.26	4.71	3.82	0.43975	.	0.000000	0.41712	D	0.000824	T	0.13927	0.0337	.	.	.	0.27988	N	0.93576	.	.	.	.	.	.	T	0.01323	-1.1385	7	0.54805	T	0.06	.	12.839	0.57790	0.0851:0.0:0.9149:0.0	.	.	.	.	K	3	ENSP00000353074:E3K	ENSP00000353074:E3K	E	+	1	0	HIST1H2BF	26307772	1.000000	0.71417	0.959000	0.39883	0.027000	0.11550	6.652000	0.74377	2.318000	0.78349	0.650000	0.86243	GAA	HIST1H2BF	-	NULL		0.488	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BF	HGNC	protein_coding	OTTHUMT00000040108.1	G	NM_003522		26199793	+1	no_errors	ENST00000359985	ensembl	human	known	70_37	missense	SNP	1.000	A
HIVEP1	3096	genome.wustl.edu	37	6	12121433	12121433	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:12121433G>A	ENST00000379388.2	+	4	1737	c.1405G>A	c.(1405-1407)Gat>Aat	p.D469N		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	469					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CTTGCAACCAGATGCTGGTGG	0.463																																																	0													72.0	74.0	73.0					6																	12121433		2006	4172	6178	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1405G>A	6.37:g.12121433G>A	ENSP00000368698:p.Asp469Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D469N	ENST00000379388.2	37	c.1405	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839736	0.91117	.	.	ENSG00000095951	ENST00000379388	T	0.10099	2.91	5.48	5.48	0.80851	.	0.226341	0.22698	N	0.056730	T	0.19446	0.0467	M	0.61703	1.905	0.80722	D	1	D	0.61080	0.989	P	0.58721	0.844	T	0.00440	-1.1738	9	.	.	.	-18.1663	19.3464	0.94365	0.0:0.0:1.0:0.0	.	469	P15822	ZEP1_HUMAN	N	469	ENSP00000368698:D469N	.	D	+	1	0	HIVEP1	12229419	1.000000	0.71417	0.984000	0.44739	0.594000	0.36715	9.869000	0.99810	2.566000	0.86566	0.655000	0.94253	GAT	HIVEP1	-	NULL		0.463	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	G	NM_002114		12121433	+1	no_errors	ENST00000379388	ensembl	human	known	70_37	missense	SNP	1.000	A
HIST1H3J	8356	genome.wustl.edu	37	6	27858575	27858575	+	5'Flank	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:27858575G>C	ENST00000359303.2	-	0	0				HIST1H3J_ENST00000479986.1_5'UTR|HIST1H2BO_ENST00000303806.4_5'Flank	NM_003535.2	NP_003526.1	P68431	H31_HUMAN	histone cluster 1, H3j						blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	8						GGCCATAGTTGAGAAAGCTAT	0.542																																																	0													23.0	26.0	25.0					6																	27858575		2197	4290	6487	SO:0001631	upstream_gene_variant	8356			Z83737	CCDS4638.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197153	ENSG00000197153		"""Histones / Replication-dependent"""	4774	protein-coding gene	gene with protein product		602817	"""H3 histone family, member J"", ""histone 1, H3j"""	H3FJ		9439656, 12408966	Standard	NM_003535		Approved	H3/j	uc003nka.3	P68431	OTTHUMG00000016185		6.37:g.27858575G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	RNA	SNP	-	NULL	ENST00000359303.2	37	NULL	CCDS4638.1	6																																																																																			HIST1H3J	-	-		0.542	HIST1H3J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3J	HGNC	protein_coding	OTTHUMT00000043453.2	G	NM_003535		27858575	-1	no_errors	ENST00000479986	ensembl	human	putative	70_37	rna	SNP	0.000	C
HLA-B	3106	genome.wustl.edu	37	6	31323001	31323001	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:31323001C>T	ENST00000412585.2	-	5	924		c.e5-1			NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GAAGACGGCTCTGGGAAAGGA	0.602									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0													60.0	61.0	61.0					6																	31323001		1511	2709	4220	SO:0001630	splice_region_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.896-1G>A	6.37:g.31323001C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q29764	Splice_Site	SNP	-	e5-1	ENST00000412585.2	37	c.896-1	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	.	13.81	2.347390	0.41599	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	.	.	.	3.69	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3839	0.49773	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HLA-B	31430980	1.000000	0.71417	0.512000	0.27736	0.299000	0.27559	3.086000	0.50159	1.804000	0.52760	0.442000	0.29010	.	HLA-B	-	-		0.602	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	C	NM_005514	Intron	31323001	-1	no_errors	ENST00000412585	ensembl	human	known	70_37	splice_site	SNP	0.931	T
HMCN1	83872	genome.wustl.edu	37	1	186014982	186014982	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:186014982G>C	ENST00000271588.4	+	41	6696	c.6467G>C	c.(6466-6468)aGa>aCa	p.R2156T	HMCN1_ENST00000367492.2_Missense_Mutation_p.R2156T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2156	Ig-like C2-type 19.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCTGAAAATAGAAGTGTGTTA	0.368																																																	0													94.0	92.0	93.0					1																	186014982		2203	4300	6503	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6467G>C	1.37:g.186014982G>C	ENSP00000271588:p.Arg2156Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.R2156T	ENST00000271588.4	37	c.6467	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994724	0.54041	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66815	-0.23;-0.23	5.35	4.43	0.53597	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.051035	0.85682	D	0.000000	T	0.46229	0.1382	N	0.04655	-0.195	0.23889	N	0.996555	B	0.09022	0.002	B	0.04013	0.001	T	0.38415	-0.9662	10	0.42905	T	0.14	.	15.9455	0.79789	0.0:0.1354:0.8646:0.0	.	2156	Q96RW7	HMCN1_HUMAN	T	2156	ENSP00000271588:R2156T;ENSP00000356462:R2156T	ENSP00000271588:R2156T	R	+	2	0	HMCN1	184281605	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.105000	0.64591	1.216000	0.43427	0.650000	0.86243	AGA	HMCN1	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.368	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	G	NM_031935		186014982	+1	no_errors	ENST00000271588	ensembl	human	known	70_37	missense	SNP	1.000	C
HMGB1	3146	genome.wustl.edu	37	13	31037403	31037403	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:31037403G>A	ENST00000405805.1	-	3	1177	c.237C>T	c.(235-237)atC>atT	p.I79I	HMGB1_ENST00000326004.4_Silent_p.I79I|HMGB1_ENST00000339872.4_Silent_p.I79I|HMGB1_ENST00000399489.1_Silent_p.I79I|HMGB1_ENST00000399494.1_Silent_p.I79I|HMGB1_ENST00000341423.5_Silent_p.I79I|HMGB1_ENST00000468384.1_5'Flank			P09429	HMGB1_HUMAN	high mobility group box 1	79					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CTTTGGGAGGGATATAGGTTT	0.413																																																	0													78.0	89.0	85.0					13																	31037403		2203	4298	6501	SO:0001819	synonymous_variant	3146			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.237C>T	13.37:g.31037403G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.I79	ENST00000405805.1	37	c.237	CCDS9335.1	13																																																																																			HMGB1	-	superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily		0.413	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB1	HGNC	protein_coding	OTTHUMT00000303998.2	G	NM_002128		31037403	-1	no_errors	ENST00000339872	ensembl	human	known	70_37	silent	SNP	0.934	A
C12orf43	64897	genome.wustl.edu	37	12	121438965	121438965	+	IGR	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:121438965C>T	ENST00000288757.3	-	0	1920				HNF1A_ENST00000544413.1_Silent_p.I629I|HNF1A_ENST00000257555.6_Silent_p.I622I|HNF1A_ENST00000541395.1_Silent_p.I653I|RP11-216P16.2_ENST00000606238.1_RNA	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43											cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGACCTTCATCTCCACCCAGA	0.637																																																	0													98.0	75.0	83.0					12																	121438965		2203	4300	6503	SO:0001628	intergenic_variant	6927			AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150		12.37:g.121438965C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53HF0|Q9H9Z7	Silent	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.I622	ENST00000288757.3	37	c.1866	CCDS9210.1	12																																																																																			HNF1A	-	pfam_HNF1a_C		0.637	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding		C	NM_022895		121438965	+1	no_errors	ENST00000257555	ensembl	human	known	70_37	silent	SNP	1.000	T
HOMER3	9454	genome.wustl.edu	37	19	19049681	19049681	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:19049681G>C	ENST00000539827.1	-	2	679	c.27C>G	c.(25-27)atC>atG	p.I9M	AC005932.1_ENST00000601106.1_RNA|HOMER3_ENST00000355887.6_Missense_Mutation_p.I9M|HOMER3_ENST00000594794.1_Intron|HOMER3_ENST00000433218.2_Missense_Mutation_p.I9M|HOMER3_ENST00000594439.1_Missense_Mutation_p.I9M|HOMER3_ENST00000392351.3_Missense_Mutation_p.I9M|HOMER3_ENST00000542541.2_Missense_Mutation_p.I9M|HOMER3_ENST00000221222.11_Missense_Mutation_p.I9M			Q9NSC5	HOME3_HUMAN	homer homolog 3 (Drosophila)	9	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				G-protein coupled glutamate receptor signaling pathway (GO:0007216)|protein targeting (GO:0006605)	basal part of cell (GO:0045178)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(3)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10			Epithelial(12;0.0107)			GTGTGCTGAAGATTGGCTGCT	0.617																																																	0													70.0	56.0	61.0					19																	19049681		2202	4300	6502	SO:0001583	missense	9454			Y18894	CCDS12391.1, CCDS46022.1, CCDS46023.1	19p13.1	2008-02-05				ENSG00000051128			17514	protein-coding gene	gene with protein product		604800				10653696, 9808459	Standard	NM_004838		Approved	HOMER-3	uc002nkv.2	Q9NSC5		ENST00000539827.1:c.27C>G	19.37:g.19049681G>C	ENSP00000439937:p.Ile9Met	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PCW9|O14580|O95350|Q9NSB9|Q9NSC0|Q9NSC1	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.I9M	ENST00000539827.1	37	c.27	CCDS12391.1	19	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185323	0.57909	.	.	ENSG00000051128	ENST00000392351;ENST00000433218;ENST00000542541;ENST00000221222;ENST00000539827;ENST00000357832;ENST00000355887	D;D;D;D;D;D	0.99150	-5.49;-5.49;-5.49;-5.49;-5.49;-5.49	3.85	2.81	0.32909	EVH1 (3);Pleckstrin homology-type (1);	0.113366	0.56097	D	0.000025	D	0.98814	0.9600	M	0.85710	2.77	0.80722	D	1	P;P;D	0.53619	0.916;0.951;0.961	P;P;P	0.58577	0.638;0.754;0.841	D	0.98842	1.0755	10	0.87932	D	0	-2.8477	5.9511	0.19246	0.0994:0.0:0.712:0.1886	.	9;9;9	E9PCW9;Q9NSC5-2;Q9NSC5	.;.;HOME3_HUMAN	M	9	ENSP00000376162:I9M;ENSP00000396154:I9M;ENSP00000446026:I9M;ENSP00000221222:I9M;ENSP00000439937:I9M;ENSP00000348150:I9M	ENSP00000221222:I9M	I	-	3	3	HOMER3	18910681	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	1.565000	0.36386	0.953000	0.37825	0.561000	0.74099	ATC	HOMER3	-	pfam_EVH1,smart_EVH1,pfscan_EVH1		0.617	HOMER3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HOMER3	HGNC	protein_coding	OTTHUMT00000464607.1	G			19049681	-1	no_errors	ENST00000392351	ensembl	human	known	70_37	missense	SNP	1.000	C
HOXC12	3228	genome.wustl.edu	37	12	54348984	54348984	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:54348984G>A	ENST00000243103.3	+	1	367	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	AC012531.23_ENST00000603432.1_lincRNA	NM_173860.1	NP_776272.1	P31275	HXC12_HUMAN	homeobox C12	91					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)	12						CGTGGAGGACGGCAAGGGTTA	0.751																																																	0													10.0	10.0	10.0					12																	54348984		2125	4202	6327	SO:0001583	missense	3228			AF328962	CCDS8866.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123407	ENSG00000123407		"""Homeoboxes / ANTP class : HOXL subclass"""	5124	protein-coding gene	gene with protein product		142975	"""homeo box C12"""	HOX3, HOX3F, HOC3F		1973146, 1358459	Standard	NM_173860		Approved		uc010soq.2	P31275	OTTHUMG00000160010	ENST00000243103.3:c.271G>A	12.37:g.54348984G>A	ENSP00000243103:p.Gly91Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXJ6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.G91S	ENST00000243103.3	37	c.271	CCDS8866.1	12	.	.	.	.	.	.	.	.	.	.	g	2.868	-0.234541	0.05983	.	.	ENSG00000123407	ENST00000243103	D	0.91996	-2.95	2.85	0.48	0.16804	.	0.140060	0.49305	N	0.000157	T	0.73776	0.3630	N	0.03891	-0.335	0.24342	N	0.994958	B	0.12630	0.006	B	0.06405	0.002	T	0.63207	-0.6689	10	0.02654	T	1	.	6.8576	0.24050	0.7784:0.0:0.2216:0.0	.	91	P31275	HXC12_HUMAN	S	91	ENSP00000243103:G91S	ENSP00000243103:G91S	G	+	1	0	HOXC12	52635251	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	3.376000	0.52417	0.081000	0.16988	-0.611000	0.04053	GGC	HOXC12	-	NULL		0.751	HOXC12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HOXC12	HGNC	protein_coding	OTTHUMT00000358868.2	G	NM_173860		54348984	+1	no_errors	ENST00000243103	ensembl	human	known	70_37	missense	SNP	0.998	A
HSD17B11	51170	genome.wustl.edu	37	4	88295859	88295859	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:88295859G>A	ENST00000358290.4	-	3	757	c.442C>T	c.(442-444)Cat>Tat	p.H148Y	HSD17B11_ENST00000507286.1_Intron|HSD17B11_ENST00000507518.1_5'Flank	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	148					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		ACCCAGAAATGTGCAAGTACA	0.323																																																	0													102.0	111.0	108.0					4																	88295859		2202	4300	6502	SO:0001583	missense	51170			AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.442C>T	4.37:g.88295859G>A	ENSP00000351035:p.His148Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96HF6|Q9UKU4	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.H148Y	ENST00000358290.4	37	c.442	CCDS3619.1	4	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460561	0.84317	.	.	ENSG00000198189	ENST00000358290	D	0.87256	-2.23	5.42	5.42	0.78866	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92348	0.7572	L	0.57130	1.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92748	0.6213	10	0.66056	D	0.02	.	17.9887	0.89162	0.0:0.0:1.0:0.0	.	148	Q8NBQ5	DHB11_HUMAN	Y	148	ENSP00000351035:H148Y	ENSP00000351035:H148Y	H	-	1	0	HSD17B11	88514883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.501000	0.73691	2.532000	0.85374	0.655000	0.94253	CAT	HSD17B11	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR		0.323	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B11	HGNC	protein_coding	OTTHUMT00000253041.1	G	NM_016245		88295859	-1	no_errors	ENST00000358290	ensembl	human	known	70_37	missense	SNP	1.000	A
HSPG2	3339	genome.wustl.edu	37	1	22166489	22166489	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:22166489C>T	ENST00000374695.3	-	72	9614	c.9535G>A	c.(9535-9537)Gat>Aat	p.D3179N		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3179	Ig-like C2-type 17.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTGCCCGCATCTGATGGTTTA	0.587																																																	0													164.0	156.0	159.0					1																	22166489		2203	4300	6503	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9535G>A	1.37:g.22166489C>T	ENSP00000363827:p.Asp3179Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.D3179N	ENST00000374695.3	37	c.9535	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.691805	0.68271	.	.	ENSG00000142798	ENST00000374695	T	0.80994	-1.44	5.56	5.56	0.83823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41001	D	0.000962	D	0.91043	0.7182	M	0.89414	3.03	0.58432	D	0.999994	D;D	0.67145	0.987;0.996	D;D	0.71656	0.974;0.964	D	0.92335	0.5877	10	0.72032	D	0.01	.	17.0144	0.86414	0.0:1.0:0.0:0.0	.	1119;3179	Q59EG0;P98160	.;PGBM_HUMAN	N	3179	ENSP00000363827:D3179N	ENSP00000363827:D3179N	D	-	1	0	HSPG2	22039076	1.000000	0.71417	0.989000	0.46669	0.083000	0.17756	5.046000	0.64226	2.619000	0.88677	0.462000	0.41574	GAT	HSPG2	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.587	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	C	NM_005529		22166489	-1	no_errors	ENST00000374695	ensembl	human	known	70_37	missense	SNP	1.000	T
IDO2	169355	genome.wustl.edu	37	8	39847324	39847324	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:39847324C>T	ENST00000389060.4	+	7	634	c.634C>T	c.(634-636)Cag>Tag	p.Q212*	RP11-44K6.3_ENST00000517623.1_RNA|IDO2_ENST00000502986.2_Nonsense_Mutation_p.Q225*|IDO2_ENST00000343295.4_3'UTR			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	212					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						ACTGTCTATTCAGGACATCAC	0.562											OREG0018729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													73.0	70.0	71.0					8																	39847324		1993	4176	6169	SO:0001587	stop_gained	169355			AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.634C>T	8.37:g.39847324C>T	ENSP00000426447:p.Gln212*	Somatic	889	WXS	Illumina HiSeq	Phase_IV	A4UD41	Nonsense_Mutation	SNP	pfam_Indolamine_dOase	p.Q225*	ENST00000389060.4	37	c.673		8	.	.	.	.	.	.	.	.	.	.	C	35	5.422339	0.96111	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	.	.	.	5.67	3.79	0.43588	.	0.867769	0.10162	N	0.708259	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6245	0.28204	0.1603:0.6063:0.2334:0.0	.	.	.	.	X	225;212	.	.	Q	+	1	0	IDO2	39966481	0.742000	0.28228	0.971000	0.41717	0.784000	0.44337	0.094000	0.15107	1.339000	0.45563	0.467000	0.42956	CAG	IDO2	-	pfam_Indolamine_dOase		0.562	IDO2-004	KNOWN	basic|appris_principal	protein_coding	IDO2	HGNC	protein_coding	OTTHUMT00000372742.1	C	NM_194294		39847324	+1	no_errors	ENST00000502986	ensembl	human	known	70_37	nonsense	SNP	0.992	T
IL17D	53342	genome.wustl.edu	37	13	21277372	21277372	+	5'Flank	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:21277372C>T	ENST00000304920.3	+	0	0				AL161772.1_ENST00000581760.1_RNA|IL17D_ENST00000498088.1_3'UTR	NM_138284.1	NP_612141.1	Q8TAD2	IL17D_HUMAN	interleukin 17D						inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|skin(1)	2		all_cancers(29;9.63e-24)|all_epithelial(30;1.09e-19)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000301)|Epithelial(112;0.000633)|OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Lung(94;0.0154)|LUSC - Lung squamous cell carcinoma(192;0.0414)		CGTGGCCCTTCGGGTTATTCC	0.687																																																	0																																										SO:0001631	upstream_gene_variant	53342			AY078238	CCDS9292.1	13q11	2008-07-18			ENSG00000172458	ENSG00000172458		"""Interleukins and interleukin receptors"""	5984	protein-coding gene	gene with protein product	"""interleukin 27"""	607587				12097364	Standard	NM_138284		Approved	IL-22, IL-27, IL-17D, IL27, FLJ30846	uc001unm.3	Q8TAD2	OTTHUMG00000016521		13.37:g.21277372C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM69	RNA	SNP	-	NULL	ENST00000304920.3	37	NULL	CCDS9292.1	13																																																																																			IL17D	-	-		0.687	IL17D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17D	HGNC	protein_coding	OTTHUMT00000044087.1	C	NM_138284		21277372	+1	no_errors	ENST00000498088	ensembl	human	known	70_37	rna	SNP	0.000	T
IL1R2	7850	genome.wustl.edu	37	2	102632495	102632495	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:102632495G>A	ENST00000332549.3	+	4	724	c.495G>A	c.(493-495)gtG>gtA	p.V165V	IL1R2_ENST00000441002.1_Silent_p.V165V|IL1R2_ENST00000393414.2_Silent_p.V165V	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	165	Ig-like C2-type 2.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						AAACTGACGTGAAGATTCAAT	0.373																																					Pancreas(106;189 1628 2302 5133 12295)												0													61.0	58.0	59.0					2																	102632495		2203	4300	6503	SO:0001819	synonymous_variant	7850			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.495G>A	2.37:g.102632495G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVJ5|Q6LCE6|Q9UE68	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II,prints_IL1_rcpt_I/II	p.V165	ENST00000332549.3	37	c.495	CCDS2054.1	2																																																																																			IL1R2	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II		0.373	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	G	NM_004633		102632495	+1	no_errors	ENST00000332549	ensembl	human	known	70_37	silent	SNP	0.001	A
INA	9118	genome.wustl.edu	37	10	105048215	105048215	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:105048215G>A	ENST00000369849.4	+	3	1338	c.1289G>A	c.(1288-1290)aGa>aAa	p.R430K		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	430	Tail.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		CTCCCACCTAGAATCCTCAGT	0.502																																																	0													127.0	121.0	123.0					10																	105048215		2203	4300	6503	SO:0001583	missense	9118			S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.1289G>A	10.37:g.105048215G>A	ENSP00000358865:p.Arg430Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQK0|Q9BRC5	Missense_Mutation	SNP	pfam_F,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin	p.R430K	ENST00000369849.4	37	c.1289	CCDS7545.1	10	.	.	.	.	.	.	.	.	.	.	G	9.386	1.074204	0.20227	.	.	ENSG00000148798	ENST00000369849	D	0.82893	-1.66	5.17	5.17	0.71159	.	0.057184	0.64402	D	0.000002	T	0.71256	0.3318	N	0.24115	0.695	0.37215	D	0.904984	B	0.23377	0.084	B	0.26202	0.067	T	0.66662	-0.5867	10	0.06236	T	0.91	.	15.6908	0.77450	0.0:0.0:1.0:0.0	.	430	Q16352	AINX_HUMAN	K	430	ENSP00000358865:R430K	ENSP00000358865:R430K	R	+	2	0	INA	105038205	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.542000	0.60677	2.690000	0.91761	0.555000	0.69702	AGA	INA	-	NULL		0.502	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INA	HGNC	protein_coding	OTTHUMT00000050145.1	G	NM_032727		105048215	+1	no_errors	ENST00000369849	ensembl	human	known	70_37	missense	SNP	0.991	A
IPO9	55705	genome.wustl.edu	37	1	201838797	201838797	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:201838797C>G	ENST00000361565.4	+	17	2153	c.2084C>G	c.(2083-2085)cCt>cGt	p.P695R		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	695					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CAAGCTTTCCCTGCTGTGGCA	0.488																																																	0													136.0	111.0	119.0					1																	201838797		2203	4300	6503	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2084C>G	1.37:g.201838797C>G	ENSP00000354742:p.Pro695Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.P695R	ENST00000361565.4	37	c.2084	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967478	0.92855	.	.	ENSG00000198700	ENST00000361565	T	0.71698	-0.59	5.8	5.8	0.92144	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84234	0.5427	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84899	0.0841	10	0.62326	D	0.03	-9.8707	17.5448	0.87858	0.0:1.0:0.0:0.0	.	695	Q96P70	IPO9_HUMAN	R	695	ENSP00000354742:P695R	ENSP00000354742:P695R	P	+	2	0	IPO9	200105420	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.402000	0.79972	2.740000	0.93945	0.650000	0.86243	CCT	IPO9	-	superfamily_ARM-type_fold		0.488	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	HGNC	protein_coding	OTTHUMT00000087088.1	C	NM_018085		201838797	+1	no_errors	ENST00000361565	ensembl	human	known	70_37	missense	SNP	1.000	G
IQCG	84223	genome.wustl.edu	37	3	197616441	197616441	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:197616441G>C	ENST00000265239.6	-	0	1766				IQCG_ENST00000455191.1_3'UTR	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G							extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		AAACACAAAAGAGAACTTGGT	0.423																																																	0													308.0	273.0	285.0					3																	197616441		2203	4300	6503	SO:0001624	3_prime_UTR_variant	84223			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.*10C>G	3.37:g.197616441G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BST2|Q9HAG8	RNA	SNP	-	NULL	ENST00000265239.6	37	NULL	CCDS3331.1	3																																																																																			IQCG	-	-		0.423	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	G	NM_032263		197616441	-1	no_errors	ENST00000485787	ensembl	human	known	70_37	rna	SNP	0.000	C
IQGAP1	8826	genome.wustl.edu	37	15	90983760	90983760	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:90983760G>A	ENST00000268182.5	+	7	686	c.562G>A	c.(562-564)Gag>Aag	p.E188K	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	188					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CATGAAGACTGAGTTGGAGAA	0.428																																																	0													61.0	54.0	57.0					15																	90983760		2195	4287	6482	SO:0001583	missense	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.562G>A	15.37:g.90983760G>A	ENSP00000268182:p.Glu188Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MBM3	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_Rsp5_WWP,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,smart_CH-domain,smart_WW_Rsp5_WWP,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.E188K	ENST00000268182.5	37	c.562	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	G	37	6.010364	0.97200	.	.	ENSG00000140575	ENST00000268182	T	0.42131	0.98	5.49	5.49	0.81192	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.68961	0.3058	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66135	-0.5999	10	0.15499	T	0.54	-30.8544	18.5489	0.91056	0.0:0.0:1.0:0.0	.	188	P46940	IQGA1_HUMAN	K	188	ENSP00000268182:E188K	ENSP00000268182:E188K	E	+	1	0	IQGAP1	88784764	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.563000	0.98148	2.857000	0.98124	0.650000	0.86243	GAG	IQGAP1	-	superfamily_CH-domain		0.428	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	G	NM_003870		90983760	+1	no_errors	ENST00000268182	ensembl	human	known	70_37	missense	SNP	1.000	A
ITGA2	3673	genome.wustl.edu	37	5	52351382	52351382	+	Nonsense_Mutation	SNP	C	C	G	rs560079800		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:52351382C>G	ENST00000296585.5	+	8	937	c.794C>G	c.(793-795)tCa>tGa	p.S265*		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	265	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TATGCTTATTCAGCAGCTTCT	0.353																																																	0													104.0	102.0	103.0					5																	52351382		2203	4300	6503	SO:0001587	stop_gained	3673				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.794C>G	5.37:g.52351382C>G	ENSP00000296585:p.Ser265*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14595	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S265*	ENST00000296585.5	37	c.794	CCDS3957.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.477990	0.96291	.	.	ENSG00000164171	ENST00000296585	.	.	.	5.54	4.66	0.58398	.	0.759254	0.12829	N	0.435753	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	14.7441	0.69477	0.0:0.9295:0.0:0.0705	.	.	.	.	X	265	.	ENSP00000296585:S265X	S	+	2	0	ITGA2	52387139	0.316000	0.24580	0.958000	0.39756	0.848000	0.48234	1.095000	0.30964	1.301000	0.44836	0.650000	0.86243	TCA	ITGA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.353	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	HGNC	protein_coding	OTTHUMT00000253857.2	C	NM_002203		52351382	+1	no_errors	ENST00000296585	ensembl	human	known	70_37	nonsense	SNP	0.989	G
IQGAP2	10788	genome.wustl.edu	37	5	76003274	76003274	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:76003274G>A	ENST00000274364.6	+	0	5161				CTD-2384B11.2_ENST00000507514.1_RNA|IQGAP2_ENST00000379730.3_3'UTR|IQGAP2_ENST00000508410.1_3'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2						negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAACTGTTCTGAAGAATGTAC	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.*136G>A	5.37:g.76003274G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4V1|B7Z8A4|J3KR91	RNA	SNP	-	NULL	ENST00000274364.6	37	NULL	CCDS34188.1	5																																																																																			IQGAP2	-	-		0.284	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	G	NM_006633		76003274	+1	no_errors	ENST00000508410	ensembl	human	putative	70_37	rna	SNP	0.018	A
ITGB1	3688	genome.wustl.edu	37	10	33218789	33218789	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:33218789G>C	ENST00000396033.2	-	4	472	c.337C>G	c.(337-339)Cag>Gag	p.Q113E	ITGB1_ENST00000302278.3_Missense_Mutation_p.Q113E|ITGB1_ENST00000484088.1_5'UTR|ITGB1_ENST00000423113.1_Missense_Mutation_p.Q113E|ITGB1_ENST00000374956.4_Missense_Mutation_p.Q113E	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	113					axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	GGTTGGATCTGAGTAATATCC	0.423																																																	0													339.0	326.0	330.0					10																	33218789		2203	4300	6503	SO:0001583	missense	3688			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.337C>G	10.37:g.33218789G>C	ENSP00000379350:p.Gln113Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,pirsf_Integrin_bsu,prints_Integrin_bsu	p.Q113E	ENST00000396033.2	37	c.337	CCDS7174.1	10	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892247	0.91889	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956;ENST00000480226;ENST00000474568;ENST00000488494;ENST00000534049;ENST00000437302;ENST00000475184	D;D;D;D;D;D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48	5.49	5.49	0.81192	Integrin beta subunit, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98090	0.9370	M	0.93808	3.46	0.80722	D	1	D;D;D;D;D	0.71674	0.995;0.996;0.996;0.996;0.998	D;D;D;D;D	0.81914	0.981;0.989;0.995;0.919;0.994	D	0.98934	1.0788	10	0.87932	D	0	.	19.3752	0.94505	0.0:0.0:1.0:0.0	.	113;113;113;113;113	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	E	113;113;113;113;113;56;116;113;113;113	ENSP00000379350:Q113E;ENSP00000388694:Q113E;ENSP00000303351:Q113E;ENSP00000364094:Q113E;ENSP00000417537:Q113E;ENSP00000420282:Q56E;ENSP00000418725:Q116E;ENSP00000431326:Q113E;ENSP00000398029:Q113E;ENSP00000417243:Q113E	ENSP00000303351:Q113E	Q	-	1	0	ITGB1	33258795	1.000000	0.71417	0.948000	0.38648	0.979000	0.70002	9.869000	0.99810	2.576000	0.86940	0.591000	0.81541	CAG	ITGB1	-	pfam_Integrin_bsu_N,smart_Integrin_bsu_N,pirsf_Integrin_bsu,prints_Integrin_bsu		0.423	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB1	HGNC	protein_coding	OTTHUMT00000047496.1	G	NM_002211		33218789	-1	no_errors	ENST00000374956	ensembl	human	known	70_37	missense	SNP	1.000	C
ITPKC	80271	genome.wustl.edu	37	19	41223322	41223322	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:41223322G>C	ENST00000263370.2	+	1	315	c.282G>C	c.(280-282)caG>caC	p.Q94H	ADCK4_ENST00000324464.3_5'Flank|ADCK4_ENST00000450541.1_5'Flank|ADCK4_ENST00000243583.6_5'Flank	NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	94					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CAGACGGACAGACTGAGCCCG	0.657																																																	0													25.0	30.0	28.0					19																	41223322		2202	4297	6499	SO:0001583	missense	80271			Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.282G>C	19.37:g.41223322G>C	ENSP00000263370:p.Gln94His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UE25|Q9Y475	Missense_Mutation	SNP	pfam_IPK	p.Q94H	ENST00000263370.2	37	c.282	CCDS12563.1	19	.	.	.	.	.	.	.	.	.	.	G	0.718	-0.784503	0.02907	.	.	ENSG00000086544	ENST00000263370	.	.	.	4.28	0.499	0.16914	.	0.967681	0.08450	N	0.944112	T	0.17619	0.0423	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24621	-1.0155	9	0.34782	T	0.22	-2.2405	5.7395	0.18085	0.1951:0.2164:0.5885:0.0	.	94	Q96DU7	IP3KC_HUMAN	H	94	.	ENSP00000263370:Q94H	Q	+	3	2	ITPKC	45915162	0.119000	0.22226	0.002000	0.10522	0.016000	0.09150	0.954000	0.29175	0.099000	0.17552	-0.350000	0.07774	CAG	ITPKC	-	NULL		0.657	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKC	HGNC	protein_coding	OTTHUMT00000463104.1	G	NM_025194		41223322	+1	no_errors	ENST00000263370	ensembl	human	known	70_37	missense	SNP	0.005	C
ITSN2	50618	genome.wustl.edu	37	2	24498643	24498643	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:24498643C>T	ENST00000355123.4	-	18	2463	c.2020G>A	c.(2020-2022)Gaa>Aaa	p.E674K	SCARNA21_ENST00000515996.1_RNA|ITSN2_ENST00000406921.3_Missense_Mutation_p.E674K|ITSN2_ENST00000361999.3_Missense_Mutation_p.E647K	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	674					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTCAATTTCCTTCAACTTG	0.343																																																	0													166.0	153.0	158.0					2																	24498643		2203	4299	6502	SO:0001583	missense	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.2020G>A	2.37:g.24498643C>T	ENSP00000347244:p.Glu674Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.E674K	ENST00000355123.4	37	c.2020	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113622	0.77210	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000406921	T;T;T;T	0.62105	1.46;0.05;1.46;0.44	5.57	5.57	0.84162	.	0.000000	0.37623	U	0.002009	T	0.74794	0.3763	M	0.73217	2.22	0.47659	D	0.999484	D;D;P	0.55605	0.972;0.972;0.953	P;P;P	0.53912	0.737;0.737;0.551	T	0.76974	-0.2760	10	0.72032	D	0.01	.	19.9464	0.97184	0.0:1.0:0.0:0.0	.	674;647;674	Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;ITSN2_HUMAN	K	647;674;647;674	ENSP00000354561:E647K;ENSP00000347244:E674K;ENSP00000370250:E647K;ENSP00000384499:E674K	ENSP00000347244:E674K	E	-	1	0	ITSN2	24352147	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.984000	0.63838	2.798000	0.96311	0.650000	0.86243	GAA	ITSN2	-	NULL		0.343	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	C	NM_006277		24498643	-1	no_errors	ENST00000355123	ensembl	human	known	70_37	missense	SNP	1.000	T
ITSN2	50618	genome.wustl.edu	37	2	24521654	24521654	+	Silent	SNP	A	A	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:24521654A>G	ENST00000355123.4	-	13	1817	c.1374T>C	c.(1372-1374)cgT>cgC	p.R458R	ITSN2_ENST00000406921.3_Silent_p.R458R|ITSN2_ENST00000361999.3_Silent_p.R458R	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	458					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCTAAGCGACGTTGTCGTT	0.343																																																	0													113.0	116.0	115.0					2																	24521654		2203	4300	6503	SO:0001819	synonymous_variant	50618			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1374T>C	2.37:g.24521654A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.R458	ENST00000355123.4	37	c.1374	CCDS1710.2	2																																																																																			ITSN2	-	NULL		0.343	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	A	NM_006277		24521654	-1	no_errors	ENST00000355123	ensembl	human	known	70_37	silent	SNP	0.308	G
JMJD1C	221037	genome.wustl.edu	37	10	64974005	64974005	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:64974005G>A	ENST00000399262.2	-	8	2140	c.1922C>T	c.(1921-1923)tCa>tTa	p.S641L	JMJD1C_ENST00000542921.1_Missense_Mutation_p.S459L|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S422L|JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000402544.1_Missense_Mutation_p.S422L	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	641					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AACTTCAGGTGATGGGCTGGA	0.393																																																	0													131.0	119.0	123.0					10																	64974005		1869	4107	5976	SO:0001583	missense	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1922C>T	10.37:g.64974005G>A	ENSP00000382204:p.Ser641Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S641L	ENST00000399262.2	37	c.1922	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	9.408	1.079896	0.20309	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	6.11	5.03	0.67393	.	0.245457	0.35870	N	0.002932	T	0.39009	0.1062	N	0.22421	0.69	0.39994	D	0.975074	B;B	0.15141	0.007;0.012	B;B	0.11329	0.006;0.004	T	0.14727	-1.0462	10	0.23891	T	0.37	-13.0328	15.2591	0.73606	0.0798:0.0:0.9202:0.0	.	641;459	Q15652;A0T124	JHD2C_HUMAN;.	L	641;422;422;459	ENSP00000382204:S641L;ENSP00000384990:S422L;ENSP00000382195:S422L;ENSP00000444682:S459L	ENSP00000382195:S422L	S	-	2	0	JMJD1C	64644011	1.000000	0.71417	0.997000	0.53966	0.905000	0.53344	3.704000	0.54815	2.906000	0.99361	0.655000	0.94253	TCA	JMJD1C	-	NULL		0.393	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	G	NM_004241		64974005	-1	no_errors	ENST00000399262	ensembl	human	known	70_37	missense	SNP	0.998	A
JMJD1C	221037	genome.wustl.edu	37	10	64974350	64974350	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:64974350G>A	ENST00000399262.2	-	8	1795	c.1577C>T	c.(1576-1578)tCa>tTa	p.S526L	JMJD1C_ENST00000542921.1_Missense_Mutation_p.S344L|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S307L|JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000402544.1_Missense_Mutation_p.S307L	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	526					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AAAGGTACTTGAGTTTTCCTG	0.358																																																	0													137.0	125.0	129.0					10																	64974350		1830	4087	5917	SO:0001583	missense	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1577C>T	10.37:g.64974350G>A	ENSP00000382204:p.Ser526Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S526L	ENST00000399262.2	37	c.1577	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253551	0.39797	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.56611	0.8;0.45;2.46;0.8	6.03	5.12	0.69794	.	0.716692	0.12930	N	0.427432	T	0.49115	0.1538	L	0.43152	1.355	0.29879	N	0.82615	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49513	-0.8932	10	0.52906	T	0.07	-1.3222	15.759	0.78063	0.0659:0.0:0.9341:0.0	.	526;344	Q15652;A0T124	JHD2C_HUMAN;.	L	526;307;307;344	ENSP00000382204:S526L;ENSP00000384990:S307L;ENSP00000382195:S307L;ENSP00000444682:S344L	ENSP00000382195:S307L	S	-	2	0	JMJD1C	64644356	1.000000	0.71417	0.992000	0.48379	0.985000	0.73830	2.992000	0.49417	1.521000	0.48983	0.655000	0.94253	TCA	JMJD1C	-	NULL		0.358	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	G	NM_004241		64974350	-1	no_errors	ENST00000399262	ensembl	human	known	70_37	missense	SNP	0.998	A
KDM5B	10765	genome.wustl.edu	37	1	202702904	202702904	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:202702904G>A	ENST00000367265.3	-	23	4698	c.3534C>T	c.(3532-3534)atC>atT	p.I1178I	KDM5B_ENST00000367264.2_Silent_p.I1214I	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1178					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GACATAGGCAGATTTTTATAT	0.507																																																	0													84.0	90.0	88.0					1																	202702904		2203	4300	6503	SO:0001819	synonymous_variant	10765			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3534C>T	1.37:g.202702904G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95811|Q15752|Q9Y3Q5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.I1178	ENST00000367265.3	37	c.3534	CCDS30974.1	1																																																																																			KDM5B	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.507	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	G	NM_006618		202702904	-1	no_errors	ENST00000367265	ensembl	human	known	70_37	silent	SNP	1.000	A
KCNK2	3776	genome.wustl.edu	37	1	215256745	215256745	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:215256745C>T	ENST00000444842.2	+	1	167	c.17C>T	c.(16-18)tCg>tTg	p.S6L	KCNK2_ENST00000391895.2_Intron|KCNK2_ENST00000391894.2_Intron	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	6					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.S6W(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CCCAGCGCCTCGCGGGAGAGA	0.547																																																	2	Substitution - Missense(2)	urinary_tract(2)											67.0	76.0	73.0					1																	215256745		2203	4300	6503	SO:0001583	missense	3776			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.17C>T	1.37:g.215256745C>T	ENSP00000394033:p.Ser6Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.S6L	ENST00000444842.2	37	c.17	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707250	0.48412	.	.	ENSG00000082482	ENST00000444842	T	0.21191	2.02	4.27	1.18	0.20946	.	0.933707	0.08889	N	0.878957	T	0.15609	0.0376	N	0.22421	0.69	0.23594	N	0.997333	P	0.44241	0.829	B	0.40134	0.32	T	0.23404	-1.0189	10	0.39692	T	0.17	.	11.786	0.52043	0.0:0.4634:0.5366:0.0	.	6	O95069	KCNK2_HUMAN	L	6	ENSP00000394033:S6L	ENSP00000394033:S6L	S	+	2	0	KCNK2	213323368	0.083000	0.21467	0.998000	0.56505	0.998000	0.95712	0.229000	0.17833	0.061000	0.16311	0.655000	0.94253	TCG	KCNK2	-	NULL		0.547	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	C	NM_014217		215256745	+1	no_errors	ENST00000444842	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA0020	9933	genome.wustl.edu	37	9	2823795	2823795	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:2823795C>G	ENST00000397885.2	-	12	1380	c.1174G>C	c.(1174-1176)Gaa>Caa	p.E392Q		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	392	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GCCACCTTTTCAACATAAGTC	0.264																																																	0													42.0	38.0	39.0					9																	2823795		2181	4247	6428	SO:0001583	missense	9933			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1174G>C	9.37:g.2823795C>G	ENSP00000380982:p.Glu392Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.E392Q	ENST00000397885.2	37	c.1174	CCDS6448.2	9	.	.	.	.	.	.	.	.	.	.	C	9.115	1.007625	0.19199	.	.	ENSG00000080608	ENST00000397885	T	0.15603	2.41	5.68	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.208574	0.49305	N	0.000148	T	0.14787	0.0357	L	0.35341	1.055	0.39810	D	0.972686	B;B	0.02656	0.0;0.0	B;B	0.11329	0.001;0.006	T	0.06110	-1.0845	10	0.16420	T	0.52	-30.6892	16.8131	0.85726	0.0:0.8714:0.1286:0.0	.	252;392	B2RDG4;Q15397	.;K0020_HUMAN	Q	392	ENSP00000380982:E392Q	ENSP00000380982:E392Q	E	-	1	0	KIAA0020	2813795	1.000000	0.71417	0.929000	0.37066	0.471000	0.32888	2.894000	0.48640	1.396000	0.46663	0.650000	0.86243	GAA	KIAA0020	-	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt		0.264	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	C	NM_014878		2823795	-1	no_errors	ENST00000397885	ensembl	human	known	70_37	missense	SNP	0.995	G
CEP162	22832	genome.wustl.edu	37	6	84913791	84913791	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:84913791C>T	ENST00000403245.3	-	7	709	c.595G>A	c.(595-597)Gat>Aat	p.D199N	KIAA1009_ENST00000257766.4_Missense_Mutation_p.D123N	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ACATACTCATCTTCAAAATCA	0.328																																																	0													95.0	96.0	96.0					6																	84913791		2203	4299	6502	SO:0001583	missense	22832																														ENST00000403245.3:c.595G>A	6.37:g.84913791C>T	ENSP00000385215:p.Asp199Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.D199N	ENST00000403245.3	37	c.595	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285696	0.59867	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.13778	2.56;2.56	5.61	4.75	0.60458	.	0.277160	0.32106	N	0.006568	T	0.13243	0.0321	M	0.62723	1.935	0.23787	N	0.996844	P;D	0.56746	0.675;0.977	B;P	0.52159	0.426;0.691	T	0.03086	-1.1074	10	0.62326	D	0.03	-10.0882	12.4739	0.55801	0.0:0.9219:0.0:0.0781	.	199;199	Q5TB80;C9JFM9	QN1_HUMAN;.	N	123;199	ENSP00000257766:D123N;ENSP00000385215:D199N	ENSP00000257766:D123N	D	-	1	0	KIAA1009	84970510	1.000000	0.71417	0.999000	0.59377	0.442000	0.32017	2.744000	0.47450	1.373000	0.46208	-0.251000	0.11542	GAT	KIAA1009	-	NULL		0.328	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	C			84913791	-1	no_errors	ENST00000403245	ensembl	human	known	70_37	missense	SNP	1.000	T
KIF26B	55083	genome.wustl.edu	37	1	245847666	245847666	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:245847666G>A	ENST00000407071.2	+	11	2830	c.2390G>A	c.(2389-2391)aGa>aAa	p.R797K	KIF26B_ENST00000366518.4_Missense_Mutation_p.R416K	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	797	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ATTGCATCGAGAGTCTTGAGG	0.597																																																	0													36.0	37.0	37.0					1																	245847666		1953	4150	6103	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2390G>A	1.37:g.245847666G>A	ENSP00000385545:p.Arg797Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R797K	ENST00000407071.2	37	c.2390	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780354	0.90195	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.77098	-1.07;-1.07	5.73	5.73	0.89815	Kinesin, motor domain (3);	.	.	.	.	D	0.87458	0.6182	M	0.68317	2.08	0.58432	D	0.999997	P;D	0.54772	0.855;0.968	P;D	0.67382	0.902;0.951	D	0.87793	0.2620	9	0.87932	D	0	.	19.8966	0.96963	0.0:0.0:1.0:0.0	.	416;797	B7WPD9;Q2KJY2	.;KI26B_HUMAN	K	797;416;413	ENSP00000385545:R797K;ENSP00000355475:R416K	ENSP00000355475:R416K	R	+	2	0	KIF26B	243914289	1.000000	0.71417	0.629000	0.29254	0.797000	0.45037	9.869000	0.99810	2.700000	0.92200	0.655000	0.94253	AGA	KIF26B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom		0.597	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	G	XM_371354		245847666	+1	no_errors	ENST00000407071	ensembl	human	known	70_37	missense	SNP	0.765	A
KIR3DX1	90011	genome.wustl.edu	37	19	55053855	55053855	+	Intron	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:55053855G>A	ENST00000335056.3	+	7	1037				KIR3DX1_ENST00000482404.1_Intron			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1							extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		ATAAAATATCGTAAGTCTCAG	0.512																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0													98.0	79.0	85.0					19																	55053855		692	1591	2283	SO:0001627	intron_variant	90011			BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.1000-730G>A	19.37:g.55053855G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNL0|Q8N0S4	Splice_Site	SNP	-	e7+1	ENST00000335056.3	37	c.1059+1		19																																																																																			KIR3DX1	-	-		0.512	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	HGNC	protein_coding	OTTHUMT00000140800.2	G	NR_026716		55053855	+1	no_errors	ENST00000221567	ensembl	human	known	70_37	splice_site	SNP	0.066	A
KITLG	4254	genome.wustl.edu	37	12	88910219	88910219	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:88910219C>T	ENST00000228280.5	-	5	594	c.412G>A	c.(412-414)Gaa>Aaa	p.E138K	KITLG_ENST00000357116.4_Intron|KITLG_ENST00000347404.5_Missense_Mutation_p.E138K|KITLG_ENST00000378535.4_5'UTR	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	138					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						AAGAATTCTTCAGGAGTAAAG	0.343									Testicular Cancer, Familial Clustering of																																								0													44.0	50.0	48.0					12																	88910219		2199	4293	6492	SO:0001583	missense	4254	Familial Cancer Database		M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.412G>A	12.37:g.88910219C>T	ENSP00000228280:p.Glu138Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Missense_Mutation	SNP	pfam_SCF,superfamily_4_helix_cytokine-like_core,pirsf_SCF	p.E138K	ENST00000228280.5	37	c.412	CCDS31868.1	12	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463785	0.63513	.	.	ENSG00000049130	ENST00000378535;ENST00000228280;ENST00000347404	T;T	0.71341	-0.56;-0.56	4.96	4.06	0.47325	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.428560	0.26623	N	0.023345	T	0.54695	0.1874	L	0.41710	1.295	0.39472	D	0.967737	P;P	0.37207	0.532;0.587	B;B	0.28784	0.057;0.094	T	0.57260	-0.7842	10	0.28530	T	0.3	-8.2727	10.7015	0.45931	0.0:0.9092:0.0:0.0907	.	138;138	P21583-2;P21583	.;SCF_HUMAN	K	103;138;138	ENSP00000228280:E138K;ENSP00000054216:E138K	ENSP00000228280:E138K	E	-	1	0	KITLG	87434350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.029000	0.49712	2.285000	0.76669	0.591000	0.81541	GAA	KITLG	-	pfam_SCF,superfamily_4_helix_cytokine-like_core,pirsf_SCF		0.343	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KITLG	HGNC	protein_coding	OTTHUMT00000406424.2	C	NM_003994		88910219	-1	no_errors	ENST00000228280	ensembl	human	known	70_37	missense	SNP	1.000	T
KLF5	688	genome.wustl.edu	37	13	73636078	73636078	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:73636078G>T	ENST00000377687.4	+	2	877	c.341G>T	c.(340-342)cGa>cTa	p.R114L	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.R23L	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	114					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R114Q(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		AAGTATAGACGAGACAGTGCC	0.418																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											162.0	156.0	158.0					13																	73636078		2203	4300	6503	SO:0001583	missense	688			D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.341G>T	13.37:g.73636078G>T	ENSP00000366915:p.Arg114Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R114L	ENST00000377687.4	37	c.341	CCDS9448.1	13	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659947	0.88154	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.16196	2.7;2.36	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.45756	0.1358	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.23013	-1.0200	10	0.72032	D	0.01	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	114	Q13887	KLF5_HUMAN	L	23;114;94	ENSP00000440407:R23L;ENSP00000366915:R114L	ENSP00000366915:R114L	R	+	2	0	KLF5	72534079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.897000	0.92532	2.873000	0.98535	0.563000	0.77884	CGA	KLF5	-	NULL		0.418	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF5	HGNC	protein_coding	OTTHUMT00000045263.1	G			73636078	+1	no_errors	ENST00000377687	ensembl	human	known	70_37	missense	SNP	1.000	T
KLHL14	57565	genome.wustl.edu	37	18	30350522	30350522	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:30350522G>A	ENST00000359358.4	-	2	471	c.33C>T	c.(31-33)ttC>ttT	p.F11F	KLHL14_ENST00000358095.4_Silent_p.F11F|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	11						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GGCTGGGGTCGAAGGTGGAGG	0.642																																																	0													78.0	56.0	63.0					18																	30350522		2202	4300	6502	SO:0001819	synonymous_variant	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.33C>T	18.37:g.30350522G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F11	ENST00000359358.4	37	c.33	CCDS32813.1	18																																																																																			KLHL14	-	superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin		0.642	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	G			30350522	-1	no_errors	ENST00000359358	ensembl	human	known	70_37	silent	SNP	1.000	A
KRTAP13-3	337960	genome.wustl.edu	37	21	31798199	31798199	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:31798199G>A	ENST00000390690.2	-	1	87	c.32C>T	c.(31-33)tCc>tTc	p.S11F		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	11						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						GGAGCAGGAGGAGAAGTTTCT	0.542																																																	0													87.0	89.0	88.0					21																	31798199		2203	4300	6503	SO:0001583	missense	337960			AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.32C>T	21.37:g.31798199G>A	ENSP00000375109:p.Ser11Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3LI78	Missense_Mutation	SNP	pfam_PMG	p.S11F	ENST00000390690.2	37	c.32	CCDS13591.1	21	.	.	.	.	.	.	.	.	.	.	-	13.57	2.277957	0.40294	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.08984	3.03	4.81	4.81	0.61882	.	0.188870	0.25397	U	0.030978	T	0.27134	0.0665	M	0.78916	2.43	0.24595	N	0.993808	D	0.61697	0.99	D	0.63597	0.916	T	0.02736	-1.1117	10	0.56958	D	0.05	-12.1826	14.0947	0.65013	0.0:0.0:1.0:0.0	.	11	Q3SY46	KR133_HUMAN	F	11	ENSP00000375109:S11F	ENSP00000375109:S11F	S	-	2	0	KRTAP13-3	30720070	1.000000	0.71417	0.770000	0.31555	0.002000	0.02628	2.574000	0.46016	2.592000	0.87571	0.650000	0.86243	TCC	KRTAP13-3	-	pfam_PMG		0.542	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-3	HGNC	protein_coding	OTTHUMT00000128228.2	G			31798199	-1	no_errors	ENST00000390690	ensembl	human	known	70_37	missense	SNP	0.998	A
LCA5L	150082	genome.wustl.edu	37	21	40777909	40777909	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:40777909G>A	ENST00000358268.2	-	10	2440	c.1912C>T	c.(1912-1914)Cag>Tag	p.Q638*	LCA5L_ENST00000288350.3_Nonsense_Mutation_p.Q638*|LCA5L_ENST00000380671.2_Nonsense_Mutation_p.Q638*|LCA5L_ENST00000495240.1_5'UTR|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	638										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				GTGGAGGCCTGACTGGGAGGC	0.443																																																	0													73.0	78.0	76.0					21																	40777909		2203	4300	6503	SO:0001587	stop_gained	150082			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1912C>T	21.37:g.40777909G>A	ENSP00000351008:p.Gln638*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSI0|Q3ZCT0	Nonsense_Mutation	SNP	NULL	p.Q638*	ENST00000358268.2	37	c.1912	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	G	34	5.382617	0.95967	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	.	.	.	4.98	4.98	0.66077	.	0.135219	0.33834	N	0.004516	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.9111	14.1401	0.65313	0.0:0.0:1.0:0.0	.	.	.	.	X	638	.	ENSP00000288350:Q638X	Q	-	1	0	LCA5L	39699779	0.887000	0.30362	0.348000	0.25681	0.105000	0.19272	2.869000	0.48444	2.465000	0.83290	0.655000	0.94253	CAG	LCA5L	-	NULL		0.443	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	G	NM_152505		40777909	-1	no_errors	ENST00000288350	ensembl	human	known	70_37	nonsense	SNP	0.567	A
LCA5L	150082	genome.wustl.edu	37	21	40777980	40777980	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:40777980G>C	ENST00000358268.2	-	10	2369	c.1841C>G	c.(1840-1842)tCa>tGa	p.S614*	LCA5L_ENST00000288350.3_Nonsense_Mutation_p.S614*|LCA5L_ENST00000380671.2_Nonsense_Mutation_p.S614*|LCA5L_ENST00000495240.1_5'UTR|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	614										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				ACCAGGACTTGATTGGTCAGT	0.473																																																	0													95.0	93.0	93.0					21																	40777980		2203	4300	6503	SO:0001587	stop_gained	150082			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1841C>G	21.37:g.40777980G>C	ENSP00000351008:p.Ser614*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSI0|Q3ZCT0	Nonsense_Mutation	SNP	NULL	p.S614*	ENST00000358268.2	37	c.1841	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	G	37	6.230408	0.97394	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	.	.	.	5.05	3.07	0.35406	.	0.922995	0.09143	N	0.842737	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-1.3051	8.5518	0.33455	0.0823:0.2116:0.706:0.0	.	.	.	.	X	614	.	ENSP00000288350:S614X	S	-	2	0	LCA5L	39699850	0.011000	0.17503	0.000000	0.03702	0.003000	0.03518	1.981000	0.40628	0.475000	0.27415	0.655000	0.94253	TCA	LCA5L	-	NULL		0.473	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	G	NM_152505		40777980	-1	no_errors	ENST00000288350	ensembl	human	known	70_37	nonsense	SNP	0.001	C
LCA5L	150082	genome.wustl.edu	37	21	40778144	40778144	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:40778144G>A	ENST00000358268.2	-	10	2205	c.1677C>T	c.(1675-1677)ctC>ctT	p.L559L	LCA5L_ENST00000288350.3_Silent_p.L559L|LCA5L_ENST00000380671.2_Silent_p.L559L|LCA5L_ENST00000495240.1_5'UTR|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	559										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				CTCTGTTACTGAGATGCTTGC	0.478																																																	0													129.0	123.0	125.0					21																	40778144		2203	4300	6503	SO:0001819	synonymous_variant	150082			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1677C>T	21.37:g.40778144G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSI0|Q3ZCT0	Silent	SNP	NULL	p.L559	ENST00000358268.2	37	c.1677	CCDS13665.1	21																																																																																			LCA5L	-	NULL		0.478	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	G	NM_152505		40778144	-1	no_errors	ENST00000288350	ensembl	human	known	70_37	silent	SNP	0.000	A
LINC00243	401247	genome.wustl.edu	37	6	30782146	30782146	+	RNA	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:30782146C>G	ENST00000399196.1	-	0	548									long intergenic non-protein coding RNA 243																		TTGATTTTGTCTGTGGCATCC	0.502																																																	0																																												401247			AK098012		6p21.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000236006	ENSG00000214894		"""Long non-coding RNAs"""	30956	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 214 (putative)"", ""non-protein coding RNA 243"""	C6orf214, NCRNA00243			Standard	XR_159458		Approved	bQB230F21.2, FLJ40693, bQB10J12.2			OTTHUMG00000031539		6.37:g.30782146C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000399196.1	37	NULL		6																																																																																			LINC00243	-	-		0.502	LINC00243-001	KNOWN	basic|exp_conf	processed_transcript	LINC00243	HGNC	processed_transcript	OTTHUMT00000076501.3	C			30782146	-1	no_errors	ENST00000399196	ensembl	human	known	70_37	rna	SNP	0.000	G
LINC00242	401288	genome.wustl.edu	37	6	170190344	170190344	+	lincRNA	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:170190344C>A	ENST00000437615.1	-	0	959				LINC00574_ENST00000420557.2_lincRNA	NR_026781.1		Q5T6M2	CF122_HUMAN	long intergenic non-protein coding RNA 242																		CGCTGCGGGTCCCACAGTGTG	0.602											OREG0017803	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													109.0	90.0	96.0					6																	170190344		692	1591	2283			401288			AK056013		6q28	2012-10-12	2011-08-11	2011-08-11	ENSG00000229214	ENSG00000229214		"""Long non-coding RNAs"""	21249	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 122"", ""non-protein coding RNA 242"""	C6orf122, NCRNA00242			Standard	NR_026781		Approved	FLJ31451, dJ266L20.5	uc003qxj.1	Q5T6M2	OTTHUMG00000016064		6.37:g.170190344C>A		Somatic	1883	WXS	Illumina HiSeq	Phase_IV	Q0VD89|Q96N37	RNA	SNP	-	NULL	ENST00000437615.1	37	NULL		6																																																																																			LINC00242	-	-		0.602	LINC00242-001	KNOWN	basic	lincRNA	LINC00242	HGNC	lincRNA	OTTHUMT00000043231.2	C	NR_026781		170190344	-1	no_errors	ENST00000437615	ensembl	human	known	70_37	rna	SNP	0.000	A
LINC00654	149837	genome.wustl.edu	37	20	5479672	5479672	+	lincRNA	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:5479672C>T	ENST00000379053.4	-	0	3153				RP5-1022P6.7_ENST00000587737.1_lincRNA	NR_015406.1				long intergenic non-protein coding RNA 654																		AGCCCCATttcaagggcttac	0.478																																																	0																																												149837			BC067900		20p12.3	2012-10-12			ENSG00000205181	ENSG00000205181		"""Long non-coding RNAs"""	27154	non-coding RNA	RNA, long non-coding							Standard	NR_015406		Approved		uc002wmc.4		OTTHUMG00000031810		20.37:g.5479672C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000379053.4	37	NULL		20																																																																																			LINC00654	-	-		0.478	LINC00654-001	KNOWN	basic	lincRNA	LINC00654	HGNC	lincRNA	OTTHUMT00000077878.3	C	NR_015406		5479672	-1	no_errors	ENST00000379053	ensembl	human	known	70_37	rna	SNP	0.000	T
LIPK	643414	genome.wustl.edu	37	10	90492212	90492212	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:90492212G>A	ENST00000404190.1	+	5	573	c.573G>A	c.(571-573)aaG>aaA	p.K191K		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	191					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TGGCTAAAAAGATTAAGATAT	0.333																																																	0													126.0	131.0	130.0					10																	90492212		1798	4071	5869	SO:0001819	synonymous_variant	643414				CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.573G>A	10.37:g.90492212G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7KIH8	Silent	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.K191	ENST00000404190.1	37	c.573	CCDS44455.1	10																																																																																			LIPK	-	pfam_AB_hydrolase_1		0.333	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPK	HGNC	protein_coding	OTTHUMT00000049253.2	G	XM_061222		90492212	+1	no_errors	ENST00000404190	ensembl	human	known	70_37	silent	SNP	0.996	A
LPPR5	163404	genome.wustl.edu	37	1	99469973	99469973	+	Intron	SNP	G	G	A	rs547682104		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:99469973G>A	ENST00000263177.4	-	1	459				LPPR5_ENST00000370188.3_Intron|RP5-896L10.1_ENST00000425113.1_RNA|LPPR5_ENST00000534652.1_Intron	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN								integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										CGACGAGGGCGAGCGCCCCCG	0.697																																																	0													7.0	9.0	8.0					1																	99469973		2156	4220	6376	SO:0001627	intron_variant	100129620																														ENST00000263177.4:c.237+17C>T	1.37:g.99469973G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	RNA	SNP	-	NULL	ENST00000263177.4	37	NULL	CCDS30778.1	1																																																																																			RP5-896L10.1	-	-		0.697	LPPR5-002	KNOWN	basic|CCDS	protein_coding	LOC100129620	Clone_based_vega_gene	protein_coding	OTTHUMT00000393221.1	G			99469973	+1	no_errors	ENST00000425113	ensembl	human	known	70_37	rna	SNP	0.001	A
LONP1	9361	genome.wustl.edu	37	19	5696116	5696116	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:5696116C>G	ENST00000360614.3	-	13	2119	c.1962G>C	c.(1960-1962)gaG>gaC	p.E654D	LONP1_ENST00000540670.2_Missense_Mutation_p.E458D|LONP1_ENST00000590729.1_Missense_Mutation_p.E524D|LONP1_ENST00000585374.1_Missense_Mutation_p.E540D|LONP1_ENST00000593119.1_Missense_Mutation_p.E590D	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGTTGATCATCTCCATACGGT	0.677																																																	0													59.0	51.0	54.0					19																	5696116		2203	4300	6503	SO:0001583	missense	9361			U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1962G>C	19.37:g.5696116C>G	ENSP00000353826:p.Glu654Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Prk_AAA_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Pept_S16_lon	p.E654D	ENST00000360614.3	37	c.1962	CCDS12148.1	19	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955109	0.53293	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	D;D	0.92048	-2.96;-2.96	4.67	3.59	0.41128	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.109437	0.64402	D	0.000012	D	0.94608	0.8262	M	0.67569	2.06	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.983;0.988	D	0.93852	0.7146	10	0.54805	T	0.06	-23.8954	11.4742	0.50288	0.1815:0.8185:0.0:0.0	.	654;590;654	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	D	654;618;458	ENSP00000353826:E654D;ENSP00000441523:E458D	ENSP00000351177:E618D	E	-	3	2	LONP1	5647116	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	2.750000	0.47500	0.886000	0.36113	0.491000	0.48974	GAG	LONP1	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_Pept_S16_lon		0.677	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP1	HGNC	protein_coding	OTTHUMT00000451662.1	C	NM_004793		5696116	-1	no_errors	ENST00000360614	ensembl	human	known	70_37	missense	SNP	1.000	G
LRP5L	91355	genome.wustl.edu	37	22	25756029	25756029	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:25756029C>T	ENST00000402785.2	-	1	127	c.31G>A	c.(31-33)Gag>Aag	p.E11K	LRP5L_ENST00000444995.3_Missense_Mutation_p.E11K|LRP5L_ENST00000402859.2_Missense_Mutation_p.E11K			A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein 5-like	11					canonical Wnt signaling pathway (GO:0060070)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)		Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	6						GCCCACACCTCGTCATCCGTC	0.592																																																	0													114.0	88.0	97.0					22																	25756029		2200	4300	6500	SO:0001583	missense	91355			AL137651	CCDS33626.1	22q11.23	2013-05-30			ENSG00000100068	ENSG00000100068			25323	protein-coding gene	gene with protein product							Standard	NM_182492		Approved	DKFZp434O0213	uc011ajz.2	A4QPB2	OTTHUMG00000150900	ENST00000402785.2:c.31G>A	22.37:g.25756029C>T	ENSP00000384562:p.Glu11Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYF3|B0QYF4|B2RPI5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	p.E11K	ENST00000402785.2	37	c.31	CCDS33626.1	22	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582868	0.28268	.	.	ENSG00000100068	ENST00000402859;ENST00000444995;ENST00000402785	D;D;D	0.91068	-2.78;-2.78;-2.78	2.12	2.12	0.27331	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.86793	0.6018	M	0.61703	1.905	0.46185	D	0.998916	D;P	0.55605	0.972;0.62	B;B	0.40741	0.339;0.051	D	0.84894	0.0838	9	0.35671	T	0.21	.	10.3412	0.43879	0.0:1.0:0.0:0.0	.	11;11	A4QPB2-2;A4QPB2	.;LRP5L_HUMAN	K	11	ENSP00000384291:E11K;ENSP00000407283:E11K;ENSP00000384562:E11K	ENSP00000384562:E11K	E	-	1	0	LRP5L	24086029	1.000000	0.71417	0.989000	0.46669	0.103000	0.19146	6.746000	0.74866	1.488000	0.48433	0.194000	0.17425	GAG	LRP5L	-	pfscan_LDLR_classB_rpt		0.592	LRP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5L	HGNC	protein_coding	OTTHUMT00000320477.2	C	NM_182492		25756029	-1	no_errors	ENST00000402785	ensembl	human	known	70_37	missense	SNP	1.000	T
LRPPRC	10128	genome.wustl.edu	37	2	44145397	44145397	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:44145397C>T	ENST00000260665.7	-	28	3094	c.3037G>A	c.(3037-3039)Gag>Aag	p.E1013K		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	1013					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAATTACCTCAGGTACGTCA	0.313																																																	0													103.0	113.0	110.0					2																	44145397		2203	4300	6503	SO:0001583	missense	10128			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.3037G>A	2.37:g.44145397C>T	ENSP00000260665:p.Glu1013Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.E1013K	ENST00000260665.7	37	c.3037	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393203	0.42410	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.56611	0.45	5.84	4.78	0.61160	.	0.175397	0.50627	D	0.000112	T	0.44117	0.1278	L	0.53729	1.69	0.80722	D	1	B;B	0.21071	0.048;0.051	B;B	0.21360	0.034;0.022	T	0.28202	-1.0051	10	0.06891	T	0.86	-7.4028	13.5404	0.61671	0.0:0.884:0.0:0.116	.	913;1013	F5H4J6;P42704	.;LPPRC_HUMAN	K	913;1013	ENSP00000260665:E1013K	ENSP00000260665:E1013K	E	-	1	0	LRPPRC	43998901	0.646000	0.27295	0.999000	0.59377	0.991000	0.79684	0.968000	0.29357	2.764000	0.94973	0.655000	0.94253	GAG	LRPPRC	-	NULL		0.313	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	C	NM_133259		44145397	-1	no_errors	ENST00000260665	ensembl	human	known	70_37	missense	SNP	0.958	T
MAATS1	89876	genome.wustl.edu	37	3	119434565	119434565	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:119434565C>T	ENST00000273390.5	+	6	734	c.657C>T	c.(655-657)ctC>ctT	p.L219L	MAATS1_ENST00000463700.1_Silent_p.L219L	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	219						mitochondrion (GO:0005739)											TCCCTGAGCTCTTGACCCTGG	0.478																																																	0													129.0	115.0	120.0					3																	119434565		2203	4300	6503	SO:0001819	synonymous_variant	89876			AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.657C>T	3.37:g.119434565C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Silent	SNP	superfamily_S-AdoMet_deCO2ase_core	p.L219	ENST00000273390.5	37	c.657	CCDS2994.1	3																																																																																			MAATS1	-	NULL		0.478	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAATS1	HGNC	protein_coding	OTTHUMT00000355222.1	C	NM_033364		119434565	+1	no_errors	ENST00000273390	ensembl	human	known	70_37	silent	SNP	0.728	T
MAN1B1	11253	genome.wustl.edu	37	9	140002950	140002950	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:140002950C>G	ENST00000371589.4	+	13	2080	c.2007C>G	c.(2005-2007)ttC>ttG	p.F669L	MAN1B1_ENST00000474902.1_Missense_Mutation_p.F372L|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	669					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		AGTATCTGTTCTTGCTCTTCT	0.552																																																	0													222.0	219.0	220.0					9																	140002950		2203	4300	6503	SO:0001583	missense	11253			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.2007C>G	9.37:g.140002950C>G	ENSP00000360645:p.Phe669Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.F669L	ENST00000371589.4	37	c.2007	CCDS7029.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.99|13.99	2.400607|2.400607	0.42613|0.42613	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000371589;ENST00000474902|ENST00000550113	D;D|.	0.83335|.	-1.71;-1.71|.	5.44|5.44	-0.457|-0.457	0.12186|0.12186	.|.	.|.	.|.	.|.	.|.	T|T	0.57315|0.57315	0.2045|0.2045	L|L	0.52905|0.52905	1.665|1.665	0.38503|0.38503	D|D	0.94827|0.94827	D;P|.	0.56287|.	0.975;0.769|.	P;B|.	0.56823|.	0.807;0.336|.	T|T	0.55805|0.55805	-0.8083|-0.8083	8|5	.|.	.|.	.|.	.|.	10.3239|10.3239	0.43781|0.43781	0.0:0.4788:0.0:0.5212|0.0:0.4788:0.0:0.5212	.|.	342;669|.	B3KXZ1;Q9UKM7|.	.;MA1B1_HUMAN|.	L|V	669;372|94	ENSP00000360645:F669L;ENSP00000447256:F372L|.	.|.	F|L	+|+	3|1	2|0	MAN1B1|MAN1B1	139122771|139122771	0.972000|0.972000	0.33761|0.33761	0.972000|0.972000	0.41901|0.41901	0.425000|0.425000	0.31504|0.31504	0.309000|0.309000	0.19332|0.19332	-0.001000|-0.001000	0.14495|0.14495	0.561000|0.561000	0.74099|0.74099	TTC|CTT	MAN1B1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47		0.552	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	C	NM_016219		140002950	+1	no_errors	ENST00000371589	ensembl	human	known	70_37	missense	SNP	0.981	G
MAP1A	4130	genome.wustl.edu	37	15	43821015	43821015	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:43821015C>T	ENST00000300231.5	+	4	7794	c.7344C>T	c.(7342-7344)ctC>ctT	p.L2448L	MAP1A_ENST00000399453.1_Silent_p.L2448L|MAP1A_ENST00000382031.1_Silent_p.L2686L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2448					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GTGGGGAGCTCTCCCCATCCT	0.667																																																	0													30.0	34.0	33.0					15																	43821015		1958	4144	6102	SO:0001819	synonymous_variant	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7344C>T	15.37:g.43821015C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	NULL	p.L2448	ENST00000300231.5	37	c.7344	CCDS42031.1	15																																																																																			MAP1A	-	NULL		0.667	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	C	NM_002373		43821015	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	silent	SNP	0.996	T
MAPK9	5601	genome.wustl.edu	37	5	179668047	179668047	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:179668047G>T	ENST00000452135.2	-	9	1278	c.980C>A	c.(979-981)cCc>cAc	p.P327H	MAPK9_ENST00000524170.1_5'Flank|MAPK9_ENST00000393360.3_Missense_Mutation_p.P327H|MAPK9_ENST00000343111.6_Missense_Mutation_p.P327H|MAPK9_ENST00000455781.1_Missense_Mutation_p.P327H|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000347470.4_Missense_Mutation_p.P242H			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	327					cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)	p.P327H(3)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCTTCGGCGGGGTCATACCA	0.458																																																	3	Substitution - Missense(3)	lung(3)											165.0	179.0	174.0					5																	179668047		2203	4300	6503	SO:0001583	missense	5601			U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.980C>A	5.37:g.179668047G>T	ENSP00000394560:p.Pro327His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	p.P327H	ENST00000452135.2	37	c.980	CCDS4453.1	5	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954039	0.53293	.	.	ENSG00000050748	ENST00000452135;ENST00000393360;ENST00000455781;ENST00000343111;ENST00000347470	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.22	5.22	0.72569	Protein kinase-like domain (1);	0.061993	0.64402	D	0.000003	D	0.91338	0.7268	M	0.88640	2.97	0.80722	D	1	D;D;D;D	0.63046	0.97;0.97;0.97;0.992	P;P;P;P	0.57324	0.818;0.818;0.746;0.8	D	0.93041	0.6457	10	0.87932	D	0	-9.8013	18.7966	0.91997	0.0:0.0:1.0:0.0	.	327;327;327;327	P45984-4;P45984-3;P45984-2;P45984	.;.;.;MK09_HUMAN	H	327;327;327;327;242	ENSP00000394560:P327H;ENSP00000377028:P327H;ENSP00000389338:P327H;ENSP00000345524:P327H;ENSP00000321410:P242H	ENSP00000345524:P327H	P	-	2	0	MAPK9	179600653	1.000000	0.71417	0.653000	0.29593	0.005000	0.04900	9.670000	0.98625	2.430000	0.82344	0.557000	0.71058	CCC	MAPK9	-	superfamily_Kinase-like_dom,prints_MAPK_JNK		0.458	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK9	HGNC	protein_coding	OTTHUMT00000253530.3	G			179668047	-1	no_errors	ENST00000452135	ensembl	human	known	70_37	missense	SNP	1.000	T
MAST3	23031	genome.wustl.edu	37	19	18239690	18239690	+	Silent	SNP	C	C	T	rs377695566		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:18239690C>T	ENST00000262811.6	+	12	1065	c.1065C>T	c.(1063-1065)gtC>gtT	p.V355V	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	355							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						GCGCCCTGGTCGGCCAGTCAC	0.607																																																	0								C		0,4008		0,0,2004	66.0	71.0	69.0		1065	-9.4	0.0	19		69	1,8337		0,1,4168	no	coding-synonymous	MAST3	NM_015016.1		0,1,6172	TT,TC,CC		0.012,0.0,0.0081		355/1310	18239690	1,12345	2004	4169	6173	SO:0001819	synonymous_variant	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.1065C>T	19.37:g.18239690C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7LDZ8|Q9UPI0	Silent	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.V355	ENST00000262811.6	37	c.1065	CCDS46014.1	19																																																																																			MAST3	-	NULL		0.607	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	C	XM_038150		18239690	+1	no_errors	ENST00000262811	ensembl	human	known	70_37	silent	SNP	0.000	T
MAU2	23383	genome.wustl.edu	37	19	19452111	19452111	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:19452111C>G	ENST00000392313.6	+	7	809	c.630C>G	c.(628-630)ctC>ctG	p.L210L	MAU2_ENST00000262815.8_Silent_p.L210L	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	210					maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						TGCTGACCCTCTGCGGGCAGA	0.642																																																	0													40.0	47.0	45.0					19																	19452111		2068	4209	6277	SO:0001819	synonymous_variant	23383			AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.630C>G	19.37:g.19452111C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Silent	SNP	pfam_Cohesin_loading_factor,smart_TPR_repeat	p.L210	ENST00000392313.6	37	c.630	CCDS32969.2	19																																																																																			MAU2	-	pfam_Cohesin_loading_factor		0.642	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAU2	HGNC	protein_coding	OTTHUMT00000316748.6	C	NM_015329		19452111	+1	no_errors	ENST00000262815	ensembl	human	known	70_37	silent	SNP	1.000	G
MBNL1	4154	genome.wustl.edu	37	3	152017352	152017352	+	5'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:152017352G>A	ENST00000282486.6	+	0	1212				MBNL1_ENST00000485910.1_5'Flank|MBNL1_ENST00000324210.5_5'UTR|MBNL1_ENST00000461436.1_3'UTR|MBNL1_ENST00000357472.3_5'UTR|MBNL1_ENST00000324196.5_5'UTR|MBNL1_ENST00000498502.1_5'UTR|MBNL1_ENST00000355460.2_5'UTR|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000492948.1_5'Flank|MBNL1_ENST00000282488.7_5'UTR|MBNL1_ENST00000463374.1_5'Flank|MBNL1_ENST00000485509.1_5'Flank|MBNL1_ENST00000545754.1_5'UTR			Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTATAATCAAGAGAAAAGCTC	0.453																																																	0																																										SO:0001623	5_prime_UTR_variant	4154			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000282486.6:c.-631G>A	3.37:g.152017352G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	RNA	SNP	-	NULL	ENST00000282486.6	37	NULL	CCDS3165.1	3																																																																																			MBNL1	-	-		0.453	MBNL1-201	KNOWN	basic|CCDS	protein_coding	MBNL1	HGNC	protein_coding		G	NM_021038		152017352	+1	no_errors	ENST00000461436	ensembl	human	putative	70_37	rna	SNP	1.000	A
MBOAT7	79143	genome.wustl.edu	37	19	54691159	54691159	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:54691159C>T	ENST00000245615.1	-	4	697	c.217G>A	c.(217-219)Gcc>Acc	p.A73T	MBOAT7_ENST00000391754.1_Missense_Mutation_p.A73T|MBOAT7_ENST00000338624.6_Intron|TSEN34_ENST00000302937.4_5'Flank|TSEN34_ENST00000429671.2_5'Flank|MBOAT7_ENST00000474910.1_5'UTR|MBOAT7_ENST00000431666.2_Intron	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	73					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AGAGCCAGGGCGTGGCAGGAG	0.632																																					NSCLC(97;826 2151 10470 22540)												0													50.0	59.0	56.0					19																	54691159		2195	4299	6494	SO:0001583	missense	79143			AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.217G>A	19.37:g.54691159C>T	ENSP00000245615:p.Ala73Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	pfam_MBOAT_fam	p.A73T	ENST00000245615.1	37	c.217	CCDS12883.1	19	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622580	0.28889	.	.	ENSG00000125505	ENST00000245615;ENST00000449249;ENST00000391754;ENST00000414665;ENST00000453320	T;T;T	0.43688	2.24;1.52;0.94	3.89	1.52	0.23074	.	0.145782	0.45126	D	0.000398	T	0.25005	0.0607	L	0.34521	1.04	0.29001	N	0.887448	B;B	0.11235	0.004;0.002	B;B	0.10450	0.005;0.003	T	0.09292	-1.0681	10	0.22109	T	0.4	-12.3691	4.8863	0.13704	0.3973:0.4901:0.0:0.1125	.	55;73	B4DDH8;Q96N66	.;MBOA7_HUMAN	T	73;25;73;73;73	ENSP00000245615:A73T;ENSP00000375634:A73T;ENSP00000388250:A73T	ENSP00000245615:A73T	A	-	1	0	MBOAT7	59382971	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.820000	0.27323	0.782000	0.33613	0.650000	0.86243	GCC	MBOAT7	-	NULL		0.632	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT7	HGNC	protein_coding	OTTHUMT00000142203.1	C	NM_024298		54691159	-1	no_errors	ENST00000245615	ensembl	human	known	70_37	missense	SNP	0.995	T
MDN1	23195	genome.wustl.edu	37	6	90435005	90435005	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:90435005C>G	ENST00000369393.3	-	38	5698	c.5583G>C	c.(5581-5583)aaG>aaC	p.K1861N	MDN1_ENST00000428876.1_Missense_Mutation_p.K1861N			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1861					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAATCTTCGTCTTTTCATGCT	0.448																																																	0													133.0	124.0	127.0					6																	90435005		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5583G>C	6.37:g.90435005C>G	ENSP00000358400:p.Lys1861Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K1861N	ENST00000369393.3	37	c.5583	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710708	0.48517	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.35789	1.29;1.29	5.88	4.1	0.47936	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.06096	0.0158	N	0.03000	-0.44	0.46954	D	0.99926	B	0.17852	0.024	B	0.24006	0.05	T	0.19877	-1.0292	10	0.11182	T	0.66	.	12.5401	0.56165	0.0:0.865:0.0:0.135	.	1861	Q9NU22	MDN1_HUMAN	N	1861	ENSP00000358400:K1861N;ENSP00000413970:K1861N	ENSP00000358400:K1861N	K	-	3	2	MDN1	90491726	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.686000	0.37669	0.822000	0.34565	0.591000	0.81541	AAG	MDN1	-	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,smart_AAA+_ATPase,pirsf_Midasin		0.448	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	C			90435005	-1	no_errors	ENST00000369393	ensembl	human	known	70_37	missense	SNP	1.000	G
MED13	9969	genome.wustl.edu	37	17	60039009	60039009	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:60039009C>T	ENST00000397786.2	-	22	5272	c.5196G>A	c.(5194-5196)gtG>gtA	p.V1732V		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1732					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TCAATGTTTTCACATTGGTTG	0.423																																																	0													121.0	120.0	120.0					17																	60039009		1878	4100	5978	SO:0001819	synonymous_variant	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5196G>A	17.37:g.60039009C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU05|O60334	Silent	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.V1732	ENST00000397786.2	37	c.5196	CCDS42366.1	17																																																																																			MED13	-	pfam_Mediator_Med13		0.423	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	C	NM_005121		60039009	-1	no_errors	ENST00000397786	ensembl	human	known	70_37	silent	SNP	0.992	T
MEF2D	4209	genome.wustl.edu	37	1	156437234	156437234	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:156437234C>T	ENST00000348159.4	-	0	2249				MEF2D_ENST00000464356.2_3'UTR|MEF2D_ENST00000360595.3_3'UTR|MEF2D_ENST00000368240.2_3'UTR|MEF2D_ENST00000353795.3_3'UTR|MEF2D_ENST00000340875.5_3'UTR	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D						adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCATCCCCCTCTCCAAAGCGA	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	4209			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.*203G>A	1.37:g.156437234C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVC0|Q14815|Q5T9U5|Q5T9U6	RNA	SNP	-	NULL	ENST00000348159.4	37	NULL	CCDS1143.1	1																																																																																			MEF2D	-	-		0.418	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	C	NM_005920		156437234	-1	no_errors	ENST00000464356	ensembl	human	known	70_37	rna	SNP	1.000	T
MEI1	150365	genome.wustl.edu	37	22	42128517	42128517	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:42128517G>C	ENST00000401548.3	+	11	1281	c.1241G>C	c.(1240-1242)aGa>aCa	p.R414T	MEI1_ENST00000400107.1_5'UTR|MEI1_ENST00000540833.1_Missense_Mutation_p.R154T|MEI1_ENST00000300398.4_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCCATGTGCAGAGATGCTGGC	0.552																																																	0													71.0	73.0	72.0					22																	42128517		2107	4236	6343	SO:0001583	missense	150365			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.1241G>C	22.37:g.42128517G>C	ENSP00000384115:p.Arg414Thr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R414T	ENST00000401548.3	37	c.1241	CCDS46718.1	22	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390853	0.42410	.	.	ENSG00000167077	ENST00000401548;ENST00000540833	T;T	0.44881	1.91;0.91	5.74	3.44	0.39384	Armadillo-like helical (1);Armadillo-type fold (1);	0.714131	0.13920	N	0.353609	T	0.33000	0.0848	L	0.56769	1.78	0.45035	D	0.998057	P;P	0.38504	0.61;0.634	B;B	0.32864	0.154;0.124	T	0.16012	-1.0417	10	0.39692	T	0.17	-3.7566	5.5857	0.17274	0.0983:0.1415:0.6158:0.1445	.	414;414	Q5TIA1;Q5TIA1-4	MEI1_HUMAN;.	T	414;154	ENSP00000384115:R414T;ENSP00000444225:R154T	ENSP00000384115:R414T	R	+	2	0	MEI1	40458463	0.479000	0.25925	0.779000	0.31741	0.976000	0.68499	0.619000	0.24388	1.373000	0.46208	0.563000	0.77884	AGA	MEI1	-	superfamily_ARM-type_fold		0.552	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3	G	NM_152513		42128517	+1	no_errors	ENST00000401548	ensembl	human	known	70_37	missense	SNP	0.662	C
MGEA5	10724	genome.wustl.edu	37	10	103577777	103577777	+	Start_Codon_SNP	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:103577777C>T	ENST00000361464.3	-	1	398	c.3G>A	c.(1-3)atG>atA	p.M1I	MGEA5_ENST00000439817.1_Start_Codon_SNP_p.M1I|MGEA5_ENST00000357797.5_Start_Codon_SNP_p.M1I|MGEA5_ENST00000370094.3_Start_Codon_SNP_p.M1I|KCNIP2-AS1_ENST00000412353.1_RNA|MGEA5_ENST00000419011.2_Start_Codon_SNP_p.M1I	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	1					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		CCTTCTGCACCATCCTCCTGC	0.701																																																	0													14.0	13.0	13.0					10																	103577777		2198	4294	6492	SO:0001582	initiator_codon_variant	10724			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.3G>A	10.37:g.103577777C>T	ENSP00000354850:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF,superfamily_Acyl_CoA_acyltransferase	p.M1I	ENST00000361464.3	37	c.3	CCDS7520.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.173869	0.94807	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797;ENST00000370094;ENST00000419011	T;T;T;T;T	0.52057	1.49;1.55;1.5;1.52;0.68	4.83	4.83	0.62350	.	0.044184	0.85682	D	0.000000	T	0.63908	0.2551	.	.	.	0.80722	D	1	P;P;P;P	0.39044	0.525;0.656;0.656;0.525	B;P;P;P	0.51777	0.38;0.584;0.679;0.48	T	0.67937	-0.5541	9	0.87932	D	0	-13.6105	17.7241	0.88360	0.0:1.0:0.0:0.0	.	1;1;1;1	E9PGF9;O60502-2;O60502-3;O60502	.;.;.;NCOAT_HUMAN	I	1	ENSP00000409973:M1I;ENSP00000354850:M1I;ENSP00000350445:M1I;ENSP00000359112:M1I;ENSP00000407081:M1I	ENSP00000350445:M1I	M	-	3	0	MGEA5	103567767	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.196000	0.65136	2.496000	0.84212	0.561000	0.74099	ATG	MGEA5	-	NULL		0.701	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	HGNC	protein_coding	OTTHUMT00000049987.1	C	NM_012215	Missense_Mutation	103577777	-1	no_errors	ENST00000361464	ensembl	human	known	70_37	missense	SNP	1.000	T
MGRN1	23295	genome.wustl.edu	37	16	4674988	4674988	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:4674988C>G	ENST00000399577.5	+	1	120	c.27C>G	c.(25-27)atC>atG	p.I9M	MGRN1_ENST00000415496.1_Missense_Mutation_p.I9M|MGRN1_ENST00000588994.1_Missense_Mutation_p.I9M|MGRN1_ENST00000262370.7_Missense_Mutation_p.I9M|MGRN1_ENST00000586183.1_Missense_Mutation_p.I9M	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	9					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						GCCGCCGCATCGCGGGGGTGG	0.736																																																	0													14.0	19.0	17.0					16																	4674988		1942	4117	6059	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.27C>G	16.37:g.4674988C>G	ENSP00000382487:p.Ile9Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.I9M	ENST00000399577.5	37	c.27	CCDS45402.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000017	0.74818	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	3.97	0.573	0.17363	.	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	L	0.47716	1.5	0.50039	D	0.999848	D;D;D;D;D;D	0.89917	1.0;0.999;0.977;0.998;0.999;1.0	D;D;P;D;D;D	0.91635	0.999;0.98;0.772;0.956;0.974;0.999	T	0.12066	-1.0562	10	0.34782	T	0.22	-18.137	5.4289	0.16442	0.0:0.6276:0.1606:0.2118	.	9;9;9;9;9;9	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	M	9	ENSP00000262370:I9M;ENSP00000382487:I9M;ENSP00000393311:I9M;ENSP00000443810:I9M	ENSP00000262370:I9M	I	+	3	3	MGRN1	4614989	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	1.459000	0.35234	-0.039000	0.13602	-0.339000	0.08088	ATC	MGRN1	-	NULL		0.736	MGRN1-004	KNOWN	basic|CCDS	protein_coding	MGRN1	HGNC	protein_coding	OTTHUMT00000432060.2	C			4674988	+1	no_errors	ENST00000262370	ensembl	human	known	70_37	missense	SNP	1.000	G
TRRAP	8295	genome.wustl.edu	37	7	98479347	98479347	+	Intron	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:98479347G>A	ENST00000359863.4	+	3	309				TRRAP_ENST00000446306.3_Intron|TRRAP_ENST00000355540.3_Intron|MIR3609_ENST00000582661.1_RNA	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein						chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ATACTGGCTGGAGCCCCAAAG	0.423																																																	0																																										SO:0001627	intron_variant	100500819			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.101-251G>A	7.37:g.98479347G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	RNA	SNP	-	NULL	ENST00000359863.4	37	NULL	CCDS59066.1	7																																																																																			MIR3609	-	-		0.423	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR3609	HGNC	protein_coding	OTTHUMT00000317978.1	G	NM_003496		98479347	+1	no_errors	ENST00000582661	ensembl	human	known	70_37	rna	SNP	1.000	A
MLH3	27030	genome.wustl.edu	37	14	75516266	75516266	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:75516266G>A	ENST00000556740.1	-	1	128	c.93C>T	c.(91-93)ctC>ctT	p.L31L	MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Silent_p.L31L|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000355774.2_Silent_p.L31L|MLH3_ENST00000238662.7_Silent_p.L31L			Q9UHC1	MLH3_HUMAN	mutL homolog 3	31					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		CAATACTGTTGAGGGCAAGTT	0.453								Mismatch excision repair (MMR)																																									0													99.0	91.0	93.0					14																	75516266		2203	4300	6503	SO:0001819	synonymous_variant	27030			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.93C>T	14.37:g.75516266G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P49751|Q56DK9|Q9P292|Q9UHC0	Silent	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_WW_Rsp5_WWP,smart_MutL_C	p.L31	ENST00000556740.1	37	c.93	CCDS32123.1	14																																																																																			MLH3	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd		0.453	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH3	HGNC	protein_coding	OTTHUMT00000415006.1	G	NM_014381		75516266	-1	no_errors	ENST00000355774	ensembl	human	known	70_37	silent	SNP	0.997	A
KMT2D	8085	genome.wustl.edu	37	12	49434544	49434544	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49434544G>C	ENST00000301067.7	-	31	7008	c.7009C>G	c.(7009-7011)Cag>Gag	p.Q2337E		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2337	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGCTCTACCTGAGATGCCCGA	0.627																																																	0													19.0	22.0	21.0					12																	49434544		1838	4075	5913	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7009C>G	12.37:g.49434544G>C	ENSP00000301067:p.Gln2337Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q2337E	ENST00000301067.7	37	c.7009	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885709	0.33255	.	.	ENSG00000167548	ENST00000301067	T	0.79749	-1.3	5.07	5.07	0.68467	.	0.000000	0.36409	N	0.002604	D	0.83046	0.5169	L	0.43152	1.355	0.46823	D	0.999213	D	0.67145	0.996	P	0.54499	0.754	D	0.85287	0.1065	10	0.87932	D	0	.	17.611	0.88053	0.0:0.0:1.0:0.0	.	2337	O14686	MLL2_HUMAN	E	2337	ENSP00000301067:Q2337E	ENSP00000301067:Q2337E	Q	-	1	0	MLL2	47720811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.603000	0.54074	2.536000	0.85505	0.655000	0.94253	CAG	MLL2	-	NULL		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49434544	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	C
KMT2D	8085	genome.wustl.edu	37	12	49434618	49434618	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49434618G>C	ENST00000301067.7	-	31	6934	c.6935C>G	c.(6934-6936)tCa>tGa	p.S2312*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2312	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTGGGTGCCTGAGGAGGGTGA	0.617																																																	0													23.0	26.0	25.0					12																	49434618		1852	4094	5946	SO:0001587	stop_gained	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6935C>G	12.37:g.49434618G>C	ENSP00000301067:p.Ser2312*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.S2312*	ENST00000301067.7	37	c.6935	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	46	12.322416	0.99657	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.07	4.13	0.48395	.	0.279394	0.19474	N	0.113377	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.2569	0.37588	0.0:0.1543:0.6872:0.1584	.	.	.	.	X	2312	.	ENSP00000301067:S2312X	S	-	2	0	MLL2	47720885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.197000	0.51028	2.536000	0.85505	0.655000	0.94253	TCA	MLL2	-	NULL		0.617	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49434618	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	nonsense	SNP	1.000	C
KMT2D	8085	genome.wustl.edu	37	12	49435470	49435470	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49435470G>A	ENST00000301067.7	-	30	6201	c.6202C>T	c.(6202-6204)Cgg>Tgg	p.R2068W		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2068					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGAGCTGCCCGGTTATCTTTG	0.582																																																	0													65.0	70.0	69.0					12																	49435470		2039	4190	6229	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6202C>T	12.37:g.49435470G>A	ENSP00000301067:p.Arg2068Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R2068W	ENST00000301067.7	37	c.6202	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	9.879	1.200969	0.22121	.	.	ENSG00000167548	ENST00000301067	D	0.94457	-3.43	4.94	4.04	0.47022	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (2);	0.230369	0.22435	N	0.060085	D	0.96886	0.8983	M	0.78344	2.41	0.49915	D	0.999833	D	0.89917	1.0	D	0.91635	0.999	D	0.97303	0.9932	10	0.87932	D	0	.	14.2147	0.65786	0.0:0.0:0.8486:0.1514	.	2068	O14686	MLL2_HUMAN	W	2068	ENSP00000301067:R2068W	ENSP00000301067:R2068W	R	-	1	2	MLL2	47721737	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.383000	0.52471	1.383000	0.46405	0.561000	0.74099	CGG	MLL2	-	superfamily_HMG_superfamily,smart_HMG_superfamily		0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49435470	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49438611	49438611	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49438611C>T	ENST00000301067.7	-	19	4878	c.4879G>A	c.(4879-4881)Gag>Aag	p.E1627K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1627					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCAGAACCCTCCAATCCTGCC	0.602																																																	0													81.0	88.0	86.0					12																	49438611		2084	4209	6293	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4879G>A	12.37:g.49438611C>T	ENSP00000301067:p.Glu1627Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E1627K	ENST00000301067.7	37	c.4879	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432509	0.62844	.	.	ENSG00000167548	ENST00000301067	T	0.79033	-1.23	5.81	5.81	0.92471	.	0.000000	0.36854	N	0.002374	T	0.67078	0.2855	N	0.22421	0.69	0.48341	D	0.999631	P	0.38922	0.651	B	0.32677	0.15	T	0.72218	-0.4357	10	0.87932	D	0	.	18.854	0.92244	0.0:1.0:0.0:0.0	.	1627	O14686	MLL2_HUMAN	K	1627	ENSP00000301067:E1627K	ENSP00000301067:E1627K	E	-	1	0	MLL2	47724878	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	6.540000	0.73861	2.746000	0.94184	0.655000	0.94253	GAG	MLL2	-	NULL		0.602	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49438611	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49440150	49440150	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49440150C>T	ENST00000301067.7	-	16	4475	c.4476G>A	c.(4474-4476)caG>caA	p.Q1492Q		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1492	Cys-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGTAACTATTCTGCCATTCAC	0.547																																																	0													98.0	108.0	105.0					12																	49440150		2138	4245	6383	SO:0001819	synonymous_variant	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4476G>A	12.37:g.49440150C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q1492	ENST00000301067.7	37	c.4476	CCDS44873.1	12																																																																																			MLL2	-	NULL		0.547	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49440150	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	silent	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49442510	49442510	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49442510C>T	ENST00000301067.7	-	13	4062	c.4063G>A	c.(4063-4065)Gaa>Aaa	p.E1355K		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1355	Poly-Glu.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCATCATCTTCTTCCTCCTCC	0.478																																																	0													250.0	251.0	251.0					12																	49442510		2046	4187	6233	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4063G>A	12.37:g.49442510C>T	ENSP00000301067:p.Glu1355Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E1355K	ENST00000301067.7	37	c.4063	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287255	0.59867	.	.	ENSG00000167548	ENST00000301067	D	0.81579	-1.51	5.92	5.92	0.95590	Zinc finger, FYVE/PHD-type (1);	0.495843	0.15002	N	0.286070	T	0.74839	0.3769	L	0.38175	1.15	0.80722	D	1	P	0.34562	0.457	B	0.27608	0.081	T	0.75436	-0.3318	10	0.87932	D	0	.	19.0866	0.93204	0.0:1.0:0.0:0.0	.	1355	O14686	MLL2_HUMAN	K	1355	ENSP00000301067:E1355K	ENSP00000301067:E1355K	E	-	1	0	MLL2	47728777	0.995000	0.38212	0.747000	0.31113	0.778000	0.44026	3.279000	0.51670	2.809000	0.96659	0.467000	0.42956	GAA	MLL2	-	superfamily_Znf_FYVE_PHD		0.478	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49442510	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49442540	49442540	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49442540C>G	ENST00000301067.7	-	13	4032	c.4033G>C	c.(4033-4035)Gat>Cat	p.D1345H		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1345					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGAGAGCTATCAATGTCAGCA	0.473																																																	0													179.0	177.0	178.0					12																	49442540		2028	4180	6208	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4033G>C	12.37:g.49442540C>G	ENSP00000301067:p.Asp1345His	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D1345H	ENST00000301067.7	37	c.4033	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601685	0.28534	.	.	ENSG00000167548	ENST00000301067	T	0.81163	-1.46	5.92	5.92	0.95590	Zinc finger, FYVE/PHD-type (1);	0.000000	0.36628	N	0.002484	D	0.84361	0.5455	L	0.32530	0.975	0.42490	D	0.992893	D	0.67145	0.996	P	0.61800	0.894	D	0.85678	0.1299	10	0.87932	D	0	.	19.0866	0.93204	0.0:1.0:0.0:0.0	.	1345	O14686	MLL2_HUMAN	H	1345	ENSP00000301067:D1345H	ENSP00000301067:D1345H	D	-	1	0	MLL2	47728807	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	5.195000	0.65131	2.809000	0.96659	0.467000	0.42956	GAT	MLL2	-	superfamily_Znf_FYVE_PHD		0.473	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49442540	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	0.999	G
KMT2D	8085	genome.wustl.edu	37	12	49442546	49442546	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:49442546C>T	ENST00000301067.7	-	13	4026	c.4027G>A	c.(4027-4029)Gac>Aac	p.D1343N		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1343					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTATCAATGTCAGCAACCTGA	0.473																																																	0													168.0	166.0	167.0					12																	49442546		2025	4175	6200	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.4027G>A	12.37:g.49442546C>T	ENSP00000301067:p.Asp1343Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D1343N	ENST00000301067.7	37	c.4027	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525845	0.44969	.	.	ENSG00000167548	ENST00000301067	T	0.79352	-1.26	5.92	5.92	0.95590	Zinc finger, FYVE/PHD-type (1);	0.000000	0.36665	N	0.002479	T	0.78489	0.4291	N	0.14661	0.345	0.34175	D	0.670215	D	0.67145	0.996	P	0.60012	0.867	D	0.84560	0.0649	10	0.87932	D	0	.	19.0866	0.93204	0.0:1.0:0.0:0.0	.	1343	O14686	MLL2_HUMAN	N	1343	ENSP00000301067:D1343N	ENSP00000301067:D1343N	D	-	1	0	MLL2	47728813	0.943000	0.32029	1.000000	0.80357	0.788000	0.44548	1.826000	0.39092	2.809000	0.96659	0.467000	0.42956	GAC	MLL2	-	superfamily_Znf_FYVE_PHD		0.473	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49442546	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	missense	SNP	1.000	T
MRAP2	112609	genome.wustl.edu	37	6	84772652	84772652	+	Silent	SNP	C	C	T	rs150284745		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:84772652C>T	ENST00000257776.4	+	3	303	c.168C>T	c.(166-168)ttC>ttT	p.F56F		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	56					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)	p.F56F(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						TTGCAGTCTTCGTGATTTTTA	0.398																																																	1	Substitution - coding silent(1)	skin(1)											277.0	246.0	256.0					6																	84772652		2203	4300	6503	SO:0001819	synonymous_variant	112609			AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.168C>T	6.37:g.84772652C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9M1|Q8IXM9|Q8N2D1	Silent	SNP	NULL	p.F56	ENST00000257776.4	37	c.168	CCDS5001.1	6																																																																																			MRAP2	-	NULL		0.398	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRAP2	HGNC	protein_coding	OTTHUMT00000041367.1	C	NM_138409		84772652	+1	no_errors	ENST00000257776	ensembl	human	known	70_37	silent	SNP	0.829	T
MSLNL	401827	genome.wustl.edu	37	16	822892	822892	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:822892C>T	ENST00000442466.1	-	10	1239	c.1240G>A	c.(1240-1242)Gag>Aag	p.E414K	MSLNL_ENST00000293892.3_Missense_Mutation_p.E765K|MIR662_ENST00000384847.1_RNA			Q96KJ4	MSLNL_HUMAN	mesothelin-like	414					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GCCCTCACCTCTGTCTGGTTC	0.682																																																	0													24.0	27.0	26.0					16																	822892		1960	4141	6101	SO:0001583	missense	401827					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1240G>A	16.37:g.822892C>T	ENSP00000415767:p.Glu414Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Mesothelin	p.E765K	ENST00000442466.1	37	c.2293		16	.	.	.	.	.	.	.	.	.	.	C	6.883	0.532401	0.13127	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.11063	2.81;2.81;2.81	5.05	2.85	0.33270	.	0.176957	0.36815	N	0.002381	T	0.11110	0.0271	.	.	.	0.27774	N	0.94341	P	0.42941	0.794	B	0.42882	0.401	T	0.08493	-1.0719	9	0.32370	T	0.25	-19.6349	12.4956	0.55927	0.0:0.6569:0.3431:0.0	.	414	Q96KJ4	MSLNL_HUMAN	K	464;414;765	ENSP00000441381:E464K;ENSP00000415767:E414K;ENSP00000293892:E765K	ENSP00000293892:E765K	E	-	1	0	MSLNL	762893	0.917000	0.31117	0.716000	0.30569	0.811000	0.45836	1.682000	0.37628	1.101000	0.41535	0.543000	0.68304	GAG	MSLNL	-	pfam_Mesothelin		0.682	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		C	NM_001025190		822892	-1	no_errors	ENST00000293892	ensembl	human	known	70_37	missense	SNP	0.576	T
MT-ND5	4540	genome.wustl.edu	37	M	12609	12609	+	Silent	SNP	T	T	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrM:12609T>C	ENST00000361567.2	+	1	273	c.273T>C	c.(271-273)ccT>ccC	p.P91P	MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	91					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATATTCATCCCTGTAGCATTG	0.383																																																	0																																										SO:0001819	synonymous_variant	4540					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.273T>C	M.37:g.12609T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.P91	ENST00000361567.2	37	c.273		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5		0.383	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		T	YP_003024036		12609	+1	no_errors	ENST00000361567	ensembl	human	known	70_37	silent	SNP	NULL	C
MTOR	2475	genome.wustl.edu	37	1	11168296	11168296	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:11168296C>T	ENST00000361445.4	-	57	7652	c.7576G>A	c.(7576-7578)Gag>Aag	p.E2526K	MTOR_ENST00000376838.1_Missense_Mutation_p.E731K	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2526	FATC. {ECO:0000255|PROSITE- ProRule:PRU00534, ECO:0000255|PROSITE- ProRule:PRU00535}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ATGAGCAGCTCAACTTGCGTT	0.458																																																	0													137.0	117.0	124.0					1																	11168296		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7576G>A	1.37:g.11168296C>T	ENSP00000354558:p.Glu2526Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_Rapamycin-bd_dom,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_Rapamycin-bd_dom,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2526K	ENST00000361445.4	37	c.7576	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974552	0.92919	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.77620	-1.11;-1.11	5.38	5.38	0.77491	PIK-related kinase, FATC (2);Phosphatidylinositol 3-/4-kinase, catalytic (2);	0.000000	0.85682	D	0.000000	T	0.81278	0.4789	M	0.70595	2.14	0.80722	D	1	P	0.39424	0.673	B	0.42738	0.396	D	0.83471	0.0059	10	0.72032	D	0.01	-19.0985	18.4765	0.90795	0.0:1.0:0.0:0.0	.	2526	P42345	MTOR_HUMAN	K	2526;731	ENSP00000354558:E2526K;ENSP00000366034:E731K	ENSP00000354558:E2526K	E	-	1	0	MTOR	11090883	1.000000	0.71417	0.953000	0.39169	0.983000	0.72400	7.201000	0.77847	2.684000	0.91462	0.561000	0.74099	GAG	MTOR	-	pfam_FATC,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom		0.458	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	C	NM_004958		11168296	-1	no_errors	ENST00000361445	ensembl	human	known	70_37	missense	SNP	1.000	T
MTMR11	10903	genome.wustl.edu	37	1	149908229	149908229	+	Intron	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:149908229G>C	ENST00000439741.2	-	2	317				MTMR11_ENST00000406732.3_Intron|MTMR11_ENST00000492824.1_Intron|MTMR11_ENST00000369140.3_5'UTR|MTMR11_ENST00000361405.6_Intron	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11								phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GGGGGAAACTGAGATCAGTGT	0.547																																																	0																																										SO:0001627	intron_variant	10903			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.67-107C>G	1.37:g.149908229G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	RNA	SNP	-	NULL	ENST00000439741.2	37	NULL	CCDS53360.1	1																																																																																			MTMR11	-	-		0.547	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		G	NM_181873		149908229	-1	no_errors	ENST00000482025	ensembl	human	known	70_37	rna	SNP	1.000	C
MUC2	4583	genome.wustl.edu	37	11	1092256	1092256	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:1092256G>A	ENST00000441003.2	+	30	4102	c.4075G>A	c.(4075-4077)Gtc>Atc	p.V1359I	MUC2_ENST00000359061.5_Missense_Mutation_p.V1360I|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Missense_Mutation_p.V25I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1359					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCAGTGTGATGTCTCTGTTGG	0.517																																																	0													142.0	161.0	154.0					11																	1092256		2155	4243	6398	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4075G>A	11.37:g.1092256G>A	ENSP00000415183:p.Val1359Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V1359I	ENST00000441003.2	37	c.4075		11	.	.	.	.	.	.	.	.	.	.	g	4.939	0.174406	0.09391	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000361558	T;T;T	0.17691	2.51;2.26;2.26	2.72	-2.82	0.05787	.	417.740000	0.01478	U	0.016543	T	0.26195	0.0639	L	0.48986	1.54	0.09310	N	1	P	0.50066	0.931	P	0.54270	0.747	T	0.40646	-0.9552	10	0.20046	T	0.44	.	8.7856	0.34818	0.0923:0.4144:0.4933:0.0	.	1359	E7EUV1	.	I	1359;1360;25	ENSP00000415183:V1359I;ENSP00000351956:V1360I;ENSP00000354885:V25I	ENSP00000351956:V1360I	V	+	1	0	MUC2	1082256	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.310000	0.08135	-0.264000	0.09365	-0.524000	0.04348	GTC	MUC2	-	NULL		0.517	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	G	NM_002457		1092256	+1	no_errors	ENST00000441003	ensembl	human	known	70_37	missense	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195508444	195508444	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:195508444G>A	ENST00000463781.3	-	2	10466	c.10007C>T	c.(10006-10008)tCa>tTa	p.S3336L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3336L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGGGCT	0.592																																																	1	Deletion - In frame(1)	stomach(1)											28.0	21.0	23.0					3																	195508444		689	1572	2261	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10007C>T	3.37:g.195508444G>A	ENSP00000417498:p.Ser3336Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3336L	ENST00000463781.3	37	c.10007	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	7.843	0.722434	0.15439	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.43	1.03	1.03	0.20045	.	.	.	.	.	T	0.19565	0.0470	N	0.19112	0.55	0.09310	N	1	B	0.20459	0.045	B	0.17722	0.019	T	0.24621	-1.0155	8	.	.	.	.	5.3938	0.16259	0.0:0.0:1.0:0.0	.	3208	E7ESK3	.	L	3336	ENSP00000417498:S3336L;ENSP00000420243:S3336L	.	S	-	2	0	MUC4	196993223	0.000000	0.05858	0.009000	0.14445	0.023000	0.10783	-1.694000	0.01915	0.494000	0.27859	0.089000	0.15464	TCA	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195508444	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.191	A
MUC4	4585	genome.wustl.edu	37	3	195509740	195509740	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:195509740G>T	ENST00000463781.3	-	2	9170	c.8711C>A	c.(8710-8712)tCa>tAa	p.S2904*	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Nonsense_Mutation_p.S2904*	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATACTGAGGAAAGGCT	0.582																																																	0													13.0	9.0	10.0					3																	195509740		675	1535	2210	SO:0001587	stop_gained	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8711C>A	3.37:g.195509740G>T	ENSP00000417498:p.Ser2904*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S2904*	ENST00000463781.3	37	c.8711	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	48	14.457741	0.99796	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	.	.	.	X	2904	.	.	S	-	2	0	MUC4	196994519	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.000000	0.14550	0.000000	0.15137	TCA	MUC4	-	NULL		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195509740	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	nonsense	SNP	0.713	T
MUC4	4585	genome.wustl.edu	37	3	195510815	195510815	+	Missense_Mutation	SNP	G	G	A	rs527609116	byFrequency	TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:195510815G>A	ENST00000463781.3	-	2	8095	c.7636C>T	c.(7636-7638)Cat>Tat	p.H2546Y	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H2546Y	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGGTGACATGAAGAGAGGTG	0.577													.|||	4	0.000798722	0.0	0.0	5008	,	,		16836	0.004		0.0	False		,,,				2504	0.0																0													148.0	120.0	128.0					3																	195510815		666	1591	2257	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7636C>T	3.37:g.195510815G>A	ENSP00000417498:p.His2546Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.H2546Y	ENST00000463781.3	37	c.7636	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	3.341	-0.134617	0.06711	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.52;1.51	.	.	.	.	.	.	.	.	T	0.11665	0.0284	N	0.08118	0	0.09310	N	1	P	0.35139	0.486	B	0.27796	0.083	T	0.23797	-1.0178	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2546	E7ESK3	.	Y	2546	ENSP00000417498:H2546Y;ENSP00000420243:H2546Y	.	H	-	1	0	MUC4	196995210	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	0.148000	0.16224	-0.000000	0.14550	0.000000	0.15137	CAT	MUC4	-	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195510815	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.340	A
MUTYH	4595	genome.wustl.edu	37	1	45799177	45799177	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:45799177G>C	ENST00000372098.3	-	3	380	c.247C>G	c.(247-249)Cta>Gta	p.L83V	MUTYH_ENST00000531105.1_Intron|MUTYH_ENST00000450313.1_Missense_Mutation_p.L86V|MUTYH_ENST00000354383.6_Missense_Mutation_p.L59V|MUTYH_ENST00000528332.2_Intron|MUTYH_ENST00000372104.1_Missense_Mutation_p.L58V|MUTYH_ENST00000372100.5_Missense_Mutation_p.L69V|MUTYH_ENST00000456914.2_Missense_Mutation_p.L58V|MUTYH_ENST00000528013.2_Missense_Mutation_p.L72V|MUTYH_ENST00000529984.1_Intron|MUTYH_ENST00000372110.3_Missense_Mutation_p.L73V|MUTYH_ENST00000488731.2_Intron|MUTYH_ENST00000448481.1_Missense_Mutation_p.L69V|MUTYH_ENST00000355498.2_Missense_Mutation_p.L58V|MUTYH_ENST00000372115.3_Missense_Mutation_p.L72V			Q9UIF7	MUTYH_HUMAN	mutY homolog	83					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA repair (GO:0006281)|mismatch repair (GO:0006298)	mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|metal ion binding (GO:0046872)|MutSalpha complex binding (GO:0032407)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					TCTCTGAATAGATGGTATGAG	0.587			Mis			colorectal		Base excision repair (BER), DNA glycosylases	MUTYH-associated polyposis																														yes	Rec		Adenomatous polyposis coli	1	1p34.3-1p32.1	4595	mutY homolog (E. coli)		E	0													79.0	71.0	74.0					1																	45799177		2203	4300	6503	SO:0001583	missense	4595	Familial Cancer Database	MAP, MYH-associated polyposis	U63329	CCDS520.1, CCDS41320.1, CCDS41321.1, CCDS41322.1, CCDS72776.1, CCDS72777.1	1p34.1	2014-09-17	2013-09-12		ENSG00000132781	ENSG00000132781			7527	protein-coding gene	gene with protein product		604933	"""mutY (E. coli) homolog"", ""mutY homolog (E. coli)"""			7823963, 10684930	Standard	NM_012222		Approved	MYH	uc009vxp.3	Q9UIF7	OTTHUMG00000007682	ENST00000372098.3:c.247C>G	1.37:g.45799177G>C	ENSP00000361170:p.Leu83Val	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPZ4|Q15830|Q9UBP2|Q9UBS7|Q9UIF4|Q9UIF5|Q9UIF6	Missense_Mutation	SNP	pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,superfamily_NUDIX_hydrolase_dom-like,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.L86V	ENST00000372098.3	37	c.256	CCDS520.1	1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385770	0.25031	.	.	ENSG00000132781	ENST00000372104;ENST00000448481;ENST00000456914;ENST00000354383;ENST00000355498;ENST00000372098;ENST00000372110;ENST00000372115;ENST00000450313;ENST00000372100;ENST00000435155;ENST00000528013;ENST00000483127	T;T;T;T;T;T;T;T;T;T;T;T;T	0.48201	3.27;3.28;3.27;3.28;3.27;3.28;3.27;3.26;3.28;3.28;1.98;0.96;0.82	5.86	4.95	0.65309	.	0.837135	0.10836	N	0.628796	T	0.45935	0.1367	M	0.62723	1.935	0.19575	N	0.999962	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.34775	-0.9815	10	0.25106	T	0.35	-3.4582	11.3423	0.49539	0.0:0.1367:0.721:0.1423	.	86;73;83;72;59	E5KP25;Q9UIF7-2;Q9UIF7;E5KP27;E5KP28	.;.;MUTYH_HUMAN;.;.	V	58;69;58;59;58;83;73;72;86;69;69;72;64	ENSP00000361176:L58V;ENSP00000409718:L69V;ENSP00000407590:L58V;ENSP00000346354:L59V;ENSP00000347685:L58V;ENSP00000361170:L83V;ENSP00000361182:L73V;ENSP00000361187:L72V;ENSP00000408176:L86V;ENSP00000361172:L69V;ENSP00000403655:L69V;ENSP00000433130:L72V;ENSP00000436469:L64V	ENSP00000346354:L59V	L	-	1	2	MUTYH	45571764	0.885000	0.30320	0.622000	0.29159	0.776000	0.43924	1.826000	0.39092	1.489000	0.48450	-0.127000	0.14921	CTA	MUTYH	-	NULL		0.587	MUTYH-002	KNOWN	basic|CCDS	protein_coding	MUTYH	HGNC	protein_coding	OTTHUMT00000020529.1	G	NM_012222		45799177	-1	no_errors	ENST00000450313	ensembl	human	known	70_37	missense	SNP	0.345	C
MX2	4600	genome.wustl.edu	37	21	42771122	42771122	+	Splice_Site	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:42771122G>A	ENST00000330714.3	+	10	1456		c.e10-1		MX2_ENST00000496774.1_Splice_Site	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2						cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				ATCATTTTCAGAAAATCAAGA	0.408																																																	0													58.0	62.0	61.0					21																	42771122		2202	4300	6502	SO:0001630	splice_region_variant	4600				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1273-1G>A	21.37:g.42771122G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z5D3|D3DSI7	Splice_Site	SNP	-	e9-1	ENST00000330714.3	37	c.1273-1	CCDS13672.1	21	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318559	0.60524	.	.	ENSG00000183486	ENST00000330714	.	.	.	3.96	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2959	0.66314	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MX2	41692992	1.000000	0.71417	0.951000	0.38953	0.935000	0.57460	5.098000	0.64548	2.140000	0.66376	0.491000	0.48974	.	MX2	-	-		0.408	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MX2	HGNC	protein_coding	OTTHUMT00000195147.1	G	NM_002463	Intron	42771122	+1	no_errors	ENST00000330714	ensembl	human	known	70_37	splice_site	SNP	1.000	A
MXRA5	25878	genome.wustl.edu	37	X	3229384	3229384	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:3229384G>A	ENST00000217939.6	-	7	7014	c.6860C>T	c.(6859-6861)tCc>tTc	p.S2287F		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2287	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTGCATGAAGGAGTTCACCAG	0.562																																																	0													96.0	78.0	84.0					X																	3229384		2203	4300	6503	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6860C>T	X.37:g.3229384G>A	ENSP00000217939:p.Ser2287Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S2287F	ENST00000217939.6	37	c.6860	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456211	0.26161	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.70282	-0.47	4.28	4.28	0.50868	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.435124	0.16816	U	0.198380	T	0.82162	0.4977	M	0.78344	2.41	0.19775	N	0.999959	D	0.69078	0.997	D	0.67103	0.949	T	0.73170	-0.4067	10	0.66056	D	0.02	.	11.576	0.50862	0.0:0.0:0.8217:0.1783	.	2287	Q9NR99	MXRA5_HUMAN	F	2287	ENSP00000217939:S2287F	ENSP00000217939:S2287F	S	-	2	0	MXRA5	3239384	1.000000	0.71417	0.066000	0.19879	0.175000	0.22909	2.872000	0.48467	1.760000	0.52011	0.509000	0.49947	TCC	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.562	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	G	NM_015419		3229384	-1	no_errors	ENST00000217939	ensembl	human	known	70_37	missense	SNP	0.334	A
MYH15	22989	genome.wustl.edu	37	3	108220642	108220642	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:108220642C>T	ENST00000273353.3	-	4	372	c.316G>A	c.(316-318)Gaa>Aaa	p.E106K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	106	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GCCATGTCTTCAATCATTTCA	0.443																																																	0													137.0	138.0	138.0					3																	108220642		2012	4213	6225	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.316G>A	3.37:g.108220642C>T	ENSP00000273353:p.Glu106Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E106K	ENST00000273353.3	37	c.316	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.121805	0.94429	.	.	ENSG00000144821	ENST00000273353	T	0.73681	-0.77	5.34	5.34	0.76211	Myosin head, motor domain (2);	.	.	.	.	D	0.90648	0.7067	H	0.95679	3.705	0.80722	D	1	D	0.55605	0.972	D	0.75020	0.985	D	0.93218	0.6606	9	0.87932	D	0	.	18.6188	0.91313	0.0:1.0:0.0:0.0	.	106	Q9Y2K3	MYH15_HUMAN	K	106	ENSP00000273353:E106K	ENSP00000273353:E106K	E	-	1	0	MYH15	109703332	1.000000	0.71417	0.997000	0.53966	0.631000	0.37964	7.069000	0.76755	2.503000	0.84419	0.591000	0.81541	GAA	MYH15	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.443	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	C	XM_036988		108220642	-1	no_errors	ENST00000273353	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH7B	57644	genome.wustl.edu	37	20	33565461	33565461	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:33565461C>A	ENST00000262873.7	+	2	124	c.32C>A	c.(31-33)tCc>tAc	p.S11Y		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	0						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AGCAGAGCTTCCTGCCCTCAC	0.642																																																	0													27.0	26.0	26.0					20																	33565461		2019	4175	6194	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.32C>A	20.37:g.33565461C>A	ENSP00000262873:p.Ser11Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S11Y	ENST00000262873.7	37	c.32	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380965	0.42207	.	.	ENSG00000078814	ENST00000262873	D	0.86297	-2.1	5.44	4.5	0.54988	.	.	.	.	.	D	0.86464	0.5939	.	.	.	0.23056	N	0.998369	.	.	.	.	.	.	T	0.79519	-0.1770	6	0.87932	D	0	.	7.273	0.26268	0.1666:0.747:0.0:0.0864	.	.	.	.	Y	11	ENSP00000262873:S11Y	ENSP00000262873:S11Y	S	+	2	0	MYH7B	33029122	0.997000	0.39634	1.000000	0.80357	0.779000	0.44077	2.837000	0.48191	1.305000	0.44909	0.609000	0.83330	TCC	MYH7B	-	NULL		0.642	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	C	NM_020884		33565461	+1	no_errors	ENST00000262873	ensembl	human	novel	70_37	missense	SNP	1.000	A
MYL5	4636	genome.wustl.edu	37	4	672505	672505	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:672505C>T	ENST00000400159.2	+	2	167	c.62C>T	c.(61-63)tCc>tTc	p.S21F	MYL5_ENST00000505477.1_5'UTR|MYL5_ENST00000511290.1_5'UTR|MYL5_ENST00000506838.1_5'UTR	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	21					regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(1)|kidney(1)|lung(1)	3						AGAGCCTCATCCAATGTCTTC	0.612																																																	0													39.0	51.0	48.0					4																	672505		1955	4179	6134	SO:0001583	missense	4636				CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.62C>T	4.37:g.672505C>T	ENSP00000383023:p.Ser21Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IXL8	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S21F	ENST00000400159.2	37	c.62	CCDS43197.1	4	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135647	0.37728	.	.	ENSG00000215375	ENST00000400159;ENST00000507804	T;T	0.77489	-0.93;-1.1	4.15	2.39	0.29439	EF-hand-like domain (1);	0.000000	0.31199	U	0.008063	D	0.83885	0.5351	M	0.84846	2.72	0.29435	N	0.85957	D	0.54964	0.969	P	0.55713	0.782	T	0.79645	-0.1717	10	0.87932	D	0	.	8.3426	0.32252	0.0:0.8083:0.0:0.1917	.	21	Q02045	MYL5_HUMAN	F	21;26	ENSP00000383023:S21F;ENSP00000427317:S26F	ENSP00000383023:S21F	S	+	2	0	MYL5	662505	0.996000	0.38824	0.014000	0.15608	0.496000	0.33645	2.134000	0.42102	0.327000	0.23409	0.591000	0.81541	TCC	MYL5	-	NULL		0.612	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL5	HGNC	protein_coding	OTTHUMT00000358570.2	C	NM_002477		672505	+1	no_errors	ENST00000400159	ensembl	human	known	70_37	missense	SNP	0.999	T
MYO7B	4648	genome.wustl.edu	37	2	128387388	128387388	+	Missense_Mutation	SNP	C	C	T	rs373498646		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:128387388C>T	ENST00000409816.2	+	33	4747	c.4715C>T	c.(4714-4716)tCg>tTg	p.S1572L	MYO7B_ENST00000428314.1_Missense_Mutation_p.S1572L|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Missense_Mutation_p.S1572L|MYO7B_ENST00000409090.1_Missense_Mutation_p.S425L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1572						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACTAAGCCCTCGGCACAGCTG	0.647																																																	0													52.0	60.0	57.0					2																	128387388		2084	4209	6293	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4715C>T	2.37:g.128387388C>T	ENSP00000386461:p.Ser1572Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14786|Q8TEE1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.S1572L	ENST00000409816.2	37	c.4715	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	c	35	5.447676	0.96205	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.83	5.83	0.93111	Src homology-3 domain (1);	0.269245	0.36893	N	0.002345	T	0.81607	0.4858	M	0.83603	2.65	0.49389	D	0.999782	D	0.71674	0.998	P	0.58660	0.843	T	0.80986	-0.1137	10	0.41790	T	0.15	.	20.1152	0.97926	0.0:1.0:0.0:0.0	.	1572	Q6PIF6	MYO7B_HUMAN	L	1572;1572;667;1572;425	ENSP00000374175:S1572L;ENSP00000415090:S1572L;ENSP00000386461:S1572L;ENSP00000386850:S425L	ENSP00000272666:S667L	S	+	2	0	MYO7B	128103858	0.991000	0.36638	0.908000	0.35775	0.839000	0.47603	5.600000	0.67599	2.750000	0.94351	0.655000	0.94253	TCG	MYO7B	-	superfamily_SH3_domain		0.647	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	C	XM_291001		128387388	+1	no_errors	ENST00000389524	ensembl	human	known	70_37	missense	SNP	0.998	T
NBPF10	100132406	genome.wustl.edu	37	1	145296382	145296382	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:145296382C>G	ENST00000342960.5	+	3	339	c.304C>G	c.(304-306)Cag>Gag	p.Q102E	NBPF10_ENST00000369339.3_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	102						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGTTCACTCTCAGGAACGAGA	0.478																																																	0																																										SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.304C>G	1.37:g.145296382C>G	ENSP00000345684:p.Gln102Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.Q102E	ENST00000342960.5	37	c.304	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	6.168	0.399221	0.11696	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.05139	3.49	0.837	0.837	0.18896	.	.	.	.	.	T	0.06735	0.0172	M	0.85542	2.76	0.09310	N	1	.	.	.	.	.	.	T	0.22208	-1.0223	7	0.46703	T	0.11	.	5.1485	0.14998	0.0:1.0:0.0:0.0	.	.	.	.	E	102;27;102	ENSP00000345684:Q102E	ENSP00000345684:Q102E	Q	+	1	0	NBPF10	144007739	0.037000	0.19845	0.002000	0.10522	0.004000	0.04260	1.365000	0.34182	0.777000	0.33496	0.121000	0.15741	CAG	NBPF10	-	NULL		0.478	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		C	NM_001039703		145296382	+1	no_errors	ENST00000342960	ensembl	human	known	70_37	missense	SNP	0.002	G
NCOA5	57727	genome.wustl.edu	37	20	44692204	44692204	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:44692204C>G	ENST00000290231.6	-	7	1109	c.945G>C	c.(943-945)aaG>aaC	p.K315N		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CATCGGCCATCTTGGCTGCCT	0.587																																																	0													63.0	57.0	59.0					20																	44692204		2203	4300	6503	SO:0001583	missense	57727				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.945G>C	20.37:g.44692204C>G	ENSP00000290231:p.Lys315Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	superfamily_Anticodon-bd	p.K315N	ENST00000290231.6	37	c.945	CCDS13392.1	20	.	.	.	.	.	.	.	.	.	.	C	15.48	2.844817	0.51164	.	.	ENSG00000124160	ENST00000290231	T	0.51817	0.69	5.41	3.45	0.39498	Anticodon-binding (1);	0.081286	0.85682	D	0.000000	T	0.57184	0.2036	L	0.46157	1.445	0.54753	D	0.999987	D	0.76494	0.999	D	0.72075	0.976	T	0.56559	-0.7959	10	0.62326	D	0.03	-4.5386	8.8649	0.35280	0.0:0.77:0.0:0.23	.	315	Q9HCD5	NCOA5_HUMAN	N	315	ENSP00000290231:K315N	ENSP00000290231:K315N	K	-	3	2	NCOA5	44125611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.691000	0.37721	0.820000	0.34516	0.561000	0.74099	AAG	NCOA5	-	superfamily_Anticodon-bd		0.587	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1	C	NM_020967		44692204	-1	no_errors	ENST00000290231	ensembl	human	known	70_37	missense	SNP	1.000	G
NCOR2	9612	genome.wustl.edu	37	12	124821320	124821320	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:124821320C>G	ENST00000405201.1	-	38	6094	c.6094G>C	c.(6094-6096)Gaa>Caa	p.E2032Q	NCOR2_ENST00000397355.1_Missense_Mutation_p.E2023Q|NCOR2_ENST00000404621.1_Missense_Mutation_p.E2022Q|NCOR2_ENST00000404121.2_Missense_Mutation_p.E1593Q|NCOR2_ENST00000356219.3_Missense_Mutation_p.E2039Q|NCOR2_ENST00000429285.2_Missense_Mutation_p.E2022Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2043					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		AGTTCCAGTTCCTGGATGGAA	0.602																																																	0													73.0	78.0	77.0					12																	124821320		1971	4167	6138	SO:0001583	missense	9612			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6094G>C	12.37:g.124821320C>G	ENSP00000384018:p.Glu2032Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E2039Q	ENST00000405201.1	37	c.6115	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	c	19.53	3.844078	0.71488	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285	T;T;T;T;T;T	0.24350	1.86;2.13;1.86;2.13;1.87;2.13	4.78	4.78	0.61160	.	0.058000	0.64402	D	0.000002	T	0.38957	0.1060	L	0.29908	0.895	0.58432	D	0.999999	D;D;D	0.76494	0.995;0.997;0.999	P;D;D	0.66351	0.829;0.917;0.943	T	0.26189	-1.0110	10	0.52906	T	0.07	-17.8706	17.8055	0.88600	0.0:1.0:0.0:0.0	.	2023;2032;2043	C9J239;C9JFD3;Q9Y618	.;.;NCOR2_HUMAN	Q	2032;2022;2039;2023;2031;1593;124;2022	ENSP00000384018:E2032Q;ENSP00000384202:E2022Q;ENSP00000348551:E2039Q;ENSP00000380513:E2023Q;ENSP00000385618:E1593Q;ENSP00000400281:E2022Q	ENSP00000348551:E2039Q	E	-	1	0	NCOR2	123387273	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	7.402000	0.79972	2.185000	0.69588	0.556000	0.70494	GAA	NCOR2	-	NULL		0.602	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	C	NM_006312		124821320	-1	no_errors	ENST00000356219	ensembl	human	known	70_37	missense	SNP	1.000	G
NDEL1	81565	genome.wustl.edu	37	17	8354172	8354172	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:8354172C>G	ENST00000334527.7	+	6	798	c.601C>G	c.(601-603)Cta>Gta	p.L201V	NDEL1_ENST00000402554.3_Missense_Mutation_p.L201V|NDEL1_ENST00000299734.7_Missense_Mutation_p.L201V|NDEL1_ENST00000380025.4_Missense_Mutation_p.L201V|NDEL1_ENST00000585098.1_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	201	Interaction with CENPF.|Interaction with KATNA1. {ECO:0000250}.|Interaction with NEFL. {ECO:0000250}.|Interaction with YWHAE. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						CTCTCCAACTCTAGACTGTGA	0.468																																																	0													76.0	65.0	69.0					17																	8354172		2203	4300	6503	SO:0001583	missense	81565			AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.601C>G	17.37:g.8354172C>G	ENSP00000333982:p.Leu201Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Missense_Mutation	SNP	pfam_NUDE_C	p.L201V	ENST00000334527.7	37	c.601	CCDS11143.1	17	.	.	.	.	.	.	.	.	.	.	C	10.10	1.258344	0.23051	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	4.98	4.01	0.46588	NUDE protein, C-terminal (1);	0.143270	0.47093	D	0.000253	T	0.43055	0.1230	L	0.41710	1.295	0.30863	N	0.733357	B;B	0.17038	0.02;0.009	B;B	0.25405	0.06;0.038	T	0.41070	-0.9529	9	0.15066	T	0.55	-2.723	13.5169	0.61545	0.0:0.925:0.0:0.0749	.	201;201	Q9GZM8;A6NIZ0	NDEL1_HUMAN;.	V	201;201;256;201	.	ENSP00000299734:L201V	L	+	1	2	NDEL1	8294897	0.008000	0.16893	0.252000	0.24328	0.971000	0.66376	0.877000	0.28106	1.461000	0.47929	0.655000	0.94253	CTA	NDEL1	-	pfam_NUDE_C		0.468	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDEL1	HGNC	protein_coding	OTTHUMT00000226999.2	C	NM_030808		8354172	+1	no_errors	ENST00000299734	ensembl	human	known	70_37	missense	SNP	0.386	G
NECAB2	54550	genome.wustl.edu	37	16	84034404	84034404	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:84034404G>C	ENST00000305202.4	+	11	1055	c.1038G>C	c.(1036-1038)aaG>aaC	p.K346N	NECAB2_ENST00000565691.1_Missense_Mutation_p.K263N	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	346	ABM.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						AGGCGTGGAAGAGGTGAGATG	0.607																																																	0													86.0	81.0	83.0					16																	84034404		2200	4300	6500	SO:0001583	missense	54550			AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.1038G>C	16.37:g.84034404G>C	ENSP00000307449:p.Lys346Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRG3|O75547|Q6ZSK0	Missense_Mutation	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.K346N	ENST00000305202.4	37	c.1038	CCDS10940.1	16	.	.	.	.	.	.	.	.	.	.	G	15.12	2.737867	0.49045	.	.	ENSG00000103154	ENST00000305202	T	0.30981	1.51	4.03	4.03	0.46877	Dimeric alpha-beta barrel (1);Antibiotic biosynthesis monooxygenase (1);	0.054298	0.64402	D	0.000001	T	0.46112	0.1376	L	0.60845	1.875	0.47123	D	0.999327	D	0.63880	0.993	D	0.63113	0.911	T	0.28073	-1.0055	10	0.30078	T	0.28	-12.3428	13.3819	0.60773	0.0:0.0:1.0:0.0	.	346	Q7Z6G3	NECA2_HUMAN	N	346	ENSP00000307449:K346N	ENSP00000307449:K346N	K	+	3	2	NECAB2	82591905	1.000000	0.71417	1.000000	0.80357	0.394000	0.30568	6.360000	0.73064	2.241000	0.73720	0.561000	0.74099	AAG	NECAB2	-	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel		0.607	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB2	HGNC	protein_coding	OTTHUMT00000269077.2	G	NM_019065		84034404	+1	no_errors	ENST00000305202	ensembl	human	known	70_37	missense	SNP	1.000	C
NF1	4763	genome.wustl.edu	37	17	29661936	29661936	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:29661936G>A	ENST00000358273.4	+	40	6276	c.5893G>A	c.(5893-5895)Gat>Aat	p.D1965N	NF1_ENST00000417592.2_5'Flank|NF1_ENST00000444181.2_5'Flank|NF1_ENST00000356175.3_Missense_Mutation_p.D1944N|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1965					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCATAATGATGATGCCAAACG	0.353			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											132.0	121.0	125.0					17																	29661936		2203	4300	6503	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5893G>A	17.37:g.29661936G>A	ENSP00000351015:p.Asp1965Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.D1965N	ENST00000358273.4	37	c.5893	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007270	0.93287	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.92397	-3.03;-3.03;-3.03	5.54	5.54	0.83059	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.94311	0.8172	L	0.39147	1.195	0.80722	D	1	D;P	0.67145	0.996;0.656	D;B	0.76071	0.987;0.358	D	0.93918	0.7203	10	0.46703	T	0.11	.	19.4882	0.95039	0.0:0.0:1.0:0.0	.	1944;1965	P21359-2;P21359	.;NF1_HUMAN	N	1965;1944;1610	ENSP00000351015:D1965N;ENSP00000348498:D1944N;ENSP00000389907:D1610N	ENSP00000348498:D1944N	D	+	1	0	NF1	26686062	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.261000	0.95576	2.620000	0.88729	0.557000	0.71058	GAT	NF1	-	superfamily_ARM-type_fold		0.353	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	G	NM_000267		29661936	+1	no_errors	ENST00000358273	ensembl	human	known	70_37	missense	SNP	1.000	A
NFU1	27247	genome.wustl.edu	37	2	69633183	69633183	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:69633183C>T	ENST00000410022.2	-	6	721	c.516G>A	c.(514-516)atG>atA	p.M172I	NFU1_ENST00000394305.1_Missense_Mutation_p.M31I|NFU1_ENST00000303698.3_Missense_Mutation_p.M148I|NFU1_ENST00000471185.1_5'UTR|NFU1_ENST00000462320.1_Missense_Mutation_p.M31I	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	172					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						ATTCCTTAATCATTGCCACAA	0.323																																																	0													134.0	129.0	131.0					2																	69633183		2203	4300	6503	SO:0001583	missense	27247			AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.516G>A	2.37:g.69633183C>T	ENSP00000387219:p.Met172Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	pfam_NIF_FeS_clus_asmbl_NifU-like_N,pfam_NIF_FeS_clus_asmbl_NifU_C,superfamily_NIF_FeS_clus_asmbl_NifU-like_N,smart_NIF_FeS_clus_asmbl_NifU-like_N,pirsf_HIRA-interacting_protein_5	p.M172I	ENST00000410022.2	37	c.516	CCDS33217.1	2	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771276	0.90108	.	.	ENSG00000169599	ENST00000410022;ENST00000303698;ENST00000394305;ENST00000462320;ENST00000450796;ENST00000484177	T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.07	5.07	0.68467	.	0.035047	0.85682	D	0.000000	D	0.82838	0.5124	M	0.85197	2.74	0.80722	D	1	P;P	0.43973	0.494;0.823	B;P	0.48089	0.221;0.566	D	0.85871	0.1416	10	0.66056	D	0.02	-19.9983	17.6738	0.88225	0.0:1.0:0.0:0.0	.	148;172	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	I	172;148;31;31;31;31	ENSP00000387219:M172I;ENSP00000306965:M148I;ENSP00000377842:M31I;ENSP00000418598:M31I;ENSP00000415102:M31I;ENSP00000417693:M31I	ENSP00000306965:M148I	M	-	3	0	NFU1	69486687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.102000	0.77005	2.637000	0.89404	0.585000	0.79938	ATG	NFU1	-	pirsf_HIRA-interacting_protein_5		0.323	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFU1	HGNC	protein_coding	OTTHUMT00000327279.3	C	NM_015700		69633183	-1	no_errors	ENST00000410022	ensembl	human	known	70_37	missense	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	37057342	37057342	+	Missense_Mutation	SNP	T	T	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:37057342T>A	ENST00000282516.8	+	43	7817	c.7318T>A	c.(7318-7320)Tac>Aac	p.Y2440N	NIPBL_ENST00000448238.2_Missense_Mutation_p.Y2440N	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2440			Y -> H (in CDLS1). {ECO:0000269|PubMed:15318302}.		brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CTGTTTTCCATACCAGACACA	0.373																																																	0			GRCh37	CM042524	NIPBL	M							102.0	93.0	96.0					5																	37057342		2203	4300	6503	SO:0001583	missense	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.7318T>A	5.37:g.37057342T>A	ENSP00000282516:p.Tyr2440Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Y2440N	ENST00000282516.8	37	c.7318	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	T	27.2	4.808546	0.90707	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.98280	-4.84;-4.84	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.99032	0.9669	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.99744	1.1016	10	0.87932	D	0	-5.3037	16.1986	0.82053	0.0:0.0:0.0:1.0	.	2440;2440;2440	Q6IEH8;Q6KC79;Q6KC79-2	.;NIPBL_HUMAN;.	N	2440	ENSP00000282516:Y2440N;ENSP00000406266:Y2440N	ENSP00000282516:Y2440N	Y	+	1	0	NIPBL	37093099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.227000	0.72691	0.455000	0.32223	TAC	NIPBL	-	NULL		0.373	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	T	NM_015384		37057342	+1	no_errors	ENST00000282516	ensembl	human	known	70_37	missense	SNP	1.000	A
NOL11	25926	genome.wustl.edu	37	17	65714108	65714108	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:65714108G>C	ENST00000253247.4	+	1	160	c.45G>C	c.(43-45)ctG>ctC	p.L15L	NOL11_ENST00000581966.1_3'UTR|NOL11_ENST00000535137.1_5'UTR	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	15					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			CGGTAGTCCTGAGCGCCGGGC	0.567											OREG0024682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													73.0	65.0	67.0					17																	65714108		2203	4300	6503	SO:0001819	synonymous_variant	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.45G>C	17.37:g.65714108G>C		Somatic	1086	WXS	Illumina HiSeq	Phase_IV	B7Z5V9|Q7L5S1|Q9UG18	Silent	SNP	pfam_NUC205	p.L15	ENST00000253247.4	37	c.45	CCDS11671.1	17																																																																																			NOL11	-	NULL		0.567	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	HGNC	protein_coding	OTTHUMT00000448074.1	G	NM_015462		65714108	+1	no_errors	ENST00000253247	ensembl	human	known	70_37	silent	SNP	0.977	C
NOTCH2	4853	genome.wustl.edu	37	1	120462868	120462868	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:120462868C>G	ENST00000256646.2	-	30	5682	c.5463G>C	c.(5461-5463)gtG>gtC	p.V1821V	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1821					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACGGACATTCACATCTAACA	0.587			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													107.0	78.0	88.0					1																	120462868		2203	4300	6503	SO:0001819	synonymous_variant	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5463G>C	1.37:g.120462868C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3X7|Q99734|Q9H240	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.V1821	ENST00000256646.2	37	c.5463	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch,pfscan_Ankyrin_rpt-contain_dom		0.587	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	C	NM_024408		120462868	-1	no_errors	ENST00000256646	ensembl	human	known	70_37	silent	SNP	1.000	G
NOTCH3	4854	genome.wustl.edu	37	19	15272415	15272415	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:15272415C>T	ENST00000263388.2	-	33	6099	c.6024G>A	c.(6022-6024)ccG>ccA	p.P2008P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2008					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CTACGTCCCGCGGCAGCCTGT	0.682																																																	0													27.0	26.0	27.0					19																	15272415		2202	4299	6501	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6024G>A	19.37:g.15272415C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.P2008	ENST00000263388.2	37	c.6024	CCDS12326.1	19																																																																																			NOTCH3	-	superfamily_Ankyrin_rpt-contain_dom,pirsf_Notch,pfscan_Ankyrin_rpt-contain_dom		0.682	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	C	NM_000435		15272415	-1	no_errors	ENST00000263388	ensembl	human	known	70_37	silent	SNP	0.029	T
NPAS2	4862	genome.wustl.edu	37	2	101591925	101591925	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:101591925C>G	ENST00000335681.5	+	14	1573	c.1288C>G	c.(1288-1290)Ccc>Gcc	p.P430A	NPAS2_ENST00000542504.1_Missense_Mutation_p.P495A|AC016738.3_ENST00000433012.1_RNA|AC016738.3_ENST00000439150.1_RNA|AC016738.3_ENST00000446644.1_RNA	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	430					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TACAGCCACTCCCACCAAGCT	0.567																																																	0													116.0	121.0	119.0					2																	101591925		2203	4300	6503	SO:0001583	missense	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1288C>G	2.37:g.101591925C>G	ENSP00000338283:p.Pro430Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_dom,tigrfam_PAS	p.P495A	ENST00000335681.5	37	c.1483	CCDS2048.1	2	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706612	0.48412	.	.	ENSG00000170485	ENST00000335681;ENST00000542504;ENST00000450763	T;T;T	0.30714	3.51;3.47;1.52	5.93	5.01	0.66863	.	0.391329	0.24202	N	0.040618	T	0.28267	0.0698	L	0.42245	1.32	0.38698	D	0.952912	P;B;B	0.36110	0.537;0.25;0.23	B;B;B	0.40134	0.32;0.099;0.074	T	0.06481	-1.0824	10	0.40728	T	0.16	.	9.23	0.37430	0.0:0.7777:0.1471:0.0751	.	495;430;430	F5H027;A0PJF9;Q99743	.;.;NPAS2_HUMAN	A	430;495;29	ENSP00000338283:P430A;ENSP00000438428:P495A;ENSP00000392125:P29A	ENSP00000338283:P430A	P	+	1	0	NPAS2	100958357	0.739000	0.28196	0.896000	0.35187	0.884000	0.51177	2.342000	0.43992	2.826000	0.97356	0.655000	0.94253	CCC	NPAS2	-	NULL		0.567	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	C			101591925	+1	no_errors	ENST00000542504	ensembl	human	known	70_37	missense	SNP	0.980	G
NR2F2	7026	genome.wustl.edu	37	15	96880846	96880846	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:96880846C>T	ENST00000394166.3	+	3	2629	c.1240C>T	c.(1240-1242)Caa>Taa	p.Q414*	NR2F2_ENST00000453270.2_Nonsense_Mutation_p.Q261*|NR2F2_ENST00000421109.2_Nonsense_Mutation_p.Q281*|NR2F2_ENST00000394171.2_Nonsense_Mutation_p.Q261*	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	414	Important for dimerization.|Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TATGGCAATTCAATAAATAAA	0.378																																																	0													59.0	66.0	63.0					15																	96880846		2197	4298	6495	SO:0001587	stop_gained	7026			M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.1240C>T	15.37:g.96880846C>T	ENSP00000377721:p.Gln414*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_COUP_TF,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4	p.Q414*	ENST00000394166.3	37	c.1240	CCDS10375.1	15	.	.	.	.	.	.	.	.	.	.	C	41	8.976000	0.99023	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9156	0.97061	0.0:1.0:0.0:0.0	.	.	.	.	X	281;414;261;261	.	ENSP00000377721:Q414X	Q	+	1	0	NR2F2	94681850	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.790000	0.85794	2.698000	0.92095	0.650000	0.86243	CAA	NR2F2	-	NULL		0.378	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2F2	HGNC	protein_coding	OTTHUMT00000313534.1	C			96880846	+1	no_errors	ENST00000394166	ensembl	human	known	70_37	nonsense	SNP	1.000	T
NSMAF	8439	genome.wustl.edu	37	8	59518528	59518528	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:59518528G>C	ENST00000038176.3	-	12	1038	c.826C>G	c.(826-828)Caa>Gaa	p.Q276E	NSMAF_ENST00000519858.1_5'UTR|NSMAF_ENST00000427130.2_Missense_Mutation_p.Q307E	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	276					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TCTCTATCTTGAGGTTCATAG	0.333																																																	0													80.0	78.0	78.0					8																	59518528		2203	4300	6503	SO:0001583	missense	8439			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.826C>G	8.37:g.59518528G>C	ENSP00000038176:p.Gln276Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,pfam_GRAM,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_GRAM,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q307E	ENST00000038176.3	37	c.919	CCDS6173.1	8	.	.	.	.	.	.	.	.	.	.	G	8.819	0.937105	0.18206	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.52526	0.67;0.66	5.17	4.23	0.50019	BEACH domain (1);PH-BEACH domain (1);	0.318271	0.36167	N	0.002759	T	0.26231	0.0640	N	0.08118	0	0.35276	D	0.780926	B;B;B	0.24368	0.102;0.001;0.001	B;B;B	0.24541	0.054;0.003;0.003	T	0.26430	-1.0103	9	.	.	.	.	12.7596	0.57356	0.0:0.0:0.7143:0.2857	.	307;276;276	Q92636-2;A8K9G4;Q92636	.;.;FAN_HUMAN	E	276;307	ENSP00000038176:Q276E;ENSP00000411012:Q307E	.	Q	-	1	0	NSMAF	59681082	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.597000	0.46214	2.579000	0.87056	0.655000	0.94253	CAA	NSMAF	-	superfamily_BEACH_dom		0.333	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	G	NM_003580		59518528	-1	no_errors	ENST00000427130	ensembl	human	known	70_37	missense	SNP	1.000	C
NTMT1	28989	genome.wustl.edu	37	9	132395141	132395141	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:132395141G>C	ENST00000372486.1	+	2	508	c.159G>C	c.(157-159)ttG>ttC	p.L53F	NTMT1_ENST00000459968.2_Missense_Mutation_p.L53F|NTMT1_ENST00000372481.3_Missense_Mutation_p.L53F|NTMT1_ENST00000486391.2_Intron|NTMT1_ENST00000372483.4_Missense_Mutation_p.L53F|NTMT1_ENST00000482347.1_Intron|NTMT1_ENST00000372480.1_Missense_Mutation_p.L53F			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	53					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)										AGAGGTTTTTGAGGGTAGGCA	0.577																																																	0													115.0	111.0	112.0					9																	132395141		2203	4300	6503	SO:0001583	missense	28989			AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.159G>C	9.37:g.132395141G>C	ENSP00000361564:p.Leu53Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_O_MeTrfase_2,pirsf_DUF858_MeTrfase_lik	p.L53F	ENST00000372486.1	37	c.159	CCDS35160.1	9	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282320	0.59867	.	.	ENSG00000148335	ENST00000372486;ENST00000372483;ENST00000372481;ENST00000372480	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.15	4.24	0.50183	.	0.000000	0.64402	D	0.000002	T	0.26484	0.0647	N	0.21617	0.685	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.04029	-1.0983	10	0.08381	T	0.77	-10.5965	11.5248	0.50573	0.0897:0.0:0.9103:0.0	.	53;53	Q9BV86-2;Q9BV86	.;NTM1A_HUMAN	F	53	ENSP00000361564:L53F;ENSP00000361561:L53F;ENSP00000361559:L53F;ENSP00000361558:L53F	ENSP00000361558:L53F	L	+	3	2	METTL11A	131434962	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	1.572000	0.36461	1.150000	0.42419	0.561000	0.74099	TTG	NTMT1	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik		0.577	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NTMT1	HGNC	protein_coding	OTTHUMT00000054589.1	G	NM_014064		132395141	+1	no_errors	ENST00000372480	ensembl	human	known	70_37	missense	SNP	1.000	C
NTPCR	84284	genome.wustl.edu	37	1	233091309	233091309	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:233091309G>C	ENST00000366628.5	+	2	128	c.41G>C	c.(40-42)gGa>gCa	p.G14A	NTPCR_ENST00000366627.4_Missense_Mutation_p.G14A	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	14						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						ttAGGAGTTGGAAAAACAACA	0.393																																																	0													40.0	40.0	40.0					1																	233091309		2202	4300	6502	SO:0001583	missense	84284			BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.41G>C	1.37:g.233091309G>C	ENSP00000355587:p.Gly14Ala	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Nuc-triphosphatase_THEP1,smart_AAA+_ATPase	p.G14A	ENST00000366628.5	37	c.41	CCDS1597.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369185	0.82463	.	.	ENSG00000135778	ENST00000366628;ENST00000366627	D;D	0.93859	-3.3;-3.3	5.12	5.12	0.69794	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	H	0.97806	4.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99327	1.0908	10	0.72032	D	0.01	-5.3572	18.7591	0.91843	0.0:0.0:1.0:0.0	.	14;14	Q9BSD7;Q5TDF0	NTPCR_HUMAN;.	A	14	ENSP00000355587:G14A;ENSP00000355586:G14A	ENSP00000355586:G14A	G	+	2	0	NTPCR	231157932	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.271000	0.89883	2.647000	0.89833	0.655000	0.94253	GGA	NTPCR	-	pfam_Nuc-triphosphatase_THEP1,smart_AAA+_ATPase		0.393	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTPCR	HGNC	protein_coding	OTTHUMT00000092324.2	G	NM_032324		233091309	+1	no_errors	ENST00000366627	ensembl	human	known	70_37	missense	SNP	1.000	C
NTRK3	4916	genome.wustl.edu	37	15	88680693	88680693	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:88680693G>A	ENST00000360948.2	-	6	725	c.564C>T	c.(562-564)taC>taT	p.Y188Y	NTRK3_ENST00000542733.2_Silent_p.Y90Y|NTRK3_ENST00000317501.3_Silent_p.Y188Y|NTRK3_ENST00000357724.2_Silent_p.Y188Y|NTRK3_ENST00000540489.2_Silent_p.Y188Y|NTRK3_ENST00000557856.1_Silent_p.Y188Y|NTRK3_ENST00000355254.2_Silent_p.Y188Y|NTRK3_ENST00000394480.2_Silent_p.Y188Y|NTRK3_ENST00000558676.1_Silent_p.Y188Y	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	188	LRRCT.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CGTTGATGCAGTAGAGGTTCT	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													140.0	105.0	117.0					15																	88680693		2201	4299	6500	SO:0001819	synonymous_variant	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.564C>T	15.37:g.88680693G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y188	ENST00000360948.2	37	c.564	CCDS32322.1	15																																																																																			NTRK3	-	smart_Cys-rich_flank_reg_C		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		G			88680693	-1	no_errors	ENST00000360948	ensembl	human	known	70_37	silent	SNP	1.000	A
NUMB	8650	genome.wustl.edu	37	14	73743895	73743895	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:73743895C>G	ENST00000355058.3	-	13	1625	c.1347G>C	c.(1345-1347)aaG>aaC	p.K449N	NUMB_ENST00000555394.1_Missense_Mutation_p.K401N|NUMB_ENST00000554546.1_Missense_Mutation_p.K390N|NUMB_ENST00000555738.2_Missense_Mutation_p.K292N|NUMB_ENST00000557597.1_Missense_Mutation_p.K438N|NUMB_ENST00000556772.1_Missense_Mutation_p.K305N|NUMB_ENST00000544991.3_Missense_Mutation_p.K254N|NUMB_ENST00000454166.4_Missense_Mutation_p.K303N|NUMB_ENST00000554521.2_Missense_Mutation_p.K243N|NUMB_ENST00000560335.1_Missense_Mutation_p.K303N|NUMB_ENST00000356296.4_Missense_Mutation_p.K401N|NUMB_ENST00000559312.1_Missense_Mutation_p.K254N|NUMB_ENST00000555238.1_Missense_Mutation_p.K449N|NUMB_ENST00000359560.3_Missense_Mutation_p.K438N|NUMB_ENST00000535282.1_Missense_Mutation_p.K438N			P49757	NUMB_HUMAN	numb homolog (Drosophila)	449					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		CCCGGACGCTCTTAGACACCT	0.612																																																	0													39.0	38.0	38.0					14																	73743895		2203	4300	6503	SO:0001583	missense	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1347G>C	14.37:g.73743895C>G	ENSP00000347169:p.Lys449Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.K449N	ENST00000355058.3	37	c.1347	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	C	15.21	2.767232	0.49574	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282	T;T;T;T;T;T;T;T;T;T;T;T;T	0.63744	0.05;0.04;0.28;0.26;0.9;0.26;0.28;0.04;0.1;-0.06;0.05;0.16;0.28	5.65	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.65048	0.2654	N	0.24115	0.695	0.58432	D	0.999998	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D	0.91635	0.999;0.994;0.994;0.994;0.994;0.999;0.999;0.994;0.968	T	0.68387	-0.5422	10	0.87932	D	0	-12.9514	9.3731	0.38266	0.0:0.7866:0.0:0.2134	.	147;292;303;243;254;390;401;438;449	B1P2N9;B1P2N6;B1P2N5;B1P2N8;B1P2N7;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;NUMB_HUMAN	N	390;401;438;449;305;449;438;401;254;303;292;243;438	ENSP00000452416:K390N;ENSP00000348644:K401N;ENSP00000451117:K438N;ENSP00000451300:K449N;ENSP00000451513:K305N;ENSP00000347169:K449N;ENSP00000352563:K438N;ENSP00000451625:K401N;ENSP00000446001:K254N;ENSP00000394025:K303N;ENSP00000452069:K292N;ENSP00000450817:K243N;ENSP00000441258:K438N	ENSP00000347169:K449N	K	-	3	2	NUMB	72813648	1.000000	0.71417	0.991000	0.47740	0.793000	0.44817	1.668000	0.37481	1.599000	0.50093	0.655000	0.94253	AAG	NUMB	-	pirsf_Numb/numb-like		0.612	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	C			73743895	-1	no_errors	ENST00000355058	ensembl	human	known	70_37	missense	SNP	1.000	G
NXN	64359	genome.wustl.edu	37	17	729296	729296	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:729296C>T	ENST00000336868.3	-	2	474	c.383G>A	c.(382-384)cGa>cAa	p.R128Q	NXN_ENST00000577098.1_5'UTR|NXN_ENST00000537628.2_5'UTR|NXN_ENST00000575801.1_Missense_Mutation_p.R20Q	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	128					cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GTTGGAAATTCGGTATTTGTT	0.453																																																	0													162.0	146.0	151.0					17																	729296		2203	4300	6503	SO:0001583	missense	64359				CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.383G>A	17.37:g.729296C>T	ENSP00000337443:p.Arg128Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.R128Q	ENST00000336868.3	37	c.383	CCDS10998.1	17	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669013	0.67814	.	.	ENSG00000167693	ENST00000336868;ENST00000537628	T	0.80480	-1.38	6.17	5.2	0.72013	Thioredoxin-like fold (2);	0.100502	0.64402	N	0.000002	T	0.68979	0.3060	N	0.22421	0.69	0.80722	D	1	P;P;D	0.53151	0.688;0.948;0.958	B;B;B	0.40199	0.064;0.322;0.278	T	0.68777	-0.5319	10	0.26408	T	0.33	-4.7226	16.1198	0.81342	0.1346:0.8654:0.0:0.0	.	20;15;128	B4DXQ0;Q6DKJ4-2;Q6DKJ4	.;.;NXN_HUMAN	Q	128;20	ENSP00000337443:R128Q	ENSP00000337443:R128Q	R	-	2	0	NXN	676046	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.972000	0.70448	1.613000	0.50231	0.655000	0.94253	CGA	NXN	-	superfamily_Thioredoxin-like_fold		0.453	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXN	HGNC	protein_coding	OTTHUMT00000206669.1	C			729296	-1	no_errors	ENST00000336868	ensembl	human	known	70_37	missense	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228461607	228461607	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:228461607G>A	ENST00000422127.1	+	18	5318	c.5274G>A	c.(5272-5274)gaG>gaA	p.E1758E	OBSCN_ENST00000359599.6_Silent_p.E605E|OBSCN_ENST00000284548.11_Silent_p.E1758E|OBSCN_ENST00000570156.2_Silent_p.E2133E|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.3_ENST00000602529.1_RNA|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1758	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ATGGTGTGGAGATTCGCCGCA	0.642																																																	0													20.0	24.0	23.0					1																	228461607		2107	4217	6324	SO:0001819	synonymous_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5274G>A	1.37:g.228461607G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E1758	ENST00000422127.1	37	c.5274	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		G	NM_052843		228461607	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	silent	SNP	1.000	A
OCRL	4952	genome.wustl.edu	37	X	128696373	128696373	+	Missense_Mutation	SNP	C	C	T	rs137853263		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:128696373C>T	ENST00000371113.4	+	11	1117	c.952C>T	c.(952-954)Cgc>Tgc	p.R318C	OCRL_ENST00000357121.5_Missense_Mutation_p.R318C	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	318	5-phosphatase.		R -> C (in DD2 and OCRL; dbSNP:rs137853263). {ECO:0000269|PubMed:15627218, ECO:0000269|PubMed:17384968, ECO:0000269|PubMed:21031565}.		cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.R318C(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						TCAACTGGTGCGCCTTGTTGG	0.408																																																	1	Substitution - Missense(1)	endometrium(1)	GRCh37	CM050304	OCRL	M	rs137853263						182.0	162.0	168.0					X																	128696373		2203	4300	6503	SO:0001583	missense	4952			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.952C>T	X.37:g.128696373C>T	ENSP00000360154:p.Arg318Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R318C	ENST00000371113.4	37	c.952	CCDS35393.1	X	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174191	0.78452	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.95690	-3.78;-3.78	5.54	5.54	0.83059	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99376	1.0921	10	0.87932	D	0	.	17.3733	0.87384	0.0:1.0:0.0:0.0	.	318;318	Q01968-2;Q01968	.;OCRL_HUMAN	C	318	ENSP00000360154:R318C;ENSP00000349635:R318C	ENSP00000349635:R318C	R	+	1	0	OCRL	128524054	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	7.484000	0.81180	2.316000	0.78162	0.513000	0.50165	CGC	OCRL	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.408	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	HGNC	protein_coding	OTTHUMT00000058917.1	C	NM_000276		128696373	+1	no_errors	ENST00000371113	ensembl	human	known	70_37	missense	SNP	1.000	T
OOEP	441161	genome.wustl.edu	37	6	74078950	74078950	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:74078950G>A	ENST00000370359.5	-	2	348	c.349C>T	c.(349-351)Cac>Tac	p.H117Y	OOEP_ENST00000370363.1_Missense_Mutation_p.H62Y|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	117					cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						TGTTCTCGGTGAAACCATGCC	0.562																																																	0													60.0	60.0	60.0					6																	74078950		2004	4178	6182	SO:0001583	missense	441161			BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.349C>T	6.37:g.74078950G>A	ENSP00000359384:p.His117Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIN5|A9UIB7	Missense_Mutation	SNP	NULL	p.H117Y	ENST00000370359.5	37	c.349	CCDS47451.1	6	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788093	0.31593	.	.	ENSG00000203907	ENST00000370363;ENST00000370359;ENST00000441145	T;T;T	0.14391	2.51;2.51;2.51	3.55	-1.33	0.09172	.	1.075700	0.07190	N	0.855538	T	0.06508	0.0167	M	0.74881	2.28	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.10450	0.005;0.004	T	0.46020	-0.9221	10	0.72032	D	0.01	-5.7378	7.2713	0.26258	0.5768:0.0:0.4232:0.0	.	62;117	F2Z364;A6NGQ2	.;OOEP_HUMAN	Y	62;117;62	ENSP00000359388:H62Y;ENSP00000359384:H117Y;ENSP00000397430:H62Y	ENSP00000359384:H117Y	H	-	1	0	OOEP	74135671	0.021000	0.18746	0.000000	0.03702	0.001000	0.01503	0.648000	0.24828	-0.331000	0.08501	-0.768000	0.03414	CAC	OOEP	-	NULL		0.562	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OOEP	HGNC	protein_coding	OTTHUMT00000108414.2	G	NM_001080507		74078950	-1	no_errors	ENST00000370359	ensembl	human	known	70_37	missense	SNP	0.000	A
OR10X1	128367	genome.wustl.edu	37	1	158549459	158549459	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:158549459G>C	ENST00000368150.1	-	1	230	c.231C>G	c.(229-231)ctC>ctG	p.L77L		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					CACTAAGGAAGAGATACATAG	0.493																																																	0													124.0	116.0	119.0					1																	158549459		2203	4300	6503	SO:0001819	synonymous_variant	128367			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.231C>G	1.37:g.158549459G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFR8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L77	ENST00000368150.1	37	c.231	CCDS30900.1	1																																																																																			OR10X1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.493	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	HGNC	protein_coding	OTTHUMT00000051850.2	G	NM_001004477		158549459	-1	no_errors	ENST00000368150	ensembl	human	known	70_37	silent	SNP	0.832	C
OR13C2	392376	genome.wustl.edu	37	9	107367884	107367884	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:107367884G>C	ENST00000542196.1	-	1	67	c.25C>G	c.(25-27)Ctg>Gtg	p.L9V		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L9V(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AATTCCACCAGAATGGTGTGG	0.373																																																	1	Substitution - Missense(1)	cervix(1)											47.0	52.0	50.0					9																	107367884		2195	4299	6494	SO:0001583	missense	392376				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.25C>G	9.37:g.107367884G>C	ENSP00000438815:p.Leu9Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L9V	ENST00000542196.1	37	c.25	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.111042	0.00353	.	.	ENSG00000257019	ENST00000542196	T	0.00299	8.22	3.39	-1.19	0.09585	.	0.313759	0.16689	U	0.203629	T	0.00039	0.0001	N	0.00081	-2.22	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47114	-0.9142	10	0.02654	T	1	.	0.7009	0.00908	0.3362:0.1654:0.331:0.1674	.	9	Q8NGS9	O13C2_HUMAN	V	9	ENSP00000438815:L9V	ENSP00000438815:L9V	L	-	1	2	OR13C2	106407705	0.000000	0.05858	0.093000	0.20910	0.892000	0.51952	-2.895000	0.00707	-0.123000	0.11745	-0.379000	0.06801	CTG	OR13C2	-	NULL		0.373	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	G	NM_001004481		107367884	-1	no_errors	ENST00000542196	ensembl	human	known	70_37	missense	SNP	0.000	C
OR2AJ1	127608	genome.wustl.edu	37	1	248097469	248097469	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:248097469G>A	ENST00000318244.3	+	1	399	c.399G>A	c.(397-399)ccG>ccA	p.P133P				Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						TGCGCTATCCGATTCTTATGA	0.542																																																	0																																										SO:0001819	synonymous_variant	127608					1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.399G>A	1.37:g.248097469G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.P133	ENST00000318244.3	37	c.399		1																																																																																			OR2AJ1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.542	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	HGNC	protein_coding	OTTHUMT00000096863.1	G	NG_004652		248097469	+1	no_errors	ENST00000318244	ensembl	human	known	70_37	silent	SNP	0.000	A
OSBPL5	114879	genome.wustl.edu	37	11	3140812	3140812	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:3140812C>A	ENST00000263650.7	-	7	815	c.656G>T	c.(655-657)aGc>aTc	p.S219I	OSBPL5_ENST00000542243.1_Intron|OSBPL5_ENST00000389989.3_Missense_Mutation_p.S151I|OSBPL5_ENST00000525498.1_Missense_Mutation_p.S130I|OSBPL5_ENST00000348039.5_Missense_Mutation_p.S151I	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	219	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GATCAGGTAGCTGCTGGGCAG	0.642																																																	0													87.0	84.0	85.0					11																	3140812		2202	4298	6500	SO:0001583	missense	114879			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.656G>T	11.37:g.3140812C>A	ENSP00000263650:p.Ser219Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S219I	ENST00000263650.7	37	c.656	CCDS31344.1	11	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071656	0.76301	.	.	ENSG00000021762	ENST00000263650;ENST00000389989;ENST00000525498;ENST00000348039	T;T;T;T	0.76316	-1.01;1.22;2.68;1.22	4.33	3.38	0.38709	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.060094	0.64402	D	0.000003	D	0.84732	0.5537	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.71674	0.996;0.992;0.996;0.998	D;D;D;D	0.74674	0.944;0.942;0.944;0.984	D	0.86123	0.1570	10	0.87932	D	0	0.1912	13.9294	0.63986	0.0:0.8465:0.1534:0.0	.	130;180;151;219	B4DVB0;E7EP03;Q8N596;Q9H0X9	.;.;.;OSBL5_HUMAN	I	219;151;130;151	ENSP00000263650:S219I;ENSP00000374639:S151I;ENSP00000433342:S130I;ENSP00000302872:S151I	ENSP00000263650:S219I	S	-	2	0	OSBPL5	3097388	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.217000	0.51184	0.997000	0.38969	0.561000	0.74099	AGC	OSBPL5	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.642	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL5	HGNC	protein_coding	OTTHUMT00000032332.2	C			3140812	-1	no_errors	ENST00000263650	ensembl	human	known	70_37	missense	SNP	1.000	A
OR52R1	119695	genome.wustl.edu	37	11	4824913	4824913	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:4824913G>A	ENST00000356069.2	-	1	697	c.698C>T	c.(697-699)tCa>tTa	p.S233L	MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.S312L|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTTCACCTGAGGGCAACTG	0.483																																																	0													77.0	73.0	74.0					11																	4824913		2201	4298	6499	SO:0001583	missense	119695			BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.698C>T	11.37:g.4824913G>A	ENSP00000348368:p.Ser233Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFI0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S312L	ENST00000356069.2	37	c.935	CCDS31360.2	11	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035341	0.54896	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00330	8.08;8.08	5.57	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.156711	0.29972	N	0.010726	T	0.00936	0.0031	H	0.96916	3.905	0.09310	N	1	D	0.53462	0.96	P	0.57009	0.811	T	0.24693	-1.0153	10	0.87932	D	0	.	7.5979	0.28058	0.0757:0.0:0.6326:0.2917	.	233	Q8NGF1	O52R1_HUMAN	L	233;312	ENSP00000348368:S233L;ENSP00000369742:S312L	ENSP00000348368:S233L	S	-	2	0	OR52R1	4781489	0.001000	0.12720	0.307000	0.25127	0.966000	0.64601	1.076000	0.30729	0.879000	0.35944	0.650000	0.86243	TCA	OR52R1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.483	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	HGNC	protein_coding	OTTHUMT00000142183.1	G	NM_001005177		4824913	-1	no_errors	ENST00000380382	ensembl	human	known	70_37	missense	SNP	0.001	A
OVCH1	341350	genome.wustl.edu	37	12	29631791	29631791	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:29631791C>T	ENST00000318184.5	-	9	1045	c.1046G>A	c.(1045-1047)cGa>cAa	p.R349Q	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	349	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.R349Q(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ACTGCTTGATCGTAAAGATAC	0.303																																																	1	Substitution - Missense(1)	NS(1)											103.0	94.0	97.0					12																	29631791		1835	4080	5915	SO:0001583	missense	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1046G>A	12.37:g.29631791C>T	ENSP00000326708:p.Arg349Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,pfscan_CUB,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R349Q	ENST00000318184.5	37	c.1046		12	.	.	.	.	.	.	.	.	.	.	C	0.095	-1.161140	0.01673	.	.	ENSG00000187950	ENST00000318184	T	0.21191	2.02	3.04	-0.811	0.10857	CUB (3);	.	.	.	.	T	0.07279	0.0184	N	0.03608	-0.345	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.39231	-0.9624	9	0.20519	T	0.43	.	4.9005	0.13771	0.0:0.1063:0.3668:0.5269	.	349	Q7RTY7	OVCH1_HUMAN	Q	349	ENSP00000326708:R349Q	ENSP00000326708:R349Q	R	-	2	0	OVCH1	29523058	0.996000	0.38824	0.893000	0.35052	0.088000	0.18126	0.341000	0.19909	-0.164000	0.10927	-2.289000	0.00267	CGA	OVCH1	-	superfamily_CUB,pfscan_CUB		0.303	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	C	NM_183378		29631791	-1	no_errors	ENST00000318184	ensembl	human	known	70_37	missense	SNP	0.959	T
PARP9	83666	genome.wustl.edu	37	3	122274229	122274229	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:122274229C>T	ENST00000360356.2	-	4	1121	c.894G>A	c.(892-894)aaG>aaA	p.K298K	PARP9_ENST00000462315.1_Silent_p.K263K|PARP9_ENST00000471785.1_Silent_p.K263K|PARP9_ENST00000477522.2_Silent_p.K263K|PARP9_ENST00000492382.1_Intron	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	298					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CCAGCTCACTCTTCCCTAGGA	0.473																																																	0													170.0	166.0	168.0					3																	122274229		2203	4300	6503	SO:0001819	synonymous_variant	83666			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.894G>A	3.37:g.122274229C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	pfam_A1pp,smart_A1pp,pfscan_A1pp,pfscan_Poly(ADP-ribose)pol_cat_dom	p.K298	ENST00000360356.2	37	c.894	CCDS3014.1	3																																																																																			PARP9	-	NULL		0.473	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	HGNC	protein_coding	OTTHUMT00000355957.1	C	NM_031458		122274229	-1	no_errors	ENST00000360356	ensembl	human	known	70_37	silent	SNP	0.000	T
PCDH12	51294	genome.wustl.edu	37	5	141336489	141336489	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:141336489G>A	ENST00000231484.3	-	1	2138	c.928C>T	c.(928-930)Cta>Tta	p.L310L	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	310	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATAGTCTAGAGGTCGACGC	0.527																																																	0													72.0	65.0	68.0					5																	141336489		2203	4300	6503	SO:0001819	synonymous_variant	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.928C>T	5.37:g.141336489G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L310	ENST00000231484.3	37	c.928	CCDS4269.1	5																																																																																			PCDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.527	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	G	NM_016580		141336489	-1	no_errors	ENST00000231484	ensembl	human	known	70_37	silent	SNP	0.922	A
PCGF6	84108	genome.wustl.edu	37	10	105107191	105107191	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:105107191G>C	ENST00000369847.3	-	4	641	c.574C>G	c.(574-576)Caa>Gaa	p.Q192E	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Intron	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	192					negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		ACTATGTCTTGTAACTGTCGG	0.343																																																	0													100.0	98.0	99.0					10																	105107191		2203	4299	6502	SO:0001583	missense	84108			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.574C>G	10.37:g.105107191G>C	ENSP00000358862:p.Gln192Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q192E	ENST00000369847.3	37	c.574	CCDS31275.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051666	0.75960	.	.	ENSG00000156374	ENST00000369847	T	0.37058	1.22	5.4	5.4	0.78164	Zinc finger, RING/FYVE/PHD-type (1);	0.059777	0.64402	N	0.000002	T	0.59348	0.2187	M	0.69823	2.125	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.59894	-0.7368	10	0.52906	T	0.07	.	17.7349	0.88390	0.0:0.0:1.0:0.0	.	192	Q9BYE7	PCGF6_HUMAN	E	192	ENSP00000358862:Q192E	ENSP00000358862:Q192E	Q	-	1	0	PCGF6	105097181	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.840000	0.92125	2.518000	0.84900	0.462000	0.41574	CAA	PCGF6	-	NULL		0.343	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1	G	NM_032154		105107191	-1	no_errors	ENST00000369847	ensembl	human	known	70_37	missense	SNP	1.000	C
PCNXL3	399909	genome.wustl.edu	37	11	65395032	65395032	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:65395032C>T	ENST00000355703.3	+	22	4220	c.3681C>T	c.(3679-3681)ctC>ctT	p.L1227L		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1227						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						ACTACTTCCTCATGTCCCTGC	0.592																																																	0													161.0	160.0	160.0					11																	65395032		2030	4195	6225	SO:0001819	synonymous_variant	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3681C>T	11.37:g.65395032C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6MZN8	Silent	SNP	pfam_Pecanex	p.L1227	ENST00000355703.3	37	c.3681	CCDS44650.1	11																																																																																			PCNXL3	-	NULL		0.592	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	C	NM_032223		65395032	+1	no_errors	ENST00000355703	ensembl	human	known	70_37	silent	SNP	1.000	T
PDILT	204474	genome.wustl.edu	37	16	20380942	20380942	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:20380942C>T	ENST00000302451.4	-	8	1236	c.988G>A	c.(988-990)Gag>Aag	p.E330K		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	330					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ATATCGACCTCTGTGACCCGG	0.458																																																	0													177.0	172.0	174.0					16																	20380942		2203	4300	6503	SO:0001583	missense	204474				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.988G>A	16.37:g.20380942C>T	ENSP00000305465:p.Glu330Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVQ5	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.E330K	ENST00000302451.4	37	c.988	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.639444	0.00799	.	.	ENSG00000169340	ENST00000302451	T	0.14640	2.49	4.9	1.62	0.23740	Thioredoxin-like fold (1);	0.748266	0.12804	N	0.437752	T	0.11324	0.0276	L	0.56769	1.78	0.09310	N	1	B	0.22211	0.066	B	0.22880	0.042	T	0.40924	-0.9537	10	0.09084	T	0.74	.	5.5077	0.16864	0.1722:0.6411:0.0:0.1866	.	330	Q8N807	PDILT_HUMAN	K	330	ENSP00000305465:E330K	ENSP00000305465:E330K	E	-	1	0	PDILT	20288443	0.030000	0.19436	0.004000	0.12327	0.180000	0.23129	1.524000	0.35942	0.638000	0.30545	0.563000	0.77884	GAG	PDILT	-	superfamily_Thioredoxin-like_fold		0.458	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	C	NM_174924		20380942	-1	no_errors	ENST00000302451	ensembl	human	known	70_37	missense	SNP	0.000	T
PDZD3	79849	genome.wustl.edu	37	11	119057178	119057178	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:119057178C>T	ENST00000531114.1	+	2	856	c.307C>T	c.(307-309)Cac>Tac	p.H103Y	PDZD3_ENST00000392817.2_Missense_Mutation_p.H103Y|PDZD3_ENST00000322712.4_Intron|PDZD3_ENST00000525131.1_Intron|PDZD3_ENST00000355547.5_Intron			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	103					cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CTGCCCACCTCACCCTCCAGA	0.612																																																	0													51.0	49.0	50.0					11																	119057178		2200	4295	6495	SO:0001583	missense	79849			AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.307C>T	11.37:g.119057178C>T	ENSP00000431164:p.His103Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H103Y	ENST00000531114.1	37	c.307		11	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448797	0.63178	.	.	ENSG00000172367	ENST00000531114;ENST00000392817	T;T	0.39787	1.06;1.06	5.28	0.829	0.18847	PDZ/DHR/GLGF (1);	0.457515	0.20754	N	0.086282	T	0.29223	0.0727	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.14578	0.011	T	0.21759	-1.0236	9	0.44086	T	0.13	4.5616	9.8669	0.41150	0.0:0.6671:0.0:0.3329	.	103	Q86UT5	NHRF4_HUMAN	Y	103	ENSP00000431164:H103Y;ENSP00000376564:H103Y	ENSP00000376564:H103Y	H	+	1	0	PDZD3	118562388	0.000000	0.05858	0.002000	0.10522	0.966000	0.64601	0.082000	0.14847	0.280000	0.22209	0.655000	0.94253	CAC	PDZD3	-	superfamily_PDZ		0.612	PDZD3-004	KNOWN	basic	protein_coding	PDZD3	HGNC	protein_coding	OTTHUMT00000388471.1	C	NM_024791		119057178	+1	no_errors	ENST00000392817	ensembl	human	known	70_37	missense	SNP	0.000	T
PILRB	29990	genome.wustl.edu	37	7	99949970	99949970	+	5'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:99949970G>A	ENST00000452089.1	+	0	172				PILRB_ENST00000448382.1_5'UTR|PILRB_ENST00000610247.1_5'UTR|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA|PILRB_ENST00000444073.1_5'Flank			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGACAACATGAAGACTTCCT	0.612																																																	0																																										SO:0001623	5_prime_UTR_variant	29990			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.-888G>A	7.37:g.99949970G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q69YF9|Q9HBS0	RNA	SNP	-	NULL	ENST00000452089.1	37	NULL	CCDS43622.1	7																																																																																			PILRB	-	-		0.612	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2	G	NM_178238		99949970	+1	no_errors	ENST00000470714	ensembl	human	known	70_37	rna	SNP	0.012	A
PINK1	65018	genome.wustl.edu	37	1	20977205	20977205	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:20977205G>A	ENST00000321556.4	+	0	1861				PINK1-AS_ENST00000451424.1_RNA|PINK1_ENST00000492302.1_3'UTR	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1						activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGGAGCTGGTGAATTACTAAA	0.562																																					Esophageal Squamous(145;853 1803 8146 34412 35011)												0													27.0	25.0	25.0					1																	20977205		2203	4300	6503	SO:0001624	3_prime_UTR_variant	65018			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.*21G>A	1.37:g.20977205G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6T9|Q8NBU3|Q96DE4	RNA	SNP	-	NULL	ENST00000321556.4	37	NULL	CCDS211.1	1																																																																																			PINK1	-	-		0.562	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PINK1	HGNC	protein_coding	OTTHUMT00000007954.1	G	NM_032409		20977205	+1	no_errors	ENST00000400490	ensembl	human	known	70_37	rna	SNP	0.001	A
PKIB	5570	genome.wustl.edu	37	6	123039060	123039060	+	Missense_Mutation	SNP	G	G	A	rs201327015		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:123039060G>A	ENST00000368448.1	+	5	748	c.121G>A	c.(121-123)Gga>Aga	p.G41R	PKIB_ENST00000368452.2_Missense_Mutation_p.G41R|PKIB_ENST00000368446.1_Missense_Mutation_p.G50R|PKIB_ENST00000258014.3_Missense_Mutation_p.G48R|PKIB_ENST00000392490.1_Missense_Mutation_p.G41R|PKIB_ENST00000354275.2_Missense_Mutation_p.G41R|PKIB_ENST00000392491.2_Missense_Mutation_p.G41R			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta	41							cAMP-dependent protein kinase inhibitor activity (GO:0004862)			large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		TGCCACAGACGGAACCTCAGA	0.502																																																	0								G	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	110.0	103.0	105.0		121,121,121	4.6	0.0	6		105	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	PKIB	NM_032471.4,NM_181794.1,NM_181795.1	125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	41/79,41/79,41/79	123039060	1,13005	2203	4300	6503	SO:0001583	missense	5570				CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.121G>A	6.37:g.123039060G>A	ENSP00000357433:p.Gly41Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCK2|Q567T9|Q5T0Z7	Missense_Mutation	SNP	pfam_cAMP_dep_PKI,pirsf_cAMP_dep_PKI	p.G50R	ENST00000368448.1	37	c.148	CCDS5126.1	6	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936537	0.73442	0.0	1.16E-4	ENSG00000135549	ENST00000392491;ENST00000368452;ENST00000368448;ENST00000392490;ENST00000258014;ENST00000354275;ENST00000368446	.	.	.	5.43	4.56	0.56223	.	0.170739	0.36066	N	0.002802	T	0.16342	0.0393	.	.	.	0.09310	N	0.999991	P;P	0.45531	0.86;0.86	B;B	0.37198	0.243;0.243	T	0.03619	-1.1019	8	0.72032	D	0.01	-7.5995	14.4057	0.67081	0.0705:0.0:0.9295:0.0	.	48;41	Q5T0Z7;Q9C010	.;IPKB_HUMAN	R	41;41;41;41;48;41;50	.	ENSP00000258014:G48R	G	+	1	0	PKIB	123080759	1.000000	0.71417	0.003000	0.11579	0.138000	0.21146	4.733000	0.62036	1.530000	0.49136	0.655000	0.94253	GGA	PKIB	-	pfam_cAMP_dep_PKI,pirsf_cAMP_dep_PKI		0.502	PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PKIB	HGNC	protein_coding	OTTHUMT00000042035.1	G			123039060	+1	no_errors	ENST00000368446	ensembl	human	known	70_37	missense	SNP	0.059	A
PMS2	5395	genome.wustl.edu	37	7	6018285	6018285	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:6018285C>T	ENST00000265849.7	-	13	2322	c.2217G>A	c.(2215-2217)ctG>ctA	p.L739L	PMS2_ENST00000406569.3_Intron|PMS2_ENST00000441476.2_Silent_p.L633L|PMS2_ENST00000382321.4_Silent_p.L338L	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	739					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GATTTTCTATCAGAACAGCTT	0.343			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													56.0	48.0	51.0					7																	6018285		2197	4280	6477	SO:0001819	synonymous_variant	5395	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2217G>A	7.37:g.6018285C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Silent	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.L739	ENST00000265849.7	37	c.2217	CCDS5343.1	7																																																																																			PMS2	-	pfam_MutL_C,smart_MutL_C		0.343	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	C	NM_000535		6018285	-1	no_errors	ENST00000265849	ensembl	human	known	70_37	silent	SNP	0.988	T
PLEKHA8	84725	genome.wustl.edu	37	7	30092483	30092483	+	Splice_Site	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:30092483G>C	ENST00000449726.1	+	7	1146		c.e7+1		PLEKHA8_ENST00000258679.7_Splice_Site|PLEKHA8_ENST00000396259.1_Splice_Site|PLEKHA8_ENST00000396257.2_Splice_Site	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8						ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						AATATAACAGGTAAAAACAAA	0.299																																																	0													33.0	31.0	31.0					7																	30092483		2178	4291	6469	SO:0001630	splice_region_variant	84725			BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.796+1G>C	7.37:g.30092483G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Splice_Site	SNP	-	e7+1	ENST00000449726.1	37	c.796+1	CCDS56473.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090567	0.76756	.	.	ENSG00000106086	ENST00000258679;ENST00000449726;ENST00000396257;ENST00000396259;ENST00000440706	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8923	0.86090	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHA8	30059008	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.582000	0.67477	2.768000	0.95171	0.655000	0.94253	.	PLEKHA8	-	-		0.299	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA8	HGNC	protein_coding		G	NM_032639	Intron	30092483	+1	no_errors	ENST00000449726	ensembl	human	known	70_37	splice_site	SNP	1.000	C
POGZ	23126	genome.wustl.edu	37	1	151403234	151403234	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:151403234G>A	ENST00000271715.2	-	4	681	c.367C>T	c.(367-369)Caa>Taa	p.Q123*	POGZ_ENST00000361398.3_Nonsense_Mutation_p.Q70*|POGZ_ENST00000392723.1_Nonsense_Mutation_p.Q70*|POGZ_ENST00000409503.1_Nonsense_Mutation_p.Q123*|POGZ_ENST00000491586.1_Nonsense_Mutation_p.Q70*|POGZ_ENST00000531094.1_Nonsense_Mutation_p.Q70*|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000368863.2_Intron	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	123					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AATACTGGTTGAGTAACCATT	0.507																																																	0													136.0	134.0	135.0					1																	151403234		2203	4300	6503	SO:0001587	stop_gained	23126			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.367C>T	1.37:g.151403234G>A	ENSP00000271715:p.Gln123*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Nonsense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_Znf_C2H2	p.Q123*	ENST00000271715.2	37	c.367	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739719	0.69304	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000437847;ENST00000533461;ENST00000533351;ENST00000450842	.	.	.	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.3466	17.5046	0.87741	0.0:0.0:1.0:0.0	.	.	.	.	X	70;123;70;123;70;70;123;123;123;70	.	ENSP00000271715:Q123X	Q	-	1	0	POGZ	149669858	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.169000	0.71913	2.708000	0.92522	0.585000	0.79938	CAA	POGZ	-	NULL		0.507	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	G	NM_207171		151403234	-1	no_errors	ENST00000271715	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PPP2R5E	5529	genome.wustl.edu	37	14	64006361	64006361	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:64006361C>G	ENST00000337537.3	-	2	645	c.43G>C	c.(43-45)Gac>Cac	p.D15H	PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000555899.1_Missense_Mutation_p.D15H	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	15					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		GAAAATCCGTCTACTTTATCC	0.448																																																	0													119.0	104.0	109.0					14																	64006361		2203	4300	6503	SO:0001583	missense	5529			L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.43G>C	14.37:g.64006361C>G	ENSP00000337641:p.Asp15His	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.D15H	ENST00000337537.3	37	c.43	CCDS9758.1	14	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530901	0.85706	.	.	ENSG00000154001	ENST00000337537;ENST00000555899	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.65923	0.2738	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.65443	0.935;0.935;0.935	T	0.64402	-0.6416	9	0.38643	T	0.18	-8.7063	19.3054	0.94161	0.0:1.0:0.0:0.0	.	15;15;15	B7ZKK9;B7Z5X1;Q16537	.;.;2A5E_HUMAN	H	15	.	ENSP00000337641:D15H	D	-	1	0	PPP2R5E	63076114	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.275000	0.78548	2.539000	0.85634	0.650000	0.86243	GAC	PPP2R5E	-	pirsf_PP2A_B56		0.448	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5E	HGNC	protein_coding	OTTHUMT00000276973.1	C	NM_006246		64006361	-1	no_errors	ENST00000337537	ensembl	human	known	70_37	missense	SNP	1.000	G
PPP4R1L	55370	genome.wustl.edu	37	20	56825954	56825954	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:56825954C>G	ENST00000334187.8	-	7	611	c.598G>C	c.(598-600)Gag>Cag	p.E200Q	PPP4R1L_ENST00000244070.3_Missense_Mutation_p.E171Q|PPP4R1L_ENST00000462333.1_5'UTR			Q9P1A2	PP4RL_HUMAN	protein phosphatase 4, regulatory subunit 1-like	200																	AAAAATTTCTCAGTGGCTTCT	0.328																																																	0																																										SO:0001583	missense	55370			AF119843		20q13.32	2013-03-28			ENSG00000124224	ENSG00000124224			15755	other	unknown				C20orf192		14702039, 11780052	Standard	NR_003505		Approved	bA196N14.4, bA196N14.5	uc002xyy.1	Q9P1A2	OTTHUMG00000032838	ENST00000334187.8:c.598G>C	20.37:g.56825954C>G	ENSP00000335579:p.Glu200Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRM4|Q96LY6|Q9BZ17|Q9BZ18	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E200Q	ENST00000334187.8	37	c.598		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.249257|4.249257	0.80024|0.80024	.|.	.|.	ENSG00000124224|ENSG00000124224	ENST00000334187;ENST00000244070|ENST00000422302	T;T|.	0.32272|.	1.46;1.46|.	5.88|5.88	3.92|3.92	0.45320|0.45320	.|.	0.170708|.	0.39341|.	U|.	0.001393|.	T|.	0.62539|.	0.2436|.	.|.	.|.	.|.	0.45118|0.45118	D|D	0.99813|0.99813	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|.	0.59172|.	-0.7504|.	9|.	0.66056|.	D|.	0.02|.	.|.	11.7096|11.7096	0.51618|0.51618	0.0:0.8095:0.1242:0.0664|0.0:0.8095:0.1242:0.0664	.|.	200|.	B4DRM4|.	.|.	Q|S	200;171|22	ENSP00000335579:E200Q;ENSP00000244070:E171Q|.	ENSP00000244070:E171Q|.	E|X	-|-	1|2	0|2	PPP4R1L|PPP4R1L	56259360|56259360	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.968000|0.968000	0.65278|0.65278	4.488000|4.488000	0.60300|0.60300	0.802000|0.802000	0.34089|0.34089	0.637000|0.637000	0.83480|0.83480	GAG|TGA	PPP4R1L	-	superfamily_ARM-type_fold,pfscan_HEAT_type_2		0.328	PPP4R1L-201	KNOWN	basic|appris_candidate_longest	protein_coding	PPP4R1L	HGNC	protein_coding		C	NR_003505		56825954	-1	no_errors	ENST00000334187	ensembl	human	known	70_37	missense	SNP	1.000	G
PPP5C	5536	genome.wustl.edu	37	19	46857221	46857221	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:46857221G>A	ENST00000012443.4	+	2	441	c.338G>A	c.(337-339)cGg>cAg	p.R113Q	PPP5C_ENST00000391919.1_Missense_Mutation_p.R7Q	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	113					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		GGCAAGTTCCGGGCCGCGCTG	0.657																																																	0													25.0	21.0	22.0					19																	46857221		2202	4298	6500	SO:0001583	missense	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.338G>A	19.37:g.46857221G>A	ENSP00000012443:p.Arg113Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16722|Q53XV2	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_PPP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ser/Thr-sp_prot-phosphatase	p.R113Q	ENST00000012443.4	37	c.338	CCDS12684.1	19	.	.	.	.	.	.	.	.	.	.	G	17.59	3.428380	0.62844	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.61859	0.07;1.64	5.07	2.51	0.30379	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.066223	0.56097	D	0.000025	T	0.33411	0.0862	N	0.17838	0.53	0.39482	D	0.9679	B;B	0.27416	0.178;0.001	B;B	0.19148	0.024;0.002	T	0.18808	-1.0325	10	0.42905	T	0.14	-19.8327	3.4712	0.07567	0.2164:0.2391:0.5445:0.0	.	113;113	B2R6R6;P53041	.;PPP5_HUMAN	Q	113;100;7	ENSP00000012443:R113Q;ENSP00000375786:R7Q	ENSP00000012443:R113Q	R	+	2	0	PPP5C	51549061	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.836000	0.75349	1.234000	0.43709	0.462000	0.41574	CGG	PPP5C	-	pfam_TPR-1,smart_TPR_repeat,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.657	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	HGNC	protein_coding	OTTHUMT00000258969.2	G	NM_006247		46857221	+1	no_errors	ENST00000012443	ensembl	human	known	70_37	missense	SNP	1.000	A
NPY4R	5540	genome.wustl.edu	37	10	47087122	47087122	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:47087122C>T	ENST00000395716.1	+	2	424	c.339C>T	c.(337-339)ctC>ctT	p.L113L	NPY4R_ENST00000374312.1_Silent_p.L113L			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	113					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										GAGAGACCCTCTGCAAGATGT	0.582																																																	0													253.0	232.0	239.0					10																	47087122		2203	4300	6503	SO:0001819	synonymous_variant	5540				CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.339C>T	10.37:g.47087122C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY4_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.L113	ENST00000395716.1	37	c.339	CCDS31193.1	10																																																																																			PPYR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM		0.582	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPYR1	HGNC	protein_coding	OTTHUMT00000047837.1	C			47087122	+1	no_errors	ENST00000374312	ensembl	human	known	70_37	silent	SNP	0.502	T
PRDM16	63976	genome.wustl.edu	37	1	3334454	3334454	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:3334454G>A	ENST00000270722.5	+	11	2803	c.2754G>A	c.(2752-2754)tcG>tcA	p.S918S	PRDM16_ENST00000441472.2_Silent_p.S917S|PRDM16_ENST00000514189.1_Silent_p.S918S|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Silent_p.S918S|PRDM16_ENST00000442529.2_Silent_p.S917S|PRDM16_ENST00000378391.2_Silent_p.S918S|PRDM16_ENST00000511072.1_Silent_p.S919S			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	918	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGGCGGACTCGGGCAGCTCCC	0.597			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													90.0	101.0	97.0					1																	3334454		2023	4184	6207	SO:0001819	synonymous_variant	63976			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2754G>A	1.37:g.3334454G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S918	ENST00000270722.5	37	c.2754	CCDS41236.2	1																																																																																			PRDM16	-	NULL		0.597	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	G	NM_022114		3334454	+1	no_errors	ENST00000270722	ensembl	human	known	70_37	silent	SNP	0.012	A
PREX2	80243	genome.wustl.edu	37	8	68968202	68968202	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:68968202C>T	ENST00000288368.4	+	10	1508	c.1231C>T	c.(1231-1233)Ctt>Ttt	p.L411F	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	411	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TAAATGCTTTCTTGGAAGGTA	0.368																																																	0													116.0	123.0	121.0					8																	68968202		2203	4300	6503	SO:0001583	missense	80243			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1231C>T	8.37:g.68968202C>T	ENSP00000288368:p.Leu411Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L411F	ENST00000288368.4	37	c.1231	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706425	0.68615	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.23950	1.88	5.69	5.69	0.88448	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.37571	0.1008	L	0.58669	1.825	0.80722	D	1	B;B;B	0.31611	0.331;0.036;0.089	B;B;B	0.43251	0.413;0.151;0.093	T	0.16424	-1.0403	10	0.72032	D	0.01	.	14.9593	0.71144	0.1427:0.8573:0.0:0.0	.	411;411;411	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	F	411	ENSP00000288368:L411F	ENSP00000288368:L411F	L	+	1	0	PREX2	69130756	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.688000	0.61715	2.840000	0.97914	0.655000	0.94253	CTT	PREX2	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom		0.368	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	C	NM_025170		68968202	+1	no_errors	ENST00000288368	ensembl	human	known	70_37	missense	SNP	1.000	T
PRKCA	5578	genome.wustl.edu	37	17	64800031	64800031	+	Missense_Mutation	SNP	G	G	A	rs140466753		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:64800031G>A	ENST00000413366.3	+	17	1921	c.1895G>A	c.(1894-1896)cGa>cAa	p.R632Q		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	632	AGC-kinase C-terminal.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	TTCTTCACACGAGGACAGCCC	0.473																																																	0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	147.0	125.0	132.0		1895	4.6	0.9	17	dbSNP_134	132	0,8600		0,0,4300	no	missense	PRKCA	NM_002737.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	632/673	64800031	1,13005	2203	4300	6503	SO:0001583	missense	5578				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1895G>A	17.37:g.64800031G>A	ENSP00000408695:p.Arg632Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.R632Q	ENST00000413366.3	37	c.1895	CCDS11664.1	17	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834989	0.32421	2.27E-4	0.0	ENSG00000154229	ENST00000413366	T	0.57436	0.4	5.57	4.6	0.57074	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.000000	0.64402	D	0.000001	T	0.48352	0.1495	L	0.52011	1.625	0.52099	D	0.999944	B	0.19583	0.037	B	0.14023	0.01	T	0.46965	-0.9153	10	0.56958	D	0.05	.	14.3942	0.67001	0.0707:0.0:0.9293:0.0	.	632	P17252	KPCA_HUMAN	Q	632	ENSP00000408695:R632Q	ENSP00000408695:R632Q	R	+	2	0	PRKCA	62230493	1.000000	0.71417	0.940000	0.37924	0.307000	0.27823	9.414000	0.97362	1.363000	0.46019	-0.136000	0.14681	CGA	PRKCA	-	pfam_Pkinase_C,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g		0.473	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	HGNC	protein_coding	OTTHUMT00000446976.1	G			64800031	+1	no_errors	ENST00000413366	ensembl	human	known	70_37	missense	SNP	1.000	A
PRKRIR	5612	genome.wustl.edu	37	11	76062771	76062771	+	Missense_Mutation	SNP	A	A	G	rs9666257		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:76062771A>G	ENST00000260045.3	-	5	1528	c.1423T>C	c.(1423-1425)Tca>Cca	p.S475P	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	475					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TCAAAATCTGACACTGCACTG	0.363																																																	0													43.0	45.0	44.0					11																	76062771		2195	4291	6486	SO:0001583	missense	5612			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1423T>C	11.37:g.76062771A>G	ENSP00000260045:p.Ser475Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.S475P	ENST00000260045.3	37	c.1423	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	A	11.15	1.554276	0.27739	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.17213	2.29;2.29	4.99	2.32	0.28847	Ribonuclease H-like (1);	0.480802	0.25686	N	0.028965	T	0.08714	0.0216	N	0.22421	0.69	0.20926	N	0.999829	B	0.29508	0.246	B	0.21917	0.037	T	0.23154	-1.0196	10	0.33141	T	0.24	.	5.1682	0.15096	0.1497:0.1501:0.0:0.7003	.	475	O43422	P52K_HUMAN	P	300;475	ENSP00000436249:S300P;ENSP00000260045:S475P	ENSP00000260045:S475P	S	-	1	0	PRKRIR	75740419	0.970000	0.33590	0.995000	0.50966	0.959000	0.62525	0.964000	0.29306	0.873000	0.35799	-0.305000	0.09177	TCA	PRKRIR	-	superfamily_RNaseH-like_dom		0.363	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	A	NM_004705		76062771	-1	no_errors	ENST00000260045	ensembl	human	known	70_37	missense	SNP	0.978	G
PRMT8	56341	genome.wustl.edu	37	12	3703117	3703117	+	3'UTR	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:3703117C>G	ENST00000382622.3	+	0	2344				PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8						histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CGTGGGCGCTCAATAAACACA	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	56341			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.*769C>G	12.37:g.3703117C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDP0|Q8TBJ8	RNA	SNP	-	NULL	ENST00000382622.3	37	NULL	CCDS8521.2	12																																																																																			PRMT8	-	-		0.522	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT8	HGNC	protein_coding	OTTHUMT00000250297.2	C	NM_019854		3703117	+1	no_errors	ENST00000261252	ensembl	human	known	70_37	rna	SNP	0.980	G
PROS1	5627	genome.wustl.edu	37	3	93624964	93624964	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:93624964G>A	ENST00000394236.3	-	5	686	c.370C>T	c.(370-372)Ctg>Ttg	p.L124L	PROS1_ENST00000407433.1_5'UTR	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	124	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TTGCATGGCAGAGGACTACAC	0.348																																																	0													111.0	113.0	113.0					3																	93624964		2203	4300	6503	SO:0001819	synonymous_variant	5627				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.370C>T	3.37:g.93624964G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.L124	ENST00000394236.3	37	c.370	CCDS2923.1	3																																																																																			PROS1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.348	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	G	NM_000313		93624964	-1	no_errors	ENST00000394236	ensembl	human	known	70_37	silent	SNP	0.974	A
PRSS23	11098	genome.wustl.edu	37	11	86519256	86519256	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:86519256C>T	ENST00000280258.5	+	2	996	c.571C>T	c.(571-573)Cga>Tga	p.R191*	PRSS23_ENST00000441050.1_Nonsense_Mutation_p.R159*|PRSS23_ENST00000533902.2_Intron	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	191						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCAGAAGCTTCGAGTGGGCTT	0.552																																																	0													39.0	41.0	40.0					11																	86519256		2201	4299	6500	SO:0001587	stop_gained	11098			AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.571C>T	11.37:g.86519256C>T	ENSP00000280258:p.Arg191*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDJ1|B4E2J3|Q6IBI0	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.R191*	ENST00000280258.5	37	c.571	CCDS8278.1	11	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535027	0.85812	.	.	ENSG00000150687	ENST00000280258;ENST00000441050	.	.	.	5.82	2.71	0.32032	.	0.059457	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.6947	14.4917	0.67654	0.5037:0.4963:0.0:0.0	.	.	.	.	X	191;159	.	.	R	+	1	2	PRSS23	86196904	0.989000	0.36119	0.396000	0.26296	0.995000	0.86356	1.868000	0.39509	0.766000	0.33244	0.655000	0.94253	CGA	PRSS23	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like		0.552	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS23	HGNC	protein_coding	OTTHUMT00000393805.2	C	NM_007173		86519256	+1	no_errors	ENST00000280258	ensembl	human	known	70_37	nonsense	SNP	0.893	T
PSD	5662	genome.wustl.edu	37	10	104174660	104174660	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:104174660C>T	ENST00000020673.5	-	4	1610	c.1084G>A	c.(1084-1086)Gat>Aat	p.D362N	PSD_ENST00000406432.1_Missense_Mutation_p.D362N|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	362					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TCGTCCACATCTTCTTCCCCA	0.657																																																	0													115.0	99.0	104.0					10																	104174660		2203	4300	6503	SO:0001583	missense	5662			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1084G>A	10.37:g.104174660C>T	ENSP00000020673:p.Asp362Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.D362N	ENST00000020673.5	37	c.1084	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547578	0.65311	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.17370	2.28;2.28	5.31	5.31	0.75309	.	0.327658	0.30879	N	0.008690	T	0.07954	0.0199	N	0.08118	0	0.31470	N	0.668471	B	0.33694	0.421	B	0.24848	0.056	T	0.09796	-1.0658	10	0.33940	T	0.23	.	11.0944	0.48134	0.0:0.9137:0.0:0.0863	.	362	A5PKW4	PSD1_HUMAN	N	362;265;362	ENSP00000020673:D362N;ENSP00000384830:D362N	ENSP00000020673:D362N	D	-	1	0	PSD	104164650	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.047000	0.49854	2.484000	0.83849	0.561000	0.74099	GAT	PSD	-	NULL		0.657	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	C			104174660	-1	no_errors	ENST00000020673	ensembl	human	known	70_37	missense	SNP	1.000	T
PSG4	5672	genome.wustl.edu	37	19	43708175	43708175	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:43708175C>G	ENST00000405312.3	-	2	530	c.293G>C	c.(292-294)aGa>aCa	p.R98T	PSG4_ENST00000244295.9_Missense_Mutation_p.R98T|PSG4_ENST00000433626.2_Missense_Mutation_p.R98T	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	98	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				TACTCTTTCTCTTCCACTGTA	0.428																																																	0													255.0	266.0	263.0					19																	43708175		2131	4271	6402	SO:0001583	missense	5672				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.293G>C	19.37:g.43708175C>G	ENSP00000384770:p.Arg98Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R98T	ENST00000405312.3	37	c.293	CCDS46093.1	19	.	.	.	.	.	.	.	.	.	.	N	11.74	1.728964	0.30684	.	.	ENSG00000243137	ENST00000244295;ENST00000405312;ENST00000433626;ENST00000451895	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	1.65	1.65	0.23941	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84456	0.5476	M	0.91972	3.26	0.09310	N	1	P;D;D	0.89917	0.939;1.0;0.998	D;D;D	0.97110	0.949;1.0;0.967	T	0.70249	-0.4924	9	0.87932	D	0	.	6.8053	0.23774	0.0:1.0:0.0:0.0	.	98;98;98	E7EX79;Q00888-2;Q00888	.;.;PSG4_HUMAN	T	98;98;98;114	ENSP00000244295:R98T;ENSP00000384770:R98T;ENSP00000387864:R98T;ENSP00000388134:R114T	ENSP00000244295:R98T	R	-	2	0	PSG4	48400015	0.018000	0.18449	0.007000	0.13788	0.022000	0.10575	0.661000	0.25023	1.251000	0.43983	0.173000	0.16961	AGA	PSG4	-	pfam_Ig_V-set,smart_Ig_sub		0.428	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG4	HGNC	protein_coding	OTTHUMT00000323073.1	C	NM_213633		43708175	-1	no_errors	ENST00000405312	ensembl	human	known	70_37	missense	SNP	0.007	G
PTPRD	5789	genome.wustl.edu	37	9	8454584	8454584	+	Intron	SNP	C	C	T	rs370467898		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:8454584C>T	ENST00000381196.4	-	31	4419				PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Intron|PTPRD_ENST00000358503.5_Intron|PTPRD_ENST00000355233.5_Missense_Mutation_p.D885N|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000540109.1_Intron|PTPRD_ENST00000486161.1_Missense_Mutation_p.D884N|PTPRD_ENST00000356435.5_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Missense_Mutation_p.D881N	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCTCACCTGTCGGGTTTACTG	0.403										TSP Lung(15;0.13)																																							0								C	ASN/ASP,,,ASN/ASP,ASN/ASP,	0,3646		0,0,1823	86.0	80.0	82.0		2641,,,2650,2653,	5.4	1.0	9		82	1,8167		0,1,4083	no	missense,intron,intron,missense,missense,intron	PTPRD	NM_001040712.2,NM_001171025.1,NM_002839.3,NM_130391.3,NM_130392.3,NM_130393.3	23,,,23,23,	0,1,5906	TT,TC,CC		0.0122,0.0,0.0085	,,,,,	881/1503,,,884/1506,885/1507,	8454584	1,11813	1823	4084	5907	SO:0001627	intron_variant	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3876-4747G>A	9.37:g.8454584C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.D885N	ENST00000381196.4	37	c.2653	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332383	0.41297	0.0	1.22E-4	ENSG00000153707	ENST00000355233;ENST00000397611;ENST00000486161	T;T;T	0.50548	0.85;0.74;0.86	5.37	5.37	0.77165	.	.	.	.	.	T	0.58538	0.2129	L	0.34521	1.04	0.80722	D	1	D;D;B	0.76494	0.999;0.999;0.147	D;D;B	0.68621	0.959;0.959;0.04	T	0.54241	-0.8323	8	.	.	.	.	19.0886	0.93217	0.0:1.0:0.0:0.0	.	884;885;881	Q3KPJ0;Q3KPJ1;F5GWT7	.;.;.	N	885;881;884	ENSP00000347373:D885N;ENSP00000380735:D881N;ENSP00000417093:D884N	.	D	-	1	0	PTPRD	8444584	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.435000	0.80391	2.517000	0.84864	0.591000	0.81541	GAC	PTPRD	-	NULL		0.403	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	C			8454584	-1	no_errors	ENST00000355233	ensembl	human	known	70_37	missense	SNP	1.000	T
PTPRT	11122	genome.wustl.edu	37	20	40877392	40877392	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:40877392G>A	ENST00000373187.1	-	14	2246	c.2247C>T	c.(2245-2247)ggC>ggT	p.G749G	PTPRT_ENST00000373198.4_Silent_p.G768G|PTPRT_ENST00000373193.3_Silent_p.G749G|PTPRT_ENST00000356100.2_Silent_p.G768G|PTPRT_ENST00000373184.1_Silent_p.G749G|PTPRT_ENST00000373201.1_Silent_p.G749G|PTPRT_ENST00000373190.1_Silent_p.G749G			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	749					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAGCGATCACGCCAGCCATCT	0.537																																																	0																																										SO:0001819	synonymous_variant	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2247C>T	20.37:g.40877392G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.G768	ENST00000373187.1	37	c.2304	CCDS42874.1	20																																																																																			PTPRT	-	NULL		0.537	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	G			40877392	-1	no_errors	ENST00000373198	ensembl	human	known	70_37	silent	SNP	0.542	A
PUM2	23369	genome.wustl.edu	37	2	20494214	20494214	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:20494214G>C	ENST00000361078.2	-	8	1097	c.1075C>G	c.(1075-1077)Cag>Gag	p.Q359E	PUM2_ENST00000338086.5_Missense_Mutation_p.Q359E|PUM2_ENST00000536417.1_Missense_Mutation_p.Q303E|PUM2_ENST00000319801.5_Missense_Mutation_p.Q359E|PUM2_ENST00000403432.1_Missense_Mutation_p.Q359E			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	359	Ala-rich.|Gln-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTTGCTGCTGAAATAAGTTG	0.517																																																	0													127.0	122.0	123.0					2																	20494214		2203	4300	6503	SO:0001583	missense	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1075C>G	2.37:g.20494214G>C	ENSP00000354370:p.Gln359Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.Q359E	ENST00000361078.2	37	c.1075		2	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975861	0.92982	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.22539	2.1;2.34;2.28;1.95;2.1;2.1	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	M	0.62723	1.935	0.80722	D	1	P;P;D	0.53885	0.792;0.924;0.963	P;P;P	0.60012	0.695;0.857;0.867	T	0.09684	-1.0663	10	0.06891	T	0.86	-3.7287	19.8689	0.96843	0.0:0.0:1.0:0.0	.	303;359;359	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	E	359;359;359;250;359;303	ENSP00000338173:Q359E;ENSP00000354370:Q359E;ENSP00000326746:Q359E;ENSP00000409905:Q250E;ENSP00000385992:Q359E;ENSP00000440093:Q303E	ENSP00000326746:Q359E	Q	-	1	0	PUM2	20357695	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	9.869000	0.99810	2.695000	0.91970	0.557000	0.71058	CAG	PUM2	-	NULL		0.517	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	HGNC	protein_coding		G	NM_015317		20494214	-1	no_errors	ENST00000361078	ensembl	human	known	70_37	missense	SNP	1.000	C
PXN	5829	genome.wustl.edu	37	12	120659471	120659471	+	Silent	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:120659471G>T	ENST00000228307.7	-	6	927	c.786C>A	c.(784-786)gcC>gcA	p.A262A	PXN_ENST00000267257.7_Silent_p.A262A|PXN_ENST00000424649.2_Silent_p.A262A|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000458477.2_Silent_p.A129A|PXN_ENST00000536957.1_Silent_p.A260A|PXN_ENST00000397506.3_5'Flank	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	262					activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTCCCTGGTGGCAGAGGAGG	0.642																																																	0													55.0	77.0	70.0					12																	120659471		2171	4264	6435	SO:0001819	synonymous_variant	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.786C>A	12.37:g.120659471G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM,prints_Paxillin	p.A262	ENST00000228307.7	37	c.786	CCDS44997.1	12																																																																																			PXN	-	NULL		0.642	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PXN	HGNC	protein_coding	OTTHUMT00000402679.4	G	NM_002859		120659471	-1	no_errors	ENST00000267257	ensembl	human	known	70_37	silent	SNP	1.000	T
RAP1GAP2	23108	genome.wustl.edu	37	17	2923826	2923826	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:2923826G>T	ENST00000254695.8	+	19	1778	c.1688G>T	c.(1687-1689)cGc>cTc	p.R563L	RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.R548L|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.R544L|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.R563L	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	563					negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						ATCAAGCGACGCTCGGGGCTC	0.627																																																	0													30.0	36.0	34.0					17																	2923826		1930	4118	6048	SO:0001583	missense	23108			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1688G>T	17.37:g.2923826G>T	ENSP00000254695:p.Arg563Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	pfam_Rap_GAP,pfscan_Rap_GAP	p.R563L	ENST00000254695.8	37	c.1688	CCDS45573.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061007	0.76074	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.90900	-2.74;-2.73;-2.75;-2.74	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.93825	0.8025	M	0.71581	2.175	0.58432	D	0.999997	D;D	0.56746	0.977;0.961	P;P	0.57720	0.826;0.674	D	0.93860	0.7153	10	0.51188	T	0.08	-18.4625	17.6561	0.88178	0.0:0.0:1.0:0.0	.	548;563	Q684P5-2;Q684P5	.;RPGP2_HUMAN	L	563;548;544;563	ENSP00000254695:R563L;ENSP00000389824:R548L;ENSP00000439688:R544L;ENSP00000444890:R563L	ENSP00000254695:R563L	R	+	2	0	RAP1GAP2	2870576	1.000000	0.71417	0.993000	0.49108	0.826000	0.46750	8.346000	0.90060	2.420000	0.82092	0.561000	0.74099	CGC	RAP1GAP2	-	NULL		0.627	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	G			2923826	+1	no_errors	ENST00000542807	ensembl	human	known	70_37	missense	SNP	1.000	T
RARRES1	5918	genome.wustl.edu	37	3	158428576	158428576	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:158428576G>A	ENST00000237696.5	-	3	766	c.486C>T	c.(484-486)taC>taT	p.Y162Y	RARRES1_ENST00000498640.1_Intron|RARRES1_ENST00000479756.1_Silent_p.Y162Y	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	162					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	TCATTTGCTTGTAAAGCAGGT	0.368																																																	0													160.0	149.0	153.0					3																	158428576		2203	4300	6503	SO:0001819	synonymous_variant	5918			U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.486C>T	3.37:g.158428576G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N1D7	Silent	SNP	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	p.Y162	ENST00000237696.5	37	c.486	CCDS3184.1	3																																																																																			RARRES1	-	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin		0.368	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARRES1	HGNC	protein_coding	OTTHUMT00000352358.1	G			158428576	-1	no_errors	ENST00000237696	ensembl	human	known	70_37	silent	SNP	0.966	A
RASGRF1	5923	genome.wustl.edu	37	15	79327552	79327552	+	Splice_Site	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr15:79327552G>A	ENST00000419573.3	-	6	1153	c.879C>T	c.(877-879)agC>agT	p.S293S	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Splice_Site_p.S293S	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	293	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TGATGGTTTCGCTGAAAGAGA	0.567																																																	0													31.0	29.0	30.0					15																	79327552		2196	4293	6489	SO:0001630	splice_region_variant	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.879-1C>T	15.37:g.79327552G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S293	ENST00000419573.3	37	c.879	CCDS10309.1	15																																																																																			RASGRF1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.567	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	G	NM_002891	Silent	79327552	-1	no_errors	ENST00000419573	ensembl	human	known	70_37	silent	SNP	0.908	A
RBL2	5934	genome.wustl.edu	37	16	53503923	53503923	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:53503923G>A	ENST00000262133.6	+	15	2208	c.2071G>A	c.(2071-2073)Gat>Aat	p.D691N	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	691	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TAGCCCCTCTGATGGAGGGAC	0.547																																																	0													78.0	78.0	78.0					16																	53503923		2198	4300	6498	SO:0001583	missense	5934			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2071G>A	16.37:g.53503923G>A	ENSP00000262133:p.Asp691Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,smart_Cyclin-like	p.D691N	ENST00000262133.6	37	c.2071	CCDS10748.1	16	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150213	0.57151	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.89552	-2.53	5.87	5.87	0.94306	.	0.307749	0.37857	N	0.001915	D	0.86822	0.6025	L	0.47716	1.5	0.80722	D	1	B;B;B	0.27559	0.003;0.043;0.181	B;B;B	0.24155	0.004;0.039;0.051	T	0.82502	-0.0425	10	0.40728	T	0.16	-12.5148	20.2032	0.98269	0.0:0.0:1.0:0.0	.	691;401;691	Q8NE70;E9PG04;Q08999	.;.;RBL2_HUMAN	N	691;401	ENSP00000262133:D691N	ENSP00000262133:D691N	D	+	1	0	RBL2	52061424	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.531000	0.73820	2.785000	0.95823	0.650000	0.86243	GAT	RBL2	-	NULL		0.547	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	HGNC	protein_coding	OTTHUMT00000256908.3	G	NM_005611		53503923	+1	no_errors	ENST00000262133	ensembl	human	known	70_37	missense	SNP	0.998	A
RBP7	116362	genome.wustl.edu	37	1	10075889	10075889	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:10075889G>A	ENST00000294435.7	+	4	447	c.404G>A	c.(403-405)tGa>tAa	p.*135*		NM_052960.2	NP_443192.1	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular	0						cytoplasm (GO:0005737)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(1)	2		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	CAGAGAGCCTGATCCACATCC	0.478																																																	0													123.0	105.0	111.0					1																	10075889		2203	4300	6503	SO:0001819	synonymous_variant	116362			AF399927	CCDS109.1	1p36.22	2013-03-01			ENSG00000162444	ENSG00000162444		"""Fatty acid binding protein family"""	30316	protein-coding gene	gene with protein product		608604				12177003	Standard	NM_052960		Approved	CRBPIV	uc001aqq.3	Q96R05	OTTHUMG00000001798	ENST00000294435.7:c.404G>A	1.37:g.10075889G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R517|Q5SWJ4	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	p.*182	ENST00000294435.7	37	c.545	CCDS109.1	1																																																																																			RBP7	-	NULL		0.478	RBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP7	HGNC	protein_coding	OTTHUMT00000005027.2	G	NM_052960		10075889	+1	no_errors	ENST00000315901	ensembl	human	known	70_37	silent	SNP	0.994	A
RGCC	28984	genome.wustl.edu	37	13	42032533	42032533	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:42032533G>T	ENST00000379359.3	+	2	311	c.162G>T	c.(160-162)gaG>gaT	p.E54D		NM_014059.2	NP_054778.2	Q9H4X1	RGCC_HUMAN	regulator of cell cycle	54					cellular response to hypoxia (GO:0071456)|complement activation (GO:0006956)|fibroblast activation (GO:0072537)|mitotic cell cycle arrest (GO:0071850)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of exit from mitosis (GO:0001100)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mitotic cell cycle phase transition (GO:1901991)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of mitosis (GO:0045840)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stress fiber assembly (GO:0051496)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)										TCCACTACGAGGAGCACCTGG	0.687																																																	0													8.0	10.0	10.0					13																	42032533		1982	4182	6164	SO:0001583	missense	28984			AF036549	CCDS41880.1	13q14.11	2012-02-20	2012-02-20	2012-02-20	ENSG00000102760	ENSG00000102760			20369	protein-coding gene	gene with protein product	"""response gene to complement 32"""	610077	"""chromosome 13 open reading frame 15"""	C13orf15		17146433, 19158077, 19652095	Standard	NM_014059		Approved	bA157L14.2, RGC-32, RGC32	uc001uyi.2	Q9H4X1	OTTHUMG00000016796	ENST00000379359.3:c.162G>T	13.37:g.42032533G>T	ENSP00000368664:p.Glu54Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NZ48|Q9UL69	Missense_Mutation	SNP	NULL	p.E54D	ENST00000379359.3	37	c.162	CCDS41880.1	13	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440846	0.43326	.	.	ENSG00000102760	ENST00000379359	.	.	.	5.32	2.67	0.31697	.	0.102376	0.64402	D	0.000005	T	0.25827	0.0629	L	0.37750	1.13	0.28034	N	0.934001	B	0.11235	0.004	B	0.11329	0.006	T	0.14699	-1.0463	9	0.26408	T	0.33	-17.8068	2.3083	0.04180	0.2601:0.13:0.4901:0.1198	.	54	Q9H4X1	RGC32_HUMAN	D	54	.	ENSP00000368664:E54D	E	+	3	2	C13orf15	40930533	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.303000	0.33470	0.246000	0.21394	0.561000	0.74099	GAG	RGCC	-	NULL		0.687	RGCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGCC	HGNC	protein_coding	OTTHUMT00000044684.1	G	NM_014059		42032533	+1	no_errors	ENST00000379359	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF145	153830	genome.wustl.edu	37	5	158596779	158596779	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:158596779G>C	ENST00000424310.2	-	7	1205	c.846C>G	c.(844-846)ttC>ttG	p.F282L	RNF145_ENST00000520638.1_Missense_Mutation_p.F296L|RNF145_ENST00000521606.2_Missense_Mutation_p.F299L|RNF145_ENST00000519865.1_Missense_Mutation_p.F282L|RNF145_ENST00000518802.1_Missense_Mutation_p.F312L|RNF145_ENST00000274542.2_Missense_Mutation_p.F310L	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	282						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGAAACCGTGAAGACCAAAC	0.423																																																	0													57.0	57.0	57.0					5																	158596779		2203	4300	6503	SO:0001583	missense	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.846C>G	5.37:g.158596779G>C	ENSP00000409064:p.Phe282Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.F310L	ENST00000424310.2	37	c.930	CCDS56390.1	5	.	.	.	.	.	.	.	.	.	.	G	14.90	2.672841	0.47781	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.75367	-0.93;-0.91;-0.91;-0.92;-0.92;-0.93;-0.92	6.07	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.75810	0.3900	L	0.41236	1.265	0.58432	D	0.999999	D;D;D;D;P;D	0.55800	0.973;0.973;0.973;0.973;0.536;0.967	P;P;P;P;B;P	0.57101	0.813;0.813;0.813;0.813;0.304;0.716	T	0.73748	-0.3885	10	0.31617	T	0.26	-24.5818	12.2082	0.54365	0.1358:0.0:0.8642:0.0	.	298;299;296;312;282;310	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;.;RN145_HUMAN;.	L	310;282;282;298;299;312;282;296	ENSP00000274542:F310L;ENSP00000430397:F282L;ENSP00000409064:F282L;ENSP00000430753:F298L;ENSP00000445115:F299L;ENSP00000430955:F312L;ENSP00000429071:F296L	ENSP00000274542:F310L	F	-	3	2	RNF145	158529357	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.756000	0.74919	1.582000	0.49881	0.585000	0.79938	TTC	RNF145	-	NULL		0.423	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1	G	NM_144726		158596779	-1	no_errors	ENST00000274542	ensembl	human	known	70_37	missense	SNP	1.000	C
RNF220	55182	genome.wustl.edu	37	1	44877992	44877992	+	Missense_Mutation	SNP	C	C	T	rs539612817		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:44877992C>T	ENST00000355387.2	+	2	673	c.223C>T	c.(223-225)Cgg>Tgg	p.R75W	RNF220_ENST00000372247.2_Missense_Mutation_p.R75W|RNF220_ENST00000361799.2_Missense_Mutation_p.R75W			Q5VTB9	RN220_HUMAN	ring finger protein 220	75					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TATGTACCATCGGCAAGGTGG	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		21550	0.0		0.001	False		,,,				2504	0.0																0													329.0	318.0	322.0					1																	44877992		2203	4300	6503	SO:0001583	missense	55182			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.223C>T	1.37:g.44877992C>T	ENSP00000347548:p.Arg75Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	superfamily_Peptidase_M20_dimer,pfscan_Znf_RING	p.R75W	ENST00000355387.2	37	c.223	CCDS510.1	1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.484243	0.63962	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	6.05	3.97	0.46021	.	0.065779	0.64402	D	0.000010	T	0.66694	0.2815	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.72272	-0.4342	9	0.87932	D	0	.	16.7121	0.85388	0.2468:0.7532:0.0:0.0	.	75	Q5VTB9	RN220_HUMAN	W	75	.	ENSP00000347548:R75W	R	+	1	2	RNF220	44650579	1.000000	0.71417	0.979000	0.43373	0.996000	0.88848	4.624000	0.61254	1.530000	0.49136	0.655000	0.94253	CGG	RNF220	-	NULL		0.517	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	C	NM_018150		44877992	+1	no_errors	ENST00000355387	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF5	6048	genome.wustl.edu	37	6	32148026	32148026	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:32148026C>T	ENST00000375094.3	+	6	624	c.466C>T	c.(466-468)Cac>Tac	p.H156Y	AGPAT1_ENST00000336984.6_5'Flank|AGPAT1_ENST00000490711.1_5'Flank|AGPAT1_ENST00000395497.1_5'Flank|RNF5_ENST00000427134.2_Intron|AGPAT1_ENST00000375104.2_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	156					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|lung(7)|urinary_tract(2)	10						GGGACAGGGTCACCCAGCCTC	0.562																																																	0													236.0	253.0	247.0					6																	32148026		1511	2709	4220	SO:0001583	missense	6048			U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.466C>T	6.37:g.32148026C>T	ENSP00000364235:p.His156Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H156Y	ENST00000375094.3	37	c.466	CCDS4745.1	6	.	.	.	.	.	.	.	.	.	.	C	3.079	-0.189322	0.06299	.	.	ENSG00000204308	ENST00000375094	D	0.93019	-3.15	5.02	5.02	0.67125	.	0.168735	0.51477	D	0.000095	T	0.72447	0.3461	N	0.04297	-0.235	0.80722	D	1	B	0.22746	0.074	B	0.20384	0.029	T	0.72200	-0.4362	10	0.02654	T	1	.	16.1944	0.82018	0.0:1.0:0.0:0.0	.	156	Q99942	RNF5_HUMAN	Y	156	ENSP00000364235:H156Y	ENSP00000364235:H156Y	H	+	1	0	RNF5	32256004	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.643000	0.46604	2.486000	0.83907	0.561000	0.74099	CAC	RNF5	-	NULL		0.562	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF5	HGNC	protein_coding	OTTHUMT00000076133.2	C	NM_006913		32148026	+1	no_errors	ENST00000375094	ensembl	human	known	70_37	missense	SNP	0.999	T
ROS1	6098	genome.wustl.edu	37	6	117642486	117642486	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:117642486C>G	ENST00000368508.3	-	35	5911	c.5713G>C	c.(5713-5715)Gag>Cag	p.E1905Q	GOPC_ENST00000467125.1_5'UTR|ROS1_ENST00000368507.3_Missense_Mutation_p.E1899Q	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1905					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCAGCCAACTCTTTGTCTTCG	0.438			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													173.0	163.0	166.0					6																	117642486		2203	4300	6503	SO:0001583	missense	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5713G>C	6.37:g.117642486C>G	ENSP00000357494:p.Glu1905Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1905Q	ENST00000368508.3	37	c.5713	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	C	15.10	2.731706	0.48939	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.73152	-0.72;-0.72	5.16	4.3	0.51218	.	0.097326	0.44097	N	0.000499	T	0.69984	0.3172	L	0.35249	1.045	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.75379	-0.3338	10	0.62326	D	0.03	.	14.9247	0.70868	0.0:0.8559:0.1441:0.0	.	1905	P08922	ROS1_HUMAN	Q	1905;1899	ENSP00000357494:E1905Q;ENSP00000357493:E1899Q	ENSP00000357493:E1899Q	E	-	1	0	ROS1	117749179	1.000000	0.71417	0.997000	0.53966	0.241000	0.25554	3.781000	0.55394	1.323000	0.45263	-0.127000	0.14921	GAG	ROS1	-	NULL		0.438	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	C			117642486	-1	no_errors	ENST00000368508	ensembl	human	known	70_37	missense	SNP	1.000	G
RPA1	6117	genome.wustl.edu	37	17	1782335	1782335	+	Missense_Mutation	SNP	C	C	G	rs201772445		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:1782335C>G	ENST00000254719.5	+	9	849	c.739C>G	c.(739-741)Cct>Gct	p.P247A	RPA1_ENST00000573924.1_3'UTR	NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	247					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						CAAGTTCTTTCCTCTTATTGA	0.557								Nucleotide excision repair (NER)																																									0													96.0	87.0	90.0					17																	1782335		2203	4300	6503	SO:0001583	missense	6117			M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.739C>G	17.37:g.1782335C>G	ENSP00000254719:p.Pro247Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0Y9|Q59ES9	Missense_Mutation	SNP	pfam_Rep_factor-A_C,pfam_Rep_factor-A_N,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,tigrfam_Rep_factor_Rpa1	p.P247A	ENST00000254719.5	37	c.739	CCDS11014.1	17	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465833	0.43839	.	.	ENSG00000132383	ENST00000254719	T	0.20738	2.05	6.08	6.08	0.98989	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.289185	0.40144	N	0.001172	T	0.21227	0.0511	L	0.48877	1.53	0.36964	D	0.893484	B	0.20164	0.042	B	0.23275	0.045	T	0.06427	-1.0827	10	0.30078	T	0.28	-13.3574	13.8168	0.63297	0.0:0.9305:0.0:0.0695	.	247	P27694	RFA1_HUMAN	A	247	ENSP00000254719:P247A	ENSP00000254719:P247A	P	+	1	0	RPA1	1729085	0.959000	0.32827	0.936000	0.37596	0.988000	0.76386	0.734000	0.26101	2.894000	0.99253	0.591000	0.81541	CCT	RPA1	-	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,tigrfam_Rep_factor_Rpa1		0.557	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA1	HGNC	protein_coding	OTTHUMT00000207118.2	C	NM_002945		1782335	+1	no_errors	ENST00000254719	ensembl	human	known	70_37	missense	SNP	0.995	G
RPL29	6159	genome.wustl.edu	37	3	52027809	52027809	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:52027809G>A	ENST00000466397.1	-	4	576	c.436C>T	c.(436-438)Cag>Tag	p.Q146*	RPL29_ENST00000479017.1_Nonsense_Mutation_p.Q146*|RPL29_ENST00000294189.6_Nonsense_Mutation_p.Q146*|RPL29_ENST00000495383.1_Nonsense_Mutation_p.Q146*|RPL29_ENST00000475248.1_Nonsense_Mutation_p.Q146*			P47914	RL29_HUMAN	ribosomal protein L29	146					cellular protein metabolic process (GO:0044267)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTGGGAGCCTGAGCTGGAACT	0.622																																																	0													49.0	60.0	56.0					3																	52027809		1670	3080	4750	SO:0001587	stop_gained	6159			U10248	CCDS2845.1	3p21.3-p21.2	2013-03-11			ENSG00000162244	ENSG00000162244		"""L ribosomal proteins"""	10331	protein-coding gene	gene with protein product	"""60S ribosomal protein L29"", ""heparin/heparan sulfate-interacting protein"", ""HP/HS-interacting protein"", ""heparin/heparan sulfate-binding protein"", ""cell surface heparin-binding protein HIP"""	601832	"""ribosomal protein L29 pseudogene 10"""	RPL29P10		8597591	Standard	NM_000992		Approved	HIP, HUMRPL29, L29	uc003dcs.3	P47914	OTTHUMG00000155262	ENST00000466397.1:c.436C>T	3.37:g.52027809G>A	ENSP00000418868:p.Gln146*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0H3|B2R4M8|Q6IPY3	Nonsense_Mutation	SNP	pfam_Ribosomal_L29e	p.Q146*	ENST00000466397.1	37	c.436	CCDS2845.1	3	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760246	0.69763	.	.	ENSG00000162244	ENST00000466397;ENST00000294189;ENST00000479017;ENST00000495383;ENST00000475248;ENST00000492277	.	.	.	4.29	3.41	0.39046	.	2.963680	0.01624	N	0.023218	.	.	.	.	.	.	0.40764	D	0.983036	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	8.3406	0.32241	0.1059:0.0:0.8941:0.0	.	.	.	.	X	146	.	ENSP00000294189:Q146X	Q	-	1	0	RPL29	52002849	0.175000	0.23083	0.642000	0.29436	0.883000	0.51084	1.594000	0.36697	1.398000	0.46701	0.655000	0.94253	CAG	RPL29	-	NULL		0.622	RPL29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL29	HGNC	protein_coding	OTTHUMT00000349680.2	G	NM_000992		52027809	-1	no_errors	ENST00000294189	ensembl	human	known	70_37	nonsense	SNP	0.491	A
RPSAP58	388524	genome.wustl.edu	37	19	24010138	24010138	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:24010138C>T	ENST00000496398.1	+	4	598	c.175C>T	c.(175-177)Ctg>Ttg	p.L59L	RPSAP58_ENST00000354585.4_Silent_p.L59L|RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA					ribosomal protein SA pseudogene 58											endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						GGAGAAGCTTCTGCTGGCAGC	0.463																																																	0																																										SO:0001819	synonymous_variant	388524					19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.175C>T	19.37:g.24010138C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2,tigrfam_Ribosomal_S2_euk/arc	p.L59	ENST00000496398.1	37	c.175		19																																																																																			RPSAP58	-	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,tigrfam_Ribosomal_S2_euk/arc		0.463	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	RPSAP58	HGNC	protein_coding	OTTHUMT00000350238.1	C	NR_003662		24010138	+1	no_errors	ENST00000354585	ensembl	human	known	70_37	silent	SNP	1.000	T
RPSAP58	388524	genome.wustl.edu	37	19	24010572	24010572	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:24010572C>T	ENST00000496398.1	+	4	1032	c.609C>T	c.(607-609)ttC>ttT	p.F203F	RPSAP58_ENST00000354585.4_Silent_p.F203F|RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA					ribosomal protein SA pseudogene 58											endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						ATCTGTACTTCTACAGAGATC	0.532																																																	0																																										SO:0001819	synonymous_variant	388524					19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.609C>T	19.37:g.24010572C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2,tigrfam_Ribosomal_S2_euk/arc	p.F203	ENST00000496398.1	37	c.609		19																																																																																			RPSAP58	-	tigrfam_Ribosomal_S2_euk/arc		0.532	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	RPSAP58	HGNC	protein_coding	OTTHUMT00000350238.1	C	NR_003662		24010572	+1	no_errors	ENST00000354585	ensembl	human	known	70_37	silent	SNP	1.000	T
RRS1	23212	genome.wustl.edu	37	8	67342458	67342458	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:67342458G>A	ENST00000320270.2	+	1	1196	c.1092G>A	c.(1090-1092)agG>agA	p.R364R	ADHFE1_ENST00000396623.3_5'Flank|ADHFE1_ENST00000415254.1_5'Flank|ADHFE1_ENST00000379385.4_5'Flank|RP11-346I3.4_ENST00000499642.1_lincRNA	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	364	Arg/Gly/Lys-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GAAAGAGGAGGAAGTAATAGT	0.507																																																	0													81.0	99.0	93.0					8																	67342458		2191	4287	6478	SO:0001819	synonymous_variant	23212			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.1092G>A	8.37:g.67342458G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUX8	Silent	SNP	pfam_Ribosom_reg	p.R364	ENST00000320270.2	37	c.1092	CCDS6189.1	8																																																																																			RRS1	-	NULL		0.507	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRS1	HGNC	protein_coding	OTTHUMT00000380126.1	G	NM_015169		67342458	+1	no_errors	ENST00000320270	ensembl	human	known	70_37	silent	SNP	0.976	A
RSF1	51773	genome.wustl.edu	37	11	77458164	77458164	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:77458164C>G	ENST00000308488.6	-	3	591	c.289G>C	c.(289-291)Gag>Cag	p.E97Q	RSF1_ENST00000360355.2_Intron			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	97					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CTGTTAAACTCTTGGCATATC	0.333																																																	0													100.0	92.0	95.0					11																	77458164		2200	4291	6491	SO:0001583	missense	51773			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.289G>C	11.37:g.77458164C>G	ENSP00000311513:p.Glu97Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E97Q	ENST00000308488.6	37	c.289	CCDS8253.1	11	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791530	0.90367	.	.	ENSG00000048649	ENST00000308488;ENST00000528095	D;T	0.86956	-2.19;1.24	5.66	5.66	0.87406	.	0.112886	0.39544	N	0.001323	D	0.90058	0.6895	L	0.43152	1.355	0.80722	D	1	D	0.63880	0.993	P	0.58013	0.831	D	0.90514	0.4483	10	0.66056	D	0.02	-10.7261	19.3721	0.94492	0.0:1.0:0.0:0.0	.	97	Q96T23	RSF1_HUMAN	Q	97;96	ENSP00000311513:E97Q;ENSP00000436408:E96Q	ENSP00000311513:E97Q	E	-	1	0	RSF1	77135812	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.448000	0.80631	2.671000	0.90904	0.655000	0.94253	GAG	RSF1	-	NULL		0.333	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	HGNC	protein_coding	OTTHUMT00000318075.2	C	NM_016578		77458164	-1	no_errors	ENST00000308488	ensembl	human	known	70_37	missense	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	38990368	38990368	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:38990368C>G	ENST00000359596.3	+	44	7121	c.7121C>G	c.(7120-7122)tCa>tGa	p.S2374*	RYR1_ENST00000355481.4_Nonsense_Mutation_p.S2374*|RYR1_ENST00000360985.3_Nonsense_Mutation_p.S2374*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2374	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAGGGTGGCTCAGGGCTGCTG	0.692																																																	0													31.0	27.0	28.0					19																	38990368		2202	4299	6501	SO:0001587	stop_gained	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7121C>G	19.37:g.38990368C>G	ENSP00000352608:p.Ser2374*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.S2374*	ENST00000359596.3	37	c.7121	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	49	15.440450	0.99834	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	3.99	3.99	0.46301	.	0.178649	0.32473	U	0.006060	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	9.5503	0.39306	0.3667:0.6333:0.0:0.0	.	.	.	.	X	2374	.	ENSP00000347667:S2374X	S	+	2	0	RYR1	43682208	0.785000	0.28726	1.000000	0.80357	0.974000	0.67602	1.835000	0.39181	2.045000	0.60652	0.297000	0.19635	TCA	RYR1	-	NULL		0.692	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	C			38990368	+1	no_errors	ENST00000359596	ensembl	human	known	70_37	nonsense	SNP	0.998	G
RYR2	6262	genome.wustl.edu	37	1	237919656	237919656	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:237919656G>A	ENST00000366574.2	+	81	11531	c.11214G>A	c.(11212-11214)gaG>gaA	p.E3738E	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Silent_p.E3722E|RYR2_ENST00000360064.6_Silent_p.E3744E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3738					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCGCGGCTGAGATGGTGCTAC	0.488																																																	0													95.0	99.0	98.0					1																	237919656		1964	4167	6131	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11214G>A	1.37:g.237919656G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E3744	ENST00000366574.2	37	c.11232	CCDS55691.1	1																																																																																			RYR2	-	NULL		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	G	NM_001035		237919656	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	silent	SNP	1.000	A
PRKACA	5566	genome.wustl.edu	37	19	14200004	14200004	+	IGR	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:14200004C>T	ENST00000308677.4	-	0	2677				SAMD1_ENST00000541938.1_5'Flank|PRKACA_ENST00000350356.3_5'Flank|SAMD1_ENST00000533683.2_Silent_p.E269E	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						CCTTGACCCTCTCCTTGGCAC	0.677																																																	0													40.0	43.0	42.0					19																	14200004		1973	4139	6112	SO:0001628	intergenic_variant	90378				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612			19.37:g.14200004C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Silent	SNP	pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E269	ENST00000308677.4	37	c.807	CCDS12304.1	19																																																																																			SAMD1	-	NULL		0.677	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD1	HGNC	protein_coding	OTTHUMT00000459004.1	C	NM_002730		14200004	-1	no_errors	ENST00000533683	ensembl	human	novel	70_37	silent	SNP	0.954	T
SCG2	7857	genome.wustl.edu	37	2	224463757	224463757	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:224463757G>C	ENST00000305409.2	-	2	476	c.244C>G	c.(244-246)Caa>Gaa	p.Q82E		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GAGACACCTTGGTAGGGATTA	0.448																																																	0													118.0	123.0	121.0					2																	224463757		2203	4300	6503	SO:0001583	missense	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.244C>G	2.37:g.224463757G>C	ENSP00000304133:p.Gln82Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	pfam_Granin	p.Q82E	ENST00000305409.2	37	c.244	CCDS2457.1	2	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414057	0.62511	.	.	ENSG00000171951	ENST00000305409;ENST00000450330;ENST00000421386;ENST00000433889	T;T;T	0.02032	4.49;4.49;4.49	5.44	5.44	0.79542	.	0.231520	0.44688	D	0.000429	T	0.06188	0.0160	L	0.39633	1.23	0.51767	D	0.999937	P	0.50819	0.939	P	0.53809	0.735	T	0.53330	-0.8454	10	0.30078	T	0.28	.	19.6298	0.95698	0.0:0.0:1.0:0.0	.	82	P13521	SCG2_HUMAN	E	82	ENSP00000304133:Q82E;ENSP00000394702:Q82E;ENSP00000415468:Q82E	ENSP00000304133:Q82E	Q	-	1	0	SCG2	224172001	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	6.461000	0.73522	2.706000	0.92434	0.585000	0.79938	CAA	SCG2	-	pfam_Granin		0.448	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	G	NM_003469		224463757	-1	no_errors	ENST00000305409	ensembl	human	known	70_37	missense	SNP	1.000	C
SDC4	6385	genome.wustl.edu	37	20	43959178	43959178	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:43959178C>T	ENST00000372733.3	-	4	312	c.273G>A	c.(271-273)gaG>gaA	p.E91E	SDC4_ENST00000537976.1_Silent_p.E19E	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	91					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)		SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				ACCCTGCCCTCTCAGGGATAT	0.532			T	ROS1	NSCLC																																			Dom	yes		20	20q12	6385	syndecan 4		E	0													67.0	59.0	62.0					20																	43959178		2203	4300	6503	SO:0001819	synonymous_variant	6385			X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.273G>A	20.37:g.43959178C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00773|Q16833|Q53FN9|Q6FGN3	Silent	SNP	pfam_Syndecan,smart_Neurexin-like	p.E91	ENST00000372733.3	37	c.273	CCDS13350.1	20																																																																																			SDC4	-	NULL		0.532	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC4	HGNC	protein_coding	OTTHUMT00000080515.1	C	NM_002999		43959178	-1	no_errors	ENST00000372733	ensembl	human	known	70_37	silent	SNP	0.707	T
SDK1	221935	genome.wustl.edu	37	7	4260916	4260916	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:4260916C>G	ENST00000404826.2	+	40	5886	c.5747C>G	c.(5746-5748)tCt>tGt	p.S1916C	SDK1_ENST00000389531.3_Missense_Mutation_p.S1896C	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1916	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AAGTCCGCCTCTGAACTGACG	0.622																																																	0													64.0	53.0	57.0					7																	4260916		2203	4300	6503	SO:0001583	missense	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5747C>G	7.37:g.4260916C>G	ENSP00000385899:p.Ser1916Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1916C	ENST00000404826.2	37	c.5747	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822086	0.50739	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.59906	0.23;0.23	4.96	4.96	0.65561	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.81178	0.4768	M	0.90145	3.09	0.51482	D	0.999927	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	D	0.85850	0.1403	10	0.87932	D	0	.	18.2063	0.89855	0.0:1.0:0.0:0.0	.	1896;403;1916	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	C	1916;164;1896	ENSP00000385899:S1916C;ENSP00000374182:S1896C	ENSP00000374182:S1896C	S	+	2	0	SDK1	4227442	1.000000	0.71417	0.956000	0.39512	0.068000	0.16541	5.769000	0.68865	2.273000	0.75805	0.655000	0.94253	TCT	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.622	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	C	NM_152744		4260916	+1	no_errors	ENST00000404826	ensembl	human	known	70_37	missense	SNP	1.000	G
COA7	65260	genome.wustl.edu	37	1	53163902	53163902	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:53163902C>G	ENST00000371538.3	-	1	136	c.97G>C	c.(97-99)Gac>Cac	p.D33H	SELRC1_ENST00000486918.1_5'Flank	NM_023077.2	NP_075565.2														breast(1)|lung(3)|prostate(1)|urinary_tract(1)	6						CCGTCCGGGTCCTTCTCGTGG	0.627																																																	0													72.0	70.0	71.0					1																	53163902		2203	4300	6503	SO:0001583	missense	65260																														ENST00000371538.3:c.97G>C	1.37:g.53163902C>G	ENSP00000360593:p.Asp33His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.D33H	ENST00000371538.3	37	c.97	CCDS570.1	1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619084	0.66787	.	.	ENSG00000162377	ENST00000371538	T	0.52983	0.64	5.61	4.69	0.59074	Tetratricopeptide-like helical (1);	0.092635	0.64402	D	0.000001	T	0.46795	0.1411	M	0.66939	2.045	0.58432	D	0.999997	B	0.29805	0.257	B	0.35353	0.201	T	0.37979	-0.9682	10	0.23891	T	0.37	-9.2922	10.4276	0.44387	0.0:0.7952:0.1332:0.0716	.	33	Q96BR5	SELR1_HUMAN	H	33	ENSP00000360593:D33H	ENSP00000360593:D33H	D	-	1	0	SELRC1	52936490	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.117000	0.41939	1.510000	0.48803	0.561000	0.74099	GAC	SELRC1	-	NULL		0.627	SELRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELRC1	HGNC	protein_coding	OTTHUMT00000023462.1	C			53163902	-1	no_errors	ENST00000371538	ensembl	human	known	70_37	missense	SNP	1.000	G
COA7	65260	genome.wustl.edu	37	1	53163968	53163968	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:53163968C>G	ENST00000371538.3	-	1	70	c.31G>C	c.(31-33)Gag>Cag	p.E11Q	SELRC1_ENST00000486918.1_5'Flank	NM_023077.2	NP_075565.2														breast(1)|lung(3)|prostate(1)|urinary_tract(1)	6						TTGACCTGCTCCTCATCCTGG	0.677																																																	0													91.0	88.0	89.0					1																	53163968		2203	4300	6503	SO:0001583	missense	65260																														ENST00000371538.3:c.31G>C	1.37:g.53163968C>G	ENSP00000360593:p.Glu11Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.E11Q	ENST00000371538.3	37	c.31	CCDS570.1	1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343292	0.41498	.	.	ENSG00000162377	ENST00000371538	T	0.49432	0.78	5.93	5.93	0.95920	.	0.198329	0.53938	D	0.000058	T	0.46795	0.1411	M	0.61703	1.905	0.47123	D	0.999323	P	0.35507	0.506	B	0.26864	0.074	T	0.45673	-0.9245	10	0.44086	T	0.13	0.3021	19.9388	0.97151	0.0:1.0:0.0:0.0	.	11	Q96BR5	SELR1_HUMAN	Q	11	ENSP00000360593:E11Q	ENSP00000360593:E11Q	E	-	1	0	SELRC1	52936556	1.000000	0.71417	1.000000	0.80357	0.145000	0.21501	2.488000	0.45276	2.815000	0.96918	0.561000	0.74099	GAG	SELRC1	-	NULL		0.677	SELRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELRC1	HGNC	protein_coding	OTTHUMT00000023462.1	C			53163968	-1	no_errors	ENST00000371538	ensembl	human	known	70_37	missense	SNP	1.000	G
SERPINA7	6906	genome.wustl.edu	37	X	105279279	105279279	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:105279279C>T	ENST00000327674.4	-	2	1055	c.720G>A	c.(718-720)caG>caA	p.Q240Q	SERPINA7_ENST00000372563.1_Silent_p.Q240Q|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	240					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATTGTTCCATCTGGTGCATCA	0.453																																																	0													225.0	185.0	199.0					X																	105279279		2203	4300	6503	SO:0001819	synonymous_variant	6906			M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.720G>A	X.37:g.105279279C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUX1	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Prot_inh_Lserp2	p.Q240	ENST00000327674.4	37	c.720	CCDS14518.1	X																																																																																			SERPINA7	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.453	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA7	HGNC	protein_coding	OTTHUMT00000057790.1	C	NM_000354		105279279	-1	no_errors	ENST00000327674	ensembl	human	known	70_37	silent	SNP	0.470	T
SERPINB11	89778	genome.wustl.edu	37	18	61377475	61377475	+	RNA	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:61377475C>G	ENST00000382749.5	+	0	293				SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000489748.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				TTGATGTGTTCAAAGAGCTGA	0.433																																					Ovarian(27;496 784 5942 8975 23930)												0													107.0	99.0	101.0					18																	61377475		1924	4153	6077			89778					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61377475C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.F16L	ENST00000382749.5	37	c.48		18	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707500	0.48412	.	.	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.81739	-1.53;-1.53	5.14	4.25	0.50352	Serpin domain (3);	0.000000	0.52532	D	0.000066	T	0.80237	0.4586	L	0.46614	1.455	0.80722	D	1	D;P	0.55385	0.971;0.885	P;B	0.57679	0.825;0.389	T	0.76105	-0.3081	10	0.27785	T	0.31	.	7.1513	0.25612	0.1731:0.7349:0.0:0.092	.	16;16	F5GY69;Q96P15	.;SPB11_HUMAN	L	16	ENSP00000441497:F16L;ENSP00000440795:F16L	ENSP00000421854:F16L	F	+	3	2	SERPINB11	59528455	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.710000	0.37920	2.536000	0.85505	0.655000	0.94253	TTC	SERPINB11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.433	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3	C	NM_080475		61377475	+1	no_errors	ENST00000538847	ensembl	human	known	70_37	missense	SNP	1.000	G
SERPINB3	6317	genome.wustl.edu	37	18	61324221	61324221	+	Splice_Site	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:61324221C>G	ENST00000283752.5	-	7	756		c.e7-1		SERPINB3_ENST00000332821.8_Intron|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3						negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TGTATGTATTCTACAATAAAT	0.358																																																	0													100.0	84.0	90.0					18																	61324221		2203	4300	6503	SO:0001630	splice_region_variant	6317			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.613-1G>C	18.37:g.61324221C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Splice_Site	SNP	-	e6-1	ENST00000283752.5	37	c.613-1	CCDS11987.1	18	.	.	.	.	.	.	.	.	.	.	C	3.573	-0.087174	0.07097	.	.	ENSG00000057149	ENST00000283752	.	.	.	2.64	0.75	0.18387	.	.	.	.	.	.	.	.	.	.	.	0.21105	N	0.999786	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8927	0.24238	0.0:0.7156:0.1777:0.1067	.	.	.	.	.	-1	.	.	.	-	.	.	SERPINB3	59475201	0.988000	0.35896	0.001000	0.08648	0.016000	0.09150	3.074000	0.50065	0.181000	0.19994	0.455000	0.32223	.	SERPINB3	-	-		0.358	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB3	HGNC	protein_coding	OTTHUMT00000133791.1	C	NM_006919	Intron	61324221	-1	no_errors	ENST00000283752	ensembl	human	known	70_37	splice_site	SNP	0.035	G
SERPINB11	89778	genome.wustl.edu	37	18	61377519	61377519	+	RNA	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:61377519C>G	ENST00000382749.5	+	0	337				SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000489748.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				ATCTTCTTTTCTTCGCTGAGT	0.438																																					Ovarian(27;496 784 5942 8975 23930)												0													129.0	119.0	122.0					18																	61377519		1921	4149	6070			89778					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61377519C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S31C	ENST00000382749.5	37	c.92		18	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173497	0.38413	.	.	ENSG00000206072	ENST00000544088;ENST00000538847	D;D	0.95447	-3.71;-3.71	5.14	5.14	0.70334	Serpin domain (3);	0.000000	0.49916	D	0.000131	D	0.98046	0.9356	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.98614	1.0664	10	0.59425	D	0.04	.	16.4501	0.83977	0.0:1.0:0.0:0.0	.	31;31	F5GY69;Q96P15	.;SPB11_HUMAN	C	31	ENSP00000441497:S31C;ENSP00000440795:S31C	ENSP00000421854:S31C	S	+	2	0	SERPINB11	59528499	0.999000	0.42202	0.942000	0.38095	0.100000	0.18952	5.117000	0.64667	2.536000	0.85505	0.655000	0.94253	TCT	SERPINB11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.438	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3	C	NM_080475		61377519	+1	no_errors	ENST00000538847	ensembl	human	known	70_37	missense	SNP	0.993	G
SETD8	387893	genome.wustl.edu	37	12	123888168	123888168	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:123888168G>A	ENST00000402868.3	+	6	1072	c.646G>A	c.(646-648)Gaa>Aaa	p.E216K	SETD8_ENST00000330479.4_Missense_Mutation_p.E216K			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	257					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		TGGGAAGGAAGAAGGAATGAA	0.488																																																	0													152.0	138.0	142.0					12																	123888168		2203	4300	6503	SO:0001583	missense	387893			AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.646G>A	12.37:g.123888168G>A	ENSP00000384629:p.Glu216Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pirsf_Hist_H4-K20_MeTrfase,pfscan_SET_dom	p.E216K	ENST00000402868.3	37	c.646	CCDS9247.1	12	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836890	0.71373	.	.	ENSG00000183955	ENST00000402868;ENST00000330479;ENST00000437502	D;D	0.98192	-4.78;-4.78	5.05	5.05	0.67936	SET domain (1);	0.046925	0.85682	D	0.000000	D	0.96938	0.9000	L	0.54323	1.7	0.80722	D	1	B;B	0.29531	0.078;0.247	B;B	0.33890	0.051;0.172	D	0.96290	0.9213	10	0.35671	T	0.21	-29.0845	16.9963	0.86368	0.0:0.0:1.0:0.0	.	257;216	Q9NQR1;Q9NQR1-2	SETD8_HUMAN;.	K	216;216;207	ENSP00000384629:E216K;ENSP00000332995:E216K	ENSP00000332995:E216K	E	+	1	0	SETD8	122454121	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	6.378000	0.73150	2.362000	0.80069	0.561000	0.74099	GAA	SETD8	-	smart_SET_dom,pirsf_Hist_H4-K20_MeTrfase		0.488	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD8	HGNC	protein_coding	OTTHUMT00000318263.1	G	NM_020382		123888168	+1	no_errors	ENST00000330479	ensembl	human	known	70_37	missense	SNP	1.000	A
SETDB1	9869	genome.wustl.edu	37	1	150913850	150913850	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:150913850C>G	ENST00000271640.5	+	5	683	c.493C>G	c.(493-495)Cag>Gag	p.Q165E	SETDB1_ENST00000368963.1_Missense_Mutation_p.Q165E|SETDB1_ENST00000368962.2_Missense_Mutation_p.Q165E|SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Missense_Mutation_p.Q165E	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	165					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCAAGATGTTCAGAAGTTCAT	0.433																																																	0													105.0	89.0	94.0					1																	150913850		2203	4300	6503	SO:0001583	missense	9869			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.493C>G	1.37:g.150913850C>G	ENSP00000271640:p.Gln165Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.Q165E	ENST00000271640.5	37	c.493	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976201	0.74360	.	.	ENSG00000143379	ENST00000271640;ENST00000368962;ENST00000534805;ENST00000368969;ENST00000368963;ENST00000498193	D;T;T;D;T	0.88896	-2.44;0.77;1.32;-2.44;1.06	5.26	5.26	0.73747	.	0.054085	0.85682	D	0.000000	D	0.88149	0.6359	L	0.27053	0.805	0.48975	D	0.999736	D;D;P;P;P	0.61697	0.982;0.99;0.859;0.75;0.635	D;D;P;B;B	0.73380	0.952;0.98;0.554;0.325;0.173	D	0.86877	0.2039	9	.	.	.	.	16.108	0.81237	0.0:0.8666:0.1334:0.0	.	165;165;165;165;165	E9PRF4;E9PQM8;Q15047-2;Q15047-3;Q15047	.;.;.;.;SETB1_HUMAN	E	165	ENSP00000271640:Q165E;ENSP00000357958:Q165E;ENSP00000436148:Q165E;ENSP00000357965:Q165E;ENSP00000432348:Q165E	.	Q	+	1	0	SETDB1	149180474	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.157000	0.58144	2.738000	0.93877	0.655000	0.94253	CAG	SETDB1	-	NULL		0.433	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	C			150913850	+1	no_errors	ENST00000271640	ensembl	human	known	70_37	missense	SNP	1.000	G
SF3B3	23450	genome.wustl.edu	37	16	70590890	70590890	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:70590890G>A	ENST00000302516.5	+	15	2179	c.1968G>A	c.(1966-1968)gaG>gaA	p.E656E		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	656					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				AGCTGGGTGAGAGGGGCTCGA	0.522																																																	0													124.0	115.0	118.0					16																	70590890		2198	4300	6498	SO:0001819	synonymous_variant	23450			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.1968G>A	16.37:g.70590890G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.E656	ENST00000302516.5	37	c.1968	CCDS10894.1	16																																																																																			SF3B3	-	superfamily_WD40_repeat_dom		0.522	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	G	NM_012426		70590890	+1	no_errors	ENST00000302516	ensembl	human	known	70_37	silent	SNP	1.000	A
SFMBT1	51460	genome.wustl.edu	37	3	52941312	52941312	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:52941312C>T	ENST00000394752.3	-	19	2486	c.2104G>A	c.(2104-2106)Gag>Aag	p.E702K	SFMBT1_ENST00000358080.2_Missense_Mutation_p.E702K|SFMBT1_ENST00000394750.1_Missense_Mutation_p.E702K|SFMBT1_ENST00000296295.6_Missense_Mutation_p.E702K	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	702					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GGGTCATCCTCATCTTCACCC	0.408																																																	0													160.0	140.0	147.0					3																	52941312		2203	4300	6503	SO:0001583	missense	51460			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2104G>A	3.37:g.52941312C>T	ENSP00000378235:p.Glu702Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.E702K	ENST00000394752.3	37	c.2104	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219102	0.79464	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	T;T;T;T	0.16457	2.43;2.43;2.34;2.43	5.86	5.86	0.93980	.	0.181881	0.38720	N	0.001599	T	0.22399	0.0540	L	0.59436	1.845	0.80722	D	1	P;P	0.42692	0.787;0.682	B;B	0.41510	0.359;0.197	T	0.02805	-1.1108	10	0.11485	T	0.65	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	702;702	Q9UHJ3-2;Q9UHJ3	.;SMBT1_HUMAN	K	702	ENSP00000378235:E702K;ENSP00000350789:E702K;ENSP00000296295:E702K;ENSP00000378233:E702K	ENSP00000296295:E702K	E	-	1	0	SFMBT1	52916352	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.238000	0.78173	2.937000	0.99478	0.650000	0.86243	GAG	SFMBT1	-	NULL		0.408	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	HGNC	protein_coding	OTTHUMT00000353040.3	C	NM_016329		52941312	-1	no_errors	ENST00000358080	ensembl	human	known	70_37	missense	SNP	1.000	T
SFSWAP	6433	genome.wustl.edu	37	12	132284171	132284171	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:132284171G>C	ENST00000261674.4	+	0	3135				SFSWAP_ENST00000539506.1_3'UTR|RNA5SP378_ENST00000363646.1_RNA	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family						mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						ATGACATTTTGAGTTTTAAGA	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	6433			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.*138G>C	12.37:g.132284171G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN45|B7ZM97|F5H6B8|Q6PJF7	RNA	SNP	-	NULL	ENST00000261674.4	37	NULL	CCDS9273.1	12																																																																																			SFSWAP	-	-		0.423	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	G	NM_004592		132284171	+1	no_errors	ENST00000539506	ensembl	human	known	70_37	rna	SNP	1.000	C
SGK3	23678	genome.wustl.edu	37	8	67748196	67748196	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:67748196G>A	ENST00000396596.1	+	10	842	c.628G>A	c.(628-630)Gaa>Aaa	p.E210K	SGK3_ENST00000520976.1_Missense_Mutation_p.E210K|SGK3_ENST00000345714.4_Missense_Mutation_p.E210K|SGK3_ENST00000521198.2_Missense_Mutation_p.E210K|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.E210K|SGK3_ENST00000522398.1_Missense_Mutation_p.E210K	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	210	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TATTATGGCTGAACGTAATGT	0.328																																																	0													112.0	113.0	112.0					8																	67748196		2202	4298	6500	SO:0001583	missense	23678				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.628G>A	8.37:g.67748196G>A	ENSP00000379842:p.Glu210Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Phox,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Phox,pfscan_Prot_kinase_cat_dom	p.E210K	ENST00000396596.1	37	c.628	CCDS6195.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.500503	0.96355	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000519396;ENST00000521152	T;T;T;T;T;T;T;D	0.84873	1.28;1.28;1.28;1.28;1.28;1.28;1.28;-1.91	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.094910	0.64402	D	0.000001	D	0.93864	0.8037	M	0.88704	2.975	0.42758	D	0.993797	D;D	0.71674	0.986;0.998	P;D	0.72982	0.894;0.979	D	0.94306	0.7541	9	0.87932	D	0	.	19.9659	0.97266	0.0:0.0:1.0:0.0	.	210;210	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	K	210;210;210;210;210;210;210;92;107	ENSP00000429022:E210K;ENSP00000430463:E210K;ENSP00000430256:E210K;ENSP00000430691:E210K;ENSP00000379842:E210K;ENSP00000331816:E210K;ENSP00000428529:E92K;ENSP00000429565:E107K	ENSP00000262211:E210K	E	+	1	0	SGK3	67910750	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.824000	0.99380	2.719000	0.93026	0.650000	0.86243	GAA	SGK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.328	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK3	HGNC	protein_coding	OTTHUMT00000379232.3	G			67748196	+1	no_errors	ENST00000262211	ensembl	human	known	70_37	missense	SNP	1.000	A
SGK3	23678	genome.wustl.edu	37	8	67748268	67748268	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:67748268G>A	ENST00000396596.1	+	10	914	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	SGK3_ENST00000520976.1_Missense_Mutation_p.E234K|SGK3_ENST00000345714.4_Missense_Mutation_p.E234K|SGK3_ENST00000521198.2_Missense_Mutation_p.E234K|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.E234K|SGK3_ENST00000522398.1_Missense_Mutation_p.E234K	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CCAAACAACTGAAAAGCTTTA	0.308																																																	0													143.0	153.0	149.0					8																	67748268		2202	4300	6502	SO:0001583	missense	23678				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.700G>A	8.37:g.67748268G>A	ENSP00000379842:p.Glu234Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Phox,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Phox,pfscan_Prot_kinase_cat_dom	p.E234K	ENST00000396596.1	37	c.700	CCDS6195.1	8	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666501	0.88251	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000519396;ENST00000521152	T;T;T;T;T;T;T;T	0.64618	3.14;3.14;3.14;3.14;3.14;3.14;3.14;-0.11	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.147999	0.64402	D	0.000009	T	0.55847	0.1946	N	0.25332	0.735	0.33455	D	0.584133	B;B	0.18610	0.029;0.013	B;B	0.25759	0.037;0.063	T	0.55276	-0.8166	9	0.62326	D	0.03	.	19.9856	0.97347	0.0:0.0:1.0:0.0	.	234;234	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	K	234;234;234;234;234;234;234;116;131	ENSP00000429022:E234K;ENSP00000430463:E234K;ENSP00000430256:E234K;ENSP00000430691:E234K;ENSP00000379842:E234K;ENSP00000331816:E234K;ENSP00000428529:E116K;ENSP00000429565:E131K	ENSP00000262211:E234K	E	+	1	0	SGK3	67910822	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.824000	0.99380	2.724000	0.93272	0.655000	0.94253	GAA	SGK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.308	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK3	HGNC	protein_coding	OTTHUMT00000379232.3	G			67748268	+1	no_errors	ENST00000262211	ensembl	human	known	70_37	missense	SNP	1.000	A
SH3PXD2B	285590	genome.wustl.edu	37	5	171766800	171766800	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:171766800G>A	ENST00000311601.5	-	13	1479	c.1309C>T	c.(1309-1311)Ctg>Ttg	p.L437L	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	437					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGGGGAGCCAGAAAGTTGGGT	0.627																																																	0													60.0	65.0	64.0					5																	171766800		2203	4300	6503	SO:0001819	synonymous_variant	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1309C>T	5.37:g.171766800G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B6F0V2|Q9P2Q1	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.L437	ENST00000311601.5	37	c.1309	CCDS34291.1	5																																																																																			SH3PXD2B	-	superfamily_SH3_domain		0.627	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	G	NM_017963		171766800	-1	no_errors	ENST00000311601	ensembl	human	known	70_37	silent	SNP	0.985	A
SHARPIN	81858	genome.wustl.edu	37	8	145153884	145153884	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:145153884C>T	ENST00000398712.2	-	8	1497	c.1061G>A	c.(1060-1062)tGt>tAt	p.C354Y	SHARPIN_ENST00000533948.1_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	354					apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCAGGAAGGACAGGACCAGCT	0.632																																																	0													51.0	57.0	55.0					8																	145153884		2066	4208	6274	SO:0001583	missense	81858			AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.1061G>A	8.37:g.145153884C>T	ENSP00000381698:p.Cys354Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.C354Y	ENST00000398712.2	37	c.1061	CCDS43777.1	8	.	.	.	.	.	.	.	.	.	.	c	14.06	2.421482	0.42918	.	.	ENSG00000179526	ENST00000532536;ENST00000398712	D;D	0.99797	-6.79;-6.79	4.62	4.62	0.57501	Zinc finger, RanBP2-type (4);	.	.	.	.	D	0.99753	0.9901	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97089	0.9789	9	0.87932	D	0	.	12.8515	0.57860	0.0:1.0:0.0:0.0	.	354	Q9H0F6	SHRPN_HUMAN	Y	62;354	ENSP00000432355:C62Y;ENSP00000381698:C354Y	ENSP00000381698:C354Y	C	-	2	0	SHARPIN	145225872	1.000000	0.71417	0.809000	0.32408	0.123000	0.20343	6.100000	0.71473	2.420000	0.82092	0.550000	0.68814	TGT	SHARPIN	-	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2		0.632	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	HGNC	protein_coding	OTTHUMT00000382901.1	C	NM_030974		145153884	-1	no_errors	ENST00000398712	ensembl	human	known	70_37	missense	SNP	1.000	T
SHC2	25759	genome.wustl.edu	37	19	438722	438722	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:438722C>T	ENST00000264554.6	-	4	715	c.716G>A	c.(715-717)cGc>cAc	p.R239H		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	239	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCACCTGGCGCGTGGCAGG	0.677																																																	0													30.0	33.0	32.0					19																	438722		2063	4152	6215	SO:0001583	missense	25759			AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.716G>A	19.37:g.438722C>T	ENSP00000264554:p.Arg239His	Somatic		WXS	Illumina HiSeq	Phase_IV	O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH2,smart_PTyr_interaction_dom,smart_SH2,pfscan_PTyr_interaction_dom,pfscan_SH2,prints_PID_domain,prints_SH2	p.R239H	ENST00000264554.6	37	c.716	CCDS45891.1	19	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023886	0.54683	.	.	ENSG00000129946	ENST00000264554	T	0.14022	2.54	3.67	2.62	0.31277	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.12689	0.0308	L	0.56769	1.78	0.52501	D	0.99995	P	0.43231	0.801	B	0.34779	0.189	T	0.06789	-1.0807	10	0.52906	T	0.07	-31.9498	11.0459	0.47859	0.0:0.9043:0.0:0.0957	.	239	P98077	SHC2_HUMAN	H	239	ENSP00000264554:R239H	ENSP00000264554:R239H	R	-	2	0	SHC2	389722	1.000000	0.71417	0.983000	0.44433	0.660000	0.38997	3.492000	0.53259	0.849000	0.35215	0.491000	0.48974	CGC	SHC2	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom		0.677	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC2	HGNC	protein_coding	OTTHUMT00000451840.3	C			438722	-1	no_errors	ENST00000264554	ensembl	human	known	70_37	missense	SNP	1.000	T
SI	6476	genome.wustl.edu	37	3	164750342	164750342	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:164750342G>C	ENST00000264382.3	-	24	2766	c.2704C>G	c.(2704-2706)Cat>Gat	p.H902D		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	902	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATTGGAATGAGCGTTCATT	0.318										HNSCC(35;0.089)																																							0													154.0	147.0	149.0					3																	164750342		2202	4300	6502	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2704C>G	3.37:g.164750342G>C	ENSP00000264382:p.His902Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.H902D	ENST00000264382.3	37	c.2704	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	1.132	-0.652191	0.03480	.	.	ENSG00000090402	ENST00000264382	T	0.13307	2.6	4.88	1.88	0.25563	.	0.556435	0.19584	N	0.110800	T	0.09512	0.0234	L	0.48642	1.525	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35425	-0.9789	10	0.13108	T	0.6	.	4.8891	0.13717	0.0856:0.1472:0.6158:0.1513	.	902	P14410	SUIS_HUMAN	D	902	ENSP00000264382:H902D	ENSP00000264382:H902D	H	-	1	0	SI	166233036	0.026000	0.19158	0.002000	0.10522	0.005000	0.04900	1.479000	0.35453	0.748000	0.32831	0.655000	0.94253	CAT	SI	-	NULL		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	G	NM_001041		164750342	-1	no_errors	ENST00000264382	ensembl	human	known	70_37	missense	SNP	0.001	C
SIPA1L1	26037	genome.wustl.edu	37	14	72128168	72128168	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:72128168G>A	ENST00000555818.1	+	7	2587	c.2239G>A	c.(2239-2241)Gac>Aac	p.D747N	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.D747N|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.D222N|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.D747N	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	747	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TCCGTGCTCTGACAGTGTCTG	0.512																																																	0													152.0	126.0	135.0					14																	72128168		2203	4300	6503	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2239G>A	14.37:g.72128168G>A	ENSP00000450832:p.Asp747Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.D747N	ENST00000555818.1	37	c.2239	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.247326	0.95305	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37	5.78	5.78	0.91487	Rap/ran-GAP (2);	0.166245	0.64402	D	0.000004	D	0.95758	0.8620	L	0.56340	1.77	0.80722	D	1	D;B;D;P;P	0.60575	0.973;0.029;0.988;0.735;0.762	P;B;D;B;P	0.64877	0.839;0.061;0.93;0.444;0.565	D	0.95418	0.8504	10	0.66056	D	0.02	-23.9275	20.3668	0.98882	0.0:0.0:1.0:0.0	.	222;747;222;747;747	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	N	747;747;747;222	ENSP00000370630:D747N;ENSP00000450832:D747N;ENSP00000351352:D747N;ENSP00000440682:D222N	ENSP00000351352:D747N	D	+	1	0	SIPA1L1	71197921	1.000000	0.71417	0.631000	0.29282	0.452000	0.32318	9.835000	0.99442	2.894000	0.99253	0.655000	0.94253	GAC	SIPA1L1	-	pfam_Rap_GAP,pfscan_Rap_GAP		0.512	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	G	NM_015556		72128168	+1	no_errors	ENST00000555818	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC25A40	55972	genome.wustl.edu	37	7	87487978	87487978	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:87487978G>C	ENST00000341119.5	-	3	411	c.65C>G	c.(64-66)tCa>tGa	p.S22*		NM_018843.3	NP_061331.2	Q8TBP6	S2540_HUMAN	solute carrier family 25, member 40	22					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	17	Esophageal squamous(14;0.00202)					TCCAGTACATGAGGCAAGCAT	0.328																																																	0													146.0	138.0	140.0					7																	87487978		2203	4300	6503	SO:0001587	stop_gained	55972			AF125531	CCDS5610.1	7q21.12	2013-05-22			ENSG00000075303	ENSG00000075303		"""Solute carriers"""	29680	protein-coding gene	gene with protein product		610821				16949250	Standard	NM_018843		Approved	MCFP	uc003uje.3	Q8TBP6	OTTHUMG00000131033	ENST00000341119.5:c.65C>G	7.37:g.87487978G>C	ENSP00000344831:p.Ser22*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K483|D6W5P6|Q53GB1|Q9UHR1	Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.S22*	ENST00000341119.5	37	c.65	CCDS5610.1	7	.	.	.	.	.	.	.	.	.	.	G	38	6.756789	0.97817	.	.	ENSG00000075303	ENST00000341119	.	.	.	5.43	4.56	0.56223	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.956	11.3036	0.49320	0.0851:0.0:0.9149:0.0	.	.	.	.	X	22	.	ENSP00000344831:S22X	S	-	2	0	SLC25A40	87325914	1.000000	0.71417	0.996000	0.52242	0.857000	0.48899	5.444000	0.66587	1.423000	0.47198	0.650000	0.86243	TCA	SLC25A40	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.328	SLC25A40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A40	HGNC	protein_coding	OTTHUMT00000253677.5	G	NM_018843		87487978	-1	no_errors	ENST00000341119	ensembl	human	known	70_37	nonsense	SNP	1.000	C
SLC25A42	284439	genome.wustl.edu	37	19	19216387	19216387	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:19216387C>G	ENST00000318596.7	+	5	382	c.231C>G	c.(229-231)ctC>ctG	p.L77L	SLC25A42_ENST00000600275.1_Intron	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	77					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TCCGGGTCCTCTACTACACCT	0.637																																																	0													82.0	63.0	70.0					19																	19216387		2203	4300	6503	SO:0001819	synonymous_variant	284439				CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.231C>G	19.37:g.19216387C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D2T2J5|O14553|O43378	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Graves_DC	p.L77	ENST00000318596.7	37	c.231	CCDS32966.1	19																																																																																			SLC25A42	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.637	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A42	HGNC	protein_coding	OTTHUMT00000465931.1	C	NM_178526		19216387	+1	no_errors	ENST00000318596	ensembl	human	known	70_37	silent	SNP	1.000	G
SLC44A3	126969	genome.wustl.edu	37	1	95293118	95293118	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:95293118C>T	ENST00000271227.6	+	4	436	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C	SLC44A3_ENST00000527077.1_Intron|SLC44A3_ENST00000446120.2_Missense_Mutation_p.R76C|SLC44A3_ENST00000467909.1_Missense_Mutation_p.R64C|SLC44A3_ENST00000530397.1_Intron|SLC44A3_ENST00000529450.1_Intron|SLC44A3_ENST00000532427.1_Intron	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	112					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GCAGCTCAACCGCATGGCCCT	0.483																																																	0													163.0	151.0	155.0					1																	95293118		2203	4300	6503	SO:0001583	missense	126969			BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.334C>T	1.37:g.95293118C>T	ENSP00000271227:p.Arg112Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.R112C	ENST00000271227.6	37	c.334	CCDS44176.1	1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845237	0.32606	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000467909;ENST00000422520	T;T;T;T	0.78481	-1.18;-1.18;2.71;-1.18	5.67	0.55	0.17219	.	0.401325	0.24176	N	0.040854	T	0.40862	0.1134	N	0.08118	0	0.19945	N	0.999941	D;D	0.54772	0.958;0.968	P;B	0.46543	0.52;0.249	T	0.47032	-0.9148	10	0.87932	D	0	-0.5379	5.4325	0.16460	0.1335:0.1335:0.0:0.7331	.	76;112	Q8N4M1-3;Q8N4M1	.;CTL3_HUMAN	C	76;112;64;64	ENSP00000389143:R76C;ENSP00000271227:R112C;ENSP00000432789:R64C;ENSP00000410832:R64C	ENSP00000271227:R112C	R	+	1	0	SLC44A3	95065706	0.805000	0.28982	0.007000	0.13788	0.070000	0.16714	1.219000	0.32479	-0.079000	0.12707	0.655000	0.94253	CGC	SLC44A3	-	NULL		0.483	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A3	HGNC	protein_coding	OTTHUMT00000029544.3	C	NM_152369		95293118	+1	no_errors	ENST00000271227	ensembl	human	known	70_37	missense	SNP	0.103	T
SLC30A10	55532	genome.wustl.edu	37	1	220100374	220100374	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:220100374G>A	ENST00000366926.3	-	2	875	c.714C>T	c.(712-714)atC>atT	p.I238I	SLC30A10_ENST00000536446.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	238					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TCCTACCTCTGATATTCAGAG	0.383																																					Colon(76;360 1614 43677 51136)												0													166.0	155.0	159.0					1																	220100374		2203	4300	6503	SO:0001819	synonymous_variant	55532			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.714C>T	1.37:g.220100374G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AL9|Q9NPW0	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.I238	ENST00000366926.3	37	c.714	CCDS31026.1	1																																																																																			SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux		0.383	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	G	NM_018713		220100374	-1	no_errors	ENST00000366926	ensembl	human	known	70_37	silent	SNP	1.000	A
SMARCB1	6598	genome.wustl.edu	37	22	24143243	24143243	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:24143243G>A	ENST00000263121.7	+	4	671	c.475G>A	c.(475-477)Gac>Aac	p.D159N	SMARCB1_ENST00000407422.3_Missense_Mutation_p.D150N|SMARCB1_ENST00000407082.3_Intron|SMARCB1_ENST00000344921.6_Missense_Mutation_p.D150N	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	159	DNA-binding. {ECO:0000255}.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(5)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CATGGGCCGAGACAAGAAGAG	0.572			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	5	Deletion - Frameshift(3)|Unknown(2)	soft_tissue(5)											214.0	134.0	161.0					22																	24143243		2203	4300	6503	SO:0001583	missense	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.475G>A	22.37:g.24143243G>A	ENSP00000263121:p.Asp159Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	pfam_SNF5,pirsf_SWI_SNF_chromatin_remodel_cplx	p.D159N	ENST00000263121.7	37	c.475	CCDS13817.1	22	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939542	0.73557	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422	D;D;D;D	0.93488	-2.86;-3.23;-3.22;-3.23	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.92166	0.7516	N	0.08118	0	0.80722	D	1	D;D;B;P;B;D	0.69078	0.974;0.991;0.046;0.565;0.415;0.997	P;P;B;B;B;D	0.73380	0.736;0.857;0.037;0.108;0.108;0.98	D	0.92385	0.5916	10	0.33141	T	0.24	-39.629	17.5554	0.87888	0.0:0.0:1.0:0.0	.	150;159;150;150;159;159	B4E117;B4DRT1;G5E975;Q17S11;Q12824;C9JTA6	.;.;.;.;SNF5_HUMAN;.	N	159;150;159;150	ENSP00000388489:D159N;ENSP00000340883:D150N;ENSP00000263121:D159N;ENSP00000383984:D150N	ENSP00000263121:D159N	D	+	1	0	SMARCB1	22473243	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	2.477000	0.83638	0.644000	0.83932	GAC	SMARCB1	-	pirsf_SWI_SNF_chromatin_remodel_cplx		0.572	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCB1	HGNC	protein_coding	OTTHUMT00000319872.1	G	NM_003073		24143243	+1	no_errors	ENST00000263121	ensembl	human	known	70_37	missense	SNP	1.000	A
SMARCB1	6598	genome.wustl.edu	37	22	24158954	24158954	+	Intron	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr22:24158954C>T	ENST00000263121.7	+	6	824				SMARCB1_ENST00000407422.3_Intron|SMARCB1_ENST00000407082.3_Intron|SMARCB1_ENST00000477836.1_3'UTR|SMARCB1_ENST00000344921.6_Intron	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1						ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)			bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CTCCTGATTTCAGAGAAGTTG	0.527			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	0													134.0	129.0	131.0					22																	24158954		2203	4300	6503	SO:0001627	intron_variant	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.629-3C>T	22.37:g.24158954C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	RNA	SNP	-	NULL	ENST00000263121.7	37	NULL	CCDS13817.1	22																																																																																			SMARCB1	-	-		0.527	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCB1	HGNC	protein_coding	OTTHUMT00000319872.1	C	NM_003073		24158954	+1	no_errors	ENST00000477836	ensembl	human	known	70_37	rna	SNP	1.000	T
SMARCC2	6601	genome.wustl.edu	37	12	56559231	56559231	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:56559231G>C	ENST00000267064.4	-	26	3096	c.3010C>G	c.(3010-3012)Cca>Gca	p.P1004A	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Missense_Mutation_p.P1035A|SMARCC2_ENST00000347471.4_Missense_Mutation_p.P1035A|SMARCC2_ENST00000394023.3_Missense_Mutation_p.P1035A	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1004	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AAACTTCCTGGAGGGGCCCCA	0.672																																																	0													16.0	17.0	17.0					12																	56559231		2196	4283	6479	SO:0001583	missense	6601			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3010C>G	12.37:g.56559231G>C	ENSP00000267064:p.Pro1004Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.P1004A	ENST00000267064.4	37	c.3010	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575330	0.45902	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.52754	1.1;0.65;0.74;0.7	4.34	4.34	0.51931	.	0.000000	0.43919	D	0.000515	T	0.45175	0.1329	N	0.08118	0	0.49687	D	0.99981	D;D;D;D;D	0.60575	0.98;0.988;0.98;0.98;0.988	D;D;D;D;D	0.73708	0.956;0.981;0.956;0.956;0.981	T	0.35649	-0.9780	10	0.18276	T	0.48	-7.1359	14.2998	0.66339	0.0:0.0:1.0:0.0	.	924;1035;1039;1004;1035	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	A	1035;1035;1035;1004	ENSP00000377591:P1035A;ENSP00000449396:P1035A;ENSP00000302919:P1035A;ENSP00000267064:P1004A	ENSP00000267064:P1004A	P	-	1	0	SMARCC2	54845498	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.926000	0.56491	2.451000	0.82905	0.650000	0.86243	CCA	SMARCC2	-	NULL		0.672	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	G			56559231	-1	no_errors	ENST00000267064	ensembl	human	known	70_37	missense	SNP	1.000	C
SMARCC2	6601	genome.wustl.edu	37	12	56559333	56559333	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:56559333G>A	ENST00000267064.4	-	26	2994	c.2908C>T	c.(2908-2910)Cag>Tag	p.Q970*	RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550164.1_Nonsense_Mutation_p.Q1001*|SMARCC2_ENST00000347471.4_Nonsense_Mutation_p.Q1001*|SMARCC2_ENST00000394023.3_Nonsense_Mutation_p.Q1001*	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	970	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GGGATAGGCTGGGAGCCTGGG	0.667																																																	0													26.0	32.0	30.0					12																	56559333		2202	4294	6496	SO:0001587	stop_gained	6601			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.2908C>T	12.37:g.56559333G>A	ENSP00000267064:p.Gln970*	Somatic		WXS	Illumina HiSeq	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Nonsense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.Q970*	ENST00000267064.4	37	c.2908	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.370616	0.98241	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	.	.	.	4.21	4.21	0.49690	.	0.510762	0.18614	N	0.136069	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-12.0226	15.91	0.79467	0.0:0.0:1.0:0.0	.	.	.	.	X	1001;1001;1001;970	.	ENSP00000267064:Q970X	Q	-	1	0	SMARCC2	54845600	0.988000	0.35896	1.000000	0.80357	0.899000	0.52679	0.923000	0.28757	2.381000	0.81170	0.555000	0.69702	CAG	SMARCC2	-	NULL		0.667	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	G			56559333	-1	no_errors	ENST00000267064	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SMARCD3	6604	genome.wustl.edu	37	7	150936713	150936713	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:150936713G>C	ENST00000262188.8	-	11	1703	c.1293C>G	c.(1291-1293)ctC>ctG	p.L431L	RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000356800.2_Silent_p.L418L|SMARCD3_ENST00000477169.1_5'Flank|MIR671_ENST00000390183.1_RNA|SMARCD3_ENST00000392811.2_Silent_p.L418L	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	431					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTTCACCTTGAGGTCCCGGC	0.557																																																	0													97.0	103.0	101.0					7																	150936713		2203	4300	6503	SO:0001819	synonymous_variant	6604			U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.1293C>G	7.37:g.150936713G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Silent	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.L431	ENST00000262188.8	37	c.1293	CCDS34780.1	7																																																																																			SMARCD3	-	NULL		0.557	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD3	HGNC	protein_coding	OTTHUMT00000348825.1	G	NM_001003801		150936713	-1	no_errors	ENST00000262188	ensembl	human	known	70_37	silent	SNP	0.983	C
SNRNP200	23020	genome.wustl.edu	37	2	96940773	96940773	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:96940773C>G	ENST00000323853.5	-	45	6465	c.6388G>C	c.(6388-6390)Gag>Cag	p.E2130Q	SNRNP200_ENST00000349783.5_Missense_Mutation_p.E619Q	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	2130					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CTGTCTGTCTCAGCTTCTTTC	0.463																																																	0													174.0	159.0	164.0					2																	96940773		2203	4300	6503	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.6388G>C	2.37:g.96940773C>G	ENSP00000317123:p.Glu2130Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E2130Q	ENST00000323853.5	37	c.6388	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718834	0.48622	.	.	ENSG00000144028	ENST00000323853;ENST00000349783;ENST00000536601;ENST00000543553	T;T	0.68624	-0.34;1.47	5.31	5.31	0.75309	.	0.061488	0.64402	D	0.000005	T	0.56093	0.1962	L	0.34521	1.04	0.30984	N	0.722215	B	0.10296	0.003	B	0.09377	0.004	T	0.52917	-0.8511	10	0.21540	T	0.41	-24.9579	16.5621	0.84569	0.0:1.0:0.0:0.0	.	2130	O75643	U520_HUMAN	Q	2130;619;589;713	ENSP00000317123:E2130Q;ENSP00000326937:E619Q	ENSP00000317123:E2130Q	E	-	1	0	SNRNP200	96304500	1.000000	0.71417	0.981000	0.43875	0.987000	0.75469	7.548000	0.82154	2.489000	0.83994	0.650000	0.86243	GAG	SNRNP200	-	NULL		0.463	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	C	NM_014014		96940773	-1	no_errors	ENST00000323853	ensembl	human	known	70_37	missense	SNP	0.999	G
SNX29P2	440352	genome.wustl.edu	37	16	29376108	29376108	+	RNA	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:29376108G>C	ENST00000507381.1	+	0	847				SNX29P2_ENST00000398878.3_lincRNA			Q8IUI4	S29P2_HUMAN	sorting nexin 29 pseudogene 2																		TGTTTAAAAAGACACCTGGGG	0.478																																																	0													46.0	54.0	51.0					16																	29376108		2193	4296	6489			440352			BX648280		16p11.2	2014-03-21	2011-08-16	2011-08-16	ENSG00000198106	ENSG00000198106			31914	pseudogene	pseudogene			"""RUN domain containing 2C"""	RUNDC2C			Standard	NR_002939		Approved		uc021tfw.1	Q8IUI4			16.37:g.29376108G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.K150N	ENST00000507381.1	37	c.450		16	.	.	.	.	.	.	.	.	.	.	G	11.92	1.783491	0.31593	.	.	ENSG00000198106	ENST00000398878;ENST00000507381;ENST00000356328	.	.	.	1.53	0.535	0.17133	.	0.175561	0.49916	D	0.000129	T	0.50718	0.1632	.	.	.	0.23435	N	0.99769	D;D	0.69078	0.997;0.988	P;P	0.60789	0.879;0.676	T	0.38222	-0.9671	8	0.72032	D	0.01	-12.0985	5.7488	0.18134	0.1958:0.0:0.8042:0.0	.	131;150	Q8IUI4;E9PDE2	RUN2B_HUMAN;.	N	131;150;131	.	ENSP00000348682:K131N	K	+	3	2	RUNDC2C	29283609	0.996000	0.38824	0.033000	0.17914	0.289000	0.27227	2.814000	0.48010	0.205000	0.20568	0.398000	0.26397	AAG	SNX29P2	-	NULL		0.478	SNX29P2-001	KNOWN	basic	processed_transcript	SNX29P2	HGNC	pseudogene	OTTHUMT00000361855.1	G	NR_002939		29376108	+1	no_errors	ENST00000507381	ensembl	human	known	70_37	missense	SNP	0.400	C
SORBS2	8470	genome.wustl.edu	37	4	186578742	186578742	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:186578742C>T	ENST00000284776.7	-	6	612	c.103G>A	c.(103-105)Gac>Aac	p.D35N	SORBS2_ENST00000393528.3_Missense_Mutation_p.D81N|SORBS2_ENST00000449407.2_Missense_Mutation_p.D121N|SORBS2_ENST00000498125.1_5'Flank|SORBS2_ENST00000418609.1_5'Flank|SORBS2_ENST00000355634.5_Missense_Mutation_p.D135N|SORBS2_ENST00000431808.1_Missense_Mutation_p.D35N|SORBS2_ENST00000319471.9_Missense_Mutation_p.D121N|SORBS2_ENST00000437304.2_Missense_Mutation_p.D214N|SORBS2_ENST00000448662.2_Missense_Mutation_p.D104N	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	35					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GGATATGTGTCTGTGGAATCT	0.453																																					Esophageal Squamous(153;41 2433 9491 36028)												0													97.0	97.0	97.0					4																	186578742		2203	4300	6503	SO:0001583	missense	8470				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.103G>A	4.37:g.186578742C>T	ENSP00000284776:p.Asp35Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.D35N	ENST00000284776.7	37	c.103	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024802	0.35701	.	.	ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000445343;ENST00000439914;ENST00000444771;ENST00000430503;ENST00000450341;ENST00000445115;ENST00000457247;ENST00000456596;ENST00000425679;ENST00000439049;ENST00000451958;ENST00000444781	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.88	4.88	0.63580	.	0.238773	0.42420	D	0.000710	T	0.20129	0.0484	N	0.08118	0	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B	0.30361	0.034;0.083;0.101;0.119;0.05;0.05;0.087;0.181;0.01;0.277;0.016;0.016	B;B;B;B;B;B;B;B;B;B;B;B	0.29267	0.043;0.07;0.079;0.1;0.021;0.016;0.031;0.069;0.009;0.046;0.093;0.047	T	0.13953	-1.0490	10	0.66056	D	0.02	-14.614	18.5848	0.91185	0.0:1.0:0.0:0.0	.	98;81;104;81;135;35;121;214;104;81;35;81	B7Z3D7;G3XAI0;C9JKV9;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	N	35;104;35;214;121;121;135;81;81;35;35;35;81;35;35;35;35;104;104;104;98	ENSP00000284776:D35N;ENSP00000409158:D104N;ENSP00000411764:D35N;ENSP00000396008:D214N;ENSP00000322182:D121N;ENSP00000397262:D121N;ENSP00000347852:D135N;ENSP00000377162:D81N;ENSP00000321983:D81N;ENSP00000399048:D35N;ENSP00000408909:D35N;ENSP00000410483:D35N;ENSP00000405349:D81N;ENSP00000415680:D35N;ENSP00000397664:D35N;ENSP00000398335:D35N;ENSP00000410967:D35N;ENSP00000415637:D104N;ENSP00000416464:D104N;ENSP00000405092:D104N;ENSP00000396183:D98N	ENSP00000284776:D35N	D	-	1	0	SORBS2	186815736	1.000000	0.71417	0.121000	0.21740	0.122000	0.20287	4.625000	0.61262	2.697000	0.92050	0.563000	0.77884	GAC	SORBS2	-	NULL		0.453	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	C	NM_003603		186578742	-1	no_errors	ENST00000284776	ensembl	human	known	70_37	missense	SNP	0.993	T
SORBS3	10174	genome.wustl.edu	37	8	22419006	22419006	+	Intron	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:22419006G>C	ENST00000240123.7	+	6	900				SORBS3_ENST00000523402.1_Missense_Mutation_p.E213Q	NM_005775.4	NP_005766.3	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3						actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|muscle contraction (GO:0006936)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of stress fiber assembly (GO:0051496)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)	18		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		AGTTCAACCTGAGAGGTTTTT	0.617																																																	0																																										SO:0001627	intron_variant	10174				CCDS6031.1	8p21.3	2008-02-05			ENSG00000120896	ENSG00000120896			30907	protein-coding gene	gene with protein product		610795				9885244, 12510380	Standard	NM_001018003		Approved	SCAM-1, SH3D4, vinexin	uc003xbv.3	O60504	OTTHUMG00000131728	ENST00000240123.7:c.517+120G>C	8.37:g.22419006G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BJE4|Q6NX54|Q96FY4|Q9UQE4	Missense_Mutation	SNP	pfam_Sorb,smart_Sorb,pfscan_Sorb	p.E213Q	ENST00000240123.7	37	c.637	CCDS6031.1	8	.	.	.	.	.	.	.	.	.	.	G	0.184	-1.059633	0.01950	.	.	ENSG00000120896	ENST00000523402	.	.	.	3.62	-0.838	0.10762	.	.	.	.	.	T	0.21022	0.0506	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24799	-1.0150	4	.	.	.	.	2.8259	0.05485	0.4283:0.0:0.3665:0.2052	.	.	.	.	Q	213	.	.	E	+	1	0	SORBS3	22474951	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	0.001000	0.13038	-0.178000	0.10672	-0.997000	0.02515	GAG	SORBS3	-	NULL		0.617	SORBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORBS3	HGNC	protein_coding	OTTHUMT00000254647.3	G	NM_005775		22419006	+1	no_errors	ENST00000523402	ensembl	human	putative	70_37	missense	SNP	0.000	C
SPAG17	200162	genome.wustl.edu	37	1	118523962	118523962	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:118523962C>G	ENST00000336338.5	-	43	6000	c.5935G>C	c.(5935-5937)Gag>Cag	p.E1979Q	SPAG17_ENST00000492438.1_5'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1979						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GCAGAAATCTCTGGTTTTGGA	0.348																																																	0													117.0	116.0	117.0					1																	118523962		2203	4300	6503	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5935G>C	1.37:g.118523962C>G	ENSP00000337804:p.Glu1979Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E1979Q	ENST00000336338.5	37	c.5935	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	9.972	1.225710	0.22542	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19250	2.16	4.85	2.97	0.34412	.	1.519990	0.04040	N	0.302998	T	0.06188	0.0160	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.32508	-0.9904	10	0.20046	T	0.44	.	6.5845	0.22612	0.0:0.7211:0.1815:0.0975	.	1979	Q6Q759	SPG17_HUMAN	Q	1979;459	ENSP00000337804:E1979Q	ENSP00000337804:E1979Q	E	-	1	0	SPAG17	118325485	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.746000	0.26275	0.636000	0.30508	-0.172000	0.13284	GAG	SPAG17	-	NULL		0.348	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	C	NM_206996		118523962	-1	no_errors	ENST00000336338	ensembl	human	known	70_37	missense	SNP	0.002	G
SPEF2	79925	genome.wustl.edu	37	5	35740349	35740349	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:35740349G>A	ENST00000356031.3	+	23	3464	c.3310G>A	c.(3310-3312)Gaa>Aaa	p.E1104K	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.E1099K	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1104					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AACAAAGGCTGAACTACATCA	0.453																																																	0													147.0	133.0	137.0					5																	35740349		1964	4156	6120	SO:0001583	missense	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3310G>A	5.37:g.35740349G>A	ENSP00000348314:p.Glu1104Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.E1104K	ENST00000356031.3	37	c.3310	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.403774	0.96051	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.22539	1.96;1.95	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.60929	-0.7165	10	0.87932	D	0	.	20.1338	0.98010	0.0:0.0:1.0:0.0	.	1099;1104	Q9C093-2;Q9C093	.;SPEF2_HUMAN	K	1104;1099	ENSP00000348314:E1104K;ENSP00000412125:E1099K	ENSP00000348314:E1104K	E	+	1	0	SPEF2	35776106	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.457000	0.90361	2.770000	0.95276	0.655000	0.94253	GAA	SPEF2	-	NULL		0.453	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	G	NM_144722		35740349	+1	no_errors	ENST00000356031	ensembl	human	known	70_37	missense	SNP	1.000	A
SPEF2	79925	genome.wustl.edu	37	5	35792494	35792494	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:35792494G>A	ENST00000356031.3	+	31	4654	c.4500G>A	c.(4498-4500)ctG>ctA	p.L1500L	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Silent_p.L297L|SPEF2_ENST00000440995.2_Silent_p.L1495L	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1500					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGGTGACCCTGAACCTTGGCA	0.348																																																	0													127.0	118.0	121.0					5																	35792494		1871	4111	5982	SO:0001819	synonymous_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4500G>A	5.37:g.35792494G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.L1500	ENST00000356031.3	37	c.4500	CCDS43309.1	5																																																																																			SPEF2	-	NULL		0.348	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	G	NM_144722		35792494	+1	no_errors	ENST00000356031	ensembl	human	known	70_37	silent	SNP	0.971	A
SPEF2	79925	genome.wustl.edu	37	5	35793312	35793312	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:35793312C>T	ENST00000356031.3	+	32	4760	c.4606C>T	c.(4606-4608)Cgg>Tgg	p.R1536W	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Missense_Mutation_p.R333W|SPEF2_ENST00000440995.2_Missense_Mutation_p.R1531W	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1536					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGTGGACTGGCGGAAGTTCCT	0.428																																																	0													102.0	96.0	98.0					5																	35793312		1902	4120	6022	SO:0001583	missense	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4606C>T	5.37:g.35793312C>T	ENSP00000348314:p.Arg1536Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.R1536W	ENST00000356031.3	37	c.4606	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	C	13.70	2.316393	0.40996	.	.	ENSG00000152582	ENST00000356031;ENST00000440995;ENST00000303129	T;T;T	0.68479	-0.33;-0.33;-0.33	5.88	0.79	0.18613	.	0.000000	0.85682	D	0.000000	T	0.58337	0.2115	M	0.63843	1.955	0.34976	D	0.753587	P;P;B	0.48589	0.912;0.534;0.399	B;B;B	0.38954	0.286;0.097;0.045	T	0.66472	-0.5915	10	0.87932	D	0	.	9.9669	0.41730	0.477:0.4603:0.0:0.0626	.	333;1531;1536	Q9C093-4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	W	1536;1531;333	ENSP00000348314:R1536W;ENSP00000412125:R1531W;ENSP00000303843:R333W	ENSP00000303843:R333W	R	+	1	2	SPEF2	35829069	1.000000	0.71417	0.995000	0.50966	0.638000	0.38207	1.131000	0.31406	-0.144000	0.11314	0.655000	0.94253	CGG	SPEF2	-	NULL		0.428	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	C	NM_144722		35793312	+1	no_errors	ENST00000356031	ensembl	human	known	70_37	missense	SNP	1.000	T
SRL	6345	genome.wustl.edu	37	16	4242627	4242627	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:4242627C>T	ENST00000399609.3	-	6	961	c.949G>A	c.(949-951)Gac>Aac	p.D317N	SRL_ENST00000537996.1_Missense_Mutation_p.D275N	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	776	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						TGATTCAGGTCTTCTAGGAGG	0.557																																																	0													102.0	109.0	107.0					16																	4242627		2057	4193	6250	SO:0001583	missense	6345			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.949G>A	16.37:g.4242627C>T	ENSP00000382518:p.Asp317Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	p.D317N	ENST00000399609.3	37	c.949	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654010	0.88056	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.95137	-3.62;-3.62	5.44	4.5	0.54988	.	0.061259	0.64402	U	0.000008	D	0.96703	0.8924	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	P	0.61070	0.883	D	0.97226	0.9881	10	0.87932	D	0	-26.5993	14.3365	0.66595	0.0:0.9292:0.0:0.0708	.	317	Q86TD4-2	.	N	317;775;275	ENSP00000382518:D317N;ENSP00000440350:D275N	ENSP00000333285:D775N	D	-	1	0	SRL	4182628	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.651000	0.83577	1.529000	0.49120	0.655000	0.94253	GAC	SRL	-	NULL		0.557	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	C	XM_064152		4242627	-1	no_errors	ENST00000399609	ensembl	human	known	70_37	missense	SNP	1.000	T
ST7-OT4	338069	genome.wustl.edu	37	7	116596563	116596563	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:116596563G>A	ENST00000397750.3	+	4	697	c.156G>A	c.(154-156)caG>caA	p.Q52Q	ST7_ENST00000323984.3_Intron|ST7_ENST00000265437.5_Intron|ST7_ENST00000393451.3_Intron|ST7_ENST00000393446.2_Intron|ST7_ENST00000393449.1_Intron|ST7-OT4_ENST00000397751.1_Silent_p.Q52Q|ST7-OT4_ENST00000466018.1_Intron|ST7-AS1_ENST00000456775.1_RNA					ST7 overlapping transcript 4																		GGGAGTTGCAGATGGCGCAGG	0.542																																																	0																																										SO:0001819	synonymous_variant	338069			BM413623		7q31.2	2013-03-06	2013-03-06	2011-08-19	ENSG00000214188	ENSG00000214188		"""Long non-coding RNAs"", ""-"""	18835	other	unknown	"""non-protein coding RNA 42"""		"""ST7 overlapping transcript 4 (non-protein coding)"""	ST7OT4		12213198	Standard	NR_002329		Approved	NCRNA00042	uc003vip.1		OTTHUMG00000063631	ENST00000397750.3:c.156G>A	7.37:g.116596563G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.Q52	ENST00000397750.3	37	c.156		7																																																																																			ST7-OT4	-	NULL		0.542	ST7-OT4-001	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	ST7-OT4	HGNC	protein_coding	OTTHUMT00000137763.3	G	NR_002329		116596563	+1	no_errors	ENST00000397750	ensembl	human	putative	70_37	silent	SNP	0.000	A
STARD10	10809	genome.wustl.edu	37	11	72470394	72470394	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:72470394C>G	ENST00000334805.6	-	3	1159	c.240G>C	c.(238-240)gaG>gaC	p.E80D	STARD10_ENST00000538437.1_5'UTR|STARD10_ENST00000538536.1_Missense_Mutation_p.E34D|STARD10_ENST00000543304.1_Missense_Mutation_p.E80D|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000545082.1_Missense_Mutation_p.E51D	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	80	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			CGTAGAGTGTCTCGGCTGGCA	0.542																																																	0													140.0	140.0	140.0					11																	72470394		2166	4262	6428	SO:0001583	missense	10809			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.240G>C	11.37:g.72470394C>G	ENSP00000335247:p.Glu80Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	O60532	Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.E80D	ENST00000334805.6	37	c.240	CCDS41688.1	11	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146437	0.77888	.	.	ENSG00000214530	ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947;ENST00000536728;ENST00000542989;ENST00000546314;ENST00000539138;ENST00000535054;ENST00000536290	T;T;T;T;T;T;T;T;T;D;T;T	0.84873	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;-1.91;0.81;1.4	5.85	1.78	0.24846	Lipid-binding START (3);START-like domain (1);	0.242658	0.36972	U	0.002318	T	0.73102	0.3544	L	0.37630	1.12	0.42380	D	0.992485	B;B	0.14805	0.009;0.011	B;B	0.17979	0.02;0.01	T	0.62253	-0.6893	10	0.29301	T	0.29	-16.6252	4.1243	0.10119	0.1629:0.5839:0.0:0.2532	.	34;80	F5GY11;Q9Y365	.;PCTL_HUMAN	D	80;80;34;51;11;80;11;80;80;51;34;80	ENSP00000438792:E80D;ENSP00000335247:E80D;ENSP00000440016:E34D;ENSP00000443548:E51D;ENSP00000438357:E11D;ENSP00000445657:E80D;ENSP00000442414:E11D;ENSP00000443597:E80D;ENSP00000445886:E80D;ENSP00000441589:E51D;ENSP00000440924:E34D;ENSP00000443523:E80D	ENSP00000335247:E80D	E	-	3	2	STARD10	72148042	0.998000	0.40836	0.998000	0.56505	0.971000	0.66376	0.688000	0.25422	0.828000	0.34709	0.655000	0.94253	GAG	STARD10	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd		0.542	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	C			72470394	-1	no_errors	ENST00000334805	ensembl	human	known	70_37	missense	SNP	1.000	G
STXBP4	252983	genome.wustl.edu	37	17	53124509	53124509	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:53124509G>A	ENST00000376352.2	+	12	1212	c.1005G>A	c.(1003-1005)gtG>gtA	p.V335V	STXBP4_ENST00000434978.2_Intron	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	335					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						TCCAGAATGTGAAACAAGTAA	0.333																																																	0													95.0	101.0	99.0					17																	53124509		2203	4300	6503	SO:0001819	synonymous_variant	252983			BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1005G>A	17.37:g.53124509G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVZ5	Silent	SNP	pfam_WW_Rsp5_WWP,pfam_PDZ,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.V335	ENST00000376352.2	37	c.1005	CCDS11584.2	17																																																																																			STXBP4	-	NULL		0.333	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP4	HGNC	protein_coding	OTTHUMT00000157184.1	G	NM_178509		53124509	+1	no_errors	ENST00000376352	ensembl	human	known	70_37	silent	SNP	1.000	A
SUSD4	55061	genome.wustl.edu	37	1	223395529	223395529	+	3'UTR	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:223395529C>G	ENST00000343846.3	-	0	2111				SUSD4_ENST00000494793.2_Intron|SUSD4_ENST00000484758.2_3'UTR|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_3'UTR|SUSD4_ENST00000454695.2_3'UTR			Q5VX71	SUSD4_HUMAN	sushi domain containing 4							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GGATCTTGACCCATATTAGGG	0.428																																																	0													133.0	120.0	124.0					1																	223395529		1855	4104	5959	SO:0001624	3_prime_UTR_variant	55061			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.*5G>C	1.37:g.223395529C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	RNA	SNP	-	NULL	ENST00000343846.3	37	NULL	CCDS41471.1	1																																																																																			SUSD4	-	-		0.428	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	C	NM_017982		223395529	-1	no_errors	ENST00000478605	ensembl	human	known	70_37	rna	SNP	0.000	G
SYNGAP1	8831	genome.wustl.edu	37	6	33391367	33391367	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:33391367G>C	ENST00000418600.2	+	2	282	c.181G>C	c.(181-183)Gag>Cag	p.E61Q	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.E61Q	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	61					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CATGCTGGATGAGGATGAGGT	0.532																																																	0													140.0	126.0	131.0					6																	33391367		2203	4300	6503	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.181G>C	6.37:g.33391367G>C	ENSP00000403636:p.Glu61Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.E61Q	ENST00000418600.2	37	c.181	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	G	13.29	2.191832	0.38707	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372	T;T	0.16324	2.35;2.43	3.73	3.73	0.42828	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.081041	0.47455	D	0.000222	T	0.12860	0.0312	N	0.19112	0.55	0.32662	N	0.517967	P;P;P	0.45902	0.659;0.769;0.868	P;P;B	0.61397	0.775;0.888;0.225	T	0.05666	-1.0871	10	0.30078	T	0.28	.	13.4332	0.61068	0.0:0.0:1.0:0.0	.	61;61;61	Q96PV0;Q96PV0-4;B7ZCA0	SYGP1_HUMAN;.;.	Q	61	ENSP00000293748:E61Q;ENSP00000403636:E61Q	ENSP00000293748:E61Q	E	+	1	0	SYNGAP1	33499345	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	4.155000	0.58131	2.098000	0.63641	0.555000	0.69702	GAG	SYNGAP1	-	smart_Pleckstrin_homology		0.532	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	HGNC	protein_coding	OTTHUMT00000076151.4	G	XM_166407		33391367	+1	no_errors	ENST00000418600	ensembl	human	known	70_37	missense	SNP	1.000	C
TADA2A	6871	genome.wustl.edu	37	17	35783680	35783680	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:35783680G>A	ENST00000394395.2	+	3	270	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K	TADA2A_ENST00000225396.6_Missense_Mutation_p.E33K|TADA2A_ENST00000417170.1_Missense_Mutation_p.E33K|TADA2A_ENST00000586023.1_Missense_Mutation_p.E33K	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	33	Cys-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						CAAGTGTGCTGAATGTGGGCC	0.433																																																	0													239.0	205.0	217.0					17																	35783680		2203	4300	6503	SO:0001583	missense	6871			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.97G>A	17.37:g.35783680G>A	ENSP00000377918:p.Glu33Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.E33K	ENST00000394395.2	37	c.97	CCDS11319.1	17	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873335	0.72180	.	.	ENSG00000108264	ENST00000394395;ENST00000225396;ENST00000417170	T;T;T	0.66099	-0.19;-0.19;-0.19	6.06	6.06	0.98353	Zinc finger, ZZ-type (1);	0.045054	0.85682	D	0.000000	T	0.61602	0.2360	L	0.59967	1.855	0.80722	D	1	B;B	0.21821	0.061;0.028	B;B	0.20955	0.032;0.006	T	0.54807	-0.8238	10	0.22109	T	0.4	-22.8841	20.2159	0.98296	0.0:0.0:1.0:0.0	.	33;33	O75478-2;O75478	.;TAD2A_HUMAN	K	33	ENSP00000377918:E33K;ENSP00000225396:E33K;ENSP00000406699:E33K	ENSP00000225396:E33K	E	+	1	0	TADA2A	32857793	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.155000	0.77445	2.882000	0.98803	0.655000	0.94253	GAA	TADA2A	-	pirsf_Transcriptional_adaptor_2		0.433	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	G	NM_001488		35783680	+1	no_errors	ENST00000225396	ensembl	human	known	70_37	missense	SNP	1.000	A
TAF1L	138474	genome.wustl.edu	37	9	32635100	32635100	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:32635100G>A	ENST00000242310.4	-	1	567	c.478C>T	c.(478-480)Cca>Tca	p.P160S	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	160	Pro-rich.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCCGGGGGTGGAGGTGGAGGA	0.488																																																	0													234.0	191.0	206.0					9																	32635100		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.478C>T	9.37:g.32635100G>A	ENSP00000418379:p.Pro160Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P160S	ENST00000242310.4	37	c.478	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775425	0.49786	.	.	ENSG00000122728	ENST00000242310	T	0.07444	3.19	1.04	1.04	0.20106	.	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	L	0.50919	1.6	0.44000	D	0.996702	D	0.71674	0.998	D	0.67725	0.953	T	0.28744	-1.0034	10	0.10377	T	0.69	.	7.5055	0.27542	0.0:0.0:1.0:0.0	.	160	Q8IZX4	TAF1L_HUMAN	S	160	ENSP00000418379:P160S	ENSP00000418379:P160S	P	-	1	0	TAF1L	32625100	1.000000	0.71417	0.989000	0.46669	0.323000	0.28346	5.835000	0.69368	0.514000	0.28300	0.205000	0.17691	CCA	TAF1L	-	pirsf_TAF1_animal		0.488	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	G			32635100	-1	no_errors	ENST00000242310	ensembl	human	known	70_37	missense	SNP	1.000	A
TARBP1	6894	genome.wustl.edu	37	1	234529150	234529150	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:234529150C>T	ENST00000040877.1	-	28	4517	c.4518G>A	c.(4516-4518)caG>caA	p.Q1506Q	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1506					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CACTGAGGTGCTGAAACTGTT	0.493																																																	0													113.0	102.0	106.0					1																	234529150		2203	4300	6503	SO:0001819	synonymous_variant	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4518G>A	1.37:g.234529150C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H581	Silent	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.Q1506	ENST00000040877.1	37	c.4518	CCDS1601.1	1																																																																																			TARBP1	-	pfam_SpoU_MeTrfase		0.493	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	C	NM_005646		234529150	-1	no_errors	ENST00000040877	ensembl	human	known	70_37	silent	SNP	1.000	T
TATDN1	83940	genome.wustl.edu	37	8	125551267	125551267	+	Splice_Site	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:125551267G>C	ENST00000276692.6	-	1	58	c.21C>G	c.(19-21)atC>atG	p.I7M	NDUFB9_ENST00000522532.1_5'Flank|TATDN1_ENST00000605953.1_Splice_Site_p.I7M|TATDN1_ENST00000521546.1_5'Flank|NDUFB9_ENST00000276689.3_5'Flank|NDUFB9_ENST00000517367.1_5'Flank|TATDN1_ENST00000519548.1_De_novo_Start_OutOfFrame|TATDN1_ENST00000517678.1_De_novo_Start_OutOfFrame|NDUFB9_ENST00000518008.1_5'Flank	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1	7					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TCCTCTTACCGATAAACTTGA	0.627																																																	0													51.0	49.0	50.0					8																	125551267		2203	4300	6503	SO:0001630	splice_region_variant	83940			AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068	ENST00000276692.6:c.22+1C>G	8.37:g.125551267G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	pfam_TatD_family,pirsf_TatD_family	p.I7M	ENST00000276692.6	37	c.21	CCDS6351.1	8	.	.	.	.	.	.	.	.	.	.	G	13.24	2.179042	0.38511	.	.	ENSG00000147687	ENST00000276692;ENST00000522810;ENST00000519232;ENST00000523152	.	.	.	5.05	0.0636	0.14349	.	1.187830	0.05935	N	0.635876	T	0.71400	0.3335	M	0.87180	2.865	0.80722	D	1	D;B	0.59357	0.985;0.033	P;B	0.58928	0.848;0.33	T	0.63821	-0.6550	9	0.87932	D	0	-20.111	1.6377	0.02746	0.1639:0.3316:0.2879:0.2167	.	7;7	E5RG17;Q6P1N9	.;TATD1_HUMAN	M	7;7;4;7	.	ENSP00000276692:I7M	I	-	3	3	TATDN1	125620448	0.093000	0.21703	0.476000	0.27291	0.152000	0.21847	-0.798000	0.04565	-0.176000	0.10707	-0.291000	0.09656	ATC	TATDN1	-	pfam_TatD_family,pirsf_TatD_family		0.627	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN1	HGNC	protein_coding	OTTHUMT00000381655.1	G	NM_032026	Missense_Mutation	125551267	-1	no_errors	ENST00000276692	ensembl	human	known	70_37	missense	SNP	0.949	C
TBC1D26	353149	genome.wustl.edu	37	17	15641633	15641633	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:15641633C>T	ENST00000437605.2	+	7	569	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	TBC1D26_ENST00000579428.1_Missense_Mutation_p.R107W|AC005324.6_ENST00000433873.1_RNA|AC005324.6_ENST00000434017.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000580194.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	107	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CCTGGCGGTACGGGGCCGGGC	0.517																																																	0													106.0	100.0	102.0					17																	15641633		1917	4130	6047	SO:0001583	missense	353149				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.319C>T	17.37:g.15641633C>T	ENSP00000410111:p.Arg107Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K929|Q4G172	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R107W	ENST00000437605.2	37	c.319	CCDS42265.1	17	.	.	.	.	.	.	.	.	.	.	c	9.703	1.155098	0.21371	.	.	ENSG00000214946	ENST00000437605	T	0.34667	1.35	1.44	0.274	0.15654	Rab-GAP/TBC domain (4);	0.000000	0.85682	U	0.000000	T	0.42787	0.1218	M	0.92970	3.365	0.09310	N	1	B;B	0.32188	0.359;0.31	B;B	0.34180	0.177;0.111	T	0.46582	-0.9181	10	0.72032	D	0.01	.	4.6603	0.12639	0.3692:0.6308:0.0:0.0	.	107;107	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	W	107	ENSP00000410111:R107W	ENSP00000410111:R107W	R	+	1	2	TBC1D26	15582358	0.131000	0.22433	0.001000	0.08648	0.002000	0.02628	-0.513000	0.06305	-0.097000	0.12307	-0.718000	0.03613	CGG	TBC1D26	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.517	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding		C	NM_178571		15641633	+1	no_errors	ENST00000437605	ensembl	human	known	70_37	missense	SNP	0.008	T
TBKBP1	9755	genome.wustl.edu	37	17	45773697	45773697	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:45773697G>A	ENST00000361722.3	+	1	1068	c.219G>A	c.(217-219)gaG>gaA	p.E73E		NM_014726.2	NP_055541.1			TBK1 binding protein 1											endometrium(5)|kidney(1)|lung(1)	7						AAGTCTACGAGATCAAGGTCA	0.587																																																	0													35.0	37.0	36.0					17																	45773697		1970	4149	6119	SO:0001819	synonymous_variant	9755			AB018318	CCDS45722.1	17q21.32	2012-05-17				ENSG00000198933			30140	protein-coding gene	gene with protein product		608476				14743216, 19481056	Standard	NM_014726		Approved	ProSAPiP2, KIAA0775	uc002ilu.3	A7MCY6		ENST00000361722.3:c.219G>A	17.37:g.45773697G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.E73	ENST00000361722.3	37	c.219	CCDS45722.1	17																																																																																			TBKBP1	-	NULL		0.587	TBKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBKBP1	HGNC	protein_coding	OTTHUMT00000441363.1	G	NM_014726		45773697	+1	no_errors	ENST00000361722	ensembl	human	known	70_37	silent	SNP	1.000	A
TCTEX1D1	200132	genome.wustl.edu	37	1	67241845	67241845	+	Intron	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:67241845G>C	ENST00000282670.2	+	4	339					NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1											large_intestine(2)|lung(10)|skin(1)	13						TCTTTCAATAGAGTCCACCCA	0.363																																																	0																																										SO:0001627	intron_variant	200132			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.212-117G>C	1.37:g.67241845G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q06YR9|Q5VYE1	RNA	SNP	-	NULL	ENST00000282670.2	37	NULL	CCDS633.1	1																																																																																			TCTEX1D1	-	-		0.363	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	G	NM_152665		67241845	+1	no_errors	ENST00000489510	ensembl	human	known	70_37	rna	SNP	0.000	C
TBX15	6913	genome.wustl.edu	37	1	119530412	119530412	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:119530412C>T	ENST00000369429.3	-	1	16	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	TBX15_ENST00000207157.3_Intron			Q96SF7	TBX15_HUMAN	T-box 15	3					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CTTCTCCTTTCACTCATTTTA	0.632																																																	0																																										SO:0001583	missense	6913			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.7G>A	1.37:g.119530412C>T	ENSP00000358437:p.Glu3Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.E3K	ENST00000369429.3	37	c.7		1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034459	0.75617	.	.	ENSG00000092607	ENST00000369429	D	0.90324	-2.65	5.29	5.29	0.74685	.	0.054356	0.64402	D	0.000001	D	0.92619	0.7655	.	.	.	0.49687	D	0.999816	.	.	.	.	.	.	D	0.93408	0.6766	7	0.72032	D	0.01	.	14.2462	0.65990	0.0:0.9263:0.0:0.0737	.	.	.	.	K	3	ENSP00000358437:E3K	ENSP00000358437:E3K	E	-	1	0	TBX15	119331935	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.484000	0.81180	2.474000	0.83562	0.561000	0.74099	GAA	TBX15	-	NULL		0.632	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	C	NM_152380		119530412	-1	no_errors	ENST00000369429	ensembl	human	known	70_37	missense	SNP	1.000	T
TECPR1	25851	genome.wustl.edu	37	7	97852404	97852404	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:97852404C>G	ENST00000447648.2	-	21	3125	c.2826G>C	c.(2824-2826)gaG>gaC	p.E942D	TECPR1_ENST00000379795.3_Missense_Mutation_p.E944D|TECPR1_ENST00000479975.1_5'UTR			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	942					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CACCCGGGCTCTCCGGGATGA	0.672																																																	0													18.0	24.0	22.0					7																	97852404		2030	4160	6190	SO:0001583	missense	25851				CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.2826G>C	7.37:g.97852404C>G	ENSP00000404923:p.Glu942Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Beta-propeller_rpt_TECPR,smart_Peroxin/Ferlin	p.E944D	ENST00000447648.2	37	c.2832	CCDS47648.1	7	.	.	.	.	.	.	.	.	.	.	C	4.257	0.046808	0.08243	.	.	ENSG00000205356	ENST00000447648;ENST00000379795	T;T	0.29142	1.58;1.58	4.05	3.17	0.36434	.	0.178994	0.49305	D	0.000141	T	0.16385	0.0394	L	0.28274	0.84	0.80722	D	1	B	0.31769	0.339	B	0.27076	0.076	T	0.05886	-1.0858	10	0.14656	T	0.56	-43.2368	7.6768	0.28490	0.0:0.8871:0.0:0.1129	.	942	Q7Z6L1	TCPR1_HUMAN	D	942;944	ENSP00000404923:E942D;ENSP00000369121:E944D	ENSP00000369121:E944D	E	-	3	2	TECPR1	97690340	0.828000	0.29307	0.962000	0.40283	0.390000	0.30446	1.330000	0.33781	1.304000	0.44892	0.561000	0.74099	GAG	TECPR1	-	smart_Beta-propeller_rpt_TECPR		0.672	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TECPR1	HGNC	protein_coding	OTTHUMT00000334661.1	C	NM_015395		97852404	-1	no_errors	ENST00000379795	ensembl	human	known	70_37	missense	SNP	0.995	G
TEK	7010	genome.wustl.edu	37	9	27203064	27203064	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:27203064G>A	ENST00000380036.4	+	13	2598	c.2156G>A	c.(2155-2157)gGg>gAg	p.G719E	TEK_ENST00000519097.1_Missense_Mutation_p.G572E|TEK_ENST00000406359.4_Missense_Mutation_p.G676E	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	719	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AACAACATAGGGTCAAGCAAC	0.463																																																	0													93.0	86.0	88.0					9																	27203064		2203	4300	6503	SO:0001583	missense	7010			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2156G>A	9.37:g.27203064G>A	ENSP00000369375:p.Gly719Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G719E	ENST00000380036.4	37	c.2156	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431720	0.83776	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.47528	0.84;0.84;0.84	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000086	T	0.60560	0.2278	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.991;0.996;1.0;0.994	T	0.63373	-0.6652	10	0.87932	D	0	.	19.7255	0.96162	0.0:0.0:1.0:0.0	.	572;752;676;719	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	E	572;719;676	ENSP00000430686:G572E;ENSP00000369375:G719E;ENSP00000383977:G676E	ENSP00000369375:G719E	G	+	2	0	TEK	27193064	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.506000	0.81665	2.732000	0.93576	0.637000	0.83480	GGG	TEK	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.463	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	G			27203064	+1	no_errors	ENST00000380036	ensembl	human	known	70_37	missense	SNP	1.000	A
TEP1	7011	genome.wustl.edu	37	14	20842653	20842653	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:20842653C>G	ENST00000262715.5	-	44	6446	c.6406G>C	c.(6406-6408)Gag>Cag	p.E2136Q	TEP1_ENST00000556935.1_Missense_Mutation_p.E2028Q|TEP1_ENST00000545983.1_Missense_Mutation_p.E474Q	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2136					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGTCCTGACTCTGGGTCCCAG	0.557																																																	0													41.0	39.0	40.0					14																	20842653		2203	4300	6503	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.6406G>C	14.37:g.20842653C>G	ENSP00000262715:p.Glu2136Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2136Q	ENST00000262715.5	37	c.6406	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	C	4.348	0.064099	0.08388	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983	T;T;T	0.81415	2.13;2.13;-1.49	4.53	-0.897	0.10553	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.911844	0.09509	N	0.792554	T	0.63189	0.2490	N	0.20357	0.565	0.09310	N	1	B;B;B;B	0.14438	0.006;0.004;0.01;0.002	B;B;B;B	0.15052	0.002;0.002;0.012;0.001	T	0.45396	-0.9264	10	0.30078	T	0.28	-1.4918	5.4881	0.16761	0.0:0.298:0.4389:0.2632	.	474;2028;1479;2136	B4E0B6;G3V5X7;G3V2A4;Q99973	.;.;.;TEP1_HUMAN	Q	2136;2136;2028;474	ENSP00000262715:E2136Q;ENSP00000452574:E2028Q;ENSP00000438849:E474Q	ENSP00000262715:E2136Q	E	-	1	0	TEP1	19912493	0.000000	0.05858	0.005000	0.12908	0.962000	0.63368	-0.504000	0.06375	-0.265000	0.09352	-0.519000	0.04390	GAG	TEP1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.557	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	C	NM_007110		20842653	-1	no_errors	ENST00000262715	ensembl	human	known	70_37	missense	SNP	0.002	G
TFR2	7036	genome.wustl.edu	37	7	100218699	100218699	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:100218699G>A	ENST00000462107.1	-	19	2474	c.2187C>T	c.(2185-2187)ttC>ttT	p.F729F	TFR2_ENST00000544242.1_Silent_p.F270F|TFR2_ENST00000223051.3_Silent_p.F729F|TFR2_ENST00000431692.1_3'UTR			Q9UP52	TFR2_HUMAN	transferrin receptor 2	729					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	AGATGTGGCGGAACGGGGAGT	0.682																																																	0													17.0	19.0	18.0					7																	100218699		2163	4262	6425	SO:0001819	synonymous_variant	7036			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2187C>T	7.37:g.100218699G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.F729	ENST00000462107.1	37	c.2187	CCDS34707.1	7																																																																																			TFR2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom		0.682	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	G	NM_003227		100218699	-1	no_errors	ENST00000223051	ensembl	human	known	70_37	silent	SNP	1.000	A
THRAP3	9967	genome.wustl.edu	37	1	36757080	36757080	+	Silent	SNP	T	T	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:36757080T>G	ENST00000354618.5	+	6	2075	c.1851T>G	c.(1849-1851)gcT>gcG	p.A617A	THRAP3_ENST00000469141.2_Silent_p.A617A|THRAP3_ENST00000466743.1_3'UTR	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	617	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TACAATCAGCTCAGTCTCAGC	0.488			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)			Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	0													123.0	111.0	115.0					1																	36757080		2203	4300	6503	SO:0001819	synonymous_variant	9967			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1851T>G	1.37:g.36757080T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPS5|Q5VTK6	Silent	SNP	NULL	p.A617	ENST00000354618.5	37	c.1851	CCDS405.1	1																																																																																			THRAP3	-	NULL		0.488	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRAP3	HGNC	protein_coding	OTTHUMT00000021688.2	T	NM_005119		36757080	+1	no_errors	ENST00000354618	ensembl	human	known	70_37	silent	SNP	1.000	G
TLR7	51284	genome.wustl.edu	37	X	12903915	12903915	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:12903915C>G	ENST00000380659.3	+	3	427	c.288C>G	c.(286-288)ttC>ttG	p.F96L		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	96					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	AGATCGATTTCAGATGCAACT	0.463																																																	0													131.0	122.0	125.0					X																	12903915		2203	4300	6503	SO:0001583	missense	51284			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.288C>G	X.37:g.12903915C>G	ENSP00000370034:p.Phe96Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.F96L	ENST00000380659.3	37	c.288	CCDS14151.1	X	.	.	.	.	.	.	.	.	.	.	C	3.001	-0.206089	0.06180	.	.	ENSG00000196664	ENST00000380659	T	0.00745	5.75	5.79	3.98	0.46160	.	0.199686	0.45126	N	0.000394	T	0.00300	0.0009	N	0.00405	-1.535	0.40685	D	0.982346	B	0.02656	0.0	B	0.04013	0.001	T	0.42749	-0.9433	10	0.02654	T	1	.	9.8076	0.40803	0.1433:0.7825:0.0:0.0743	.	96	Q9NYK1	TLR7_HUMAN	L	96	ENSP00000370034:F96L	ENSP00000370034:F96L	F	+	3	2	TLR7	12813836	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	1.844000	0.39269	0.561000	0.29186	0.500000	0.49745	TTC	TLR7	-	NULL		0.463	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	C	NM_016562		12903915	+1	no_errors	ENST00000380659	ensembl	human	known	70_37	missense	SNP	1.000	G
TMEFF2	23671	genome.wustl.edu	37	2	192922421	192922421	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:192922421C>G	ENST00000272771.5	-	5	1704	c.520G>C	c.(520-522)Gat>Cat	p.D174H	TMEFF2_ENST00000392314.1_Missense_Mutation_p.D174H	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	174						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TCCTCGGCATCTTCGTCACAT	0.383																																					Pancreas(50;1277 1381 28487 47072)												0													121.0	109.0	113.0					2																	192922421		2203	4300	6503	SO:0001583	missense	23671			AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.520G>C	2.37:g.192922421C>G	ENSP00000272771:p.Asp174His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,pfscan_EG-like_dom	p.D174H	ENST00000272771.5	37	c.520	CCDS2314.1	2	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200985	0.79015	.	.	ENSG00000144339	ENST00000392314;ENST00000272771	T;T	0.74842	-0.88;-0.88	4.68	4.68	0.58851	.	0.056069	0.64402	D	0.000001	T	0.80281	0.4594	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82540	-0.0406	10	0.87932	D	0	-20.1717	16.3329	0.83049	0.0:1.0:0.0:0.0	.	174	Q9UIK5	TEFF2_HUMAN	H	174	ENSP00000376128:D174H;ENSP00000272771:D174H	ENSP00000272771:D174H	D	-	1	0	TMEFF2	192630666	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.787000	0.75099	2.592000	0.87571	0.650000	0.86243	GAT	TMEFF2	-	NULL		0.383	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEFF2	HGNC	protein_coding	OTTHUMT00000256065.2	C	NM_016192		192922421	-1	no_errors	ENST00000272771	ensembl	human	known	70_37	missense	SNP	1.000	G
TMEM176A	55365	genome.wustl.edu	37	7	150500755	150500755	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:150500755C>T	ENST00000484928.1	+	5	971	c.390C>T	c.(388-390)atC>atT	p.I130I	TMEM176A_ENST00000461345.1_Silent_p.I71I|TMEM176B_ENST00000447204.2_5'Flank|TMEM176A_ENST00000004103.3_Silent_p.I130I			Q96HP8	T176A_HUMAN	transmembrane protein 176A	130					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCACAGCCATCGCTGCCCTCA	0.532																																																	0													78.0	82.0	81.0					7																	150500755		2203	4300	6503	SO:0001819	synonymous_variant	55365			AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.390C>T	7.37:g.150500755C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX00|Q9NYC7	Silent	SNP	pfam_CD20-like	p.I130	ENST00000484928.1	37	c.390	CCDS5909.1	7																																																																																			TMEM176A	-	pfam_CD20-like		0.532	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM176A	HGNC	protein_coding	OTTHUMT00000350222.1	C	NM_018487		150500755	+1	no_errors	ENST00000004103	ensembl	human	known	70_37	silent	SNP	0.000	T
TMEM254	80195	genome.wustl.edu	37	10	81838408	81838408	+	5'Flank	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:81838408C>G	ENST00000372281.3	+	0	0				TMEM254-AS1_ENST00000432070.2_RNA|TMEM254-AS1_ENST00000412298.1_RNA|TMEM254_ENST00000372274.1_5'Flank|TMEM254_ENST00000372277.3_5'Flank|TMEM254-AS1_ENST00000448729.2_RNA|TMEM254_ENST00000372275.1_5'Flank	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254							integral component of membrane (GO:0016021)											CCTCCGCGCTCGCGCTCGACG	0.692																																																	0													27.0	25.0	25.0					10																	81838408		2187	4260	6447	SO:0001631	upstream_gene_variant	80195			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602		10.37:g.81838408C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	RNA	SNP	-	NULL	ENST00000372281.3	37	NULL	CCDS7363.1	10																																																																																			TMEM254	-	-		0.692	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	HGNC	protein_coding	OTTHUMT00000049030.1	C	NM_025125		81838408	+1	no_errors	ENST00000472622	ensembl	human	known	70_37	rna	SNP	0.000	G
TMEM54	113452	genome.wustl.edu	37	1	33360939	33360939	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:33360939C>G	ENST00000373463.3	-	5	680	c.561G>C	c.(559-561)ctG>ctC	p.L187L	TMEM54_ENST00000329151.5_Silent_p.L134L|TMEM54_ENST00000475208.1_5'UTR	NM_033504.2	NP_277039.1	Q969K7	TMM54_HUMAN	transmembrane protein 54	187						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACCAGGGCCTCAGCTCCAGCA	0.642																																																	0													58.0	46.0	50.0					1																	33360939		2203	4300	6503	SO:0001819	synonymous_variant	113452				CCDS371.1	1p35-p34	2008-02-05			ENSG00000121900	ENSG00000121900			24143	protein-coding gene	gene with protein product						9500206	Standard	NM_033504		Approved	CAC-1	uc001bwi.1	Q969K7	OTTHUMG00000004016	ENST00000373463.3:c.561G>C	1.37:g.33360939C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UV18|Q8IVD0|Q9UM12	Silent	SNP	pfam_Beta-casein-like	p.L187	ENST00000373463.3	37	c.561	CCDS371.1	1																																																																																			TMEM54	-	pfam_Beta-casein-like		0.642	TMEM54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM54	HGNC	protein_coding	OTTHUMT00000011474.1	C	NM_033504		33360939	-1	no_errors	ENST00000373463	ensembl	human	known	70_37	silent	SNP	1.000	G
TMPRSS3	64699	genome.wustl.edu	37	21	43816182	43816182	+	5'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr21:43816182G>A	ENST00000291532.3	-	0	773				TMPRSS3_ENST00000433957.2_5'Flank|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R24W|TMPRSS3_ENST00000398397.3_5'UTR|TMPRSS3_ENST00000398405.1_5'Flank	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3						cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						GAAAGTACCCGAGCCGTCCGG	0.547																																																	0													36.0	36.0	36.0					21																	43816182		876	1991	2867	SO:0001623	5_prime_UTR_variant	64699			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.-183C>T	21.37:g.43816182G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Srcr_rcpt,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_LDrepeatLR_classA_rpt,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R24W	ENST00000291532.3	37	c.70	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	A	9.512	1.106059	0.20632	.	.	ENSG00000160183	ENST00000380399	D	0.90133	-2.62	3.78	-7.56	0.01322	.	3.036110	0.01101	N	0.005369	T	0.78013	0.4217	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.69235	-0.5198	6	.	.	.	.	1.1717	0.01826	0.3827:0.1689:0.2718:0.1765	.	.	.	.	W	24	ENSP00000369762:R24W	.	R	-	1	2	TMPRSS3	42689251	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.077000	0.00300	-3.324000	0.00187	-0.977000	0.02584	CGG	TMPRSS3	-	NULL		0.547	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	HGNC	protein_coding	OTTHUMT00000195347.1	G			43816182	-1	no_errors	ENST00000380399	ensembl	human	known	70_37	missense	SNP	0.000	A
TNC	3371	genome.wustl.edu	37	9	117808902	117808902	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:117808902G>C	ENST00000350763.4	-	17	5323	c.4912C>G	c.(4912-4914)Ctg>Gtg	p.L1638V	TNC_ENST00000535648.1_Missense_Mutation_p.L1183V|TNC_ENST00000537320.1_Intron|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000542877.1_Missense_Mutation_p.L1275V|TNC_ENST00000341037.4_Missense_Mutation_p.L1456V|TNC_ENST00000346706.3_Missense_Mutation_p.L1092V|TNC_ENST00000340094.3_Missense_Mutation_p.L1274V|TNC_ENST00000423613.2_Intron|TNC_ENST00000345230.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1638	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GTCCAGGACAGACGGAAACCG	0.493																																																	0													57.0	63.0	61.0					9																	117808902		2203	4300	6503	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4912C>G	9.37:g.117808902G>C	ENSP00000265131:p.Leu1638Val	Somatic		WXS	Illumina HiSeq	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L1638V	ENST00000350763.4	37	c.4912	CCDS6811.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.11|14.11	2.438466|2.438466	0.43326|0.43326	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877|ENST00000544972	T;T;T;T;T;T|.	0.04551|.	3.6;3.6;3.6;3.6;3.6;3.6|.	5.94|5.94	5.94|5.94	0.96194|0.96194	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.70500|0.70500	0.3231|0.3231	L|L	0.48362|0.48362	1.52|1.52	0.80722|0.80722	D|D	1|1	P|.	0.51537|.	0.946|.	P|.	0.51833|.	0.681|.	T|T	0.64419|0.64419	-0.6412|-0.6412	10|5	0.29301|.	T|.	0.29|.	.|.	20.352|20.352	0.98815|0.98815	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1638|.	P24821|.	TENA_HUMAN|.	V|C	1274;1183;1092;1638;1456;1275|200	ENSP00000344400:L1274V;ENSP00000438152:L1183V;ENSP00000344555:L1092V;ENSP00000265131:L1638V;ENSP00000339553:L1456V;ENSP00000442242:L1275V|.	ENSP00000344400:L1274V|.	L|S	-|-	1|2	2|0	TNC|TNC	116848723|116848723	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.259000|6.259000	0.72494|0.72494	2.803000|2.803000	0.96430|0.96430	0.655000|0.655000	0.94253|0.94253	CTG|TCT	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.493	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	G	NM_002160		117808902	-1	no_errors	ENST00000350763	ensembl	human	known	70_37	missense	SNP	1.000	C
TPTE2	93492	genome.wustl.edu	37	13	20000617	20000617	+	Missense_Mutation	SNP	A	A	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:20000617A>G	ENST00000400230.2	-	18	1387	c.1343T>C	c.(1342-1344)gTa>gCa	p.V448A	TPTE2_ENST00000382975.4_Missense_Mutation_p.V408A|TPTE2_ENST00000457266.2_Missense_Mutation_p.V337A|TPTE2_ENST00000390680.2_Missense_Mutation_p.V371A|TPTE2_ENST00000400103.2_Missense_Mutation_p.V337A|TPTE2_ENST00000382977.4_Missense_Mutation_p.V448A|TPTE2_ENST00000382978.1_Missense_Mutation_p.V408A|TPTE2_ENST00000255310.6_Missense_Mutation_p.V371A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	448	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACCGTCATATACATTAATTAA	0.348																																																	0													97.0	101.0	100.0					13																	20000617		2201	4299	6500	SO:0001583	missense	93492			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1343T>C	13.37:g.20000617A>G	ENSP00000383089:p.Val448Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.V448A	ENST00000400230.2	37	c.1343	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	a	10.15	1.270785	0.23221	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	2.06	0.847	0.18961	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.605992	0.15491	N	0.259551	D	0.84710	0.5532	L	0.50333	1.59	0.09310	N	1	P;P;P	0.50272	0.766;0.677;0.933	P;P;P	0.58172	0.755;0.625;0.834	T	0.73000	-0.4120	9	.	.	.	-1.377	3.9345	0.09299	0.8106:0.0:0.1894:0.0	.	337;371;448	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	A	408;337;448;371;371;448;408;337;448	ENSP00000372438:V408A;ENSP00000382974:V337A;ENSP00000383089:V448A;ENSP00000255310:V371A;ENSP00000375098:V371A;ENSP00000372437:V448A;ENSP00000372435:V408A;ENSP00000442218:V337A	.	V	-	2	0	TPTE2	18898617	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	1.563000	0.36364	0.241000	0.21283	0.163000	0.16589	GTA	TPTE2	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tensin_phosphatase_C2-dom		0.348	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		A	NM_199254		20000617	-1	no_errors	ENST00000382977	ensembl	human	known	70_37	missense	SNP	0.000	G
TRAPPC9	83696	genome.wustl.edu	37	8	141468469	141468469	+	5'Flank	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:141468469G>A	ENST00000438773.2	-	0	0				TRAPPC9_ENST00000389328.4_Silent_p.C65C|TRAPPC9_ENST00000389327.3_5'Flank	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9						cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						GATCCCTGCGGCACCCCCTGT	0.701																																																	0													21.0	19.0	20.0					8																	141468469		2196	4293	6489	SO:0001631	upstream_gene_variant	83696			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187		8.37:g.141468469G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Silent	SNP	pfam_TRAPP_II_complex_Trs120	p.C65	ENST00000438773.2	37	c.195	CCDS55278.1	8																																																																																			TRAPPC9	-	NULL		0.701	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	G	NM_031466		141468469	-1	no_errors	ENST00000389328	ensembl	human	known	70_37	silent	SNP	0.007	A
TRAT1	50852	genome.wustl.edu	37	3	108566027	108566027	+	Intron	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:108566027C>T	ENST00000295756.6	+	4	444				TRAT1_ENST00000426646.1_Intron|TRAT1_ENST00000493604.1_3'UTR	NM_016388.2	NP_057472.2	Q6PIZ9	TRAT1_HUMAN	T cell receptor associated transmembrane adaptor 1						cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of receptor recycling (GO:0001920)|negative regulation of transport (GO:0051051)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell receptor signaling pathway (GO:0050862)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(3)	28						CAGTTGGTTTCACAAAATAAT	0.279																																																	0													22.0	24.0	23.0					3																	108566027		2163	4261	6424	SO:0001627	intron_variant	50852			AJ240084	CCDS33813.1	3q13	2005-05-04	2005-05-04	2005-05-04	ENSG00000163519	ENSG00000163519			30698	protein-coding gene	gene with protein product		604962	"""T cell receptor interacting molecule"""	TCRIM		10663578, 9687533	Standard	NM_016388		Approved	HSPC062, TRIM	uc003dxi.1	Q6PIZ9	OTTHUMG00000159198	ENST00000295756.6:c.214+51C>T	3.37:g.108566027C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZX5	RNA	SNP	-	NULL	ENST00000295756.6	37	NULL	CCDS33813.1	3																																																																																			TRAT1	-	-		0.279	TRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAT1	HGNC	protein_coding	OTTHUMT00000353794.1	C	NM_016388		108566027	+1	no_errors	ENST00000493604	ensembl	human	known	70_37	rna	SNP	0.000	T
TRDN	10345	genome.wustl.edu	37	6	123590999	123590999	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:123590999G>A	ENST00000398178.3	-	31	1754	c.1733C>T	c.(1732-1734)cCa>cTa	p.P578L	TRDN_ENST00000334268.4_Missense_Mutation_p.P578L	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	578					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CTTACTTGTTGGTTTGGGCTT	0.323																																																	0													143.0	143.0	143.0					6																	123590999		1869	4100	5969	SO:0001583	missense	10345			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1733C>T	6.37:g.123590999G>A	ENSP00000381240:p.Pro578Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.P578L	ENST00000398178.3	37	c.1733	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274114	0.59649	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.17528	2.27;2.27	4.56	2.7	0.31948	.	0.371858	0.19871	N	0.104187	T	0.03477	0.0100	N	0.19112	0.55	0.80722	D	1	B	0.18863	0.031	B	0.14578	0.011	T	0.23940	-1.0174	10	0.41790	T	0.15	-0.6433	5.4149	0.16368	0.1038:0.0:0.6975:0.1987	.	578	Q13061	TRDN_HUMAN	L	578;580;578	ENSP00000381240:P578L;ENSP00000333984:P578L	ENSP00000333984:P578L	P	-	2	0	TRDN	123632698	0.985000	0.35326	0.988000	0.46212	0.856000	0.48823	0.972000	0.29409	0.581000	0.29539	0.650000	0.86243	CCA	TRDN	-	NULL		0.323	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		G			123590999	-1	no_errors	ENST00000398178	ensembl	human	known	70_37	missense	SNP	0.995	A
TRHDE	29953	genome.wustl.edu	37	12	73046213	73046213	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:73046213G>A	ENST00000261180.4	+	16	2748	c.2652G>A	c.(2650-2652)gaG>gaA	p.E884E		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	884					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CAGTTTCTGAGAAGAAAATAT	0.373																																																	0													87.0	87.0	87.0					12																	73046213		2203	4300	6503	SO:0001819	synonymous_variant	29953			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2652G>A	12.37:g.73046213G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E884	ENST00000261180.4	37	c.2652	CCDS9004.1	12																																																																																			TRHDE	-	NULL		0.373	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	G	NM_013381		73046213	+1	no_errors	ENST00000261180	ensembl	human	known	70_37	silent	SNP	0.999	A
TRIM45	80263	genome.wustl.edu	37	1	117663434	117663434	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:117663434G>A	ENST00000256649.4	-	1	916	c.390C>T	c.(388-390)ggC>ggT	p.G130G	TRIM45_ENST00000369464.3_Silent_p.G130G|TRIM45_ENST00000369461.3_Silent_p.G73G	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	130					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CCAGGCCCTGGCCTTCCCCAC	0.572																																																	0													93.0	79.0	84.0					1																	117663434		2203	4300	6503	SO:0001819	synonymous_variant	80263				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.390C>T	1.37:g.117663434G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_B-box,pfscan_Znf_RING	p.G130	ENST00000256649.4	37	c.390	CCDS893.1	1																																																																																			TRIM45	-	smart_Znf_B-box,pfscan_Znf_B-box		0.572	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM45	HGNC	protein_coding	OTTHUMT00000033503.1	G	NM_025188		117663434	-1	no_errors	ENST00000256649	ensembl	human	known	70_37	silent	SNP	1.000	A
TRIM67	440730	genome.wustl.edu	37	1	231333183	231333183	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:231333183C>T	ENST00000366653.5	+	2	1111	c.1111C>T	c.(1111-1113)Cag>Tag	p.Q371*	TRIM67_ENST00000449018.3_Nonsense_Mutation_p.Q309*|TRIM67_ENST00000444294.3_Nonsense_Mutation_p.Q371*|TRIM67_ENST00000366652.2_Nonsense_Mutation_p.Q371*			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	371					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GTTTCTGGTTCAGCTAAAGAA	0.408																																																	0													128.0	120.0	122.0					1																	231333183		1929	4154	6083	SO:0001587	stop_gained	440730			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1111C>T	1.37:g.231333183C>T	ENSP00000355613:p.Gln371*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TER7|Q5TER8|Q7Z4K7	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.Q371*	ENST00000366653.5	37	c.1111	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	C	46	12.570435	0.99679	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	.	.	.	5.64	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	13.9826	0.64315	0.0:0.9277:0.0:0.0723	.	.	.	.	X	371;371;309;371	.	ENSP00000355612:Q371X	Q	+	1	0	TRIM67	229399806	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.725000	0.68507	2.643000	0.89663	0.655000	0.94253	CAG	TRIM67	-	smart_Bbox_C		0.408	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	C	NM_001004342		231333183	+1	no_errors	ENST00000366652	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TSC2	7249	genome.wustl.edu	37	16	2136841	2136841	+	Missense_Mutation	SNP	C	C	T	rs45517383|rs137854272		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:2136841C>T	ENST00000219476.3	+	38	5588	c.4958C>T	c.(4957-4959)tCc>tTc	p.S1653F	TSC2_ENST00000382538.6_Missense_Mutation_p.S1538F|TSC2_ENST00000439673.2_Missense_Mutation_p.S1550F|TSC2_ENST00000350773.4_Missense_Mutation_p.S1630F|TSC2_ENST00000401874.2_Missense_Mutation_p.S1586F|TSC2_ENST00000568454.1_Missense_Mutation_p.S1597F|TSC2_ENST00000353929.4_Missense_Mutation_p.S1610F	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1653	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.		S -> F (in TSC2). {ECO:0000269|PubMed:15024740}.		acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TACAATGACTCCGGTGAGGAC	0.617			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0			GRCh37	CM040809	TSC2	M	rs45517383						73.0	53.0	60.0					16																	2136841		2194	4290	6484	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4958C>T	16.37:g.2136841C>T	ENSP00000219476:p.Ser1653Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP,prints_Tuberin	p.S1653F	ENST00000219476.3	37	c.4958	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543660	0.65198	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48	5.09	5.09	0.68999	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.97707	0.9248	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.995;1.0;0.997;0.997;0.999	D;D;D;D;D;D;D	0.91635	0.998;0.996;0.997;0.999;0.997;0.997;0.998	D	0.98633	1.0672	10	0.87932	D	0	-18.3923	18.4919	0.90851	0.0:1.0:0.0:0.0	rs45517383	1538;1550;1630;428;1609;1586;1653	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	F	1653;1587;1610;1550;1538;1630	ENSP00000219476:S1653F;ENSP00000248099:S1610F;ENSP00000399232:S1550F;ENSP00000371978:S1538F;ENSP00000344383:S1630F	ENSP00000219476:S1653F	S	+	2	0	TSC2	2076842	1.000000	0.71417	0.580000	0.28601	0.025000	0.11179	7.748000	0.85085	2.368000	0.80403	0.549000	0.68633	TCC	TSC2	-	pfam_Rap_GAP,pfscan_Rap_GAP		0.617	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	C	NM_000548		2136841	+1	no_errors	ENST00000219476	ensembl	human	known	70_37	missense	SNP	1.000	T
TSTD3	100130890	genome.wustl.edu	37	6	99979292	99979292	+	RNA	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr6:99979292G>A	ENST00000452647.2	+	0	555							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		TATTTCTAAAGATGTCACTTA	0.294																																																	0																																												100130890					6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99979292G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			TSTD3	-	-		0.294	TSTD3-001	KNOWN	basic	antisense	TSTD3	HGNC	antisense	OTTHUMT00000041605.2	G	NM_001195131		99979292	+1	no_errors	ENST00000452647	ensembl	human	known	70_37	rna	SNP	0.002	A
TTC16	158248	genome.wustl.edu	37	9	130479949	130479949	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:130479949C>G	ENST00000373289.3	+	4	404	c.324C>G	c.(322-324)ctC>ctG	p.L108L	PTRH1_ENST00000423807.1_5'Flank|PTRH1_ENST00000429848.1_Intron|PTRH1_ENST00000543175.1_5'Flank|TTC16_ENST00000393748.4_5'UTR|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	108										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						ACCTCCAGCTCTGTGACTTCT	0.607																																																	0													75.0	70.0	71.0					9																	130479949		2203	4300	6503	SO:0001819	synonymous_variant	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.324C>G	9.37:g.130479949C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYG4|B5ME24|Q5JU66|Q96M72	Silent	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L108	ENST00000373289.3	37	c.324	CCDS6875.1	9																																																																																			TTC16	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.607	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	C	NM_144965		130479949	+1	no_errors	ENST00000373289	ensembl	human	known	70_37	silent	SNP	0.996	G
TTC8	123016	genome.wustl.edu	37	14	89341385	89341385	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:89341385C>T	ENST00000345383.5	+	13	1417	c.1333C>T	c.(1333-1335)Caa>Taa	p.Q445*	TTC8_ENST00000380656.2_Nonsense_Mutation_p.Q455*|TTC8_ENST00000354441.6_Nonsense_Mutation_p.Q190*|TTC8_ENST00000536576.1_Nonsense_Mutation_p.Q216*|TTC8_ENST00000358622.5_Nonsense_Mutation_p.Q257*|TTC8_ENST00000338104.6_Nonsense_Mutation_p.Q471*|TTC8_ENST00000346301.4_Nonsense_Mutation_p.Q415*	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	481					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GGCACTATTACAAACTGCATC	0.313																																																	0													136.0	128.0	130.0					14																	89341385		2203	4297	6500	SO:0001587	stop_gained	123016			AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1333C>T	14.37:g.89341385C>T	ENSP00000339486:p.Gln445*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Nonsense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q471*	ENST00000345383.5	37	c.1411	CCDS9885.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.13|16.13	3.034919|3.034919	0.54896|0.54896	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000557580	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76248	.|0.3961	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75033	.|-0.3460	.|3	0.11794|.	T|.	0.64|.	-12.7215|-12.7215	19.293|19.293	0.94110|0.94110	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	445;216;415;471;190;455;257|243	.|.	ENSP00000337653:Q471X|.	Q|T	+|+	1|2	0|0	TTC8|TTC8	88411138|88411138	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.549000|0.549000	0.35272|0.35272	6.630000|6.630000	0.74272|0.74272	2.561000|2.561000	0.86390|0.86390	0.555000|0.555000	0.69702|0.69702	CAA|ACA	TTC8	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.313	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC8	HGNC	protein_coding	OTTHUMT00000410861.1	C	NM_144596		89341385	+1	no_errors	ENST00000338104	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TTF2	8458	genome.wustl.edu	37	1	117617603	117617603	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:117617603C>G	ENST00000369466.4	+	5	441	c.397C>G	c.(397-399)Caa>Gaa	p.Q133E		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	133					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		TGACAAGAATCAAGAACCAGC	0.403																																																	0													72.0	74.0	73.0					1																	117617603		2203	4300	6503	SO:0001583	missense	8458			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.397C>G	1.37:g.117617603C>G	ENSP00000358478:p.Gln133Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q133E	ENST00000369466.4	37	c.397	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996132	0.35226	.	.	ENSG00000116830	ENST00000369466	D	0.86956	-2.19	5.59	3.66	0.41972	.	0.000000	0.38058	N	0.001833	D	0.83751	0.5322	M	0.66939	2.045	0.23765	N	0.996905	P;D	0.54207	0.622;0.965	B;P	0.53266	0.197;0.722	T	0.76545	-0.2920	10	0.39692	T	0.17	-8.0519	11.3993	0.49860	0.329:0.671:0.0:0.0	.	133;133	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	E	133	ENSP00000358478:Q133E	ENSP00000358478:Q133E	Q	+	1	0	TTF2	117419126	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	1.915000	0.39976	0.779000	0.33543	0.557000	0.71058	CAA	TTF2	-	NULL		0.403	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	C			117617603	+1	no_errors	ENST00000369466	ensembl	human	known	70_37	missense	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179455128	179455128	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr2:179455128C>T	ENST00000591111.1	-	254	56625	c.56401G>A	c.(56401-56403)Gag>Aag	p.E18801K	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E20442K|TTN_ENST00000460472.2_Missense_Mutation_p.E11377K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E11502K|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E11569K|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E17874K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18801	Fibronectin type-III 36. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCTGTACTCATTTCCTTCA	0.418																																																	0													128.0	120.0	122.0					2																	179455128		1915	4128	6043	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56401G>A	2.37:g.179455128C>T	ENSP00000465570:p.Glu18801Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E17874K	ENST00000591111.1	37	c.53620		2	.	.	.	.	.	.	.	.	.	.	C	12.38	1.921490	0.33908	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	6.11	6.11	0.99139	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67297	0.2878	L	0.54863	1.705	0.52099	D	0.999941	D;D;D;D	0.61697	0.961;0.961;0.961;0.99	P;P;P;P	0.57846	0.764;0.764;0.764;0.828	T	0.66913	-0.5803	9	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	11377;11502;11569;18801	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	17874;11377;11569;11502;11375	ENSP00000343764:E17874K;ENSP00000434586:E11377K;ENSP00000340554:E11569K;ENSP00000352154:E11502K	ENSP00000340554:E11569K	E	-	1	0	TTN	179163374	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.864000	0.56024	2.906000	0.99361	0.655000	0.94253	GAG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179455128	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
UBC	7316	genome.wustl.edu	37	12	125398044	125398044	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:125398044C>G	ENST00000538617.1	-	3	590	c.274G>C	c.(274-276)Gag>Cag	p.E92Q	UBC_ENST00000339647.5_Missense_Mutation_p.E92Q|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Missense_Mutation_p.E92Q|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000536769.1_Missense_Mutation_p.E92Q			P0CG48	UBC_HUMAN	ubiquitin C	472	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GGCTCGACCTCAAGGGTGATG	0.532																																																	0													234.0	205.0	215.0					12																	125398044		2203	4300	6503	SO:0001583	missense	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.274G>C	12.37:g.125398044C>G	ENSP00000443053:p.Glu92Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.E92Q	ENST00000538617.1	37	c.274		12	.	.	.	.	.	.	.	.	.	.	-	14.55	2.569959	0.45798	.	.	ENSG00000150991	ENST00000536769;ENST00000535460;ENST00000538617;ENST00000541046;ENST00000339647;ENST00000546120;ENST00000544656;ENST00000541272;ENST00000540351;ENST00000541645;ENST00000535131;ENST00000546271;ENST00000540700;ENST00000535859	T;T;T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	4.12	4.12	0.48240	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	U	0.000015	D	0.83440	0.5255	L	0.48174	1.505	0.53005	D	0.999967	P;P;D	0.53619	0.892;0.869;0.961	D;P;D	0.65987	0.94;0.901;0.94	D	0.85764	0.1351	10	0.87932	D	0	.	15.327	0.74172	0.0:1.0:0.0:0.0	.	181;92;92	Q66K58;F5H7K6;P0CG48	.;.;UBC_HUMAN	Q	92	ENSP00000441543:E92Q;ENSP00000443053:E92Q;ENSP00000344818:E92Q;ENSP00000438394:E92Q;ENSP00000440205:E92Q;ENSP00000442800:E92Q;ENSP00000445337:E92Q;ENSP00000439492:E92Q;ENSP00000438289:E92Q;ENSP00000441238:E92Q;ENSP00000437452:E92Q	ENSP00000344818:E92Q	E	-	1	0	UBC	123963997	1.000000	0.71417	0.993000	0.49108	0.536000	0.34869	4.849000	0.62882	2.011000	0.59026	0.650000	0.86243	GAG	UBC	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup		0.532	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400179.1	C	NM_021009		125398044	-1	no_errors	ENST00000339647	ensembl	human	known	70_37	missense	SNP	1.000	G
UBE2J2	118424	genome.wustl.edu	37	1	1203290	1203290	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:1203290G>A	ENST00000349431.6	-	2	302	c.83C>T	c.(82-84)cCg>cTg	p.P28L	UBE2J2_ENST00000491779.1_Intron|UBE2J2_ENST00000348298.7_5'UTR|UBE2J2_ENST00000339385.6_5'Flank|UBE2J2_ENST00000400930.4_Missense_Mutation_p.P28L|UBE2J2_ENST00000360466.2_Missense_Mutation_p.P28L|UBE2J2_ENST00000400929.2_Intron|UBE2J2_ENST00000347370.2_5'UTR	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	28					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		GTAAGGCACCGGGTCTTTCTT	0.582																																																	0													223.0	241.0	235.0					1																	1203290		2203	4300	6503	SO:0001583	missense	118424			AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.83C>T	1.37:g.1203290G>A	ENSP00000305826:p.Pro28Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P28L	ENST00000349431.6	37	c.83	CCDS14.1	1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484807	0.63962	.	.	ENSG00000160087	ENST00000349431;ENST00000360466;ENST00000400930;ENST00000435198;ENST00000422076;ENST00000502382;ENST00000488418	T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13	5.72	4.8	0.61643	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.047167	0.85682	N	0.000000	T	0.73976	0.3656	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.934;1.0	T	0.82782	-0.0287	10	0.87932	D	0	.	15.4989	0.75680	0.0:0.1391:0.8609:0.0	.	28;28	A8MYC7;Q8N2K1	.;UB2J2_HUMAN	L	28	ENSP00000305826:P28L;ENSP00000353653:P28L;ENSP00000383719:P28L;ENSP00000393301:P28L;ENSP00000401898:P28L;ENSP00000424342:P28L	ENSP00000305826:P28L	P	-	2	0	UBE2J2	1193153	1.000000	0.71417	0.879000	0.34478	0.051000	0.14879	8.860000	0.92272	1.407000	0.46875	0.655000	0.94253	CCG	UBE2J2	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.582	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	UBE2J2	HGNC	protein_coding	OTTHUMT00000005430.1	G	NM_058167		1203290	-1	no_errors	ENST00000400930	ensembl	human	known	70_37	missense	SNP	0.999	A
UGT2A3	79799	genome.wustl.edu	37	4	69816797	69816797	+	Missense_Mutation	SNP	G	G	A	rs371911179		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:69816797G>A	ENST00000251566.4	-	1	712	c.682C>T	c.(682-684)Cat>Tat	p.H228Y	UGT2A3_ENST00000420231.2_5'UTR	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	228					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TCCCAAAAATGATAGTCGTAA	0.299																																																	0													41.0	43.0	42.0					4																	69816797		2197	4298	6495	SO:0001583	missense	79799				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.682C>T	4.37:g.69816797G>A	ENSP00000251566:p.His228Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H6S4	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.H228Y	ENST00000251566.4	37	c.682	CCDS3525.1	4	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586157	0.28268	.	.	ENSG00000135220	ENST00000251566	T	0.59364	0.27	4.44	-5.98	0.02220	.	1.449290	0.04135	N	0.318590	T	0.36580	0.0972	N	0.04508	-0.205	0.09310	N	0.999998	P	0.48407	0.91	P	0.47827	0.558	T	0.41875	-0.9484	10	0.72032	D	0.01	.	4.233	0.10613	0.1369:0.0854:0.2529:0.5248	.	228	Q6UWM9	UD2A3_HUMAN	Y	228	ENSP00000251566:H228Y	ENSP00000251566:H228Y	H	-	1	0	UGT2A3	69851386	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-2.836000	0.00740	-1.563000	0.01680	-1.273000	0.01405	CAT	UGT2A3	-	pfam_UDP_glucos_trans		0.299	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A3	HGNC	protein_coding	OTTHUMT00000251564.1	G	NM_024743		69816797	-1	no_errors	ENST00000251566	ensembl	human	known	70_37	missense	SNP	0.000	A
UGT2B11	10720	genome.wustl.edu	37	4	70080248	70080248	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr4:70080248C>T	ENST00000446444.1	-	1	201	c.193G>A	c.(193-195)Gat>Aat	p.D65N	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	65					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						TCATTGGGATCAAAAAGAATG	0.373																																																	0													56.0	64.0	62.0					4																	70080248		2195	4279	6474	SO:0001583	missense	10720			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.193G>A	4.37:g.70080248C>T	ENSP00000387683:p.Asp65Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KNV9	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D65N	ENST00000446444.1	37	c.193	CCDS3527.1	4	.	.	.	.	.	.	.	.	.	.	-	1.772	-0.484147	0.04383	.	.	ENSG00000213759	ENST00000446444	T	0.60171	0.21	1.96	1.96	0.26148	.	0.265381	0.30483	U	0.009525	T	0.48409	0.1498	L	0.55834	1.745	0.09310	N	1	B	0.12013	0.005	B	0.15484	0.013	T	0.43458	-0.9390	10	0.39692	T	0.17	.	9.5515	0.39313	0.0:1.0:0.0:0.0	.	65	O75310	UDB11_HUMAN	N	65	ENSP00000387683:D65N	ENSP00000387683:D65N	D	-	1	0	UGT2B11	70114837	0.000000	0.05858	0.185000	0.23176	0.170000	0.22686	0.066000	0.14489	1.087000	0.41251	0.184000	0.17185	GAT	UGT2B11	-	pfam_UDP_glucos_trans		0.373	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	HGNC	protein_coding	OTTHUMT00000251551.2	C	NM_001073		70080248	-1	no_errors	ENST00000446444	ensembl	human	known	70_37	missense	SNP	0.270	T
UGT3A1	133688	genome.wustl.edu	37	5	35988572	35988572	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:35988572C>T	ENST00000274278.3	-	2	533	c.176G>A	c.(175-177)aGt>aAt	p.S59N	UGT3A1_ENST00000507113.1_Intron|UGT3A1_ENST00000333811.4_Missense_Mutation_p.S5N|UGT3A1_ENST00000503189.1_Missense_Mutation_p.S59N|UGT3A1_ENST00000513233.1_Intron	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	59						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAACTTTCCACTCTGATGAAG	0.343																																																	0													75.0	70.0	72.0					5																	35988572		2203	4300	6503	SO:0001583	missense	133688				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.176G>A	5.37:g.35988572C>T	ENSP00000274278:p.Ser59Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.S59N	ENST00000274278.3	37	c.176	CCDS3913.1	5	.	.	.	.	.	.	.	.	.	.	C	8.620	0.891261	0.17613	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000333811	T;T;T	0.61274	0.12;0.12;0.97	3.21	-6.42	0.01932	.	2.272660	0.02443	U	0.084836	T	0.46814	0.1412	L	0.59436	1.845	0.09310	N	1	B;B;B	0.31054	0.014;0.306;0.026	B;B;B	0.31495	0.063;0.131;0.033	T	0.32745	-0.9895	10	0.62326	D	0.03	.	0.4012	0.00426	0.2397:0.1519:0.2272:0.3813	.	59;5;59	B7Z8Q8;G5E961;Q6NUS8	.;.;UD3A1_HUMAN	N	59;59;5	ENSP00000274278:S59N;ENSP00000427079:S59N;ENSP00000328033:S5N	ENSP00000274278:S59N	S	-	2	0	UGT3A1	36024329	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.186000	0.03070	-1.754000	0.01321	0.462000	0.41574	AGT	UGT3A1	-	pfam_UDP_glucos_trans		0.343	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	HGNC	protein_coding	OTTHUMT00000253770.2	C	NM_152404		35988572	-1	no_errors	ENST00000274278	ensembl	human	known	70_37	missense	SNP	0.000	T
UMOD	7369	genome.wustl.edu	37	16	20348020	20348020	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:20348020C>T	ENST00000570689.1	-	9	1916	c.1770G>A	c.(1768-1770)ggG>ggA	p.G590G	UMOD_ENST00000396138.4_Silent_p.G639G|UMOD_ENST00000424589.1_Silent_p.G623G|UMOD_ENST00000396134.2_Silent_p.G623G|UMOD_ENST00000570331.1_5'UTR|UMOD_ENST00000396142.2_Silent_p.G590G|UMOD_ENST00000302509.4_Silent_p.G590G			P07911	UROM_HUMAN	uromodulin	590					cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CTATGACACTCCCACTTCGGA	0.527																																																	0													107.0	88.0	94.0					16																	20348020		2203	4300	6503	SO:0001819	synonymous_variant	7369			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1770G>A	16.37:g.20348020C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Silent	SNP	pfam_ZP_dom,pfam_EGF-like_Ca-bd,pfam_EG-like_dom,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_ZP_dom,pfscan_EG-like_dom,pfscan_ZP_dom,prints_ZP_dom	p.G623	ENST00000570689.1	37	c.1869	CCDS10583.1	16																																																																																			UMOD	-	NULL		0.527	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	UMOD	HGNC	protein_coding	OTTHUMT00000436862.1	C			20348020	-1	no_errors	ENST00000424589	ensembl	human	known	70_37	silent	SNP	0.037	T
UPF1	5976	genome.wustl.edu	37	19	18966783	18966783	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:18966783G>A	ENST00000599848.1	+	12	1836	c.1627G>A	c.(1627-1629)Gag>Aag	p.E543K	UPF1_ENST00000262803.5_Missense_Mutation_p.E532K			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	543					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CCAGCTAACGGAGAAGATCCA	0.612																																																	0													68.0	55.0	59.0					19																	18966783		2203	4300	6503	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1627G>A	19.37:g.18966783G>A	ENSP00000470142:p.Glu543Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom	p.E543K	ENST00000599848.1	37	c.1627		19	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087713	0.76642	.	.	ENSG00000005007	ENST00000262803	D	0.84070	-1.8	4.46	4.46	0.54185	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	D	0.85720	0.5762	M	0.80616	2.505	0.80722	D	1	B;B	0.23128	0.08;0.065	B;B	0.32805	0.153;0.047	D	0.85866	0.1413	10	0.66056	D	0.02	-48.247	16.4279	0.83824	0.0:0.0:1.0:0.0	.	543;532	Q92900;Q92900-2	RENT1_HUMAN;.	K	532	ENSP00000262803:E532K	ENSP00000262803:E532K	E	+	1	0	UPF1	18827783	1.000000	0.71417	0.929000	0.37066	0.683000	0.39861	9.128000	0.94424	2.199000	0.70637	0.655000	0.94253	GAG	UPF1	-	pfam_Helicase/UvrB_dom		0.612	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	G	NM_002911		18966783	+1	no_errors	ENST00000599848	ensembl	human	known	70_37	missense	SNP	1.000	A
UPF2	26019	genome.wustl.edu	37	10	11971866	11971866	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:11971866C>T	ENST00000356352.2	-	20	4280	c.3807G>A	c.(3805-3807)ggG>ggA	p.G1269G	UPF2_ENST00000357604.5_Silent_p.G1269G|UPF2_ENST00000397053.2_Silent_p.G1269G			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1269	Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF1 C- terminus.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TGCTTTACCTCCCACCAGTCT	0.468																																																	0													161.0	145.0	150.0					10																	11971866		2203	4300	6503	SO:0001819	synonymous_variant	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3807G>A	10.37:g.11971866C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.G1269	ENST00000356352.2	37	c.3807	CCDS7086.1	10																																																																																			UPF2	-	NULL		0.468	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	C			11971866	-1	no_errors	ENST00000356352	ensembl	human	known	70_37	silent	SNP	1.000	T
UPF2	26019	genome.wustl.edu	37	10	11971934	11971934	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:11971934C>T	ENST00000356352.2	-	20	4212	c.3739G>A	c.(3739-3741)Gag>Aag	p.E1247K	UPF2_ENST00000357604.5_Missense_Mutation_p.E1247K|UPF2_ENST00000397053.2_Missense_Mutation_p.E1247K			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	1247	Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF1 C- terminus.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				GGCCGCCTCTCACGATTGGTG	0.463																																																	0													154.0	139.0	144.0					10																	11971934		2203	4300	6503	SO:0001583	missense	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.3739G>A	10.37:g.11971934C>T	ENSP00000348708:p.Glu1247Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E1247K	ENST00000356352.2	37	c.3739	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971693	0.74246	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.44881	0.91;0.91;0.91	5.23	5.23	0.72850	.	0.128575	0.51477	D	0.000100	T	0.36880	0.0983	L	0.60455	1.87	0.58432	D	0.999997	P	0.37781	0.608	B	0.26864	0.074	T	0.25984	-1.0116	10	0.19147	T	0.46	.	18.7827	0.91941	0.0:1.0:0.0:0.0	.	1247	Q9HAU5	RENT2_HUMAN	K	1247	ENSP00000348708:E1247K;ENSP00000350221:E1247K;ENSP00000380244:E1247K	ENSP00000348708:E1247K	E	-	1	0	UPF2	12011940	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.270000	0.78493	2.439000	0.82584	0.462000	0.41574	GAG	UPF2	-	NULL		0.463	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	C			11971934	-1	no_errors	ENST00000356352	ensembl	human	known	70_37	missense	SNP	1.000	T
UPF2	26019	genome.wustl.edu	37	10	11994167	11994167	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:11994167C>G	ENST00000356352.2	-	14	3405	c.2932G>C	c.(2932-2934)Gat>Cat	p.D978H	UPF2_ENST00000357604.5_Missense_Mutation_p.D978H|UPF2_ENST00000397053.2_Missense_Mutation_p.D978H			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	978	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TCTAGTGTATCACTGATCATG	0.353																																																	0													162.0	157.0	159.0					10																	11994167		2203	4300	6503	SO:0001583	missense	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2932G>C	10.37:g.11994167C>G	ENSP00000348708:p.Asp978His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.D978H	ENST00000356352.2	37	c.2932	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623406	0.87460	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.26810	1.71;1.71;1.71	5.48	5.48	0.80851	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.052886	0.64402	D	0.000001	T	0.63522	0.2518	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72411	-0.4302	10	0.87932	D	0	.	19.7018	0.96057	0.0:1.0:0.0:0.0	.	978	Q9HAU5	RENT2_HUMAN	H	978	ENSP00000348708:D978H;ENSP00000350221:D978H;ENSP00000380244:D978H	ENSP00000348708:D978H	D	-	1	0	UPF2	12034173	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.733000	0.93635	0.591000	0.81541	GAT	UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.353	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	C			11994167	-1	no_errors	ENST00000356352	ensembl	human	known	70_37	missense	SNP	1.000	G
USP32	84669	genome.wustl.edu	37	17	58292072	58292072	+	Missense_Mutation	SNP	C	C	A	rs377023063		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:58292072C>A	ENST00000300896.4	-	17	2125	c.1931G>T	c.(1930-1932)cGa>cTa	p.R644L	USP32_ENST00000592339.1_Missense_Mutation_p.R314L	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	644					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			GGTCTGCATTCGACTAAAACA	0.423																																																	0													32.0	31.0	32.0					17																	58292072		2200	4277	6477	SO:0001583	missense	84669			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.1931G>T	17.37:g.58292072C>A	ENSP00000300896:p.Arg644Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_EF_hand_Ca-bd,smart_Pept_C19_DUSP,pfscan_EF_HAND_2,pfscan_Peptidase_C19,prints_Recoverin	p.R644L	ENST00000300896.4	37	c.1931	CCDS32697.1	17	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045994	0.93685	.	.	ENSG00000170832	ENST00000300896	T	0.51325	0.71	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	M	0.64170	1.965	0.80722	D	1	D	0.59767	0.986	P	0.52309	0.695	T	0.63739	-0.6569	10	0.66056	D	0.02	.	19.155	0.93506	0.0:1.0:0.0:0.0	.	644	Q8NFA0	UBP32_HUMAN	L	644	ENSP00000300896:R644L	ENSP00000300896:R644L	R	-	2	0	USP32	55646854	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.921000	0.70028	2.539000	0.85634	0.650000	0.86243	CGA	USP32	-	NULL		0.423	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	C	NM_032582		58292072	-1	no_errors	ENST00000300896	ensembl	human	known	70_37	missense	SNP	1.000	A
USP6NL	9712	genome.wustl.edu	37	10	11523855	11523855	+	Missense_Mutation	SNP	A	A	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:11523855A>T	ENST00000609104.1	-	14	1386	c.992T>A	c.(991-993)tTt>tAt	p.F331Y	USP6NL_ENST00000277575.5_Missense_Mutation_p.F348Y|USP6NL_ENST00000379237.2_Missense_Mutation_p.F354Y	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	331					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TTCAAAGAAAAAATCCTTTGC	0.368																																																	0													45.0	43.0	44.0					10																	11523855		1793	4061	5854	SO:0001583	missense	9712			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.992T>A	10.37:g.11523855A>T	ENSP00000476462:p.Phe331Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.F348Y	ENST00000609104.1	37	c.1043	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801366	0.90538	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.23552	1.9;1.9	5.55	5.55	0.83447	Rab-GAP/TBC domain (1);	0.104334	0.64402	D	0.000002	T	0.44582	0.1300	M	0.81802	2.56	0.80722	D	1	P;P	0.37824	0.609;0.537	B;P	0.47251	0.436;0.542	T	0.41538	-0.9503	10	0.48119	T	0.1	.	15.6977	0.77512	1.0:0.0:0.0:0.0	.	331;348	Q92738;Q92738-2	US6NL_HUMAN;.	Y	331;348;331	ENSP00000277575:F348Y;ENSP00000368539:F331Y	ENSP00000277575:F348Y	F	-	2	0	USP6NL	11563861	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.779000	0.91792	2.107000	0.64212	0.482000	0.46254	TTT	USP6NL	-	superfamily_Rab-GTPase-TBC_dom		0.368	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3	A	NM_014688		11523855	-1	no_errors	ENST00000277575	ensembl	human	known	70_37	missense	SNP	1.000	T
USPL1	10208	genome.wustl.edu	37	13	31205020	31205020	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr13:31205020G>A	ENST00000255304.4	+	4	619	c.277G>A	c.(277-279)Gat>Aat	p.D93N	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	93					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		AATTTCTCCTGATTTGGAAGA	0.328																																					Ovarian(60;318 1180 1554 28110 31601)												0													58.0	61.0	60.0					13																	31205020		2203	4300	6503	SO:0001583	missense	10208			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.277G>A	13.37:g.31205020G>A	ENSP00000255304:p.Asp93Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.D93N	ENST00000255304.4	37	c.277	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514591	0.64522	.	.	ENSG00000132952	ENST00000255304	T	0.09163	3.01	6.07	6.07	0.98685	.	0.262304	0.35903	N	0.002916	T	0.20901	0.0503	M	0.69823	2.125	0.32554	N	0.532037	P	0.46277	0.875	P	0.47376	0.545	T	0.13124	-1.0521	10	0.52906	T	0.07	-18.1421	13.8057	0.63230	0.0695:0.0:0.9305:0.0	.	93	Q5W0Q7	USPL1_HUMAN	N	93	ENSP00000255304:D93N	ENSP00000255304:D93N	D	+	1	0	USPL1	30103020	1.000000	0.71417	0.994000	0.49952	0.120000	0.20174	4.959000	0.63666	2.885000	0.99019	0.655000	0.94253	GAT	USPL1	-	NULL		0.328	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	G	NM_005800		31205020	+1	no_errors	ENST00000255304	ensembl	human	known	70_37	missense	SNP	0.955	A
UTP20	27340	genome.wustl.edu	37	12	101769493	101769493	+	Missense_Mutation	SNP	T	T	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:101769493T>G	ENST00000261637.4	+	56	7529	c.7355T>G	c.(7354-7356)aTt>aGt	p.I2452S		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2452			I -> F (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TGTAATATTATTCAGTTTACC	0.308																																																	0													66.0	65.0	65.0					12																	101769493		2203	4300	6503	SO:0001583	missense	27340			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7355T>G	12.37:g.101769493T>G	ENSP00000261637:p.Ile2452Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.I2452S	ENST00000261637.4	37	c.7355	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574167	0.28092	.	.	ENSG00000120800	ENST00000261637	T	0.65732	-0.17	5.33	5.33	0.75918	Armadillo-type fold (1);	0.346678	0.31210	N	0.008047	T	0.53578	0.1805	L	0.60455	1.87	0.39667	D	0.970703	B	0.25235	0.121	B	0.18263	0.021	T	0.51857	-0.8652	10	0.19590	T	0.45	-2.7595	9.7797	0.40640	0.0:0.077:0.0:0.923	.	2452	O75691	UTP20_HUMAN	S	2452	ENSP00000261637:I2452S	ENSP00000261637:I2452S	I	+	2	0	UTP20	100293624	0.991000	0.36638	0.969000	0.41365	0.366000	0.29705	3.847000	0.55895	2.019000	0.59389	0.459000	0.35465	ATT	UTP20	-	superfamily_ARM-type_fold		0.308	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	T	NM_014503		101769493	+1	no_errors	ENST00000261637	ensembl	human	known	70_37	missense	SNP	0.976	G
ATG7	10533	genome.wustl.edu	37	3	11600204	11600204	+	IGR	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:11600204G>C	ENST00000354449.3	+	0	4959				VGLL4_ENST00000273038.3_Missense_Mutation_p.I233M|VGLL4_ENST00000424529.2_Missense_Mutation_p.I149M|VGLL4_ENST00000413604.1_Missense_Mutation_p.I174M|VGLL4_ENST00000404339.1_Missense_Mutation_p.I238M|VGLL4_ENST00000430365.2_Missense_Mutation_p.I239M|VGLL4_ENST00000451674.2_Missense_Mutation_p.I153M	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CGGAGCCCGTGATGGACACGG	0.632																																																	0													69.0	80.0	76.0					3																	11600204		2203	4300	6503	SO:0001628	intergenic_variant	9686			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740		3.37:g.11600204G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	smart_TDU_repeat	p.I239M	ENST00000354449.3	37	c.717	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	g	22.8	4.333176	0.81801	.	.	ENSG00000144560	ENST00000273038;ENST00000413604;ENST00000451674;ENST00000424529;ENST00000430365;ENST00000404339	T;T;T	0.55413	0.52;0.58;0.56	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73156	0.3551	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.999;0.997;0.997;0.997;0.997	T	0.75980	-0.3126	10	0.72032	D	0.01	-38.5468	18.8719	0.92319	0.0:0.0:1.0:0.0	.	239;153;149;238;233	G5E9M7;Q14135-6;Q14135-5;G5E9F4;Q14135	.;.;.;.;VGLL4_HUMAN	M	233;174;153;149;239;238	ENSP00000273038:I233M;ENSP00000404251:I239M;ENSP00000384705:I238M	ENSP00000273038:I233M	I	-	3	3	VGLL4	11575204	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.487000	0.66863	2.468000	0.83385	0.558000	0.71614	ATC	VGLL4	-	NULL		0.632	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL4	HGNC	protein_coding	OTTHUMT00000251951.3	G	NM_006395		11600204	-1	no_errors	ENST00000430365	ensembl	human	known	70_37	missense	SNP	1.000	C
VPS4A	27183	genome.wustl.edu	37	16	69354623	69354623	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:69354623C>T	ENST00000254950.11	+	8	958	c.802C>T	c.(802-804)Ctt>Ttt	p.L268F	COG8_ENST00000564419.1_5'UTR	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				GACTCTGGTTCTTGGAGCCAC	0.562																																																	0													35.0	39.0	38.0					16																	69354623		1985	4163	6148	SO:0001583	missense	27183			AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.802C>T	16.37:g.69354623C>T	ENSP00000254950:p.Leu268Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase	p.L268F	ENST00000254950.11	37	c.802	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535929	0.85812	.	.	ENSG00000132612	ENST00000254950	D	0.95482	-3.72	5.77	5.77	0.91146	ATPase, AAA-type, conserved site (1);ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.054353	0.64402	D	0.000001	D	0.97213	0.9089	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96814	0.9599	10	0.87932	D	0	-18.965	9.2449	0.37520	0.0:0.8459:0.0:0.1541	.	268	Q9UN37	VPS4A_HUMAN	F	268	ENSP00000254950:L268F	ENSP00000254950:L268F	L	+	1	0	VPS4A	67912124	0.860000	0.29831	0.997000	0.53966	0.958000	0.62258	1.744000	0.38268	2.884000	0.98904	0.655000	0.94253	CTT	VPS4A	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase		0.562	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	C	NM_013245		69354623	+1	no_errors	ENST00000254950	ensembl	human	known	70_37	missense	SNP	1.000	T
VTN	7448	genome.wustl.edu	37	17	26696313	26696313	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:26696313G>A	ENST00000226218.4	-	4	1284	c.666C>T	c.(664-666)ttC>ttT	p.F222F	CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000457710.3_5'Flank|TMEM199_ENST00000509083.1_Intron|CTB-96E2.2_ENST00000555059.2_5'Flank|VTN_ENST00000536498.1_5'UTR|SARM1_ENST00000379061.4_Intron|VTN_ENST00000438614.1_5'Flank	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	222					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CTGGCACCTTGAAGAGGTAGG	0.622																																																	0													78.0	80.0	79.0					17																	26696313		2203	4300	6503	SO:0001819	synonymous_variant	7448			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.666C>T	17.37:g.26696313G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7G0|P01141|Q9BSH7	Silent	SNP	pfam_Hemopexin/matrixin_repeat,pfam_Somatomedin_B_dom,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.F222	ENST00000226218.4	37	c.666	CCDS11229.1	17																																																																																			VTN	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat		0.622	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTN	HGNC	protein_coding	OTTHUMT00000255680.2	G	NM_000638		26696313	-1	no_errors	ENST00000226218	ensembl	human	known	70_37	silent	SNP	1.000	A
WASH6P	653440	genome.wustl.edu	37	X	155250676	155250676	+	RNA	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:155250676C>T	ENST00000461007.1	+	0	0				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCTCGGGCATCAggagccagc	0.532																																																	0																																												653440			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155250676C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGF1|Q8N305	Silent	SNP	pfam_WASH_WASD	p.I17	ENST00000461007.1	37	c.51		X																																																																																			WASH6P	-	NULL		0.532	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	C	NG_008380		155250676	+1	no_errors	ENST00000359512	ensembl	human	known	70_37	silent	SNP	0.001	T
WBP11	51729	genome.wustl.edu	37	12	14940418	14940418	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:14940418G>A	ENST00000261167.2	-	12	1740	c.1507C>T	c.(1507-1509)Cgt>Tgt	p.R503C		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	503	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						ATGCCAGGACGAGGTGGAGGA	0.463																																																	0													42.0	47.0	46.0					12																	14940418		2203	4300	6503	SO:0001583	missense	51729			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1507C>T	12.37:g.14940418G>A	ENSP00000261167:p.Arg503Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AY8	Missense_Mutation	SNP	pfam_WW_dom-bd_prot_11	p.R503C	ENST00000261167.2	37	c.1507	CCDS8666.1	12	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068793	0.55539	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	D	0.89939	-2.59	5.2	5.2	0.72013	.	0.384961	0.28908	N	0.013748	T	0.80974	0.4727	N	0.08118	0	0.54753	D	0.999984	D	0.69078	0.997	B	0.44315	0.446	D	0.84926	0.0857	10	0.59425	D	0.04	-3.3231	16.2797	0.82670	0.0:0.0:1.0:0.0	.	503	Q9Y2W2	WBP11_HUMAN	C	503;469	ENSP00000442868:R469C	ENSP00000261167:R503C	R	-	1	0	WBP11	14831685	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.229000	0.89791	2.717000	0.92951	0.655000	0.94253	CGT	WBP11	-	NULL		0.463	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP11	HGNC	protein_coding	OTTHUMT00000400850.1	G	NM_016312		14940418	-1	no_errors	ENST00000261167	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR45	11152	genome.wustl.edu	37	X	48932841	48932841	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:48932841G>C	ENST00000376372.3	-	10	1108	c.927C>G	c.(925-927)atC>atG	p.I309M	WDR45_ENST00000376368.2_Missense_Mutation_p.I310M|WDR45_ENST00000356463.3_Missense_Mutation_p.I310M|WDR45_ENST00000465431.1_5'Flank|PRAF2_ENST00000491199.1_5'Flank|AF196779.12_ENST00000376358.3_Intron|WDR45_ENST00000485908.1_Missense_Mutation_p.I274M|WDR45_ENST00000322995.8_Missense_Mutation_p.I320M|WDR45_ENST00000553851.1_Intron|PRAF2_ENST00000376390.4_5'Flank|WDR45_ENST00000396681.4_Missense_Mutation_p.I295M|PRAF2_ENST00000376386.3_5'Flank|WDR45_ENST00000473974.1_Intron	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	309					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						CGAAGGCGCAGATGCAAGCTG	0.597																																																	0													64.0	53.0	57.0					X																	48932841		2203	4300	6503	SO:0001583	missense	11152			BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.927C>G	X.37:g.48932841G>C	ENSP00000365551:p.Ile309Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.I320M	ENST00000376372.3	37	c.960	CCDS35250.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.61|13.61	2.287261|2.287261	0.40494|0.40494	.|.	.|.	ENSG00000196998|ENSG00000196998	ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000376368;ENST00000396681|ENST00000486337;ENST00000367375	T;T;T;T;T;T|.	0.76968|.	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06|.	4.09|4.09	4.09|4.09	0.47781|0.47781	.|.	0.136529|.	0.51477|.	D|.	0.000088|.	T|T	0.67951|0.67951	0.2948|0.2948	L|L	0.53617|0.53617	1.68|1.68	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.41546|.	0.749;0.754;0.57;0.458|.	B;B;B;B|.	0.40825|.	0.341;0.169;0.169;0.15|.	T|T	0.67142|0.67142	-0.5745|-0.5745	10|5	0.52906|.	T|.	0.07|.	-16.6594|-16.6594	14.9736|14.9736	0.71251|0.71251	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	320;274;310;309|.	Q9Y484-2;C9JYH8;Q9Y484-3;Q9Y484|.	.;.;.;WIPI4_HUMAN|.	M|V	309;320;310;274;310;295|34;236	ENSP00000365551:I309M;ENSP00000365543:I320M;ENSP00000348848:I310M;ENSP00000419897:I274M;ENSP00000365546:I310M;ENSP00000379913:I295M|.	ENSP00000365543:I320M|.	I|L	-|-	3|1	3|2	WDR45|WDR45	48819785|48819785	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.907000|3.907000	0.56348|0.56348	1.968000|1.968000	0.57251|0.57251	0.409000|0.409000	0.27619|0.27619	ATC|CTG	WDR45	-	NULL		0.597	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR45	HGNC	protein_coding	OTTHUMT00000083418.2	G	NM_007075		48932841	-1	no_errors	ENST00000322995	ensembl	human	known	70_37	missense	SNP	1.000	C
WDR48	57599	genome.wustl.edu	37	3	39116328	39116328	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:39116328G>A	ENST00000302313.5	+	8	812	c.784G>A	c.(784-786)Gat>Aat	p.D262N	WDR48_ENST00000544962.1_Missense_Mutation_p.D54N|WDR48_ENST00000396258.3_Missense_Mutation_p.D180N|WDR48_ENST00000418020.1_De_novo_Start_OutOfFrame	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	262					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCAAGTCAATGATGCCTTCAC	0.463																																																	0													180.0	154.0	163.0					3																	39116328		2203	4300	6503	SO:0001583	missense	57599			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.784G>A	3.37:g.39116328G>A	ENSP00000307491:p.Asp262Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	pfam_DUF3337,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D262N	ENST00000302313.5	37	c.784	CCDS33738.1	3	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747195	0.89663	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258	T;T;T	0.60424	2.26;0.19;2.24	6.01	6.01	0.97437	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.087875	0.85682	D	0.000000	T	0.52996	0.1769	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.26041	0.13;0.068;0.029;0.14	B;B;B;B	0.35899	0.043;0.068;0.059;0.213	T	0.51356	-0.8716	10	0.59425	D	0.04	-8.9229	20.5211	0.99222	0.0:0.0:1.0:0.0	.	54;180;253;262	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	N	262;54;180	ENSP00000307491:D262N;ENSP00000445187:D54N;ENSP00000379557:D180N	ENSP00000307491:D262N	D	+	1	0	WDR48	39091332	1.000000	0.71417	0.988000	0.46212	0.969000	0.65631	9.869000	0.99810	2.861000	0.98227	0.650000	0.86243	GAT	WDR48	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.463	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1	G	NM_020839		39116328	+1	no_errors	ENST00000302313	ensembl	human	known	70_37	missense	SNP	1.000	A
CFAP57	149465	genome.wustl.edu	37	1	43638464	43638464	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:43638464C>G	ENST00000372492.4	+	2	364	c.40C>G	c.(40-42)Ctt>Gtt	p.L14V	WDR65_ENST00000528956.1_Missense_Mutation_p.L14V|EBNA1BP2_ENST00000472982.1_5'Flank|EBNA1BP2_ENST00000431635.2_5'Flank|EBNA1BP2_ENST00000236051.2_5'Flank	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		14										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTTTTTGGTCTTCGATCCCA	0.478																																																	0													145.0	129.0	134.0					1																	43638464		2203	4300	6503	SO:0001583	missense	149465																														ENST00000372492.4:c.40C>G	1.37:g.43638464C>G	ENSP00000361570:p.Leu14Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L14V	ENST00000372492.4	37	c.40		1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997829	0.54147	.	.	ENSG00000243710	ENST00000372492;ENST00000528956;ENST00000529956	T;T;T	0.37915	4.9;1.17;4.9	5.27	2.37	0.29283	.	0.070557	0.64402	D	0.000018	T	0.28034	0.0691	L	0.48362	1.52	0.37137	D	0.901528	P	0.42827	0.791	B	0.40101	0.319	T	0.13124	-1.0521	10	0.23891	T	0.37	.	8.6227	0.33870	0.0:0.6297:0.0:0.3703	.	14	Q96MR6-2	.	V	14	ENSP00000361570:L14V;ENSP00000435310:L14V;ENSP00000434133:L14V	ENSP00000361570:L14V	L	+	1	0	WDR65	43411051	0.991000	0.36638	0.907000	0.35723	0.863000	0.49368	1.689000	0.37700	0.221000	0.20879	0.655000	0.94253	CTT	WDR65	-	superfamily_WD40_repeat_dom		0.478	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1	C			43638464	+1	no_errors	ENST00000528956	ensembl	human	known	70_37	missense	SNP	0.982	G
WDR7	23335	genome.wustl.edu	37	18	54605880	54605880	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr18:54605880G>C	ENST00000254442.3	+	24	4159	c.3948G>C	c.(3946-3948)aaG>aaC	p.K1316N	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.K1283N	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1316					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TTATTGAAAAGATGCCCACAG	0.358																																																	0													93.0	88.0	90.0					18																	54605880		2203	4300	6503	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3948G>C	18.37:g.54605880G>C	ENSP00000254442:p.Lys1316Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K1316N	ENST00000254442.3	37	c.3948	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619391	0.66787	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.18174	2.23;2.23	5.99	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.30510	0.0767	L	0.52573	1.65	0.58432	D	0.999992	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.987	T	0.02275	-1.1184	10	0.51188	T	0.08	.	7.2137	0.25947	0.3348:0.0:0.6652:0.0	.	1283;1316	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	N	1316;1283;641;1283	ENSP00000254442:K1316N;ENSP00000350187:K1283N	ENSP00000254442:K1316N	K	+	3	2	WDR7	52756878	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.010000	0.40913	1.542000	0.49330	-0.150000	0.13652	AAG	WDR7	-	superfamily_ARM-type_fold		0.358	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	G			54605880	+1	no_errors	ENST00000254442	ensembl	human	known	70_37	missense	SNP	1.000	C
WFIKKN1	117166	genome.wustl.edu	37	16	683820	683820	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:683820C>T	ENST00000319070.2	+	2	1732	c.1410C>T	c.(1408-1410)ctC>ctT	p.L470L		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	470	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				AGATGGGCCTCAAGTTCTTGG	0.687																																																	0													76.0	42.0	53.0					16																	683820		2177	4292	6469	SO:0001819	synonymous_variant	117166			AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1410C>T	16.37:g.683820C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7LDW0|Q8NBQ1|Q96S20	Silent	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Whey_acidic_protein_4-diS_core,pfam_Kazal-type_dom,pfam_Immunoglobulin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Prot_inh_Kunz-m	p.L470	ENST00000319070.2	37	c.1410	CCDS10414.1	16																																																																																			WFIKKN1	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain		0.687	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN1	HGNC	protein_coding	OTTHUMT00000206731.2	C	NM_053284		683820	+1	no_errors	ENST00000319070	ensembl	human	known	70_37	silent	SNP	1.000	T
WIZ	58525	genome.wustl.edu	37	19	15547763	15547763	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:15547763G>C	ENST00000389282.4	-	4	2663	c.2450C>G	c.(2449-2451)tCt>tGt	p.S817C	WIZ_ENST00000263381.7_Missense_Mutation_p.S128C			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	817					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CTCAGCAGCAGAGGTGGCCAG	0.682																																																	0													42.0	51.0	48.0					19																	15547763		2059	4191	6250	SO:0001583	missense	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.2450C>G	19.37:g.15547763G>C	ENSP00000373933:p.Ser817Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S817C	ENST00000389282.4	37	c.2450		19	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660190	0.47572	.	.	ENSG00000011451	ENST00000389282;ENST00000263381	T	0.03124	4.04	4.26	4.26	0.50523	.	0.173561	0.38663	N	0.001620	T	0.07143	0.0181	.	.	.	0.80722	D	1	P	0.52577	0.954	P	0.47162	0.54	T	0.08289	-1.0729	9	0.66056	D	0.02	-15.2832	11.6822	0.51463	0.0:0.1797:0.8203:0.0	.	128	O95785-2	.	C	817;128	ENSP00000373933:S817C	ENSP00000263381:S128C	S	-	2	0	WIZ	15408763	.	.	0.915000	0.36163	0.476000	0.33039	.	.	2.215000	0.71742	0.449000	0.29647	TCT	WIZ	-	NULL		0.682	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		G	NM_021241		15547763	-1	no_errors	ENST00000389282	ensembl	human	known	70_37	missense	SNP	0.946	C
XPO7	23039	genome.wustl.edu	37	8	21845357	21845357	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:21845357C>T	ENST00000252512.9	+	15	1876	c.1776C>T	c.(1774-1776)ttC>ttT	p.F592F	XPO7_ENST00000433566.4_Silent_p.F593F|XPO7_ENST00000434536.1_Silent_p.F601F	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	592					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TAAGCGTCTTCATAGGAAAAA	0.458																																																	0													107.0	101.0	103.0					8																	21845357		1965	4151	6116	SO:0001819	synonymous_variant	23039			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1776C>T	8.37:g.21845357C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O94846|Q6PJK9|Q8NEK7	Silent	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F601	ENST00000252512.9	37	c.1803	CCDS47818.1	8																																																																																			XPO7	-	superfamily_ARM-type_fold		0.458	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	C	NM_015024		21845357	+1	no_errors	ENST00000434536	ensembl	human	known	70_37	silent	SNP	1.000	T
XRN2	22803	genome.wustl.edu	37	20	21314412	21314412	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr20:21314412G>A	ENST00000377191.3	+	11	1099	c.1004G>A	c.(1003-1005)tGg>tAg	p.W335*	XRN2_ENST00000430571.2_Nonsense_Mutation_p.W259*|XRN2_ENST00000539513.1_Nonsense_Mutation_p.W281*	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	335					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						ATTGATGACTGGGTTTTCATG	0.408																																																	0													307.0	282.0	291.0					20																	21314412		2203	4300	6503	SO:0001587	stop_gained	22803			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1004G>A	20.37:g.21314412G>A	ENSP00000366396:p.Trp335*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Nonsense_Mutation	SNP	pfam_Put_53exo,superfamily_Znf_CCHC,pirsf_5_3_exoribonuclease_2	p.W335*	ENST00000377191.3	37	c.1004	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	G	38	7.111925	0.98070	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6303	20.1162	0.97934	0.0:0.0:1.0:0.0	.	.	.	.	X	335;259;281	.	ENSP00000366396:W335X	W	+	2	0	XRN2	21262412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.756000	0.94617	0.655000	0.94253	TGG	XRN2	-	pirsf_5_3_exoribonuclease_2		0.408	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	HGNC	protein_coding	OTTHUMT00000078273.2	G	NM_012255		21314412	+1	no_errors	ENST00000377191	ensembl	human	known	70_37	nonsense	SNP	1.000	A
YEATS2	55689	genome.wustl.edu	37	3	183479900	183479900	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:183479900G>A	ENST00000305135.5	+	15	1975	c.1780G>A	c.(1780-1782)Gaa>Aaa	p.E594K		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	594					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CATCAAACAGGAACCTGGTGA	0.473																																																	0													75.0	81.0	79.0					3																	183479900		1953	4155	6108	SO:0001583	missense	55689			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1780G>A	3.37:g.183479900G>A	ENSP00000306983:p.Glu594Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.E594K	ENST00000305135.5	37	c.1780	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.469828	0.96274	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.28069	1.63	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.47948	0.1473	L	0.32530	0.975	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.43245	-0.9403	10	0.72032	D	0.01	-29.2232	19.9928	0.97374	0.0:0.0:1.0:0.0	.	594	Q9ULM3	YETS2_HUMAN	K	594	ENSP00000306983:E594K	ENSP00000306983:E594K	E	+	1	0	YEATS2	184962594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.884000	0.92432	2.745000	0.94114	0.650000	0.86243	GAA	YEATS2	-	NULL		0.473	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	G	NM_018023		183479900	+1	no_errors	ENST00000305135	ensembl	human	known	70_37	missense	SNP	1.000	A
YKT6	10652	genome.wustl.edu	37	7	44246081	44246081	+	Silent	SNP	G	G	A	rs571774649		TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:44246081G>A	ENST00000223369.2	+	3	372	c.285G>A	c.(283-285)gaG>gaA	p.E95E	YKT6_ENST00000496112.1_Silent_p.E95E|YKT6_ENST00000447123.1_3'UTR	NM_006555.3	NP_006546.1	O15498	YKT6_HUMAN	YKT6 v-SNARE homolog (S. cerevisiae)	95	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|metabolic process (GO:0008152)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle docking involved in exocytosis (GO:0006904)|vesicle targeting (GO:0006903)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|SNARE complex (GO:0031201)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7						CCTTGCTGGAGAAGGTGAGTT	0.493																																																	0													147.0	120.0	129.0					7																	44246081		2203	4300	6503	SO:0001819	synonymous_variant	10652			BC007319	CCDS5482.1	7p13	2006-07-07			ENSG00000106636	ENSG00000106636			16959	protein-coding gene	gene with protein product	"""R-SNARE"""	606209				15479160, 15544955	Standard	NM_006555		Approved		uc003tkm.3	O15498	OTTHUMG00000129089	ENST00000223369.2:c.285G>A	7.37:g.44246081G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR94|Q53F01|Q6FGU9|Q6IB15	Silent	SNP	pfam_Synaptobrevin,superfamily_Longin-like_dom,pfscan_Longin_dom,pfscan_Synaptobrevin	p.E95	ENST00000223369.2	37	c.285	CCDS5482.1	7																																																																																			YKT6	-	superfamily_Longin-like_dom,pfscan_Longin_dom		0.493	YKT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YKT6	HGNC	protein_coding	OTTHUMT00000251125.2	G	NM_006555		44246081	+1	no_errors	ENST00000223369	ensembl	human	known	70_37	silent	SNP	0.996	A
YTHDC2	64848	genome.wustl.edu	37	5	112917198	112917198	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:112917198C>T	ENST00000161863.4	+	25	3652	c.3439C>T	c.(3439-3441)Caa>Taa	p.Q1147*		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1147					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ACCTTGGTCTCAAGTTGATGA	0.423																																																	0													94.0	87.0	89.0					5																	112917198		2202	4300	6502	SO:0001587	stop_gained	64848			AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.3439C>T	5.37:g.112917198C>T	ENSP00000161863:p.Gln1147*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP66	Nonsense_Mutation	SNP	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1147*	ENST00000161863.4	37	c.3439	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	C	45	11.722724	0.99595	.	.	ENSG00000047188	ENST00000161863;ENST00000511372	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	18.2066	0.89857	0.0:1.0:0.0:0.0	.	.	.	.	X	1147;1057	.	ENSP00000161863:Q1147X	Q	+	1	0	YTHDC2	112945097	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.619000	0.83057	2.281000	0.76405	0.644000	0.83932	CAA	YTHDC2	-	NULL		0.423	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	HGNC	protein_coding	OTTHUMT00000250776.2	C	NM_022828		112917198	+1	no_errors	ENST00000161863	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZBTB5	9925	genome.wustl.edu	37	9	37441722	37441722	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:37441722G>A	ENST00000307750.4	-	2	1015	c.827C>T	c.(826-828)tCt>tTt	p.S276F		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		ACTGTTATCAGACTGGCTGGG	0.473																																																	0													71.0	76.0	74.0					9																	37441722		2203	4300	6503	SO:0001583	missense	9925			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.827C>T	9.37:g.37441722G>A	ENSP00000307604:p.Ser276Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S276F	ENST00000307750.4	37	c.827	CCDS6610.1	9	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128939	0.56721	.	.	ENSG00000168795	ENST00000307750	T	0.14266	2.52	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	L	0.27053	0.805	0.80722	D	1	D	0.58268	0.982	P	0.55667	0.781	T	0.00405	-1.1760	10	0.66056	D	0.02	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	276	O15062	ZBTB5_HUMAN	F	276	ENSP00000307604:S276F	ENSP00000307604:S276F	S	-	2	0	ZBTB5	37431722	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.204000	0.77872	2.884000	0.98904	0.655000	0.94253	TCT	ZBTB5	-	NULL		0.473	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	HGNC	protein_coding	OTTHUMT00000052462.1	G	NM_014872		37441722	-1	no_errors	ENST00000307750	ensembl	human	known	70_37	missense	SNP	1.000	A
ZC3H12C	85463	genome.wustl.edu	37	11	110030151	110030151	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:110030151G>C	ENST00000278590.3	+	4	1135	c.1084G>C	c.(1084-1086)Gag>Cag	p.E362Q	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.E363Q|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.E331Q	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	362							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CTTGGCTAATGAGAAGCCAGA	0.403																																																	0													62.0	63.0	63.0					11																	110030151		2089	4254	6343	SO:0001583	missense	85463				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1084G>C	11.37:g.110030151G>C	ENSP00000278590:p.Glu362Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.E362Q	ENST00000278590.3	37	c.1084	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241079	0.79912	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.46063	0.88;0.88;0.88	5.55	5.55	0.83447	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.91038	3.17	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.996;0.998	T	0.79179	-0.1910	10	0.72032	D	0.01	-30.2454	19.8683	0.96840	0.0:0.0:1.0:0.0	.	363;362;362	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	Q	362;363;331	ENSP00000278590:E362Q;ENSP00000431821:E363Q;ENSP00000413094:E331Q	ENSP00000278590:E362Q	E	+	1	0	ZC3H12C	109535361	1.000000	0.71417	0.819000	0.32651	0.436000	0.31835	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	GAG	ZC3H12C	-	pfam_RNase_Zc3h12		0.403	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	G	NM_033390		110030151	+1	no_errors	ENST00000278590	ensembl	human	known	70_37	missense	SNP	1.000	C
ZC4H2	55906	genome.wustl.edu	37	X	64136882	64136882	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chrX:64136882G>A	ENST00000374839.3	-	0	1562				ZC4H2_ENST00000447788.2_3'UTR|ZC4H2_ENST00000545618.1_3'UTR|ZC4H2_ENST00000337990.2_3'UTR|ZC4H2_ENST00000488608.1_5'UTR	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing						nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CCCTACAGCCGAGCCCTCAGC	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	55906			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.*781C>T	X.37:g.64136882G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	RNA	SNP	-	NULL	ENST00000374839.3	37	NULL	CCDS14380.1	X																																																																																			ZC4H2	-	-		0.488	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC4H2	HGNC	protein_coding	OTTHUMT00000056958.1	G	NM_018684		64136882	-1	no_errors	ENST00000488608	ensembl	human	known	70_37	rna	SNP	0.000	A
ZDHHC23	254887	genome.wustl.edu	37	3	113672893	113672893	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr3:113672893C>T	ENST00000330212.3	+	3	807	c.508C>T	c.(508-510)Cag>Tag	p.Q170*	ZDHHC23_ENST00000498275.1_Nonsense_Mutation_p.Q164*	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	170					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						GGGTCCCGTTCAGCTGGCGGT	0.532																																																	0													133.0	133.0	133.0					3																	113672893		2203	4300	6503	SO:0001587	stop_gained	254887			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.508C>T	3.37:g.113672893C>T	ENSP00000330485:p.Gln170*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DN76	Nonsense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.Q170*	ENST00000330212.3	37	c.508	CCDS33827.1	3	.	.	.	.	.	.	.	.	.	.	C	20.1	3.941022	0.73557	.	.	ENSG00000184307	ENST00000330212;ENST00000498275	.	.	.	5.66	5.66	0.87406	.	0.296168	0.38959	N	0.001512	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-17.5183	19.7359	0.96202	0.0:1.0:0.0:0.0	.	.	.	.	X	170;164	.	ENSP00000330485:Q170X	Q	+	1	0	ZDHHC23	115155583	1.000000	0.71417	0.170000	0.22879	0.331000	0.28603	5.388000	0.66249	2.672000	0.90937	0.462000	0.41574	CAG	ZDHHC23	-	NULL		0.532	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	HGNC	protein_coding	OTTHUMT00000354702.1	C	NM_173570		113672893	+1	no_errors	ENST00000478793	ensembl	human	known	70_37	nonsense	SNP	0.980	T
ZDHHC5	25921	genome.wustl.edu	37	11	57466416	57466416	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:57466416C>T	ENST00000287169.3	+	11	2870	c.1508C>T	c.(1507-1509)tCa>tTa	p.S503L	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.S450L	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	503					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CCCTTCCTGTCAGCCAGGCTG	0.582																																																	0													61.0	56.0	58.0					11																	57466416		2201	4296	6497	SO:0001583	missense	25921			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1508C>T	11.37:g.57466416C>T	ENSP00000287169:p.Ser503Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.S503L	ENST00000287169.3	37	c.1508	CCDS7965.1	11	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981631	0.74474	.	.	ENSG00000156599	ENST00000527985;ENST00000287169	T;T	0.61510	0.1;1.1	5.09	5.09	0.68999	.	0.169925	0.39687	N	0.001281	T	0.58694	0.2140	L	0.47190	1.495	0.58432	D	0.999999	P	0.43938	0.822	P	0.44732	0.459	T	0.62062	-0.6933	10	0.54805	T	0.06	-15.0725	18.2951	0.90143	0.0:1.0:0.0:0.0	.	503	Q9C0B5	ZDHC5_HUMAN	L	450;503	ENSP00000432202:S450L;ENSP00000287169:S503L	ENSP00000287169:S503L	S	+	2	0	ZDHHC5	57222992	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.718000	0.74713	2.656000	0.90262	0.563000	0.77884	TCA	ZDHHC5	-	NULL		0.582	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC5	HGNC	protein_coding	OTTHUMT00000393694.1	C	NM_015457		57466416	+1	no_errors	ENST00000287169	ensembl	human	known	70_37	missense	SNP	0.999	T
ZFC3H1	196441	genome.wustl.edu	37	12	72021566	72021566	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr12:72021566G>C	ENST00000378743.3	-	21	4453	c.4095C>G	c.(4093-4095)ctC>ctG	p.L1365L		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1365					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACGCAAGCTTGAGCCAAAGTT	0.353																																																	0													134.0	122.0	126.0					12																	72021566		1876	4111	5987	SO:0001819	synonymous_variant	196441			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4095C>G	12.37:g.72021566G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.L1365	ENST00000378743.3	37	c.4095	CCDS41813.1	12																																																																																			ZFC3H1	-	pfscan_TPR-contain_dom		0.353	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1	G	NM_144982		72021566	-1	no_errors	ENST00000378743	ensembl	human	known	70_37	silent	SNP	1.000	C
ZFYVE26	23503	genome.wustl.edu	37	14	68264470	68264470	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr14:68264470C>G	ENST00000347230.4	-	12	2389	c.2251G>C	c.(2251-2253)Gag>Cag	p.E751Q	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.E751Q	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	751					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GAAGGTTGCTCCTCTGAAAGA	0.537																																																	0													72.0	62.0	65.0					14																	68264470		2203	4300	6503	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.2251G>C	14.37:g.68264470C>G	ENSP00000251119:p.Glu751Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.E751Q	ENST00000347230.4	37	c.2251	CCDS9788.1	14	.	.	.	.	.	.	.	.	.	.	C	14.32	2.499505	0.44455	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.29917	1.69;1.55	5.38	3.57	0.40892	.	0.650048	0.16609	N	0.206995	T	0.28995	0.0720	L	0.60455	1.87	0.31834	N	0.624321	P;P;B	0.46142	0.873;0.59;0.22	B;B;B	0.41036	0.23;0.346;0.036	T	0.35919	-0.9769	10	0.44086	T	0.13	-4.9507	8.0667	0.30665	0.0:0.8193:0.0:0.1807	.	751;751;751	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	Q	751;730;751	ENSP00000251119:E751Q;ENSP00000450603:E751Q	ENSP00000251119:E751Q	E	-	1	0	ZFYVE26	67334223	0.967000	0.33354	0.797000	0.32132	0.693000	0.40251	1.972000	0.40540	0.847000	0.35167	0.655000	0.94253	GAG	ZFYVE26	-	NULL		0.537	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2	C	NM_015346		68264470	-1	no_errors	ENST00000347230	ensembl	human	known	70_37	missense	SNP	0.964	G
ZHX1	11244	genome.wustl.edu	37	8	124267821	124267821	+	Silent	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:124267821C>G	ENST00000522655.1	-	3	906	c.366G>C	c.(364-366)ctG>ctC	p.L122L	ZHX1_ENST00000297857.2_Silent_p.L122L|ZHX1_ENST00000522595.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Silent_p.L122L			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	122					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GGTGATATTTCAGATTATGCT	0.348																																																	0													99.0	94.0	96.0					8																	124267821		2203	4300	6503	SO:0001819	synonymous_variant	11244			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.366G>C	8.37:g.124267821C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWD8	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.L122	ENST00000522655.1	37	c.366	CCDS6342.1	8																																																																																			ZHX1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.348	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	C			124267821	-1	no_errors	ENST00000297857	ensembl	human	known	70_37	silent	SNP	1.000	G
ZHX1	11244	genome.wustl.edu	37	8	124268338	124268338	+	5'UTR	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr8:124268338C>A	ENST00000522655.1	-	0	389				ZHX1_ENST00000297857.2_5'UTR|ZHX1_ENST00000522595.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_5'UTR			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1						cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			ATGGTGCAATCAAGTAAAGAG	0.323																																																	0																																										SO:0001623	5_prime_UTR_variant	11244			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.-152G>T	8.37:g.124268338C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWD8	RNA	SNP	-	NULL	ENST00000522655.1	37	NULL	CCDS6342.1	8																																																																																			ZHX1	-	-		0.323	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	C			124268338	-1	no_errors	ENST00000522595	ensembl	human	known	70_37	rna	SNP	1.000	A
ZNF169	169841	genome.wustl.edu	37	9	97062636	97062636	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr9:97062636G>C	ENST00000395395.2	+	5	886	c.796G>C	c.(796-798)Gag>Cag	p.E266Q	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	266					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				CCTGTGTCCTGAGTGTGGGCG	0.572																																																	0													69.0	73.0	72.0					9																	97062636		2203	4300	6503	SO:0001583	missense	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.796G>C	9.37:g.97062636G>C	ENSP00000378792:p.Glu266Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E266Q	ENST00000395395.2	37	c.796	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	8.168	0.791054	0.16258	.	.	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.37411	1.2	2.73	2.73	0.32206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37376	0.1001	N	0.11673	0.155	0.22926	N	0.998556	D	0.89917	1.0	D	0.77004	0.989	T	0.26052	-1.0114	9	0.30854	T	0.27	.	11.6516	0.51292	0.0:0.0:1.0:0.0	.	266	Q14929	ZN169_HUMAN	Q	266;75	ENSP00000378792:E266Q	ENSP00000340711:E75Q	E	+	1	0	ZNF169	96102457	0.021000	0.18746	0.047000	0.18901	0.008000	0.06430	0.465000	0.22004	1.851000	0.53745	0.603000	0.83216	GAG	ZNF169	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.572	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	G	NM_194320		97062636	+1	no_errors	ENST00000395395	ensembl	human	known	70_37	missense	SNP	0.318	C
ZNF202	7753	genome.wustl.edu	37	11	123601372	123601372	+	Silent	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr11:123601372C>T	ENST00000529691.1	-	2	444	c.225G>A	c.(223-225)ctG>ctA	p.L75L	ZNF202_ENST00000336139.4_Silent_p.L75L|ZNF202_ENST00000530393.1_Silent_p.L75L			O95125	ZN202_HUMAN	zinc finger protein 202	75	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TCTCTGGTCTCAGCCACTGGT	0.562																																																	0													97.0	96.0	96.0					11																	123601372		2202	4299	6501	SO:0001819	synonymous_variant	7753			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.225G>A	11.37:g.123601372C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L75	ENST00000529691.1	37	c.225	CCDS8443.1	11																																																																																			ZNF202	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.562	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387419.1	C	NM_003455		123601372	-1	no_errors	ENST00000336139	ensembl	human	known	70_37	silent	SNP	0.999	T
ZNF579	163033	genome.wustl.edu	37	19	56089506	56089506	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:56089506G>A	ENST00000325421.4	-	2	1528	c.1500C>T	c.(1498-1500)ctC>ctT	p.L500L	CTD-2537I9.5_ENST00000589396.1_lincRNA	NM_152600.2	NP_689813.2	Q8NAF0	ZN579_HUMAN	zinc finger protein 579	500	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.106)		GGGGCAGCGGGAGCCCTTCTT	0.731																																																	0													12.0	11.0	11.0					19																	56089506		2038	4043	6081	SO:0001819	synonymous_variant	163033			AK092772	CCDS12927.1	19q13.42	2013-09-20			ENSG00000218891	ENSG00000218891		"""Zinc fingers, C2H2-type"""	26646	protein-coding gene	gene with protein product							Standard	NM_152600		Approved	FLJ35453	uc002qlh.3	Q8NAF0	OTTHUMG00000180857	ENST00000325421.4:c.1500C>T	19.37:g.56089506G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L500	ENST00000325421.4	37	c.1500	CCDS12927.1	19																																																																																			ZNF579	-	NULL		0.731	ZNF579-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF579	HGNC	protein_coding	OTTHUMT00000453348.1	G	NM_152600		56089506	-1	no_errors	ENST00000325421	ensembl	human	known	70_37	silent	SNP	0.816	A
ZNF544	27300	genome.wustl.edu	37	19	58772318	58772318	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:58772318G>A	ENST00000596652.1	+	6	580	c.346G>A	c.(346-348)Gag>Aag	p.E116K	CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000599953.1_5'UTR|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000594384.1_3'UTR|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000415203.2_Missense_Mutation_p.E88K|ZNF544_ENST00000596825.1_3'UTR|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000600220.1_Missense_Mutation_p.E88K|ZNF544_ENST00000269829.4_Missense_Mutation_p.E116K|ZNF544_ENST00000600044.1_Missense_Mutation_p.E88K|ZNF544_ENST00000596929.1_Intron			Q6NX49	ZN544_HUMAN	zinc finger protein 544	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TGGACCGGAGGAGCCACCCTC	0.488																																																	0													75.0	72.0	73.0					19																	58772318		2203	4300	6503	SO:0001583	missense	27300			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.346G>A	19.37:g.58772318G>A	ENSP00000469635:p.Glu116Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6J1|Q9UEX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E116K	ENST00000596652.1	37	c.346	CCDS12973.1	19	.	.	.	.	.	.	.	.	.	.	G	3.753	-0.051128	0.07407	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.06849	3.29;3.25	3.03	1.92	0.25849	.	.	.	.	.	T	0.03136	0.0092	N	0.03608	-0.345	0.09310	N	1	P;P;B	0.37330	0.59;0.59;0.336	B;B;B	0.34093	0.175;0.175;0.087	T	0.44726	-0.9309	9	0.18710	T	0.47	.	7.8263	0.29318	0.0:0.2591:0.7409:0.0	.	88;88;116	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	K	116;88	ENSP00000269829:E116K;ENSP00000394341:E88K	ENSP00000269829:E116K	E	+	1	0	ZNF544	63464130	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.366000	0.20365	0.564000	0.29238	0.655000	0.94253	GAG	ZNF544	-	NULL		0.488	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	G	NM_014480		58772318	+1	no_errors	ENST00000269829	ensembl	human	known	70_37	missense	SNP	0.001	A
ZNF594	84622	genome.wustl.edu	37	17	5086046	5086046	+	Silent	SNP	G	G	C			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr17:5086046G>C	ENST00000399604.4	-	1	1646	c.1506C>G	c.(1504-1506)ctC>ctG	p.L502L	ZNF594_ENST00000575779.1_Silent_p.L502L			Q96JF6	ZN594_HUMAN	zinc finger protein 594	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GTTGAATAAGGAGTGAACGCC	0.463																																																	0													67.0	70.0	69.0					17																	5086046		2184	4288	6472	SO:0001819	synonymous_variant	84622			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1506C>G	17.37:g.5086046G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6RFS0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L502	ENST00000399604.4	37	c.1506	CCDS42241.1	17																																																																																			ZNF594	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.463	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	HGNC	protein_coding	OTTHUMT00000438996.1	G	XM_290737		5086046	-1	no_errors	ENST00000399604	ensembl	human	known	70_37	silent	SNP	0.010	C
ZNF668	79759	genome.wustl.edu	37	16	31072775	31072775	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:31072775G>A	ENST00000538906.1	-	3	2258	c.1474C>T	c.(1474-1476)Cgg>Tgg	p.R492W	ZNF668_ENST00000426488.2_Missense_Mutation_p.R515W|ZNF668_ENST00000394983.2_Missense_Mutation_p.R492W|ZNF668_ENST00000539836.3_Missense_Mutation_p.R515W|ZNF668_ENST00000417110.2_5'Flank|ZNF668_ENST00000535577.1_Missense_Mutation_p.R492W|ZNF668_ENST00000300849.4_Missense_Mutation_p.R492W	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						GGAGCCTCCCGGACACCAGCA	0.652																																					Colon(181;1111 1980 5060 10512 25785)												0													65.0	68.0	67.0					16																	31072775		2197	4300	6497	SO:0001583	missense	79759				CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.1474C>T	16.37:g.31072775G>A	ENSP00000440149:p.Arg492Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R515W	ENST00000538906.1	37	c.1543	CCDS10701.1	16	.	.	.	.	.	.	.	.	.	.	G	2.323	-0.355126	0.05138	.	.	ENSG00000167394	ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849	T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19	5.15	3.07	0.35406	.	0.530450	0.17051	N	0.188931	T	0.03263	0.0095	N	0.08118	0	0.09310	N	1	P	0.44260	0.83	B	0.30495	0.116	T	0.39313	-0.9620	10	0.66056	D	0.02	-15.2438	7.5318	0.27687	0.1811:0.625:0.1939:0.0	.	492	Q96K58	ZN668_HUMAN	W	515;492;492;492;492	ENSP00000442573:R515W;ENSP00000441349:R492W;ENSP00000440149:R492W;ENSP00000378434:R492W;ENSP00000300849:R492W	ENSP00000300849:R492W	R	-	1	2	ZNF668	30980276	0.545000	0.26449	0.077000	0.20336	0.003000	0.03518	-0.315000	0.08081	1.181000	0.42912	-0.311000	0.09066	CGG	ZNF668	-	NULL		0.652	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF668	HGNC	protein_coding	OTTHUMT00000108516.2	G	NM_024706		31072775	-1	no_errors	ENST00000426488	ensembl	human	known	70_37	missense	SNP	0.163	A
ZNF727	442319	genome.wustl.edu	37	7	63538354	63538354	+	Silent	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:63538354G>A	ENST00000550760.3	+	4	1106	c.927G>A	c.(925-927)gaG>gaA	p.E309E	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	309					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						ATACTGGAGAGAAACCCTACA	0.378																																																	0													25.0	27.0	26.0					7																	63538354		692	1591	2283	SO:0001819	synonymous_variant	442319					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.927G>A	7.37:g.63538354G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E309	ENST00000550760.3	37	c.927	CCDS55113.1	7																																																																																			ZNF727	-	pfscan_Znf_C2H2		0.378	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		G	NM_001159522		63538354	+1	no_errors	ENST00000550760	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF786	136051	genome.wustl.edu	37	7	148768366	148768366	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr7:148768366G>A	ENST00000491431.1	-	4	1562	c.1498C>T	c.(1498-1500)Cgg>Tgg	p.R500W	ZNF786_ENST00000316286.9_Missense_Mutation_p.R414W|ZNF786_ENST00000451334.3_Missense_Mutation_p.R463W	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TGCCGGAGCCGGTGGGCTCTC	0.657																																																	0													33.0	37.0	36.0					7																	148768366		2124	4250	6374	SO:0001583	missense	136051			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.1498C>T	7.37:g.148768366G>A	ENSP00000417470:p.Arg500Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R500W	ENST00000491431.1	37	c.1498	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923135	0.52653	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.18810	2.19;2.19;2.19	4.3	1.26	0.21427	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.542019	0.13948	N	0.351747	T	0.42494	0.1205	M	0.86805	2.84	0.24330	N	0.995009	D	0.89917	1.0	P	0.58266	0.836	T	0.25117	-1.0141	10	0.72032	D	0.01	-1.8437	8.4616	0.32931	0.0:0.3168:0.52:0.1632	.	500	Q8N393	ZN786_HUMAN	W	414;500;463	ENSP00000313516:R414W;ENSP00000417470:R500W;ENSP00000404984:R463W	ENSP00000313516:R414W	R	-	1	2	ZNF786	148399299	0.000000	0.05858	0.054000	0.19295	0.085000	0.17905	-0.134000	0.10436	0.064000	0.16427	0.563000	0.77884	CGG	ZNF786	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.657	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	G	NM_152411		148768366	-1	no_errors	ENST00000491431	ensembl	human	known	70_37	missense	SNP	0.577	A
ZNF99	7652	genome.wustl.edu	37	19	22939111	22939111	+	IGR	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:22939111G>A	ENST00000596209.1	-	0	2686				ZNF99_ENST00000397104.3_Missense_Mutation_p.H1004Y|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CCTCCAGTATGAATTGTTTTA	0.373																																																	0													56.0	75.0	69.0					19																	22939111		1974	4276	6250	SO:0001628	intergenic_variant	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939111G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H1004Y	ENST00000596209.1	37	c.3010	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	-	13.75	2.329881	0.41297	.	.	ENSG00000213973	ENST00000397104	D	0.81908	-1.55	1.2	1.2	0.21068	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.83723	0.5316	.	.	.	0.28057	N	0.933112	B	0.33940	0.433	P	0.46585	0.521	T	0.78342	-0.2241	8	0.87932	D	0	.	9.4278	0.38590	0.0:0.0:1.0:0.0	.	1003	A8MXY4	ZNF99_HUMAN	Y	1004	ENSP00000380293:H1004Y	ENSP00000380293:H1004Y	H	-	1	0	ZNF99	22730951	0.999000	0.42202	0.002000	0.10522	0.017000	0.09413	3.122000	0.50446	0.657000	0.30906	0.369000	0.22263	CAT	ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	G	XM_065124		22939111	-1	no_errors	ENST00000397104	ensembl	human	known	70_37	missense	SNP	0.993	A
ZNF91	7644	genome.wustl.edu	37	19	23545029	23545029	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:23545029G>A	ENST00000300619.7	-	4	957	c.752C>T	c.(751-753)tCa>tTa	p.S251L	ZNF91_ENST00000397082.2_Missense_Mutation_p.S219L|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	251					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGTAAGGGTTGAGAGCTGCTT	0.368																																																	0													100.0	112.0	108.0					19																	23545029		2174	4290	6464	SO:0001583	missense	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.752C>T	19.37:g.23545029G>A	ENSP00000300619:p.Ser251Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S251L	ENST00000300619.7	37	c.752	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133008	0.37630	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.17691	2.26;2.26	1.66	-3.32	0.04973	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14270	0.0345	M	0.77712	2.385	0.09310	N	1	P;B	0.40282	0.711;0.049	B;B	0.29598	0.104;0.059	T	0.22941	-1.0202	9	0.62326	D	0.03	.	4.8393	0.13481	0.0:0.1846:0.4464:0.369	.	219;251	Q05481-2;Q05481	.;ZNF91_HUMAN	L	251;219	ENSP00000300619:S251L;ENSP00000380272:S219L	ENSP00000300619:S251L	S	-	2	0	ZNF91	23336869	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-5.555000	0.00113	-0.025000	0.13918	0.174000	0.16983	TCA	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	G	NM_003430		23545029	-1	no_errors	ENST00000300619	ensembl	human	known	70_37	missense	SNP	0.000	A
ZNF8	7554	genome.wustl.edu	37	19	58797541	58797541	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:58797541G>T	ENST00000196548.5	+	3	390	c.259G>T	c.(259-261)Gag>Tag	p.E87*	ZNF8_ENST00000608843.1_Nonsense_Mutation_p.E87*|CTD-3138B18.4_ENST00000600029.1_3'UTR|AC010642.1_ENST00000591325.1_3'UTR			P17098	ZNF8_HUMAN	zinc finger protein 8	87	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		ATGGGTGGCTGAGAGAGGAAC	0.577																																																	0													55.0	48.0	50.0					19																	58797541		2203	4300	6503	SO:0001587	stop_gained	7554			M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.259G>T	19.37:g.58797541G>T	ENSP00000196548:p.Glu87*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PI99	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E87*	ENST00000196548.5	37	c.259	CCDS12974.1	19	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523508	0.85600	.	.	ENSG00000083842	ENST00000196548	.	.	.	5.15	4.11	0.48088	.	0.481779	0.17534	N	0.170769	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-9.0938	9.8679	0.41154	0.096:0.0:0.904:0.0	.	.	.	.	X	87	.	ENSP00000196548:E87X	E	+	1	0	ZNF8	63489353	0.007000	0.16637	0.146000	0.22360	0.033000	0.12548	1.095000	0.30964	1.294000	0.44707	0.561000	0.74099	GAG	ZNF8	-	pfscan_Krueppel-associated_box		0.577	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	ZNF8	HGNC	protein_coding	OTTHUMT00000459135.1	G	NM_021089		58797541	+1	no_errors	ENST00000196548	ensembl	human	known	70_37	nonsense	SNP	0.110	T
ZP2	7783	genome.wustl.edu	37	16	21218209	21218209	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr16:21218209C>T	ENST00000574002.1	-	6	915	c.433G>A	c.(433-435)Gag>Aag	p.E145K	ZP2_ENST00000574091.1_Missense_Mutation_p.E145K|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.E145K			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	145					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		CCCTGGGTCTCTTCTACTTGC	0.502																																																	0													187.0	171.0	177.0					16																	21218209		2199	4300	6499	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.433G>A	16.37:g.21218209C>T	ENSP00000460971:p.Glu145Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.E145K	ENST00000574002.1	37	c.433	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	C	17.92	3.505881	0.64410	.	.	ENSG00000103310	ENST00000219593	T	0.78364	-1.17	3.67	1.57	0.23409	.	0.774576	0.11945	N	0.514327	T	0.78162	0.4240	M	0.75264	2.295	0.09310	N	1	P;P;P	0.51537	0.946;0.908;0.847	P;P;B	0.48840	0.592;0.521;0.293	T	0.67436	-0.5671	10	0.72032	D	0.01	0.3648	4.5188	0.11949	0.0:0.5976:0.2617:0.1407	.	145;145;145	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	K	145	ENSP00000219593:E145K	ENSP00000219593:E145K	E	-	1	0	ZP2	21125710	0.002000	0.14202	0.002000	0.10522	0.870000	0.49936	-0.055000	0.11807	0.297000	0.22615	0.591000	0.81541	GAG	ZP2	-	NULL		0.502	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	C			21218209	-1	no_errors	ENST00000219593	ensembl	human	known	70_37	missense	SNP	0.001	T
ZRANB2	9406	genome.wustl.edu	37	1	71544392	71544392	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr1:71544392C>T	ENST00000370920.3	-	2	358		c.e2-1		ZRANB2-AS2_ENST00000455406.1_RNA|ZRANB2-AS2_ENST00000596952.1_RNA|ZRANB2_ENST00000254821.6_Splice_Site	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						ATTTCCACATCTAAAAACAGA	0.269																																																	0													44.0	46.0	46.0					1																	71544392		2175	4289	6464	SO:0001630	splice_region_variant	9406			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.57-1G>A	1.37:g.71544392C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Splice_Site	SNP	-	e2-1	ENST00000370920.3	37	c.57-1	CCDS659.1	1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201547	0.58234	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.323	0.90244	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZRANB2	71316980	1.000000	0.71417	1.000000	0.80357	0.573000	0.36030	7.128000	0.77217	2.701000	0.92244	0.563000	0.77884	.	ZRANB2	-	-		0.269	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	C	NM_203350	Intron	71544392	-1	no_errors	ENST00000370920	ensembl	human	known	70_37	splice_site	SNP	1.000	T
ZSWIM4	65249	genome.wustl.edu	37	19	13928068	13928068	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr19:13928068G>A	ENST00000254323.2	+	7	1408	c.1219G>A	c.(1219-1221)Gaa>Aaa	p.E407K	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.E241K|RN7SL619P_ENST00000581753.1_RNA	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	407							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACCAACACCGAAGGATGGGT	0.632																																																	0													74.0	73.0	73.0					19																	13928068		2203	4300	6503	SO:0001583	missense	65249			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1219G>A	19.37:g.13928068G>A	ENSP00000254323:p.Glu407Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfscan_Znf_SWIM	p.E407K	ENST00000254323.2	37	c.1219	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.282923	0.95489	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.48201	0.82;0.84	4.79	4.79	0.61399	.	0.198962	0.32357	N	0.006212	T	0.61664	0.2365	L	0.60455	1.87	0.51767	D	0.999934	P;D	0.69078	0.681;0.997	B;P	0.61397	0.155;0.888	T	0.63972	-0.6516	10	0.52906	T	0.07	-2.0711	15.3128	0.74048	0.0:0.0:1.0:0.0	.	241;407	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	K	407;241	ENSP00000254323:E407K;ENSP00000405278:E241K	ENSP00000254323:E407K	E	+	1	0	ZSWIM4	13789068	1.000000	0.71417	0.877000	0.34402	0.830000	0.47004	9.483000	0.97937	2.215000	0.71742	0.400000	0.26472	GAA	ZSWIM4	-	NULL		0.632	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	G	XM_031342		13928068	+1	no_errors	ENST00000254323	ensembl	human	known	70_37	missense	SNP	1.000	A
ZSWIM6	57688	genome.wustl.edu	37	5	60839696	60839696	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr5:60839696C>G	ENST00000252744.5	+	14	3200	c.3200C>G	c.(3199-3201)cCt>cGt	p.P1067R		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	1067					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GACACACACCCTGCCATTAAT	0.537																																																	0													73.0	62.0	65.0					5																	60839696		692	1591	2283	SO:0001583	missense	57688			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.3200C>G	5.37:g.60839696C>G	ENSP00000252744:p.Pro1067Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfscan_Znf_SWIM,prints_Antifreeze_1	p.P1067R	ENST00000252744.5	37	c.3200	CCDS47215.1	5	.	.	.	.	.	.	.	.	.	.	c	20.6	4.013481	0.75161	.	.	ENSG00000130449	ENST00000252744	T	0.58797	0.31	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.76835	0.4043	M	0.79258	2.445	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.80009	-0.1562	10	0.87932	D	0	-6.7337	18.5427	0.91035	0.0:1.0:0.0:0.0	.	1067	Q9HCJ5	ZSWM6_HUMAN	R	1067	ENSP00000252744:P1067R	ENSP00000252744:P1067R	P	+	2	0	ZSWIM6	60875453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.648000	0.83479	2.611000	0.88343	0.550000	0.68814	CCT	ZSWIM6	-	NULL		0.537	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZSWIM6	HGNC	protein_coding	OTTHUMT00000368710.1	C	NM_020928		60839696	+1	no_errors	ENST00000252744	ensembl	human	known	70_37	missense	SNP	1.000	G
ZWINT	11130	genome.wustl.edu	37	10	58118684	58118684	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LL-01A-11D-A20U-09	TCGA-IR-A3LL-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8788027e-3464-4a19-896b-4f5c3dccdee5	fe76b2c2-feab-4c67-863e-28f103b47dd8	g.chr10:58118684C>A	ENST00000373944.3	-	6	543	c.505G>T	c.(505-507)Gag>Tag	p.E169*	ZWINT_ENST00000361148.6_Nonsense_Mutation_p.E169*|ZWINT_ENST00000395405.1_Nonsense_Mutation_p.E169*|ZWINT_ENST00000318387.2_Nonsense_Mutation_p.E49*|ZWINT_ENST00000460654.1_5'UTR			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	169					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						GCAGAAACCTCCGCCAGATGC	0.527																																																	0													78.0	75.0	76.0					10																	58118684		2203	4300	6503	SO:0001587	stop_gained	11130			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.505G>T	10.37:g.58118684C>A	ENSP00000363055:p.Glu169*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNV6|Q0D2I3|Q9BWD0	Nonsense_Mutation	SNP	NULL	p.E169*	ENST00000373944.3	37	c.505	CCDS7249.1	10	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458853	0.26248	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000318387;ENST00000361148	.	.	.	4.7	0.833	0.18875	.	0.359030	0.20961	N	0.082565	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-23.4475	8.8668	0.35291	0.0:0.6574:0.0:0.3426	.	.	.	.	X	169;169;49;169	.	ENSP00000322850:E49X	E	-	1	0	ZWINT	57788690	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.376000	0.07465	-0.027000	0.13873	-0.797000	0.03246	GAG	ZWINT	-	NULL		0.527	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZWINT	HGNC	protein_coding	OTTHUMT00000048132.1	C			58118684	-1	no_errors	ENST00000373944	ensembl	human	known	70_37	nonsense	SNP	0.001	A
