#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACTR2	10097	genome.wustl.edu	37	2	65473736	65473736	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:65473736C>T	ENST00000260641.5	+	3	395	c.238C>T	c.(238-240)Cga>Tga	p.R80*	ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Nonsense_Mutation_p.R85*|ACTR2_ENST00000542850.1_Nonsense_Mutation_p.R25*	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	80					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						TGGCATAGTACGAAATTGGGA	0.373																																																	0													128.0	133.0	131.0					2																	65473736		2203	4300	6503	SO:0001587	stop_gained	10097			AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.238C>T	2.37:g.65473736C>T	ENSP00000260641:p.Arg80*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Nonsense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R85*	ENST00000260641.5	37	c.253	CCDS1881.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.175894	0.97348	.	.	ENSG00000138071	ENST00000260641;ENST00000542850;ENST00000377982;ENST00000535303	.	.	.	5.55	4.67	0.58626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8398	14.259	0.66073	0.2709:0.7291:0.0:0.0	.	.	.	.	X	80;25;85;25	.	ENSP00000260641:R80X	R	+	1	2	ACTR2	65327240	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	2.504000	0.45416	1.335000	0.45486	0.561000	0.74099	CGA	ACTR2	-	pfam_Actin-like,smart_Actin-like		0.373	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR2	HGNC	protein_coding	OTTHUMT00000251730.1	C	NM_001005386		65473736	+1	no_errors	ENST00000377982	ensembl	human	known	70_37	nonsense	SNP	0.990	T
ADH6	130	genome.wustl.edu	37	4	100129851	100129851	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:100129851C>A	ENST00000237653.7	-	6	1186	c.802G>T	c.(802-804)Gag>Tag	p.E268*	ADH6_ENST00000504257.1_5'UTR|RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000407820.2_Nonsense_Mutation_p.E59*|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Nonsense_Mutation_p.E268*|ADH6_ENST00000394899.2_Nonsense_Mutation_p.E268*|RP11-696N14.1_ENST00000500358.2_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	268					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	CCAATGGCCTCAAAGCAGAAG	0.393																																																	0													165.0	176.0	172.0					4																	100129851		2203	4300	6503	SO:0001587	stop_gained	130			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.802G>T	4.37:g.100129851C>A	ENSP00000237653:p.Glu268*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KS45|Q58F53	Nonsense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.E268*	ENST00000237653.7	37	c.802	CCDS3647.1	4	.	.	.	.	.	.	.	.	.	.	C	38	7.104919	0.98066	.	.	ENSG00000172955	ENST00000394897;ENST00000394899;ENST00000407820;ENST00000237653;ENST00000508558	.	.	.	4.71	3.81	0.43845	.	0.047602	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-37.8758	15.3988	0.74818	0.0:0.8606:0.1394:0.0	.	.	.	.	X	268;268;59;268;204	.	ENSP00000237653:E268X	E	-	1	0	ADH6	100348874	1.000000	0.71417	0.589000	0.28718	0.007000	0.05969	5.102000	0.64572	2.316000	0.78162	0.557000	0.71058	GAG	ADH6	-	pfam_ADH_C,smart_PKS_ER		0.393	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	HGNC	protein_coding	OTTHUMT00000253665.1	C	NM_000672		100129851	-1	no_errors	ENST00000394899	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ATF7IP	55729	genome.wustl.edu	37	12	14613980	14613980	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr12:14613980C>T	ENST00000540793.1	+	8	2865	c.2710C>T	c.(2710-2712)Cga>Tga	p.R904*	ATF7IP_ENST00000544627.1_Nonsense_Mutation_p.R912*|ATF7IP_ENST00000543189.1_Nonsense_Mutation_p.R903*|ATF7IP_ENST00000536444.1_Nonsense_Mutation_p.R903*|ATF7IP_ENST00000261168.4_Nonsense_Mutation_p.R904*			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	904					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						ATCAACTAATCGAGGTCCTAT	0.453																																																	0													55.0	52.0	53.0					12																	14613980		2203	4300	6503	SO:0001587	stop_gained	55729			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2710C>T	12.37:g.14613980C>T	ENSP00000444589:p.Arg904*	Somatic		WXS	Illumina HiSeq	Phase_IV	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Nonsense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.R904*	ENST00000540793.1	37	c.2710	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	C	39	7.674228	0.98425	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	.	.	.	6.16	6.16	0.99307	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.053	16.3585	0.83245	0.1324:0.8676:0.0:0.0	.	.	.	.	X	904;903;903;912;904	.	.	R	+	1	2	ATF7IP	14505247	1.000000	0.71417	0.974000	0.42286	0.986000	0.74619	3.668000	0.54554	2.937000	0.99478	0.650000	0.86243	CGA	ATF7IP	-	NULL		0.453	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	C	NM_018179		14613980	+1	no_errors	ENST00000261168	ensembl	human	known	70_37	nonsense	SNP	0.992	T
ARID2	196528	genome.wustl.edu	37	12	46245832	46245832	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr12:46245832C>G	ENST00000334344.6	+	15	4098	c.3926C>G	c.(3925-3927)tCa>tGa	p.S1309*	ARID2_ENST00000444670.1_Nonsense_Mutation_p.S919*|ARID2_ENST00000422737.1_Nonsense_Mutation_p.S1160*|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1309					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CCTTCAAACTCAGGGAAAATT	0.408			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													49.0	49.0	49.0					12																	46245832		2203	4300	6503	SO:0001587	stop_gained	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3926C>G	12.37:g.46245832C>G	ENSP00000335044:p.Ser1309*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S1309*	ENST00000334344.6	37	c.3926	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	44	10.781055	0.99466	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.4524	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	X	1309;426;426;1160;919	.	ENSP00000335044:S1309X	S	+	2	0	ARID2	44532099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.263000	0.78421	2.884000	0.98904	0.655000	0.94253	TCA	ARID2	-	NULL		0.408	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	C	XM_350875		46245832	+1	no_errors	ENST00000334344	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ARID2	196528	genome.wustl.edu	37	12	46246080	46246080	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr12:46246080C>G	ENST00000334344.6	+	15	4346	c.4174C>G	c.(4174-4176)Cca>Gca	p.P1392A	ARID2_ENST00000444670.1_Missense_Mutation_p.P1002A|ARID2_ENST00000422737.1_Missense_Mutation_p.P1243A|ARID2_ENST00000457135.1_5'UTR|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1392					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TGAGATATCTCCAATGGAACC	0.358			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													68.0	66.0	66.0					12																	46246080		2203	4300	6503	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4174C>G	12.37:g.46246080C>G	ENSP00000335044:p.Pro1392Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.P1392A	ENST00000334344.6	37	c.4174	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	9.707	1.156162	0.21454	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.37235	1.21	6.07	6.07	0.98685	.	0.095343	0.64402	D	0.000001	T	0.28001	0.0690	N	0.24115	0.695	0.80722	D	1	P;P;B	0.36990	0.577;0.577;0.307	B;B;B	0.38264	0.269;0.269;0.138	T	0.03335	-1.1047	10	0.32370	T	0.25	-11.9385	14.2055	0.65732	0.0:0.9239:0.0:0.0761	.	1392;1002;1392	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	A	1392;509;509;1243;1002	ENSP00000335044:P1392A	ENSP00000335044:P1392A	P	+	1	0	ARID2	44532347	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.856000	0.48341	2.884000	0.98904	0.655000	0.94253	CCA	ARID2	-	NULL		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	C	XM_350875		46246080	+1	no_errors	ENST00000334344	ensembl	human	known	70_37	missense	SNP	1.000	G
ANAPC7	51434	genome.wustl.edu	37	12	110819749	110819749	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr12:110819749G>C	ENST00000455511.3	-	8	1042	c.1042C>G	c.(1042-1044)Cac>Gac	p.H348D	ANAPC7_ENST00000481473.1_5'Flank|ANAPC7_ENST00000450008.2_Missense_Mutation_p.H348D	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	348					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						TAGAAGCTGTGACAGCTGGAG	0.413																																																	0													25.0	22.0	23.0					12																	110819749		2202	4299	6501	SO:0001583	missense	51434			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.1042C>G	12.37:g.110819749G>C	ENSP00000394394:p.His348Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.H348D	ENST00000455511.3	37	c.1042	CCDS9145.2	12	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474074	0.84640	.	.	ENSG00000196510	ENST00000455511;ENST00000450008;ENST00000471602;ENST00000548234	T;T	0.58797	0.31;0.66	6.17	6.17	0.99709	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.61135	0.2323	N	0.11201	0.11	0.80722	D	1	D;D	0.57257	0.96;0.979	D;P	0.66979	0.948;0.564	T	0.62402	-0.6862	10	0.36615	T	0.2	-35.408	20.8794	0.99867	0.0:0.0:1.0:0.0	.	348;348	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	D	348;348;41;50	ENSP00000394394:H348D;ENSP00000402314:H348D	ENSP00000402314:H348D	H	-	1	0	ANAPC7	109304132	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CAC	ANAPC7	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.413	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	G	NM_016238		110819749	-1	no_errors	ENST00000455511	ensembl	human	known	70_37	missense	SNP	1.000	C
ATG9B	285973	genome.wustl.edu	37	7	150721408	150721408	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:150721408G>T	ENST00000377974.2	-	1	178	c.103C>A	c.(103-105)Cct>Act	p.P35T	ATG9B_ENST00000605952.1_Missense_Mutation_p.P35T|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000605938.1_Missense_Mutation_p.P35T			Q674R7	ATG9B_HUMAN	autophagy related 9B	35	Pro-rich.				autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGAGGAGGAGGAGGTGGCAGT	0.667																																																	0													10.0	12.0	11.0					7																	150721408		1896	4071	5967	SO:0001583	missense	285973			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.103C>A	7.37:g.150721408G>T	ENSP00000475005:p.Pro35Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A5D3|Q6JRW5|Q8N8I8	RNA	SNP	-	NULL	ENST00000377974.2	37	NULL		7	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708974	0.68615	.	.	ENSG00000248602	ENST00000377974;ENST00000397266;ENST00000545613	.	.	.	4.2	4.2	0.49525	.	0.456159	0.16184	N	0.225688	T	0.37320	0.0999	.	.	.	.	.	.	B	0.23058	0.079	B	0.23574	0.047	T	0.42965	-0.9420	7	0.19147	T	0.46	-3.0078	12.2668	0.54683	0.0:0.0:1.0:0.0	.	35	Q674R7	ATG9B_HUMAN	T	35	.	ENSP00000444232:P35T	P	-	1	0	AC010973.1	150352341	1.000000	0.71417	0.991000	0.47740	0.809000	0.45718	2.256000	0.43231	2.337000	0.79520	0.555000	0.69702	CCT	ATG9B	-	-		0.667	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		G	NM_173681		150721408	-1	no_errors	ENST00000377974	ensembl	human	known	70_37	rna	SNP	0.935	T
BATF	10538	genome.wustl.edu	37	14	76012949	76012949	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:76012949G>A	ENST00000286639.6	+	3	571	c.313G>A	c.(313-315)Gag>Aag	p.E105K	BATF_ENST00000555504.1_Intron|BATF_ENST00000555795.1_3'UTR	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	105					cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		CTCGCCCCCCGAGGTGGTGTA	0.657																																																	0													37.0	28.0	31.0					14																	76012949		2200	4300	6500	SO:0001583	missense	10538			AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.313G>A	14.37:g.76012949G>A	ENSP00000286639:p.Glu105Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.E105K	ENST00000286639.6	37	c.313	CCDS9843.1	14	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650912	0.67472	.	.	ENSG00000156127	ENST00000286639	T	0.78481	-1.18	5.33	5.33	0.75918	.	0.153676	0.56097	D	0.000025	T	0.64114	0.2569	L	0.27053	0.805	0.80722	D	1	D	0.57899	0.981	B	0.39419	0.299	T	0.64141	-0.6477	10	0.11485	T	0.65	-1.5992	17.2289	0.86979	0.0:0.0:1.0:0.0	.	105	Q16520	BATF_HUMAN	K	105	ENSP00000286639:E105K	ENSP00000286639:E105K	E	+	1	0	BATF	75082702	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	8.127000	0.89593	2.495000	0.84180	0.655000	0.94253	GAG	BATF	-	NULL		0.657	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF	HGNC	protein_coding	OTTHUMT00000413669.1	G	NM_006399		76012949	+1	no_errors	ENST00000286639	ensembl	human	known	70_37	missense	SNP	1.000	A
CALN1	83698	genome.wustl.edu	37	7	71252834	71252834	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:71252834C>T	ENST00000329008.5	-	6	884	c.586G>A	c.(586-588)Gcc>Acc	p.A196T	CALN1_ENST00000412588.1_Missense_Mutation_p.A238T|CALN1_ENST00000395275.2_Missense_Mutation_p.A238T|CALN1_ENST00000431984.1_Missense_Mutation_p.A196T|CALN1_ENST00000405452.2_Missense_Mutation_p.A196T|CALN1_ENST00000395276.2_Missense_Mutation_p.A196T	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				ATAGCAAAGGCGCATATGAGG	0.567																																																	0													128.0	100.0	109.0					7																	71252834		2203	4300	6503	SO:0001583	missense	83698			AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.586G>A	7.37:g.71252834C>T	ENSP00000332498:p.Ala196Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	J3KQA7	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.A238T	ENST00000329008.5	37	c.712	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.176133	0.94846	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	T;T;T;T;T;T	0.80123	-1.1;-1.34;-1.1;-1.1;-1.34;-1.1	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	L	0.29908	0.895	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86975	0.2100	10	0.87932	D	0	-25.7589	17.5493	0.87872	0.0:1.0:0.0:0.0	.	196;196	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	T	196;238;196;196;238;196	ENSP00000332498:A196T;ENSP00000378690:A238T;ENSP00000378691:A196T;ENSP00000410704:A196T;ENSP00000391882:A238T;ENSP00000384354:A196T	ENSP00000332498:A196T	A	-	1	0	CALN1	70890770	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.724000	0.84798	2.372000	0.80975	0.561000	0.74099	GCC	CALN1	-	NULL		0.567	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	HGNC	protein_coding	OTTHUMT00000320044.2	C	NM_031468		71252834	-1	no_errors	ENST00000395275	ensembl	human	known	70_37	missense	SNP	1.000	T
CARM1	10498	genome.wustl.edu	37	19	11015736	11015736	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:11015736G>C	ENST00000327064.4	+	2	520	c.330G>C	c.(328-330)caG>caC	p.Q110H	CARM1_ENST00000344150.4_Missense_Mutation_p.Q110H	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	110					cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						TCCTCATCCAGTTCGCCACAC	0.617																																																	0													218.0	151.0	174.0					19																	11015736		2203	4300	6503	SO:0001583	missense	10498			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.330G>C	19.37:g.11015736G>C	ENSP00000325690:p.Gln110His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN38	Missense_Mutation	SNP	pfam_Histone-Arg_MeTrfase_N,pfam_Arg_MeTrfase,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_mo5U34_MeTrfase,pfam_Methyltransf_11	p.Q110H	ENST00000327064.4	37	c.330	CCDS12250.1	19	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934832	0.52866	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.27890	1.65;1.64	5.31	4.26	0.50523	Histone-arginine methyltransferase CARM1, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.22360	0.0539	N	0.19112	0.55	0.58432	D	0.999994	B	0.26002	0.139	B	0.29716	0.106	T	0.07177	-1.0786	10	0.48119	T	0.1	-3.1879	13.1986	0.59754	0.0806:0.0:0.9194:0.0	.	110	Q86X55	CARM1_HUMAN	H	110	ENSP00000325690:Q110H;ENSP00000340934:Q110H	ENSP00000325690:Q110H	Q	+	3	2	CARM1	10876736	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	4.823000	0.62694	2.478000	0.83669	0.561000	0.74099	CAG	CARM1	-	pfam_Histone-Arg_MeTrfase_N		0.617	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	HGNC	protein_coding	OTTHUMT00000452625.1	G	XM_032719		11015736	+1	no_errors	ENST00000327064	ensembl	human	known	70_37	missense	SNP	1.000	C
CBX8	57332	genome.wustl.edu	37	17	77768758	77768758	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr17:77768758delG	ENST00000269385.4	-	5	963	c.846delC	c.(844-846)gccfs	p.A282fs	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	282					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TTATCACCCTGGCCGGGAAGG	0.652																																																	0													30.0	29.0	29.0					17																	77768758		2202	4299	6501	SO:0001589	frameshift_variant	57332			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.846delC	17.37:g.77768758delG	ENSP00000269385:p.Ala282fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96H39|Q9NR07	Frame_Shift_Del	DEL	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.R283fs	ENST00000269385.4	37	c.846	CCDS11765.1	17																																																																																			CBX8	-	NULL		0.652	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	G	NM_020649		77768758	-1	no_errors	ENST00000269385	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
CCDC175	729665	genome.wustl.edu	37	14	60004827	60004827	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:60004827C>T	ENST00000537690.2	-	13	1592	c.1537G>A	c.(1537-1539)Gaa>Aaa	p.E513K	CCDC175_ENST00000281581.4_Missense_Mutation_p.E513K	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	513																	GTAAGTTTTTCAATCTGTGCC	0.303																																																	0													178.0	136.0	148.0					14																	60004827		692	1591	2283	SO:0001583	missense	729665				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.1537G>A	14.37:g.60004827C>T	ENSP00000453940:p.Glu513Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.E513K	ENST00000537690.2	37	c.1537	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825013	0.32237	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.94	4.06	0.47325	.	0.269718	0.26631	N	0.023301	T	0.34250	0.0891	L	0.32530	0.975	0.09310	N	1	.	.	.	.	.	.	T	0.17018	-1.0383	7	0.28530	T	0.3	-13.7223	9.3741	0.38272	0.0:0.9034:0.0:0.0966	.	.	.	.	K	513	.	ENSP00000281581:E513K	E	-	1	0	C14orf38	59074580	0.073000	0.21202	0.084000	0.20598	0.011000	0.07611	0.654000	0.24918	1.442000	0.47568	0.561000	0.74099	GAA	CCDC175	-	NULL		0.303	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1	C	NM_001164399		60004827	-1	no_errors	ENST00000281581	ensembl	human	known	70_37	missense	SNP	0.117	T
COL5A3	50509	genome.wustl.edu	37	19	10088308	10088308	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:10088308C>T	ENST00000264828.3	-	42	3173	c.3088G>A	c.(3088-3090)Gaa>Aaa	p.E1030K		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1030	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			ACGGGGCCTTCGCTGCCACTT	0.622																																																	0													28.0	28.0	28.0					19																	10088308		2203	4300	6503	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3088G>A	19.37:g.10088308C>T	ENSP00000264828:p.Glu1030Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.E1030K	ENST00000264828.3	37	c.3088	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277682	0.59758	.	.	ENSG00000080573	ENST00000264828	D	0.95756	-3.8	4.84	3.78	0.43462	.	0.786745	0.11250	N	0.583694	D	0.87309	0.6145	N	0.03209	-0.39	0.09310	N	1	B	0.18461	0.028	B	0.09377	0.004	T	0.72151	-0.4377	10	0.15952	T	0.53	.	13.0027	0.58685	0.0:0.3108:0.6892:0.0	.	1030	P25940	CO5A3_HUMAN	K	1030	ENSP00000264828:E1030K	ENSP00000264828:E1030K	E	-	1	0	COL5A3	9949308	0.794000	0.28838	0.954000	0.39281	0.116000	0.19942	3.120000	0.50430	0.628000	0.30357	-0.120000	0.15030	GAA	COL5A3	-	NULL		0.622	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	C	NM_015719		10088308	-1	no_errors	ENST00000264828	ensembl	human	known	70_37	missense	SNP	0.147	T
DACT1	51339	genome.wustl.edu	37	14	59113812	59113812	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:59113812G>A	ENST00000335867.4	+	4	2495	c.2471G>A	c.(2470-2472)cGc>cAc	p.R824H	DACT1_ENST00000395153.3_Missense_Mutation_p.R787H|DACT1_ENST00000541264.2_Missense_Mutation_p.R543H|DACT1_ENST00000556859.1_Missense_Mutation_p.R543H			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	824					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						AAGATCCTCCGCTTTCGGTCT	0.448																																																	0													113.0	118.0	116.0					14																	59113812		2203	4300	6503	SO:0001583	missense	51339			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2471G>A	14.37:g.59113812G>A	ENSP00000337439:p.Arg824His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYJ2|Q86TY0	Missense_Mutation	SNP	NULL	p.R824H	ENST00000335867.4	37	c.2471	CCDS9736.1	14	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759142	0.89843	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.84520	0.5490	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.85392	0.1126	10	0.87932	D	0	-20.2693	20.422	0.99049	0.0:0.0:1.0:0.0	.	787;824	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	H	543;543;787;824;543	ENSP00000451598:R543H;ENSP00000378581:R543H;ENSP00000378582:R787H;ENSP00000337439:R824H;ENSP00000442850:R543H	ENSP00000337439:R824H	R	+	2	0	DACT1	58183565	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.455000	0.97625	2.832000	0.97577	0.655000	0.94253	CGC	DACT1	-	NULL		0.448	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	G	NM_016651		59113812	+1	no_errors	ENST00000335867	ensembl	human	known	70_37	missense	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155155736	155155736	+	Silent	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:155155736G>A	ENST00000357232.4	-	25	8702	c.8703C>T	c.(8701-8703)atC>atT	p.I2901I		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2901					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATGTACCACTGATGTGTGTTC	0.433																																																	0													153.0	131.0	138.0					4																	155155736		2203	4300	6503	SO:0001819	synonymous_variant	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8703C>T	4.37:g.155155736G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I2901	ENST00000357232.4	37	c.8703	CCDS3785.1	4																																																																																			DCHS2	-	NULL		0.433	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	G	NM_001142552		155155736	-1	no_errors	ENST00000357232	ensembl	human	known	70_37	silent	SNP	0.000	A
DNAAF1	123872	genome.wustl.edu	37	16	84199549	84199549	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:84199549G>C	ENST00000378553.5	+	7	1148	c.1024G>C	c.(1024-1026)Gag>Cag	p.E342Q	DNAAF1_ENST00000563818.1_3'UTR|DNAAF1_ENST00000334315.5_Missense_Mutation_p.E342Q	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	342					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						AGAGAGTCAAGAGAGAGGTAT	0.502																																																	0													134.0	126.0	129.0					16																	84199549		2200	4300	6500	SO:0001583	missense	123872			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1024G>C	16.37:g.84199549G>C	ENSP00000367815:p.Glu342Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	NULL	p.E342Q	ENST00000378553.5	37	c.1024	CCDS10943.2	16	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408234	0.42715	.	.	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.35236	1.32;1.73	5.66	4.69	0.59074	.	0.130034	0.49916	D	0.000132	T	0.33177	0.0854	L	0.38175	1.15	0.30726	N	0.747727	P;P	0.45715	0.865;0.639	B;B	0.42555	0.391;0.155	T	0.26087	-1.0113	10	0.37606	T	0.19	-14.9223	16.2457	0.82445	0.0:0.1331:0.8669:0.0	.	90;342	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	Q	342	ENSP00000334593:E342Q;ENSP00000367815:E342Q	ENSP00000334593:E342Q	E	+	1	0	DNAAF1	82757050	0.999000	0.42202	0.004000	0.12327	0.001000	0.01503	3.500000	0.53318	1.381000	0.46364	-0.181000	0.13052	GAG	DNAAF1	-	NULL		0.502	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	HGNC	protein_coding	OTTHUMT00000250328.3	G	NM_178452		84199549	+1	no_errors	ENST00000378553	ensembl	human	known	70_37	missense	SNP	0.704	C
DNAH8	1769	genome.wustl.edu	37	6	38840902	38840902	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:38840902C>T	ENST00000359357.3	+	49	7061	c.6807C>T	c.(6805-6807)ctC>ctT	p.L2269L	DNAH8_ENST00000449981.2_Silent_p.L2486L|DNAH8_ENST00000441566.1_Silent_p.L2233L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2269	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCTCTGCTCTCAGCTGGAGGC	0.488																																																	0													72.0	75.0	74.0					6																	38840902		2203	4300	6503	SO:0001819	synonymous_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6807C>T	6.37:g.38840902C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L2269	ENST00000359357.3	37	c.6807		6																																																																																			DNAH8	-	smart_AAA+_ATPase		0.488	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	C	NM_001206927		38840902	+1	no_errors	ENST00000359357	ensembl	human	known	70_37	silent	SNP	0.556	T
DSCAM	1826	genome.wustl.edu	37	21	41516627	41516627	+	Missense_Mutation	SNP	A	A	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr21:41516627A>G	ENST00000400454.1	-	17	3527	c.3050T>C	c.(3049-3051)aTc>aCc	p.I1017T		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1017	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTAGCCACGGATAATCCCATT	0.463																																					Melanoma(134;970 1778 1785 21664 32388)												0													81.0	77.0	78.0					21																	41516627		1964	4157	6121	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3050T>C	21.37:g.41516627A>G	ENSP00000383303:p.Ile1017Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I1017T	ENST00000400454.1	37	c.3050	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339119	0.81911	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.62364	0.03;0.03	5.0	5.0	0.66597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.051152	0.85682	D	0.000000	T	0.81772	0.4893	H	0.96576	3.845	0.44562	D	0.997522	B	0.33904	0.431	P	0.46237	0.508	D	0.85959	0.1469	10	0.87932	D	0	.	14.7334	0.69399	1.0:0.0:0.0:0.0	.	1017	O60469	DSCAM_HUMAN	T	1017;769	ENSP00000383303:I1017T;ENSP00000385342:I769T	ENSP00000383303:I1017T	I	-	2	0	DSCAM	40438497	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	9.092000	0.94157	1.878000	0.54408	0.456000	0.33151	ATC	DSCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.463	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	A	NM_001389		41516627	-1	no_errors	ENST00000400454	ensembl	human	known	70_37	missense	SNP	1.000	G
EIF1AX	1964	genome.wustl.edu	37	X	20156734	20156734	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chrX:20156734C>T	ENST00000379607.5	-	2	226	c.23G>A	c.(22-24)gGa>gAa	p.G8E	snoU2_19_ENST00000364722.1_RNA|snoU2-30_ENST00000365012.1_RNA|EIF1AX-AS1_ENST00000424026.1_RNA|EIF1AX_ENST00000379593.1_Intron	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	8					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						GTTTTTACCTCCTTTACCTGA	0.313																																																	0													139.0	129.0	132.0					X																	20156734		2203	4300	6503	SO:0001583	missense	1964			L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.23G>A	X.37:g.20156734C>T	ENSP00000368927:p.Gly8Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1,tigrfam_TIF_eIF-1A	p.G8E	ENST00000379607.5	37	c.23	CCDS14196.1	X	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627537	0.66901	.	.	ENSG00000173674	ENST00000379607	T	0.47869	0.83	4.94	4.94	0.65067	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.79100	0.4389	H	0.96365	3.81	0.80722	D	1	D	0.67145	0.996	D	0.77004	0.989	D	0.86654	0.1900	9	0.72032	D	0.01	-2.5166	17.661	0.88193	0.0:1.0:0.0:0.0	.	8	P47813	IF1AX_HUMAN	E	8	ENSP00000368927:G8E	ENSP00000368927:G8E	G	-	2	0	EIF1AX	20066655	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.237000	0.78164	2.187000	0.69744	0.600000	0.82982	GGA	EIF1AX	-	superfamily_NA-bd_OB-fold-like		0.313	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AX	HGNC	protein_coding	OTTHUMT00000058913.1	C			20156734	-1	no_errors	ENST00000379607	ensembl	human	known	70_37	missense	SNP	1.000	T
FRG2FP	100128827	genome.wustl.edu	37	3	197838353	197838353	+	RNA	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr3:197838353G>C	ENST00000419104.1	+	0	475																											CCACCATAAGGGACATTCGAG	0.498																																																	0																																												0																															3.37:g.197838353G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000419104.1	37	NULL		3																																																																																			AC073135.3	-	-		0.498	AC073135.3-003	KNOWN	basic	processed_transcript	ENSG00000232783	Clone_based_vega_gene	pseudogene	OTTHUMT00000339698.1	G			197838353	+1	no_errors	ENST00000419104	ensembl	human	known	70_37	rna	SNP	0.005	C
ZNF727	442319	genome.wustl.edu	37	7	63539443	63539443	+	IGR	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:63539443G>A	ENST00000550760.3	+	0	1679				RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						ATGGAAGAGGGACCTTACAAA	0.408																																																	0																																										SO:0001628	intergenic_variant	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536		7.37:g.63539443G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000550760.3	37	NULL	CCDS55113.1	7																																																																																			RP11-3N2.1	-	-		0.408	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000244117	Clone_based_vega_gene	protein_coding		G	NM_001159522		63539443	+1	no_errors	ENST00000430271	ensembl	human	putative	70_37	rna	SNP	1.000	A
FLJ14816	0	genome.wustl.edu	37	2	121223347	121223347	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:121223347G>T	ENST00000593290.1	-	1	350	c.340C>A	c.(340-342)Ctg>Atg	p.L114M																								GAAACCTCCAGTGCAGAAATC	0.532																																																	0																																										SO:0001583	missense	0																														ENST00000593290.1:c.340C>A	2.37:g.121223347G>T	ENSP00000469038:p.Leu114Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.L114M	ENST00000593290.1	37	c.340		2																																																																																			FLJ14816	-	NULL		0.532	FLJ14816-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000268194	Uniprot_genename	protein_coding		G			121223347	-1	no_errors	ENST00000593290	ensembl	human	known	70_37	missense	SNP	0.000	T
EPHA5	2044	genome.wustl.edu	37	4	66189873	66189873	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:66189873C>G	ENST00000273854.3	-	18	3673	c.3073G>C	c.(3073-3075)Gaa>Caa	p.E1025Q	EPHA5_ENST00000354839.4_Missense_Mutation_p.E1003Q|EPHA5_ENST00000432638.2_Missense_Mutation_p.E862Q	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	1025	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ACCTTCATTTCTTGAAGGCTG	0.433										TSP Lung(17;0.13)																																							0													124.0	112.0	116.0					4																	66189873		2203	4300	6503	SO:0001583	missense	2044			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.3073G>C	4.37:g.66189873C>G	ENSP00000273854:p.Glu1025Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1025Q	ENST00000273854.3	37	c.3073	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695821	0.30052	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839	T;T;T	0.47177	0.85;0.85;0.85	5.25	5.25	0.73442	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.56097	D	0.000039	T	0.43100	0.1232	N	0.17872	0.535	0.80722	D	1	P;P;P;B	0.43973	0.757;0.823;0.82;0.097	P;P;B;B	0.48524	0.58;0.565;0.444;0.057	T	0.15492	-1.0435	10	0.15066	T	0.55	.	18.8545	0.92246	0.0:1.0:0.0:0.0	.	1004;1026;1003;1025	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	1025;862;1003	ENSP00000273854:E1025Q;ENSP00000389208:E862Q;ENSP00000346899:E1003Q	ENSP00000273854:E1025Q	E	-	1	0	EPHA5	65872468	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.446000	0.52928	2.446000	0.82766	0.557000	0.71058	GAA	EPHA5	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_SAM		0.433	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	C	NM_004439		66189873	-1	no_errors	ENST00000273854	ensembl	human	known	70_37	missense	SNP	1.000	G
ERC2	26059	genome.wustl.edu	37	3	55543687	55543687	+	3'UTR	SNP	C	C	T	rs530267065	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr3:55543687C>T	ENST00000288221.6	-	0	4786				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		AACTCAGGGACGGTTTCATCT	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*1657G>A	3.37:g.55543687C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2T9F6|Q86TK4	RNA	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-		0.393	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	C	NM_015576		55543687	-1	no_errors	ENST00000484530	ensembl	human	known	70_37	rna	SNP	0.000	T
FASTK	10922	genome.wustl.edu	37	7	150774001	150774001	+	Splice_Site	SNP	G	G	A	rs374560885		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:150774001G>A	ENST00000297532.6	-	9	1618	c.1541C>T	c.(1540-1542)cCg>cTg	p.P514L	FASTK_ENST00000482571.1_Splice_Site_p.P487L|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000353841.2_Splice_Site_p.P373L|FASTK_ENST00000489884.1_5'UTR	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	514	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GCCACTCACCGGCAGGAGCTG	0.697																																																	0													16.0	19.0	18.0					7																	150774001		2197	4296	6493	SO:0001630	splice_region_variant	10922				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1542+1C>T	7.37:g.150774001G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.P514L	ENST00000297532.6	37	c.1541	CCDS5918.1	7	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418007	0.62622	.	.	ENSG00000164896	ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.29142	1.98;1.96;1.58	4.44	3.55	0.40652	RAP domain (3);	0.190935	0.34700	N	0.003741	T	0.24236	0.0587	N	0.08118	0	0.80722	D	1	D;B;B	0.71674	0.998;0.008;0.008	P;B;B	0.60682	0.878;0.007;0.007	T	0.06734	-1.0810	10	0.21014	T	0.42	-24.4665	6.2245	0.20700	0.0994:0.0:0.7034:0.1973	.	487;373;514	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	L	373;514;487	ENSP00000324817:P373L;ENSP00000297532:P514L;ENSP00000418516:P487L	ENSP00000297532:P514L	P	-	2	0	FASTK	150404934	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.767000	0.38501	1.173000	0.42796	0.561000	0.74099	CCG	FASTK	-	pfam_RAP,smart_RAP		0.697	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	G	NM_006712	Missense_Mutation	150774001	-1	no_errors	ENST00000297532	ensembl	human	known	70_37	missense	SNP	1.000	A
FBXO41	150726	genome.wustl.edu	37	2	73491609	73491609	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:73491609C>G	ENST00000521871.1	-	6	2018	c.1603G>C	c.(1603-1605)Gag>Cag	p.E535Q	FBXO41_ENST00000295133.5_Missense_Mutation_p.E596Q|FBXO41_ENST00000520530.2_Missense_Mutation_p.E535Q			Q8TF61	FBX41_HUMAN	F-box protein 41	535	F-box.									breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						CTGACCCTCTCTGCTCGCCGA	0.627																																																	0													51.0	57.0	55.0					2																	73491609		2082	4202	6284	SO:0001583	missense	150726			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.1603G>C	2.37:g.73491609C>G	ENSP00000428646:p.Glu535Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.E596Q	ENST00000521871.1	37	c.1786	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025727	0.54683	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	.	.	.	5.26	5.26	0.73747	.	0.577437	0.18708	N	0.133391	T	0.53286	0.1787	L	0.40543	1.245	0.53005	D	0.999963	B	0.27559	0.181	B	0.23419	0.046	T	0.47522	-0.9111	9	0.15066	T	0.55	.	17.6182	0.88073	0.0:1.0:0.0:0.0	.	535	Q8TF61	FBX41_HUMAN	Q	596;535	.	ENSP00000295133:E596Q	E	-	1	0	FBXO41	73345117	1.000000	0.71417	0.932000	0.37286	0.769000	0.43574	5.310000	0.65780	2.737000	0.93849	0.643000	0.83706	GAG	FBXO41	-	NULL		0.627	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	C			73491609	-1	no_errors	ENST00000295133	ensembl	human	known	70_37	missense	SNP	0.990	G
GALC	2581	genome.wustl.edu	37	14	88452831	88452831	+	Splice_Site	SNP	A	A	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:88452831A>G	ENST00000261304.2	-	4	549		c.e4+1		GALC_ENST00000544807.2_Splice_Site|GALC_ENST00000393568.4_Splice_Site|GALC_ENST00000393569.2_Splice_Site|GALC_ENST00000554916.1_Splice_Site	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase						carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTCATTTCTTACCAATGAGTG	0.358																																																	0													139.0	128.0	131.0					14																	88452831		1872	4110	5982	SO:0001630	splice_region_variant	2581			L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.442+1T>C	14.37:g.88452831A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Splice_Site	SNP	-	e4+2	ENST00000261304.2	37	c.442+2	CCDS9878.2	14	.	.	.	.	.	.	.	.	.	.	A	21.7	4.185077	0.78677	.	.	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000393568;ENST00000445021	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3922	0.66986	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GALC	87522584	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	8.865000	0.92300	2.044000	0.60594	0.374000	0.22700	.	GALC	-	-		0.358	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	HGNC	protein_coding	OTTHUMT00000071559.2	A		Intron	88452831	-1	no_errors	ENST00000261304	ensembl	human	known	70_37	splice_site	SNP	1.000	G
GLIS3	169792	genome.wustl.edu	37	9	3827920	3827920	+	3'UTR	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr9:3827920G>A	ENST00000324333.10	-	0	2873				GLIS3_ENST00000381971.3_3'UTR|GLIS3_ENST00000461870.1_5'UTR	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TTTTCAGGTAGAGTCATCCCC	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.*352C>T	9.37:g.3827920G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL19|Q1PHK5	RNA	SNP	-	NULL	ENST00000324333.10	37	NULL	CCDS6451.1	9																																																																																			GLIS3	-	-		0.478	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1	G	NM_152629		3827920	-1	no_errors	ENST00000461870	ensembl	human	known	70_37	rna	SNP	0.007	A
GPC5	2262	genome.wustl.edu	37	13	92380901	92380901	+	Missense_Mutation	SNP	C	C	T	rs138581416		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr13:92380901C>T	ENST00000377067.3	+	4	1508	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	379					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				AGTGAAGAGACGCTTGCCAAC	0.398													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15022	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	119.0	124.0	122.0		1136	4.1	1.0	13	dbSNP_134	122	0,8600		0,0,4300	yes	missense	GPC5	NM_004466.4	81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	379/573	92380901	2,13004	2203	4300	6503	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1136C>T	13.37:g.92380901C>T	ENSP00000366267:p.Thr379Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.T379M	ENST00000377067.3	37	c.1136	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	C	17.31	3.358204	0.61403	4.54E-4	0.0	ENSG00000179399	ENST00000377067	T	0.59224	0.28	5.88	4.1	0.47936	.	0.436426	0.25604	N	0.029537	T	0.67069	0.2854	M	0.73962	2.25	0.33440	D	0.582257	D	0.58620	0.983	P	0.55260	0.772	T	0.78254	-0.2275	10	0.87932	D	0	-0.2407	9.3761	0.38283	0.0:0.7808:0.1434:0.0759	.	379	P78333	GPC5_HUMAN	M	379	ENSP00000366267:T379M	ENSP00000366267:T379M	T	+	2	0	GPC5	91178902	0.967000	0.33354	1.000000	0.80357	0.925000	0.55904	2.211000	0.42825	1.499000	0.48617	0.557000	0.71058	ACG	GPC5	-	pfam_Glypican		0.398	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	C	NM_004466		92380901	+1	no_errors	ENST00000377067	ensembl	human	known	70_37	missense	SNP	0.992	T
HELT	391723	genome.wustl.edu	37	4	185940974	185940975	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:185940974_185940975insT	ENST00000515777.1	+	3	294_295	c.206_207insT	c.(205-210)gattttfs	p.DF69fs	HELT_ENST00000338875.4_Frame_Shift_Ins_p.DF154fs|HELT_ENST00000505610.1_Frame_Shift_Ins_p.DF69fs			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	69					central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CACTCCGCTGATTTTCCCCGGG	0.634																																																	0																																										SO:0001589	frameshift_variant	391723			BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.210dupT	4.37:g.185940978_185940978dupT	ENSP00000426033:p.Asp69fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTS5|B7ZMI7|B7ZMI8	Frame_Shift_Ins	INS	pfam_HLH_dom,pfam_Orange,superfamily_HLH_dom,smart_HLH_dom,pfscan_Orange,pfscan_HLH_dom	p.P156fs	ENST00000515777.1	37	c.461_462		4																																																																																			HELT	-	smart_HLH_dom		0.634	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	HELT	HGNC	protein_coding	OTTHUMT00000360792.1	-	NM_001300781		185940975	+1	no_errors	ENST00000338875	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:0.997	T
HELT	391723	genome.wustl.edu	37	4	185940979	185940979	+	Missense_Mutation	SNP	C	C	T	rs147187823		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:185940979C>T	ENST00000515777.1	+	3	299	c.211C>T	c.(211-213)Ccc>Tcc	p.P71S	HELT_ENST00000338875.4_Missense_Mutation_p.P156S|HELT_ENST00000505610.1_Missense_Mutation_p.P71S			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	71					central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CGCTGATTTTCCCCGGGGAAG	0.632													c|||	1	0.000199681	0.0008	0.0	5008	,	,		15683	0.0		0.0	False		,,,				2504	0.0																0								C	SER/PRO	3,4401		0,3,2199	26.0	26.0	26.0		466	4.9	1.0	4	dbSNP_134	26	0,8600		0,0,4300	yes	missense	HELT	NM_001029887.1	74	0,3,6499	TT,TC,CC		0.0,0.0681,0.0231	benign	156/328	185940979	3,13001	2202	4300	6502	SO:0001583	missense	391723			BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.211C>T	4.37:g.185940979C>T	ENSP00000426033:p.Pro71Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	pfam_HLH_dom,pfam_Orange,superfamily_HLH_dom,smart_HLH_dom,pfscan_Orange,pfscan_HLH_dom	p.P156S	ENST00000515777.1	37	c.466		4	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269824	0.40095	6.81E-4	0.0	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;D	0.98221	-0.09;-0.09;-4.8	4.89	4.89	0.63831	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95430	0.8516	L	0.38953	1.18	0.80722	D	1	B;B;B	0.31769	0.339;0.023;0.066	B;B;B	0.26094	0.066;0.012;0.028	D	0.94698	0.7880	10	0.15952	T	0.53	-11.869	17.8433	0.88721	0.0:1.0:0.0:0.0	.	156;71;71	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	S	71;71;156	ENSP00000422140:P71S;ENSP00000426033:P71S;ENSP00000343464:P156S	ENSP00000343464:P156S	P	+	1	0	HELT	186177973	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.411000	0.80078	2.551000	0.86045	0.561000	0.74099	CCC	HELT	-	smart_HLH_dom		0.632	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	HELT	HGNC	protein_coding	OTTHUMT00000360792.1	C	NM_001300781		185940979	+1	no_errors	ENST00000338875	ensembl	human	known	70_37	missense	SNP	1.000	T
HLA-B	3106	genome.wustl.edu	37	6	31324878	31324879	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:31324878_31324879insCA	ENST00000412585.2	-	1	85_86	c.57_58insTG	c.(55-60)ctgaccfs	p.T20fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	20					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CAGGTCTCGGTCAGGGCCAGGG	0.728									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0																																										SO:0001589	frameshift_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.56_57dupTG	6.37:g.31324879_31324880dupCA	ENSP00000399168:p.Thr20fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q29764	Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.T19fs	ENST00000412585.2	37	c.58_57	CCDS34394.1	6																																																																																			HLA-B	-	NULL		0.728	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	-	NM_005514		31324879	-1	no_errors	ENST00000412585	ensembl	human	known	70_37	frame_shift_ins	INS	0.202:0.408	CA
HSD17B4	3295	genome.wustl.edu	37	5	118813176	118813176	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:118813176G>A	ENST00000256216.6	+	7	547	c.414G>A	c.(412-414)atG>atA	p.M138I	HSD17B4_ENST00000515320.1_Missense_Mutation_p.M120I|HSD17B4_ENST00000414835.2_Start_Codon_SNP_p.M1I|HSD17B4_ENST00000513628.1_Start_Codon_SNP_p.M1I|HSD17B4_ENST00000510025.1_Missense_Mutation_p.M114I|HSD17B4_ENST00000504811.1_Missense_Mutation_p.M163I|HSD17B4_ENST00000509514.1_5'UTR	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	138	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		GGGAACACATGAAGAAACAGA	0.378																																					Colon(35;490 801 34689 41394 43344)												0													74.0	75.0	75.0					5																	118813176		2202	4300	6502	SO:0001583	missense	3295				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.414G>A	5.37:g.118813176G>A	ENSP00000256216:p.Met138Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.M138I	ENST00000256216.6	37	c.414	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.456458	0.96223	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628	D;D;D;D;T;D	0.91740	-2.9;-2.9;-2.9;-2.9;-1.38;-2.9	6.02	6.02	0.97574	NAD(P)-binding domain (1);	0.036044	0.85682	D	0.000000	D	0.96200	0.8761	M	0.81112	2.525	0.80722	D	1	P;D;D;P	0.64830	0.866;0.994;0.983;0.95	P;D;D;D	0.66602	0.814;0.926;0.945;0.925	D	0.95866	0.8887	10	0.72032	D	0.01	-33.3167	20.1358	0.98028	0.0:0.0:1.0:0.0	.	163;120;114;138	F5HE57;E9PB82;E7EWE5;P51659	.;.;.;DHB4_HUMAN	I	138;120;114;163;1;1	ENSP00000256216:M138I;ENSP00000424613:M120I;ENSP00000424940:M114I;ENSP00000420914:M163I;ENSP00000411960:M1I;ENSP00000425993:M1I	ENSP00000256216:M138I	M	+	3	0	HSD17B4	118841075	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.698000	0.98700	2.865000	0.98341	0.655000	0.94253	ATG	HSD17B4	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,smart_PKS/FAS_KR,prints_Glc/ribitol_DH		0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	G	NM_000414		118813176	+1	no_errors	ENST00000256216	ensembl	human	known	70_37	missense	SNP	1.000	A
IL16	3603	genome.wustl.edu	37	15	81517900	81517900	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr15:81517900G>C	ENST00000302987.4	+	1	160	c.160G>C	c.(160-162)Gag>Cag	p.E54Q	IL16_ENST00000394660.2_Missense_Mutation_p.E54Q			Q14005	IL16_HUMAN	interleukin 16	54					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CCAGGGCAAGGAGGGAATTTT	0.542																																																	0													82.0	82.0	82.0					15																	81517900		2014	4193	6207	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.160G>C	15.37:g.81517900G>C	ENSP00000302935:p.Glu54Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_Interleukin-16	p.E54Q	ENST00000302987.4	37	c.160	CCDS42069.1	15	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651775	0.47362	.	.	ENSG00000172349	ENST00000394655;ENST00000360547;ENST00000394660;ENST00000302987	T;T	0.17528	2.28;2.27	3.97	3.97	0.46021	.	0.189501	0.25590	N	0.029632	T	0.34221	0.0890	M	0.65975	2.015	0.80722	D	1	P;D	0.57899	0.769;0.981	B;P	0.55999	0.282;0.789	T	0.22871	-1.0204	10	0.56958	D	0.05	.	16.2407	0.82405	0.0:0.0:1.0:0.0	.	54;54	Q14005;Q14005-2	IL16_HUMAN;.	Q	54;96;54;54	ENSP00000378155:E54Q;ENSP00000302935:E54Q	ENSP00000302935:E54Q	E	+	1	0	IL16	79304955	1.000000	0.71417	0.965000	0.40720	0.264000	0.26372	4.337000	0.59310	2.043000	0.60533	0.563000	0.77884	GAG	IL16	-	NULL		0.542	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	HGNC	protein_coding	OTTHUMT00000303952.1	G	NM_172217		81517900	+1	no_errors	ENST00000302987	ensembl	human	known	70_37	missense	SNP	0.997	C
IL1F10	84639	genome.wustl.edu	37	2	113832909	113832909	+	Missense_Mutation	SNP	C	C	T	rs140273950	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:113832909C>T	ENST00000393197.2	+	4	848	c.427C>T	c.(427-429)Cgt>Tgt	p.R143C	IL1F10_ENST00000341010.2_Missense_Mutation_p.R143C|IL1F10_ENST00000337569.3_Missense_Mutation_p.R143C	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	143						extracellular space (GO:0005615)				endometrium(1)|lung(6)|ovary(1)	8						GCCCTCAGCCCGTACCAAGTT	0.577													C|||	9	0.00179712	0.0	0.0	5008	,	,		18857	0.0		0.0	False		,,,				2504	0.0092																0								C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	60.0	62.0	61.0		427,427	-0.6	0.1	2	dbSNP_134	61	1,8599		0,1,4299	no	missense,missense	IL1F10	NM_032556.5,NM_173161.2	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	143/153,143/153	113832909	1,13005	2203	4300	6503	SO:0001583	missense	84639			AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.427C>T	2.37:g.113832909C>T	ENSP00000376893:p.Arg143Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Missense_Mutation	SNP	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1,prints_Interleukin_1,prints_InterleukinIL1B	p.R143C	ENST00000393197.2	37	c.427	CCDS2112.1	2	.	.	.	.	.	.	.	.	.	.	C	4.093	0.015210	0.07959	0.0	1.16E-4	ENSG00000136697	ENST00000341010;ENST00000337569;ENST00000393197	T;T;T	0.16743	2.32;2.32;2.32	4.87	-0.547	0.11836	.	0.848252	0.10644	N	0.650705	T	0.11452	0.0279	L	0.36672	1.1	0.09310	N	0.999992	B;B	0.13145	0.007;0.001	B;B	0.08055	0.003;0.002	T	0.31223	-0.9951	10	0.37606	T	0.19	-13.1867	4.8979	0.13760	0.1377:0.5296:0.0:0.3327	.	143;143	Q8WWZ1-2;Q8WWZ1	.;IL1FA_HUMAN	C	143	ENSP00000341794:R143C;ENSP00000338418:R143C;ENSP00000376893:R143C	ENSP00000338418:R143C	R	+	1	0	IL1F10	113549380	0.000000	0.05858	0.050000	0.19076	0.126000	0.20510	-0.240000	0.08952	-0.024000	0.13941	-0.150000	0.13652	CGT	IL1F10	-	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1		0.577	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	IL1F10	HGNC	protein_coding	OTTHUMT00000330725.1	C	NM_173161		113832909	+1	no_errors	ENST00000337569	ensembl	human	known	70_37	missense	SNP	0.231	T
IL4R	3566	genome.wustl.edu	37	16	27352391	27352391	+	Intron	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:27352391G>A	ENST00000395762.2	+	3	329				IL4R_ENST00000170630.2_Intron|IL4R_ENST00000449195.1_Intron|IL4R_ENST00000543915.2_Intron|IL4R_ENST00000380922.3_5'UTR	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor						defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						tgttccaaaggactcttcagg	0.532																																																	0																																										SO:0001627	intron_variant	3566			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.70+797G>A	16.37:g.27352391G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	NULL	p.G24E	ENST00000395762.2	37	c.71	CCDS10629.1	16																																																																																			IL4R	-	NULL		0.532	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	G			27352391	+1	no_errors	ENST00000563926	ensembl	human	known	70_37	missense	SNP	0.029	A
IPO11	51194	genome.wustl.edu	37	5	61747703	61747703	+	Silent	SNP	T	T	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:61747703T>C	ENST00000325324.6	+	5	628	c.459T>C	c.(457-459)caT>caC	p.H153H	KIF2A_ENST00000509663.2_Intron|IPO11_ENST00000409296.3_Silent_p.H193H	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	153					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		CCTTCTATCATGTTACCAAGA	0.373																																																	0													147.0	136.0	140.0					5																	61747703		2203	4300	6503	SO:0001819	synonymous_variant	51194			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.459T>C	5.37:g.61747703T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Silent	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.H193	ENST00000325324.6	37	c.579	CCDS34167.1	5																																																																																			IPO11	-	superfamily_ARM-type_fold		0.373	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO11	HGNC	protein_coding	OTTHUMT00000335062.1	T	NM_016338		61747703	+1	no_errors	ENST00000409296	ensembl	human	known	70_37	silent	SNP	1.000	C
JMJD1C	221037	genome.wustl.edu	37	10	64953104	64953104	+	Splice_Site	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr10:64953104C>G	ENST00000399262.2	-	15	6081		c.e15+1		JMJD1C_ENST00000402544.1_Splice_Site|JMJD1C_ENST00000399251.1_Splice_Site|JMJD1C_ENST00000542921.1_Splice_Site	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C						blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTTTTACTCACTTGAGATACA	0.284																																																	0													98.0	88.0	91.0					10																	64953104		1791	4060	5851	SO:0001630	splice_region_variant	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5862+1G>C	10.37:g.64953104C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Splice_Site	SNP	-	e15+1	ENST00000399262.2	37	c.5862+1	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436413	0.62955	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921;ENST00000327520	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3736	0.94500	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JMJD1C	64623110	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.809000	0.69172	2.675000	0.91044	0.655000	0.94253	.	JMJD1C	-	-		0.284	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	C	NM_004241	Intron	64953104	-1	no_errors	ENST00000399262	ensembl	human	known	70_37	splice_site	SNP	1.000	G
KAT6A	7994	genome.wustl.edu	37	8	41798922	41798922	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr8:41798922G>C	ENST00000396930.3	-	16	3020	c.2477C>G	c.(2476-2478)tCt>tGt	p.S826C	KAT6A_ENST00000265713.2_Missense_Mutation_p.S826C|KAT6A_ENST00000406337.1_Missense_Mutation_p.S826C	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	826					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TACTGAATAAGAATCTTGTTC	0.358																																																	0													67.0	66.0	66.0					8																	41798922		2203	4300	6503	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2477C>G	8.37:g.41798922G>C	ENSP00000380136:p.Ser826Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S826C	ENST00000396930.3	37	c.2477	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817693	0.32145	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.60672	0.17;0.17;0.17	5.67	4.78	0.61160	.	0.286130	0.30126	N	0.010354	T	0.46347	0.1388	L	0.27053	0.805	0.31548	N	0.659126	B	0.06786	0.001	B	0.04013	0.001	T	0.52019	-0.8631	10	0.51188	T	0.08	-7.56	14.9072	0.70730	0.0:0.1427:0.8573:0.0	.	826	Q92794	KAT6A_HUMAN	C	826;826;826;406	ENSP00000265713:S826C;ENSP00000385888:S826C;ENSP00000380136:S826C	ENSP00000265713:S826C	S	-	2	0	KAT6A	41918079	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	3.578000	0.53892	1.351000	0.45789	0.655000	0.94253	TCT	KAT6A	-	NULL		0.358	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	G	NM_006766		41798922	-1	no_errors	ENST00000265713	ensembl	human	known	70_37	missense	SNP	1.000	C
KCNJ14	3770	genome.wustl.edu	37	19	48965361	48965361	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:48965361G>T	ENST00000391884.1	+	1	856	c.380G>T	c.(379-381)tGc>tTc	p.C127F	KCNJ14_ENST00000342291.2_Missense_Mutation_p.C127F			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	127					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	CCCGCGCCCTGCTTCTCACAC	0.706																																					NSCLC(148;170 3504 35216)												0													13.0	10.0	11.0					19																	48965361		2182	4270	6452	SO:0001583	missense	3770			BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.380G>T	19.37:g.48965361G>T	ENSP00000375756:p.Cys127Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	p.C127F	ENST00000391884.1	37	c.380	CCDS12721.1	19	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526104	0.85600	.	.	ENSG00000182324	ENST00000342291;ENST00000391884	D;D	0.97378	-4.36;-4.36	4.69	4.69	0.59074	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.99064	0.9679	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99053	1.0828	10	0.87932	D	0	.	15.5066	0.75745	0.0:0.0:1.0:0.0	.	127	Q9UNX9	IRK14_HUMAN	F	127	ENSP00000341479:C127F;ENSP00000375756:C127F	ENSP00000341479:C127F	C	+	2	0	KCNJ14	53657173	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.786000	0.99046	2.323000	0.78572	0.591000	0.81541	TGC	KCNJ14	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir		0.706	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ14	HGNC	protein_coding	OTTHUMT00000466127.1	G	NM_013348		48965361	+1	no_errors	ENST00000342291	ensembl	human	known	70_37	missense	SNP	1.000	T
CEP162	22832	genome.wustl.edu	37	6	84884962	84884962	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:84884962C>T	ENST00000403245.3	-	14	1882	c.1768G>A	c.(1768-1770)Gaa>Aaa	p.E590K	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E514K	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		GAATCAGTTTCTGTGGGATTT	0.313																																																	0													52.0	49.0	50.0					6																	84884962		2095	4071	6166	SO:0001583	missense	22832																														ENST00000403245.3:c.1768G>A	6.37:g.84884962C>T	ENSP00000385215:p.Glu590Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E590K	ENST00000403245.3	37	c.1768	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	6.357	0.433929	0.12045	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.17854	2.25;2.25	5.5	3.62	0.41486	.	0.436669	0.22103	N	0.064594	T	0.07818	0.0196	M	0.63428	1.95	0.09310	N	1	P;P	0.38504	0.634;0.573	B;B	0.38378	0.116;0.272	T	0.13764	-1.0497	10	0.42905	T	0.14	-2.7104	8.3903	0.32524	0.1682:0.6302:0.2016:0.0	.	590;590	Q5TB80;C9JFM9	QN1_HUMAN;.	K	514;590	ENSP00000257766:E514K;ENSP00000385215:E590K	ENSP00000257766:E514K	E	-	1	0	KIAA1009	84941681	0.998000	0.40836	0.018000	0.16275	0.518000	0.34316	2.290000	0.43531	0.686000	0.31488	0.563000	0.77884	GAA	KIAA1009	-	NULL		0.313	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	C			84884962	-1	no_errors	ENST00000403245	ensembl	human	known	70_37	missense	SNP	0.138	T
LILRB3	11025	genome.wustl.edu	37	19	54726628	54726628	+	Missense_Mutation	SNP	C	C	T	rs200758022	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:54726628C>T	ENST00000391750.1	-	3	197	c.61G>A	c.(61-63)Gtg>Atg	p.V21M	LILRB3_ENST00000346401.6_Missense_Mutation_p.V21M|LILRB3_ENST00000245620.9_Missense_Mutation_p.V21M|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000424807.1_Missense_Mutation_p.V21M|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000469273.1_5'Flank			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	21			V -> M (in dbSNP:rs1132588).		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTGCCTGCACGCGGGTCCTG	0.657																																																	0													2.0	2.0	2.0					19																	54726628		1163	2749	3912	SO:0001583	missense	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.61G>A	19.37:g.54726628C>T	ENSP00000375630:p.Val21Met	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V21M	ENST00000391750.1	37	c.61	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	C	7.872	0.728256	0.15507	.	.	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000445347	T;T;T;T;T	0.00522	7.06;7.06;7.02;7.05;6.84	2.9	0.662	0.17880	Immunoglobulin-like fold (1);	0.896200	0.09207	N	0.833786	T	0.00998	0.0033	M	0.71296	2.17	0.09310	N	1	D;P	0.67145	0.996;0.944	P;P	0.58620	0.842;0.606	T	0.50906	-0.8772	10	0.51188	T	0.08	.	4.0591	0.09831	0.0:0.6121:0.2464:0.1415	.	21;21	O75022;O75022-3	LIRB3_HUMAN;.	M	21	ENSP00000375630:V21M;ENSP00000412771:V21M;ENSP00000345184:V21M;ENSP00000245620:V21M;ENSP00000388199:V21M	ENSP00000245620:V21M	V	-	1	0	LILRB3	59418440	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.246000	0.08878	0.274000	0.22072	-0.241000	0.12123	GTG	LILRB3	-	NULL		0.657	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	C	NM_006864		54726628	-1	no_errors	ENST00000346401	ensembl	human	known	70_37	missense	SNP	0.000	T
LMBRD1	55788	genome.wustl.edu	37	6	70462177	70462177	+	Missense_Mutation	SNP	C	C	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:70462177C>A	ENST00000370577.3	-	4	608	c.379G>T	c.(379-381)Gat>Tat	p.D127Y	LMBRD1_ENST00000370570.1_Missense_Mutation_p.D54Y	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	127					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TCATCATCATCCTTTTCTTCA	0.299																																																	0													53.0	56.0	55.0					6																	70462177		2195	4278	6473	SO:0001583	missense	55788			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.379G>T	6.37:g.70462177C>A	ENSP00000359609:p.Asp127Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.D127Y	ENST00000370577.3	37	c.379	CCDS4969.1	6	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313027	0.81358	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.32272	1.46;1.46	5.23	5.23	0.72850	LMBR1-like membrane protein (1);	0.050794	0.85682	D	0.000000	T	0.53850	0.1822	M	0.84683	2.71	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.61973	-0.6952	10	0.72032	D	0.01	-13.9989	17.5764	0.87950	0.0:1.0:0.0:0.0	.	127	Q9NUN5	LMBD1_HUMAN	Y	127;54	ENSP00000359609:D127Y;ENSP00000359602:D54Y	ENSP00000359602:D54Y	D	-	1	0	LMBRD1	70518898	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.028000	0.76470	2.451000	0.82905	0.557000	0.71058	GAT	LMBRD1	-	pfam_LMBR1-like_membr_prot		0.299	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD1	HGNC	protein_coding	OTTHUMT00000041124.1	C	NM_018368		70462177	-1	no_errors	ENST00000370577	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC16A9	220963	genome.wustl.edu	37	10	61496974	61496974	+	5'Flank	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr10:61496974G>A	ENST00000395347.1	-	0	0				LINC00948_ENST00000600486.1_lincRNA			Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9						urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						GAATTATCCCGCTCCCTAGGA	0.308																																																	0																																										SO:0001631	upstream_gene_variant	100507027			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283		10.37:g.61496974G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMI2|Q9UFH8	RNA	SNP	-	NULL	ENST00000395347.1	37	NULL	CCDS7256.1	10																																																																																			RP11-59J5.1	-	-		0.308	SLC16A9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	M1	Clone_based_vega_gene	protein_coding	OTTHUMT00000276891.1	G	NM_194298		61496974	-1	no_errors	ENST00000414264	ensembl	human	known	70_37	rna	SNP	0.013	A
MAN2B2	23324	genome.wustl.edu	37	4	6596327	6596327	+	Missense_Mutation	SNP	A	A	T	rs536840018		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:6596327A>T	ENST00000285599.3	+	7	961	c.925A>T	c.(925-927)Atc>Ttc	p.I309F	MAN2B2_ENST00000504248.1_Intron	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	309					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						GCTGGACCACATCAACAGCCA	0.602																																																	0													130.0	96.0	107.0					4																	6596327		2203	4300	6503	SO:0001583	missense	23324			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.925A>T	4.37:g.6596327A>T	ENSP00000285599:p.Ile309Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.I309F	ENST00000285599.3	37	c.925	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	A	19.14	3.768915	0.69878	.	.	ENSG00000013288	ENST00000285599	T	0.76578	-1.03	4.4	0.282	0.15692	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.320649	0.31909	N	0.006879	D	0.82719	0.5098	M	0.77616	2.38	0.80722	D	1	D;P	0.59767	0.986;0.891	D;P	0.66351	0.943;0.681	T	0.78285	-0.2263	10	0.72032	D	0.01	-25.4284	4.1555	0.10258	0.6762:0.0:0.1736:0.1502	.	309;309	Q9Y2E5;Q9Y2E5-2	MA2B2_HUMAN;.	F	309	ENSP00000285599:I309F	ENSP00000285599:I309F	I	+	1	0	MAN2B2	6647228	0.999000	0.42202	0.540000	0.28089	0.878000	0.50629	3.968000	0.56809	-0.184000	0.10567	-0.499000	0.04595	ATC	MAN2B2	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl		0.602	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	A	NM_015274		6596327	+1	no_errors	ENST00000285599	ensembl	human	known	70_37	missense	SNP	1.000	T
MED25	81857	genome.wustl.edu	37	19	50338793	50338793	+	Missense_Mutation	SNP	G	G	T	rs369006637	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:50338793G>T	ENST00000312865.6	+	15	1730	c.1677G>T	c.(1675-1677)atG>atT	p.M559I	MED25_ENST00000538643.1_Missense_Mutation_p.M346I	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	559					cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CCGTGCAGATGGGGGGACAGC	0.657																																					GBM(51;894 1657 37868)												0													9.0	8.0	9.0					19																	50338793		2175	4252	6427	SO:0001583	missense	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1677G>T	19.37:g.50338793G>T	ENSP00000326767:p.Met559Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.M559I	ENST00000312865.6	37	c.1677	CCDS33075.1	19	.	.	.	.	.	.	.	.	.	.	g	11.21	1.570341	0.28003	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070;ENST00000536547	T;T	0.78481	-1.18;-1.15	5.7	2.19	0.27852	.	0.224748	0.43416	D	0.000562	T	0.60573	0.2279	L	0.27053	0.805	0.28846	N	0.896311	P;B;B	0.42078	0.77;0.0;0.001	B;B;B	0.37091	0.241;0.0;0.001	T	0.58951	-0.7545	10	0.56958	D	0.05	.	7.4085	0.27004	0.0868:0.3231:0.5901:0.0	.	346;559;559	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	I	559;559;559;559;559;346;294;48	ENSP00000326767:M559I;ENSP00000437496:M346I	ENSP00000326767:M559I	M	+	3	0	MED25	55030605	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	1.784000	0.38674	0.754000	0.32968	0.447000	0.29281	ATG	MED25	-	NULL		0.657	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	G	NM_030973		50338793	+1	no_errors	ENST00000312865	ensembl	human	known	70_37	missense	SNP	1.000	T
MT-CO1	4512	genome.wustl.edu	37	M	3221	3221	+	5'Flank	SNP	A	A	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chrM:3221A>G	ENST00000361624.2	+	0	0				MT-TI_ENST00000387365.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCCACCCAAGAACAGGGTTTg	0.428																																																	0																																										SO:0001631	upstream_gene_variant	100616263					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3221A>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MIR4485	-	-		0.428	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MIR4485	HGNC	protein_coding		A	YP_003024028		3221	+1	no_errors	ENST00000387347	ensembl	human	known	70_37	rna	SNP	NULL	G
MTTP	4547	genome.wustl.edu	37	4	100530023	100530023	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:100530023C>T	ENST00000265517.5	+	12	1861	c.1658C>T	c.(1657-1659)tCc>tTc	p.S553F	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Missense_Mutation_p.S553F|MTTP_ENST00000511045.1_Missense_Mutation_p.S580F			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	553	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AACAATCCATCCTACATGGAC	0.408																																																	0													132.0	131.0	131.0					4																	100530023		2203	4300	6503	SO:0001583	missense	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1658C>T	4.37:g.100530023C>T	ENSP00000265517:p.Ser553Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.S553F	ENST00000265517.5	37	c.1658	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628112	0.87560	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.72615	-0.67;-0.67;-0.67	5.12	5.12	0.69794	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.000000	0.85682	D	0.000000	D	0.84790	0.5550	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;0.973	D;P	0.79784	0.993;0.876	D	0.86368	0.1721	10	0.66056	D	0.02	-8.3824	18.9281	0.92553	0.0:1.0:0.0:0.0	.	580;553	E9PBP6;P55157	.;MTP_HUMAN	F	580;553;553	ENSP00000427679:S580F;ENSP00000400821:S553F;ENSP00000265517:S553F	ENSP00000265517:S553F	S	+	2	0	MTTP	100749046	1.000000	0.71417	0.971000	0.41717	0.824000	0.46624	7.357000	0.79456	2.532000	0.85374	0.655000	0.94253	TCC	MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.408	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	C			100530023	+1	no_errors	ENST00000265517	ensembl	human	known	70_37	missense	SNP	1.000	T
MUS81	80198	genome.wustl.edu	37	11	65629694	65629694	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr11:65629694C>T	ENST00000308110.4	+	5	812	c.463C>T	c.(463-465)Cac>Tac	p.H155Y	CFL1_ENST00000534769.1_5'Flank|MUS81_ENST00000533035.1_Missense_Mutation_p.H80Y|CFL1_ENST00000531413.1_5'Flank|CFL1_ENST00000525451.2_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	155	Interaction with BLM.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		TCCTAATGGTCACCACTTCTT	0.582								Homologous recombination																																									0													86.0	86.0	86.0					11																	65629694		2201	4297	6498	SO:0001583	missense	80198				CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.463C>T	11.37:g.65629694C>T	ENSP00000307853:p.His155Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H7D9	Missense_Mutation	SNP	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,superfamily_DNA-dir_DNA_pol_X_beta-like_N,smart_ERCC4_domain	p.H155Y	ENST00000308110.4	37	c.463	CCDS8115.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.011|0.011	-1.726599|-1.726599	0.00694|0.00694	.|.	.|.	ENSG00000172732|ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855;ENST00000525768|ENST00000529374;ENST00000530111	T;T;T|.	0.23147|.	2.54;2.77;1.92|.	4.45|4.45	1.25|1.25	0.21368|0.21368	.|.	0.768004|.	0.13044|.	N|.	0.418276|.	T|T	0.32376|0.32376	0.0827|0.0827	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	P|.	0.34412|.	0.453|.	B|.	0.24701|.	0.055|.	T|T	0.24835|0.24835	-1.0149|-1.0149	10|5	0.02654|.	T|.	1|.	-0.4907|-0.4907	5.9971|5.9971	0.19499|0.19499	0.1504:0.6505:0.0:0.1991|0.1504:0.6505:0.0:0.1991	.|.	155|.	Q96NY9|.	MUS81_HUMAN|.	Y|L	80;155;155;80|79;50	ENSP00000432287:H80Y;ENSP00000307853:H155Y;ENSP00000431478:H80Y|.	ENSP00000307853:H155Y|.	H|S	+|+	1|2	0|0	MUS81|MUS81	65386270|65386270	0.009000|0.009000	0.17119|0.17119	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	0.520000|0.520000	0.22878|0.22878	-0.164000|-0.164000	0.10927|0.10927	-1.134000|-1.134000	0.01955|0.01955	CAC|TCA	MUS81	-	NULL		0.582	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUS81	HGNC	protein_coding	OTTHUMT00000390941.3	C	NM_025128		65629694	+1	no_errors	ENST00000308110	ensembl	human	known	70_37	missense	SNP	0.006	T
MYO15A	51168	genome.wustl.edu	37	17	18023395	18023395	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr17:18023395C>T	ENST00000205890.5	+	2	1619	c.1281C>T	c.(1279-1281)caC>caT	p.H427H		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	427					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGTATGCCCACGCCATGGATG	0.667																																																	0													48.0	55.0	52.0					17																	18023395		2118	4219	6337	SO:0001819	synonymous_variant	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1281C>T	17.37:g.18023395C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFC7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.H427	ENST00000205890.5	37	c.1281	CCDS42271.1	17																																																																																			MYO15A	-	NULL		0.667	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	C	NM_016239		18023395	+1	no_errors	ENST00000205890	ensembl	human	known	70_37	silent	SNP	0.996	T
NEXN	91624	genome.wustl.edu	37	1	78408216	78408216	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr1:78408216C>G	ENST00000334785.7	+	13	1914	c.1730C>G	c.(1729-1731)aCc>aGc	p.T577S	NEXN_ENST00000457030.1_Missense_Mutation_p.T563S|NEXN_ENST00000330010.8_Missense_Mutation_p.T513S|FUBP1_ENST00000489495.1_5'Flank|NEXN_ENST00000480732.2_3'UTR	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		GAAGAGCAAACCAGATCAGGA	0.428																																																	0													91.0	92.0	92.0					1																	78408216		1916	4117	6033	SO:0001583	missense	91624			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.1730C>G	1.37:g.78408216C>G	ENSP00000333938:p.Thr577Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.T577S	ENST00000334785.7	37	c.1730	CCDS41351.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.375|9.375	1.071497|1.071497	0.20147|0.20147	.|.	.|.	ENSG00000162614|ENSG00000162614	ENST00000342754|ENST00000457030;ENST00000330010;ENST00000334785	.|T;T;T	.|0.59638	.|0.33;0.25;0.32	5.84|5.84	2.75|2.75	0.32379|0.32379	.|.	.|0.233113	.|0.29868	.|N	.|0.010994	T|T	0.16428|0.16428	0.0395|0.0395	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.10450	.|0.005;0.002;0.002	T|T	0.27331|0.27331	-1.0077|-1.0077	5|10	.|0.02654	.|T	.|1	0.1393|0.1393	10.3565|10.3565	0.43967|0.43967	0.0:0.6782:0.2507:0.0711|0.0:0.6782:0.2507:0.0711	.|.	.|563;577;513	.|Q0ZGT2-2;Q0ZGT2;B4DPZ7	.|.;NEXN_HUMAN;.	A|S	477|563;513;577	.|ENSP00000388048:T563S;ENSP00000327363:T513S;ENSP00000333938:T577S	.|ENSP00000327363:T513S	P|T	+|+	1|2	0|0	NEXN|NEXN	78180804|78180804	0.983000|0.983000	0.35010|0.35010	0.990000|0.990000	0.47175|0.47175	0.046000|0.046000	0.14306|0.14306	1.610000|1.610000	0.36869|0.36869	0.290000|0.290000	0.22444|0.22444	0.591000|0.591000	0.81541|0.81541	CCA|ACC	NEXN	-	NULL		0.428	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEXN	HGNC	protein_coding	OTTHUMT00000097549.1	C	NM_144573		78408216	+1	no_errors	ENST00000334785	ensembl	human	known	70_37	missense	SNP	1.000	G
NOVA1	4857	genome.wustl.edu	37	14	27066575	27066575	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:27066575G>A	ENST00000344429.5	-	1	71	c.68C>T	c.(67-69)cCg>cTg	p.P23L	NOVA1_ENST00000547619.1_Missense_Mutation_p.P23L|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000465357.2_Missense_Mutation_p.P23L|NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000551754.1_5'Flank|NOVA1_ENST00000574031.1_Missense_Mutation_p.P23L|NOVA1_ENST00000539517.2_Missense_Mutation_p.P23L	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	23					locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		CCGCGAGTCCGGCGGGTCCAG	0.662																																																	0													11.0	12.0	12.0					14																	27066575		2196	4284	6480	SO:0001583	missense	4857			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.68C>T	14.37:g.27066575G>A	ENSP00000342387:p.Pro23Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P23L	ENST00000344429.5	37	c.68	CCDS9635.1	14	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112931	0.37242	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000344429;ENST00000547619	T;T;T;T	0.52057	1.42;1.47;0.68;0.72	3.73	3.73	0.42828	.	0.000000	0.43416	D	0.000573	T	0.32556	0.0833	L	0.34521	1.04	0.80722	D	1	B;B;P	0.36249	0.181;0.272;0.545	B;B;B	0.17979	0.015;0.009;0.02	T	0.39375	-0.9617	10	0.54805	T	0.06	-0.9152	15.043	0.71805	0.0:0.0:1.0:0.0	.	23;23;23	P51513-2;D3DS81;P51513-4	.;.;.	L	23	ENSP00000447391:P23L;ENSP00000438875:P23L;ENSP00000342387:P23L;ENSP00000448157:P23L	ENSP00000342387:P23L	P	-	2	0	NOVA1	26136415	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	7.294000	0.78760	2.094000	0.63399	0.555000	0.69702	CCG	NOVA1	-	NULL		0.662	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	NOVA1	HGNC	protein_coding	OTTHUMT00000276557.1	G	NM_006491		27066575	-1	no_errors	ENST00000539517	ensembl	human	known	70_37	missense	SNP	1.000	A
NUFIP1	26747	genome.wustl.edu	37	13	45515443	45515443	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr13:45515443G>T	ENST00000379161.4	-	10	1432	c.1386C>A	c.(1384-1386)gaC>gaA	p.D462E		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	462					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		CATGTCGAATGTCCGGAGCTA	0.323																																																	0													59.0	55.0	56.0					13																	45515443		2203	4300	6503	SO:0001583	missense	26747			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1386C>A	13.37:g.45515443G>T	ENSP00000368459:p.Asp462Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D462E	ENST00000379161.4	37	c.1386	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938326	0.34189	.	.	ENSG00000083635	ENST00000379161	T	0.54279	0.58	5.37	2.58	0.30949	.	0.045768	0.85682	D	0.000000	T	0.61800	0.2376	L	0.60904	1.88	0.43714	D	0.996189	D	0.76494	0.999	D	0.76071	0.987	T	0.55704	-0.8099	10	0.30078	T	0.28	.	7.0875	0.25266	0.3068:0.0:0.6932:0.0	.	462	Q9UHK0	NUFP1_HUMAN	E	462	ENSP00000368459:D462E	ENSP00000368459:D462E	D	-	3	2	NUFIP1	44413443	1.000000	0.71417	0.998000	0.56505	0.477000	0.33069	1.608000	0.36847	0.288000	0.22398	-0.241000	0.12123	GAC	NUFIP1	-	NULL		0.323	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	G	NM_012345		45515443	-1	no_errors	ENST00000379161	ensembl	human	known	70_37	missense	SNP	1.000	T
NXF1	10482	genome.wustl.edu	37	11	62572855	62572855	+	5'UTR	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr11:62572855C>T	ENST00000532297.1	-	0	603				RP11-727F15.13_ENST00000596971.1_RNA|NXF1_ENST00000531131.1_5'UTR|NXF1_ENST00000531709.2_5'UTR|NXF1_ENST00000439713.2_5'UTR|NXF1_ENST00000294172.2_5'UTR			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGGGCGGGCTCAGGCGCTGGC	0.637																																																	0													41.0	36.0	37.0					11																	62572855		2201	4298	6499	SO:0001623	5_prime_UTR_variant	10482			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.-27G>A	11.37:g.62572855C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E269|Q99799|Q9UQL2	RNA	SNP	-	NULL	ENST00000532297.1	37	NULL	CCDS8037.1	11																																																																																			NXF1	-	-		0.637	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF1	HGNC	protein_coding	OTTHUMT00000395365.2	C	NM_006362		62572855	-1	no_errors	ENST00000526163	ensembl	human	known	70_37	rna	SNP	0.008	T
OFD1	8481	genome.wustl.edu	37	X	13778396	13778396	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chrX:13778396C>G	ENST00000340096.6	+	16	2144	c.1817C>G	c.(1816-1818)tCa>tGa	p.S606*	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Nonsense_Mutation_p.S566*|OFD1_ENST00000380567.1_Nonsense_Mutation_p.S466*	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	606					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						ATGGTTGCATCAAGGATCACA	0.428																																																	0													172.0	138.0	150.0					X																	13778396		2203	4300	6503	SO:0001587	stop_gained	8481			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1817C>G	X.37:g.13778396C>G	ENSP00000344314:p.Ser606*	Somatic		WXS	Illumina HiSeq	Phase_IV	B9ZVU5|O75666|Q4VAK4	Nonsense_Mutation	SNP	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.S606*	ENST00000340096.6	37	c.1817	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	.	45	11.896877	0.99615	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	.	.	.	5.55	4.67	0.58626	.	0.463335	0.22239	N	0.062720	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-0.707	14.5384	0.67976	0.0:0.8568:0.1432:0.0	.	.	.	.	X	566;606;466	.	ENSP00000344314:S606X	S	+	2	0	OFD1	13688317	0.186000	0.23225	0.002000	0.10522	0.046000	0.14306	2.300000	0.43620	1.104000	0.41587	0.529000	0.55759	TCA	OFD1	-	NULL		0.428	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	C	NM_003611		13778396	+1	no_errors	ENST00000340096	ensembl	human	known	70_37	nonsense	SNP	0.147	G
PAX9	5083	genome.wustl.edu	37	14	37135651	37135651	+	Intron	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:37135651C>T	ENST00000361487.6	+	3	856				PAX9_ENST00000557107.1_3'UTR|PAX9_ENST00000554201.1_Intron|PAX9_ENST00000402703.2_Intron			P55771	PAX9_HUMAN	paired box 9						cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		CTGACACCCTCTCTTCTCTCC	0.692																																																	0													13.0	14.0	14.0					14																	37135651		2195	4299	6494	SO:0001627	intron_variant	5083			AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.632-16C>T	14.37:g.37135651C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q99582|Q9UQR4	RNA	SNP	-	NULL	ENST00000361487.6	37	NULL	CCDS9662.1	14																																																																																			PAX9	-	-		0.692	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX9	HGNC	protein_coding	OTTHUMT00000276733.2	C			37135651	+1	no_errors	ENST00000557107	ensembl	human	known	70_37	rna	SNP	0.000	T
PCDHB8	56128	genome.wustl.edu	37	5	140558959	140558959	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:140558959C>T	ENST00000239444.2	+	1	1589	c.1344C>T	c.(1342-1344)aaC>aaT	p.N448N	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N448N(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAATGACAACGCCCCCGCCT	0.592																																																	1	Substitution - coding silent(1)	large_intestine(1)											163.0	209.0	193.0					5																	140558959		2203	4300	6503	SO:0001819	synonymous_variant	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1344C>T	5.37:g.140558959C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N448	ENST00000239444.2	37	c.1344	CCDS4250.1	5																																																																																			PCDHB8	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.592	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	C	NM_019120		140558959	+1	no_errors	ENST00000239444	ensembl	human	known	70_37	silent	SNP	0.994	T
PCDH1	5097	genome.wustl.edu	37	5	141236899	141236899	+	Silent	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:141236899G>A	ENST00000287008.3	-	4	3384	c.3237C>T	c.(3235-3237)ctC>ctT	p.L1079L	PCDH1_ENST00000503492.1_Silent_p.L347L	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CCAGGGGACCGAGTCGAGGCC	0.622																																					Ovarian(132;1609 1739 4190 14731 45037)												0													78.0	70.0	73.0					5																	141236899		2203	4300	6503	SO:0001819	synonymous_variant	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3237C>T	5.37:g.141236899G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IUP2	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1079	ENST00000287008.3	37	c.3237	CCDS4267.1	5																																																																																			PCDH1	-	NULL		0.622	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000320587.2	G	NM_032420		141236899	-1	no_errors	ENST00000287008	ensembl	human	known	70_37	silent	SNP	0.089	A
PEAR1	375033	genome.wustl.edu	37	1	156879698	156879698	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr1:156879698C>T	ENST00000338302.3	+	13	1792	c.1567C>T	c.(1567-1569)Ccc>Tcc	p.P523S	PEAR1_ENST00000292357.7_Missense_Mutation_p.P523S			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	523					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGCCAGCTGCCCTGTCCGGT	0.662																																																	0													39.0	40.0	40.0					1																	156879698		2203	4300	6503	SO:0001583	missense	375033			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1567C>T	1.37:g.156879698C>T	ENSP00000344465:p.Pro523Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.P523S	ENST00000338302.3	37	c.1567	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139898	0.37728	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.75154	-0.91;-0.91	5.05	4.14	0.48551	EGF-like region, conserved site (1);	0.000000	0.49305	D	0.000153	T	0.46502	0.1396	N	0.21508	0.67	0.40442	D	0.980055	P	0.48503	0.911	B	0.42112	0.376	T	0.49143	-0.8970	10	0.32370	T	0.25	.	11.2201	0.48848	0.0:0.9111:0.0:0.0889	.	523	Q5VY43	PEAR1_HUMAN	S	523	ENSP00000344465:P523S;ENSP00000292357:P523S	ENSP00000292357:P523S	P	+	1	0	PEAR1	155146322	0.944000	0.32072	0.995000	0.50966	0.683000	0.39861	2.364000	0.44187	1.359000	0.45940	0.561000	0.74099	CCC	PEAR1	-	superfamily_Growth_fac_rcpt,smart_EGF_laminin		0.662	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	C	NM_001080471		156879698	+1	no_errors	ENST00000292357	ensembl	human	known	70_37	missense	SNP	0.964	T
PIP5K1C	23396	genome.wustl.edu	37	19	3653299	3653299	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:3653299G>A	ENST00000335312.3	-	7	998	c.910C>T	c.(910-912)Cgg>Tgg	p.R304W	PIP5K1C_ENST00000589578.1_Missense_Mutation_p.R304W|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.R304W|PIP5K1C_ENST00000587482.1_5'UTR|PIP5K1C_ENST00000537021.1_Missense_Mutation_p.R304W	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	304	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.R304W(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		AGGCAGTCCCGCTGCAGCGTC	0.706																																					Esophageal Squamous(135;99 1744 12852 27186 39851)												1	Substitution - Missense(1)	stomach(1)											32.0	24.0	27.0					19																	3653299		2202	4290	6492	SO:0001583	missense	23396			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.910C>T	19.37:g.3653299G>A	ENSP00000335333:p.Arg304Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.R304W	ENST00000335312.3	37	c.910	CCDS32872.1	19	.	.	.	.	.	.	.	.	.	.	G	15.65	2.897628	0.52121	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.38077	1.16;1.16;1.16	4.57	3.5	0.40072	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	H	0.97103	3.94	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.79784	0.968;0.993	T	0.79398	-0.1820	10	0.87932	D	0	-20.7707	11.5951	0.50968	0.0:0.0:0.7132:0.2867	.	304;304	O60331-3;O60331	.;PI51C_HUMAN	W	304	ENSP00000335333:R304W;ENSP00000445992:R304W;ENSP00000444779:R304W	ENSP00000335333:R304W	R	-	1	2	PIP5K1C	3604299	1.000000	0.71417	0.999000	0.59377	0.409000	0.31022	2.509000	0.45459	2.075000	0.62263	0.491000	0.48974	CGG	PIP5K1C	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub		0.706	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIP5K1C	HGNC	protein_coding	OTTHUMT00000453432.2	G	NM_012398		3653299	-1	no_errors	ENST00000537021	ensembl	human	known	70_37	missense	SNP	1.000	A
PLEKHG4	25894	genome.wustl.edu	37	16	67322304	67322304	+	Splice_Site	SNP	G	G	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:67322304G>T	ENST00000360461.5	+	19	5989		c.e19+1		PLEKHG4_ENST00000379344.3_Splice_Site|PLEKHG4_ENST00000450733.1_Splice_Site|PLEKHG4_ENST00000427155.2_Splice_Site	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4								Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CCCTCTTTGAGTATGTCTGGG	0.637																																																	0													43.0	46.0	45.0					16																	67322304		2198	4300	6498	SO:0001630	splice_region_variant	25894			AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.3454+1G>T	16.37:g.67322304G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Splice_Site	SNP	-	e19+1	ENST00000360461.5	37	c.3454+1	CCDS32466.1	16	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743787	0.69418	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0105	0.86405	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHG4	65879805	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.184000	0.94893	2.243000	0.73865	0.462000	0.41574	.	PLEKHG4	-	-		0.637	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4	HGNC	protein_coding	OTTHUMT00000421395.2	G	NM_015432	Intron	67322304	+1	no_errors	ENST00000360461	ensembl	human	known	70_37	splice_site	SNP	1.000	T
PLG	5340	genome.wustl.edu	37	6	161134305	161134306	+	Intron	INS	-	-	T	rs113752311|rs140653624|rs528521448	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:161134305_161134306insT	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTAACCTGAAttttttttttt	0.436																																																	0																																										SO:0001627	intron_variant	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+148->T	6.37:g.161134316_161134316dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15146|Q5TEH4|Q6PA00	RNA	INS	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			PLG	-	-		0.436	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	-	NM_000301		161134306	+1	no_errors	ENST00000462918	ensembl	human	known	70_37	rna	INS	0.002:0.003	T
PRDM9	56979	genome.wustl.edu	37	5	23509156	23509156	+	Missense_Mutation	SNP	A	A	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:23509156A>T	ENST00000296682.3	+	2	196	c.14A>T	c.(13-15)aAg>aTg	p.K5M		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	5					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGCCCTGAAAAGTCCCAAGAG	0.567										HNSCC(3;0.000094)																																							0													75.0	79.0	78.0					5																	23509156		1897	4132	6029	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.14A>T	5.37:g.23509156A>T	ENSP00000296682:p.Lys5Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.K5M	ENST00000296682.3	37	c.14	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	6.390	0.440080	0.12104	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.10960	2.82;2.97	1.88	-3.08	0.05347	.	.	.	.	.	T	0.07413	0.0187	L	0.29908	0.895	0.09310	N	1	B	0.28713	0.22	B	0.30855	0.121	T	0.31052	-0.9957	9	0.87932	D	0	.	4.9679	0.14100	0.4728:0.1553:0.3719:0.0	.	5	Q9NQV7	PRDM9_HUMAN	M	5	ENSP00000425471:K5M;ENSP00000296682:K5M	ENSP00000296682:K5M	K	+	2	0	PRDM9	23544913	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.515000	0.06290	-1.577000	0.01650	-1.299000	0.01334	AAG	PRDM9	-	NULL		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	A	NM_020227		23509156	+1	no_errors	ENST00000296682	ensembl	human	known	70_37	missense	SNP	0.000	T
PSMB9	5698	genome.wustl.edu	37	6	32822041	32822041	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:32822041C>T	ENST00000374859.2	+	1	104	c.35C>T	c.(34-36)cCc>cTc	p.P12L	PSMB9_ENST00000453265.2_Missense_Mutation_p.P12L|PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000354258.4_5'Flank|TAP1_ENST00000425148.2_5'Flank	NM_002800.4	NP_002791.1	P28065	PSB9_HUMAN	proteasome (prosome, macropain) subunit, beta type, 9	12					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			large_intestine(4)|lung(4)|skin(1)	9					Carfilzomib(DB08889)	GGGGACTTACCCCGGGCGGGA	0.692																																																	0													10.0	8.0	9.0					6																	32822041		1455	2629	4084	SO:0001583	missense	5698				CCDS4759.1	6p21.3	2013-03-27	2013-03-27		ENSG00000240065	ENSG00000240065		"""Proteasome (prosome, macropain) subunits"""	9546	protein-coding gene	gene with protein product		177045	"""proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2)"", ""large multifunctional peptidase 2"""	LMP2		1922385, 1529427	Standard	NM_002800		Approved	RING12, beta1i, PSMB6i	uc003sga.3	P28065	OTTHUMG00000031287	ENST00000374859.2:c.35C>T	6.37:g.32822041C>T	ENSP00000363993:p.Pro12Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B0V0T1|Q16523|Q5JNW4	Missense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.P12L	ENST00000374859.2	37	c.35	CCDS4759.1	6	.	.	.	.	.	.	.	.	.	.	C	9.742	1.165137	0.21538	.	.	ENSG00000240065	ENST00000374859;ENST00000453265;ENST00000395333	T;T	0.36520	1.68;1.25	4.97	4.09	0.47781	.	0.874843	0.09789	N	0.755639	T	0.04770	0.0129	N	0.04018	-0.295	0.09310	N	1	B	0.15141	0.012	B	0.15484	0.013	T	0.37430	-0.9706	10	0.06757	T	0.87	-9.6751	8.3124	0.32080	0.0:0.8909:0.0:0.1091	.	12	B4DZW2	.	L	12	ENSP00000363993:P12L;ENSP00000394773:P12L	ENSP00000363993:P12L	P	+	2	0	PSMB9	32930019	0.003000	0.15002	0.006000	0.13384	0.883000	0.51084	1.338000	0.33873	1.288000	0.44600	0.579000	0.79373	CCC	PSMB9	-	NULL		0.692	PSMB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB9	HGNC	protein_coding	OTTHUMT00000076624.5	C	NM_002800		32822041	+1	no_errors	ENST00000374859	ensembl	human	known	70_37	missense	SNP	0.004	T
PSTPIP1	9051	genome.wustl.edu	37	15	77320166	77320166	+	Intron	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr15:77320166C>T	ENST00000558012.1	+	6	843				PSTPIP1_ENST00000379595.3_Intron|PSTPIP1_ENST00000267939.5_Intron|PSTPIP1_ENST00000559295.1_Intron	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1						cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						CCGCGGCCCTCGGCTCAGAAC	0.652																																																	0													14.0	17.0	16.0					15																	77320166		1905	4067	5972	SO:0001627	intron_variant	9051			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.355-27C>T	15.37:g.77320166C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	pfam_FCH,superfamily_Prismane-like,smart_FCH,pfscan_FCH	p.S127L	ENST00000558012.1	37	c.380	CCDS45312.1	15																																																																																			PSTPIP1	-	NULL		0.652	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTPIP1	HGNC	protein_coding	OTTHUMT00000419373.2	C	NM_003978		77320166	+1	no_errors	ENST00000559750	ensembl	human	known	70_37	missense	SNP	0.289	T
PTPN13	5783	genome.wustl.edu	37	4	87653625	87653625	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:87653625C>G	ENST00000411767.2	+	11	1744	c.1681C>G	c.(1681-1683)Ctt>Gtt	p.L561V	PTPN13_ENST00000316707.6_Missense_Mutation_p.L561V|PTPN13_ENST00000436978.1_Missense_Mutation_p.L561V|PTPN13_ENST00000427191.2_Missense_Mutation_p.L561V|PTPN13_ENST00000511467.1_Missense_Mutation_p.L561V			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	561					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ACGGTCTATTCTTGTAAGTAA	0.294																																																	0													52.0	47.0	49.0					4																	87653625		1796	4059	5855	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1681C>G	4.37:g.87653625C>G	ENSP00000407249:p.Leu561Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L561V	ENST00000411767.2	37	c.1681	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	12.94	2.086995	0.36855	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.48201	0.82;0.86;0.87;0.83;0.86	5.79	5.79	0.91817	.	0.000000	0.39475	N	0.001349	T	0.36331	0.0963	N	0.10945	0.07	0.37653	D	0.922492	P;D;D;D	0.69078	0.715;0.991;0.985;0.997	P;P;P;P	0.59643	0.553;0.853;0.625;0.861	T	0.42548	-0.9445	10	0.05959	T	0.93	.	7.6018	0.28079	0.0:0.8056:0.0:0.1944	.	561;561;561;561	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	V	561;561;561;561;561;529	ENSP00000408368:L561V;ENSP00000394794:L561V;ENSP00000322675:L561V;ENSP00000407249:L561V;ENSP00000426626:L561V	ENSP00000322675:L561V	L	+	1	0	PTPN13	87872649	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	2.169000	0.42434	2.725000	0.93324	0.557000	0.71058	CTT	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13		0.294	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	C			87653625	+1	no_errors	ENST00000436978	ensembl	human	known	70_37	missense	SNP	1.000	G
RABIF	5877	genome.wustl.edu	37	1	202858203	202858203	+	Silent	SNP	G	G	A	rs142176614	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr1:202858203G>A	ENST00000367262.3	-	1	60	c.24C>T	c.(22-24)agC>agT	p.S8S		NM_002871.4	NP_002862.2	P47224	MSS4_HUMAN	RAB interacting factor	8					membrane fusion (GO:0061025)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(75;0.166)			ACACTAACTCGCTCGGCTGCT	0.682																																																	0													29.0	29.0	29.0					1																	202858203		2203	4298	6501	SO:0001819	synonymous_variant	5877			S78873	CCDS1428.1	1q32.1	2008-05-14			ENSG00000183155	ENSG00000183155			9797	protein-coding gene	gene with protein product		603417		RASGRF3		9441742, 7619808	Standard	NM_002871		Approved	mss4	uc001gyl.3	P47224	OTTHUMG00000041400	ENST00000367262.3:c.24C>T	1.37:g.202858203G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4P4|Q92992	Silent	SNP	pfam_Mss4,superfamily_Mss4-like	p.S8	ENST00000367262.3	37	c.24	CCDS1428.1	1																																																																																			RABIF	-	NULL		0.682	RABIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABIF	HGNC	protein_coding	OTTHUMT00000099183.1	G			202858203	-1	no_errors	ENST00000367262	ensembl	human	known	70_37	silent	SNP	0.829	A
RBFOX1	54715	genome.wustl.edu	37	16	7760713	7760713	+	Missense_Mutation	SNP	A	A	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:7760713A>G	ENST00000550418.1	+	16	2148	c.1160A>G	c.(1159-1161)tAc>tGc	p.Y387C	RBFOX1_ENST00000547372.1_3'UTR|RBFOX1_ENST00000552089.1_3'UTR|RBFOX1_ENST00000340209.4_Missense_Mutation_p.Y392C|RBFOX1_ENST00000355637.4_3'UTR|RBFOX1_ENST00000547338.1_Missense_Mutation_p.Y387C|RBFOX1_ENST00000311745.5_Missense_Mutation_p.Y408C|RBFOX1_ENST00000436368.2_Missense_Mutation_p.Y382C|RBFOX1_ENST00000553186.1_Missense_Mutation_p.Y360C	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	387					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GCTAGTATATACCGAGGGGGA	0.448																																					Ovarian(157;934 2567 15163 39509)												0													185.0	163.0	171.0					16																	7760713		2197	4300	6497	SO:0001583	missense	54715			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.1160A>G	16.37:g.7760713A>G	ENSP00000450031:p.Tyr387Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.Y408C	ENST00000550418.1	37	c.1223	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	A	11.70	1.717321	0.30413	.	.	ENSG00000078328	ENST00000550418;ENST00000553186;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000352951;ENST00000340209	T;T;T;T;T;T	0.38401	1.14;1.3;1.14;1.23;1.2;1.15	5.95	5.95	0.96441	.	0.060595	0.64402	D	0.000002	T	0.42337	0.1198	N	0.14661	0.345	0.80722	D	1	D;B;P;B;B	0.76494	0.999;0.028;0.482;0.074;0.076	D;B;B;B;B	0.65443	0.935;0.016;0.222;0.072;0.071	T	0.39354	-0.9618	10	0.38643	T	0.18	-7.3233	16.4221	0.83766	1.0:0.0:0.0:0.0	.	381;408;382;360;387	F8WAC5;Q9NWB1-2;Q9NWB1-4;Q9NWB1-3;Q9NWB1	.;.;.;.;RFOX1_HUMAN	C	387;360;387;382;408;381;392	ENSP00000450031:Y387C;ENSP00000447753:Y360C;ENSP00000447717:Y387C;ENSP00000402745:Y382C;ENSP00000309117:Y408C;ENSP00000344196:Y392C	ENSP00000309117:Y408C	Y	+	2	0	RBFOX1	7700714	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.535000	0.90623	2.283000	0.76528	0.496000	0.49642	TAC	RBFOX1	-	NULL		0.448	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	HGNC	protein_coding	OTTHUMT00000409492.2	A	NM_145891		7760713	+1	no_errors	ENST00000311745	ensembl	human	known	70_37	missense	SNP	1.000	G
RSPH10B2	728194	genome.wustl.edu	37	7	6797357	6797357	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:6797357C>T	ENST00000403107.1	+	2	436	c.49C>T	c.(49-51)Cgc>Tgc	p.R17C	RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.R17C|RSPH10B2_ENST00000433859.2_Missense_Mutation_p.R17C|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.R17C			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	17										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GAAGTCTGCCCGCTCTCCCTC	0.443																																																	0																																										SO:0001583	missense	728194				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.49C>T	7.37:g.6797357C>T	ENSP00000384766:p.Arg17Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.R17C	ENST00000403107.1	37	c.49	CCDS43552.1	7	.	.	.	.	.	.	.	.	.	.	C	8.174	0.792432	0.16258	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000418406;ENST00000297186;ENST00000433859	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	2.65	2.65	0.31530	.	0.983418	0.08298	N	0.967412	T	0.43700	0.1259	L	0.31926	0.97	0.80722	D	1	B	0.17465	0.022	B	0.12156	0.007	T	0.35674	-0.9779	10	0.54805	T	0.06	.	11.0959	0.48143	0.0:1.0:0.0:0.0	.	17	B2RC85	R10B2_HUMAN	C	17	ENSP00000384766:R17C;ENSP00000386102:R17C;ENSP00000297186:R17C;ENSP00000416710:R17C	ENSP00000297186:R17C	R	+	1	0	RSPH10B2	6763882	0.001000	0.12720	0.922000	0.36590	0.193000	0.23685	0.191000	0.17076	1.494000	0.48533	0.392000	0.25879	CGC	RSPH10B2	-	NULL		0.443	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B2	HGNC	protein_coding	OTTHUMT00000324184.4	C	NM_001099697		6797357	+1	no_errors	ENST00000297186	ensembl	human	known	70_37	missense	SNP	0.965	T
HNRNPH3	3189	genome.wustl.edu	37	10	70103367	70103367	+	IGR	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr10:70103367C>T	ENST00000265866.7	+	0	2339				RUFY2_ENST00000388768.2_3'UTR	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)						epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						TTCCCTGGCACCATGATAGCA	0.299																																																	0																																										SO:0001628	intergenic_variant	55680				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349		10.37:g.70103367C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	RNA	SNP	-	NULL	ENST00000265866.7	37	NULL	CCDS7278.1	10																																																																																			RUFY2	-	-		0.299	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	RUFY2	HGNC	protein_coding	OTTHUMT00000090165.1	C			70103367	-1	no_errors	ENST00000466187	ensembl	human	known	70_37	rna	SNP	1.000	T
SCN7A	6332	genome.wustl.edu	37	2	167328850	167328850	+	Silent	SNP	G	G	A	rs376920778		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:167328850G>A	ENST00000409855.1	-	5	675	c.549C>T	c.(547-549)ctC>ctT	p.L183L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	183					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CGCTGAAATCGAGCCAGTTCC	0.353													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17577	0.0		0.0	False		,,,				2504	0.0																0								G		1,3779		0,1,1889	47.0	47.0	47.0		549	-10.7	0.4	2		47	0,8300		0,0,4150	no	coding-synonymous	SCN7A	NM_002976.3		0,1,6039	AA,AG,GG		0.0,0.0265,0.0083		183/1683	167328850	1,12079	1890	4150	6040	SO:0001819	synonymous_variant	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.549C>T	2.37:g.167328850G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L183	ENST00000409855.1	37	c.549	CCDS46442.1	2																																																																																			SCN7A	-	pfam_Ion_trans_dom		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	G			167328850	-1	no_errors	ENST00000409855	ensembl	human	known	70_37	silent	SNP	0.482	A
SH3BP2	6452	genome.wustl.edu	37	4	2831494	2831494	+	Silent	SNP	C	C	T	rs376641544		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:2831494C>T	ENST00000356331.5	+	8	1122	c.861C>T	c.(859-861)acC>acT	p.T287T	SH3BP2_ENST00000452765.2_Silent_p.T287T|SH3BP2_ENST00000442312.2_Silent_p.T315T|SH3BP2_ENST00000435136.2_Silent_p.T287T|SH3BP2_ENST00000511747.1_Silent_p.T287T|SH3BP2_ENST00000503393.2_Silent_p.T344T	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	287					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		CCATGCCCACCGCACCCGGCC	0.706									Cherubism																																								0								C	,,,	1,4405	2.1+/-5.4	0,1,2202	38.0	42.0	41.0		861,945,1032,861	-10.3	0.0	4		41	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SH3BP2	NM_001122681.1,NM_001145855.1,NM_001145856.1,NM_003023.4	,,,	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	,,,	287/562,315/590,344/619,287/562	2831494	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	6452	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.861C>T	4.37:g.2831494C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Silent	SNP	pfam_Pleckstrin_homology,pfam_SH2,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_SH2	p.T344	ENST00000356331.5	37	c.1032	CCDS33944.1	4																																																																																			SH3BP2	-	NULL		0.706	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	SH3BP2	HGNC	protein_coding	OTTHUMT00000362406.2	C	NM_003023		2831494	+1	no_errors	ENST00000503393	ensembl	human	known	70_37	silent	SNP	0.000	T
SLC1A2	6506	genome.wustl.edu	37	11	35323113	35323113	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr11:35323113G>C	ENST00000278379.3	-	6	1092	c.810C>G	c.(808-810)ttC>ttG	p.F270L	SLC1A2_ENST00000606205.1_Missense_Mutation_p.F270L|SLC1A2_ENST00000395750.1_Missense_Mutation_p.F261L|SLC1A2_ENST00000395753.1_Missense_Mutation_p.F261L	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	270				AKLMVDFFNILNEIVMKLVIMIMWYSP -> GQADGGFLQH FERDCNEVSDHDHVVLS (in Ref. 3; CAA83532). {ECO:0000305}.	adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			TCAAAATGTTGAAGAAATCCA	0.428																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)												0													154.0	128.0	137.0					11																	35323113		2202	4298	6500	SO:0001583	missense	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.810C>G	11.37:g.35323113G>C	ENSP00000278379:p.Phe270Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.F270L	ENST00000278379.3	37	c.810	CCDS31459.1	11	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888862	0.91814	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753	T;T;T	0.58060	0.36;0.36;0.36	5.4	5.4	0.78164	.	0.150127	0.64402	D	0.000004	T	0.73265	0.3565	M	0.70903	2.155	0.80722	D	1	D;D	0.89917	0.965;1.0	P;D	0.97110	0.893;1.0	T	0.75147	-0.3420	10	0.62326	D	0.03	-19.9008	19.1734	0.93590	0.0:0.0:1.0:0.0	.	270;270	B4DQE9;P43004	.;EAA2_HUMAN	L	270;261;261	ENSP00000278379:F270L;ENSP00000379099:F261L;ENSP00000379102:F261L	ENSP00000278379:F270L	F	-	3	2	SLC1A2	35279689	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	7.927000	0.87577	2.539000	0.85634	0.561000	0.74099	TTC	SLC1A2	-	pfam_Na-dicarboxylate_symporter		0.428	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	HGNC	protein_coding	OTTHUMT00000258181.1	G	NM_004171		35323113	-1	no_errors	ENST00000278379	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC25A16	8034	genome.wustl.edu	37	10	70243298	70243298	+	Missense_Mutation	SNP	C	C	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr10:70243298C>A	ENST00000609923.1	-	9	988	c.890G>T	c.(889-891)cGa>cTa	p.R297L	SLC25A16_ENST00000265870.3_5'UTR|SLC25A16_ENST00000539557.1_Missense_Mutation_p.R199L	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	297					coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						GAGTCCTTTTCGAATTCCATG	0.383																																																	0													156.0	153.0	154.0					10																	70243298		2203	4300	6503	SO:0001583	missense	8034			M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.890G>T	10.37:g.70243298C>A	ENSP00000476815:p.Arg297Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N2U1	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Graves_DC,prints_Mit_carrier	p.R297L	ENST00000609923.1	37	c.890	CCDS7280.1	10	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778435	0.49786	.	.	ENSG00000122912	ENST00000265870;ENST00000539557	T;T	0.78707	-1.2;-1.2	5.67	4.75	0.60458	Mitochondrial carrier domain (2);	0.060409	0.64402	D	0.000003	T	0.75347	0.3837	M	0.74467	2.265	0.50467	D	0.999877	B	0.23540	0.087	B	0.23574	0.047	T	0.69811	-0.5044	10	0.12430	T	0.62	-9.3668	15.016	0.71584	0.0:0.9306:0.0:0.0694	.	297	P16260	GDC_HUMAN	L	297;199	ENSP00000265870:R297L;ENSP00000443914:R199L	ENSP00000265870:R297L	R	-	2	0	SLC25A16	69913304	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	3.061000	0.49963	2.682000	0.91365	0.555000	0.69702	CGA	SLC25A16	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Graves_DC		0.383	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A16	HGNC	protein_coding	OTTHUMT00000048347.2	C			70243298	-1	no_errors	ENST00000265870	ensembl	human	known	70_37	missense	SNP	0.997	A
SLC25A47	283600	genome.wustl.edu	37	14	100792566	100792566	+	Splice_Site	SNP	G	G	A	rs367820954		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr14:100792566G>A	ENST00000361529.3	+	3	222		c.e3+1		SLC25A47_ENST00000557052.1_Splice_Site	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						CCGAGAGCGCGTAGGTCTGGG	0.657																																					GBM(11;1289 1351)												0													45.0	38.0	40.0					14																	100792566		2203	4300	6503	SO:0001630	splice_region_variant	283600				CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.144+1G>A	14.37:g.100792566G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP39|Q68CL2|Q6PZD8|Q86U14	Splice_Site	SNP	-	e3+1	ENST00000361529.3	37	c.144+1	CCDS9959.1	14	.	.	.	.	.	.	.	.	.	.	G	12.81	2.049572	0.36181	.	.	ENSG00000140107	ENST00000361529	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7221	0.88355	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC25A47	99862319	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	5.803000	0.69129	2.709000	0.92574	0.511000	0.50034	.	SLC25A47	-	-		0.657	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A47	HGNC	protein_coding	OTTHUMT00000414231.1	G		Intron	100792566	+1	no_errors	ENST00000361529	ensembl	human	known	70_37	splice_site	SNP	1.000	A
SLC35F3	148641	genome.wustl.edu	37	1	234444857	234444857	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr1:234444857C>T	ENST00000366617.3	+	3	640	c.412C>T	c.(412-414)Cga>Tga	p.R138*	SLC35F3_ENST00000366618.3_Nonsense_Mutation_p.R207*|MIR4671_ENST00000583284.1_RNA			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	138					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GGAATGCTGTCGATTTTTTGG	0.383																																																	0													107.0	98.0	101.0					1																	234444857		2203	4300	6503	SO:0001587	stop_gained	148641				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.412C>T	1.37:g.234444857C>T	ENSP00000355576:p.Arg138*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TDD6|Q8N9C9	Nonsense_Mutation	SNP	pfam_DMT,pfam_DUF250,pfam_DUF914_euk	p.R207*	ENST00000366617.3	37	c.619		1	.	.	.	.	.	.	.	.	.	.	C	38	6.960817	0.97964	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	.	.	.	5.64	4.71	0.59529	.	0.054850	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.5892	11.3947	0.49834	0.1421:0.7212:0.1367:0.0	.	.	.	.	X	207;138	.	ENSP00000355576:R138X	R	+	1	2	SLC35F3	232511480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.703000	0.47110	1.355000	0.45865	0.655000	0.94253	CGA	SLC35F3	-	NULL		0.383	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000128322.1	C	NM_173508		234444857	+1	no_errors	ENST00000366618	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SLC46A2	57864	genome.wustl.edu	37	9	115652031	115652031	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr9:115652031C>T	ENST00000374228.4	-	1	1162	c.931G>A	c.(931-933)Gag>Aag	p.E311K		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	311					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						CCGAGAGGCTCCCTCAGCACA	0.552																																																	0													114.0	105.0	108.0					9																	115652031		2203	4300	6503	SO:0001583	missense	57864			AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.931G>A	9.37:g.115652031C>T	ENSP00000363345:p.Glu311Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALK1|Q86VT0|Q96NE2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Tet-R_TetA/multi-R_MdtG	p.E311K	ENST00000374228.4	37	c.931	CCDS6786.1	9	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202095	0.58234	.	.	ENSG00000119457	ENST00000374228	T	0.57907	0.37	5.66	5.66	0.87406	Major facilitator superfamily domain, general substrate transporter (1);	0.531595	0.21208	N	0.078357	T	0.43787	0.1263	L	0.50333	1.59	0.49687	D	0.999811	B	0.30763	0.294	B	0.31614	0.133	T	0.25882	-1.0119	10	0.06625	T	0.88	-15.8422	12.7305	0.57195	0.0:0.9243:0.0:0.0757	.	311	Q9BY10	TSCOT_HUMAN	K	311	ENSP00000363345:E311K	ENSP00000363345:E311K	E	-	1	0	SLC46A2	114691852	0.945000	0.32115	0.992000	0.48379	0.995000	0.86356	0.944000	0.29043	2.683000	0.91414	0.555000	0.69702	GAG	SLC46A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.552	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC46A2	HGNC	protein_coding	OTTHUMT00000053702.1	C	NM_033051		115652031	-1	no_errors	ENST00000374228	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC7A2	6542	genome.wustl.edu	37	8	17401053	17401053	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr8:17401053G>A	ENST00000494857.1	+	3	423	c.205G>A	c.(205-207)Gtg>Atg	p.V69M	SLC7A2_ENST00000522656.1_Missense_Mutation_p.V69M|SLC7A2_ENST00000398090.3_Missense_Mutation_p.V109M|SLC7A2_ENST00000004531.10_Missense_Mutation_p.V109M|SLC7A2_ENST00000470360.1_Missense_Mutation_p.V109M	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2	69					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCCAGCATCGTGGTGTCCTT	0.612																																																	0													66.0	54.0	58.0					8																	17401053		2203	4300	6503	SO:0001583	missense	6542			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.205G>A	8.37:g.17401053G>A	ENSP00000419140:p.Val69Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	pfam_AA-permease_dom,tigrfam_Cat_AA_permease	p.V109M	ENST00000494857.1	37	c.325	CCDS34852.1	8	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814490	0.70912	.	.	ENSG00000003989	ENST00000494857;ENST00000522656;ENST00000470360;ENST00000004531;ENST00000398090	D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61	5.64	4.77	0.60923	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.91971	0.7457	L	0.60845	1.875	0.58432	D	0.999997	D;D;D	0.63880	0.993;0.988;0.989	P;P;P	0.62649	0.802;0.572;0.905	D	0.92416	0.5941	10	0.66056	D	0.02	.	12.8721	0.57970	0.1352:0.0:0.8648:0.0	.	109;109;69	P52569-3;P52569-2;P52569	.;.;CTR2_HUMAN	M	69;69;109;109;109	ENSP00000419140:V69M;ENSP00000430464:V69M;ENSP00000419873:V109M;ENSP00000004531:V109M;ENSP00000381164:V109M	ENSP00000004531:V109M	V	+	1	0	SLC7A2	17445432	1.000000	0.71417	0.098000	0.21074	0.748000	0.42578	7.933000	0.87642	1.542000	0.49330	0.655000	0.94253	GTG	SLC7A2	-	pfam_AA-permease_dom,tigrfam_Cat_AA_permease		0.612	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	HGNC	protein_coding	OTTHUMT00000253367.3	G	NM_003046		17401053	+1	no_errors	ENST00000004531	ensembl	human	known	70_37	missense	SNP	0.960	A
SMARCC2	6601	genome.wustl.edu	37	12	56558435	56558435	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr12:56558435C>T	ENST00000267064.4	-	27	3306	c.3220G>A	c.(3220-3222)Gcg>Acg	p.A1074T	SMARCC2_ENST00000347471.4_Missense_Mutation_p.A1105T|SMARCC2_ENST00000394023.3_Missense_Mutation_p.A1105T|SMARCC2_ENST00000550164.1_Missense_Mutation_p.A1105T|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1074	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GCATTACCCGCCACGCCTGGG	0.577																																																	0													45.0	44.0	44.0					12																	56558435		2202	4300	6502	SO:0001583	missense	6601			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3220G>A	12.37:g.56558435C>T	ENSP00000267064:p.Ala1074Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.A1074T	ENST00000267064.4	37	c.3220	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022535	0.54683	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.47177	1.13;0.85;0.87;0.85	4.67	4.67	0.58626	.	0.179410	0.36034	N	0.002833	T	0.35128	0.0921	N	0.19112	0.55	0.37604	D	0.92066	P;P;P;P;P	0.38800	0.516;0.648;0.516;0.516;0.648	B;B;B;B;B	0.40285	0.173;0.325;0.173;0.173;0.325	T	0.34004	-0.9846	10	0.34782	T	0.22	-10.2821	13.037	0.58877	0.0:0.8369:0.1631:0.0	.	994;1105;1109;1074;1105	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	T	1105;1105;1105;1074	ENSP00000377591:A1105T;ENSP00000449396:A1105T;ENSP00000302919:A1105T;ENSP00000267064:A1074T	ENSP00000267064:A1074T	A	-	1	0	SMARCC2	54844702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.240000	0.43088	2.528000	0.85240	0.557000	0.71058	GCG	SMARCC2	-	NULL		0.577	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	C			56558435	-1	no_errors	ENST00000267064	ensembl	human	known	70_37	missense	SNP	1.000	T
SMO	6608	genome.wustl.edu	37	7	128845480	128845480	+	Silent	SNP	G	G	A	rs373730958		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:128845480G>A	ENST00000249373.3	+	4	1057	c.777G>A	c.(775-777)tcG>tcA	p.S259S		NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	259					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	GGCGGAACTCGAATCGCTACC	0.542			Mis		skin basal cell																																			Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0								G		0,4406		0,0,2203	114.0	110.0	111.0		777	-11.3	0.2	7		111	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SMO	NM_005631.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		259/788	128845480	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6608			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.777G>A	7.37:g.128845480G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1K5	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,pfam_GPCR_2_secretin-like,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S259	ENST00000249373.3	37	c.777	CCDS5811.1	7																																																																																			SMO	-	pfam_Frizzled,pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.542	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMO	HGNC	protein_coding	OTTHUMT00000350986.1	G	NM_005631		128845480	+1	no_errors	ENST00000249373	ensembl	human	known	70_37	silent	SNP	0.676	A
SOHLH2	54937	genome.wustl.edu	37	13	36747844	36747844	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr13:36747844C>T	ENST00000379881.3	-	9	1073	c.985G>A	c.(985-987)Gat>Aat	p.D329N	SOHLH2_ENST00000554962.1_Missense_Mutation_p.D406N|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.D406N	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	329					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		ACAGCTTCATCCAAGGAGCTC	0.552																																																	0													123.0	110.0	114.0					13																	36747844		2203	4300	6503	SO:0001583	missense	54937			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.985G>A	13.37:g.36747844C>T	ENSP00000369210:p.Asp329Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.D406N	ENST00000379881.3	37	c.1216	CCDS9355.1	13	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506887	0.44558	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.34275	1.37;1.37;1.37	5.67	4.82	0.62117	.	0.305226	0.28236	N	0.016089	T	0.39436	0.1078	L	0.59436	1.845	0.21950	N	0.999451	P;P	0.43094	0.799;0.799	B;B	0.42692	0.395;0.395	T	0.37596	-0.9699	10	0.87932	D	0	-3.3844	12.7541	0.57323	0.0:0.8355:0.1645:0.0	.	406;329	B4DX90;Q9NX45	.;SOLH2_HUMAN	N	329;406;406	ENSP00000369210:D329N;ENSP00000451542:D406N;ENSP00000421868:D406N	ENSP00000421868:D406N	D	-	1	0	CCDC169-SOHLH2;SOHLH2	35645844	0.863000	0.29885	0.085000	0.20634	0.138000	0.21146	3.150000	0.50662	1.400000	0.46741	0.462000	0.41574	GAT	SOHLH2	-	NULL		0.552	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOHLH2	HGNC	protein_coding	OTTHUMT00000044477.2	C	NM_017826		36747844	-1	no_errors	ENST00000554962	ensembl	human	known	70_37	missense	SNP	0.587	T
SRCAP	10847	genome.wustl.edu	37	16	30736067	30736067	+	Silent	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:30736067G>A	ENST00000262518.4	+	25	5707	c.5322G>A	c.(5320-5322)tcG>tcA	p.S1774S	SRCAP_ENST00000344771.4_Silent_p.S1616S|SRCAP_ENST00000395059.2_Silent_p.S1712S	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1774	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ctccagcatcgtcatctgctt	0.647																																																	0													53.0	44.0	47.0					16																	30736067		2197	4300	6497	SO:0001819	synonymous_variant	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5322G>A	16.37:g.30736067G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.S1774	ENST00000262518.4	37	c.5322	CCDS10689.2	16																																																																																			SRCAP	-	NULL		0.647	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	G	NM_006662		30736067	+1	no_errors	ENST00000262518	ensembl	human	known	70_37	silent	SNP	0.198	A
SVIL	6840	genome.wustl.edu	37	10	29746346	29746347	+	3'UTR	INS	-	-	TGTT	rs10634956|rs397728367|rs149992010	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr10:29746346_29746347insTGTT	ENST00000375398.2	-	0	7923_7924				PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000438202.1_RNA|PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000430295.1_RNA|SVIL_ENST00000375400.3_3'UTR|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|PTCHD3P1_ENST00000423223.1_RNA			O95425	SVIL_HUMAN	supervillin						cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GACATGTGTACTGTTTACAACC	0.312														1764	0.352236	0.2587	0.3732	5008	,	,		17727	0.5565		0.2465	False		,,,				2504	0.362																0																																										SO:0001624	3_prime_UTR_variant	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000375398.2:c.*830->AACA	10.37:g.29746347_29746350dupTGTT		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	RNA	INS	-	NULL	ENST00000375398.2	37	NULL	CCDS7164.1	10																																																																																			SVIL	-	-		0.312	SVIL-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding		-			29746347	-1	no_errors	ENST00000497265	ensembl	human	known	70_37	rna	INS	0.991:0.994	TGTT
SYNE1	23345	genome.wustl.edu	37	6	152470698	152470698	+	Nonsense_Mutation	SNP	C	C	A	rs200752692		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr6:152470698C>A	ENST00000367255.5	-	136	25157	c.24556G>T	c.(24556-24558)Gag>Tag	p.E8186*	SYNE1_ENST00000539504.1_Nonsense_Mutation_p.E341*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.E2710*|SYNE1_ENST00000354674.4_Nonsense_Mutation_p.E341*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.E7798*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.E8186*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.E8115*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.E8115*|SYNE1_ENST00000347037.5_5'UTR	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8186					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGTTCCTCCTCGATGATCGCT	0.483										HNSCC(10;0.0054)																																							0													135.0	122.0	126.0					6																	152470698		2203	4300	6503	SO:0001587	stop_gained	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24556G>T	6.37:g.152470698C>A	ENSP00000356224:p.Glu8186*	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E8186*	ENST00000367255.5	37	c.24556	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	49	15.121153	0.99823	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	.	.	.	5.76	4.88	0.63580	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	16.8719	0.86042	0.0:0.8716:0.1284:0.0	.	.	.	.	X	8186;341;832;8115;8186;8115;7798;2710;348;343;1108;341	.	ENSP00000265368:E8186X	E	-	1	0	SYNE1	152512391	1.000000	0.71417	0.966000	0.40874	0.129000	0.20672	5.901000	0.69861	1.415000	0.47037	0.655000	0.94253	GAG	SYNE1	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152470698	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	nonsense	SNP	1.000	A
TGIF2	60436	genome.wustl.edu	37	20	35220571	35220572	+	3'UTR	INS	-	-	A	rs60964912|rs556291931		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr20:35220571_35220572insA	ENST00000373874.2	+	0	1650_1651				TGIF2_ENST00000373872.4_3'UTR|TGIF2-C20orf24_ENST00000558530.1_Intron|RP5-977B1.11_ENST00000561134.1_RNA	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2						gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AAAAGGCAGGGAAAAAAAAAAA	0.441																																																	0																																										SO:0001624	3_prime_UTR_variant	60436			AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.*738->A	20.37:g.35220582_35220582dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9U3|E1P5T9|H0YNI0	RNA	INS	-	NULL	ENST00000373874.2	37	NULL	CCDS13278.1	20																																																																																			TGIF2	-	-		0.441	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TGIF2	HGNC	protein_coding	OTTHUMT00000079004.2	-	NM_021809		35220572	+1	no_errors	ENST00000558465	ensembl	human	known	70_37	rna	INS	0.001:0.001	A
THAP9	79725	genome.wustl.edu	37	4	83839270	83839270	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:83839270G>C	ENST00000302236.5	+	5	1956	c.1905G>C	c.(1903-1905)caG>caC	p.Q635H	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	635					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				TGGCATTCCAGAAAGCTTACT	0.353																																																	0													44.0	47.0	46.0					4																	83839270		2201	4299	6500	SO:0001583	missense	79725			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.1905G>C	4.37:g.83839270G>C	ENSP00000305533:p.Gln635His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRE2|Q59AC9	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.Q635H	ENST00000302236.5	37	c.1905	CCDS3598.1	4	.	.	.	.	.	.	.	.	.	.	G	7.290	0.610960	0.14066	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.90676	-2.71	3.87	0.566	0.17317	.	0.403417	0.18770	N	0.131644	D	0.88808	0.6537	L	0.43152	1.355	0.80722	D	1	D	0.61697	0.99	P	0.56865	0.808	D	0.83805	0.0238	10	0.44086	T	0.13	-1.0814	4.7194	0.12912	0.2409:0.1686:0.5905:0.0	.	635	Q9H5L6	THAP9_HUMAN	H	635	ENSP00000305533:Q635H	ENSP00000305533:Q635H	Q	+	3	2	THAP9	84058294	1.000000	0.71417	0.999000	0.59377	0.604000	0.37047	0.843000	0.27640	0.071000	0.16664	-0.150000	0.13652	CAG	THAP9	-	NULL		0.353	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9	HGNC	protein_coding	OTTHUMT00000252633.1	G	NM_024672		83839270	+1	no_errors	ENST00000302236	ensembl	human	known	70_37	missense	SNP	0.999	C
THSD7B	80731	genome.wustl.edu	37	2	137852675	137852675	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:137852675C>G	ENST00000409968.1	+	4	1361	c.1183C>G	c.(1183-1185)Ctg>Gtg	p.L395V	THSD7B_ENST00000543459.1_Missense_Mutation_p.L254V|THSD7B_ENST00000272643.3_Missense_Mutation_p.L395V|THSD7B_ENST00000413152.2_Missense_Mutation_p.L364V			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	395						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGGAGAACTTCTGCAGCAATG	0.448																																																	0													80.0	89.0	86.0					2																	137852675		1966	4164	6130	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1183C>G	2.37:g.137852675C>G	ENSP00000387145:p.Leu395Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.L395V	ENST00000409968.1	37	c.1183		2	.	.	.	.	.	.	.	.	.	.	C	7.201	0.593569	0.13875	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.24350	2.46;2.33;1.94;1.86	5.81	1.35	0.21983	.	0.062011	0.64402	D	0.000003	T	0.35068	0.0919	L	0.46614	1.455	0.40473	D	0.980366	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.17868	-1.0355	10	0.11794	T	0.64	.	9.408	0.38473	0.0:0.726:0.1568:0.1172	.	395;364	Q9C0I4;C9JKN6	THS7B_HUMAN;.	V	395;395;364;254	ENSP00000387145:L395V;ENSP00000272643:L395V;ENSP00000413841:L364V;ENSP00000443370:L254V	ENSP00000272643:L395V	L	+	1	2	THSD7B	137569145	0.983000	0.35010	0.253000	0.24343	0.030000	0.12068	2.486000	0.45259	0.257000	0.21650	0.644000	0.83932	CTG	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt		0.448	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9		137852675	+1	no_errors	ENST00000272643	ensembl	human	known	70_37	missense	SNP	0.926	G
TKTL2	84076	genome.wustl.edu	37	4	164393427	164393427	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr4:164393427G>A	ENST00000280605.3	-	1	1620	c.1460C>T	c.(1459-1461)cCa>cTa	p.P487L		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	487						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.P487R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATTTTCTTGTGGGGTATAAAT	0.463																																																	1	Substitution - Missense(1)	lung(1)											113.0	119.0	117.0					4																	164393427		2203	4300	6503	SO:0001583	missense	84076			BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1460C>T	4.37:g.164393427G>A	ENSP00000280605:p.Pro487Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.P487L	ENST00000280605.3	37	c.1460	CCDS3805.1	4	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123193	0.20959	.	.	ENSG00000151005	ENST00000280605	D	0.91894	-2.93	4.15	4.15	0.48705	.	0.192855	0.45126	D	0.000381	D	0.91099	0.7198	M	0.80847	2.515	0.20403	N	0.99991	B	0.29955	0.263	B	0.32677	0.15	T	0.81858	-0.0739	10	0.24483	T	0.36	-1.9798	12.2328	0.54497	0.0:0.0:1.0:0.0	.	487	Q9H0I9	TKTL2_HUMAN	L	487	ENSP00000280605:P487L	ENSP00000280605:P487L	P	-	2	0	TKTL2	164612877	0.871000	0.30034	0.010000	0.14722	0.934000	0.57294	4.285000	0.58989	2.611000	0.88343	0.650000	0.86243	CCA	TKTL2	-	NULL		0.463	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL2	HGNC	protein_coding	OTTHUMT00000365207.1	G	NM_032136		164393427	-1	no_errors	ENST00000280605	ensembl	human	known	70_37	missense	SNP	0.008	A
TMC5	79838	genome.wustl.edu	37	16	19451964	19451964	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:19451964C>T	ENST00000396229.2	+	3	1353	c.604C>T	c.(604-606)Ctg>Ttg	p.L202L	TMC5_ENST00000541464.1_Silent_p.L202L|TMC5_ENST00000542583.2_Silent_p.L202L|TMC5_ENST00000381414.4_Silent_p.L202L	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	202					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CGCAGACTCTCTGGGAAAGCC	0.473																																																	0													76.0	75.0	75.0					16																	19451964		1998	4188	6186	SO:0001819	synonymous_variant	79838			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.604C>T	16.37:g.19451964C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	pfam_TMC	p.L202	ENST00000396229.2	37	c.604	CCDS45431.1	16																																																																																			TMC5	-	NULL		0.473	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	C	NM_024780		19451964	+1	no_errors	ENST00000396229	ensembl	human	known	70_37	silent	SNP	0.000	T
TPCN2	219931	genome.wustl.edu	37	11	68855399	68855399	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr11:68855399C>T	ENST00000294309.3	+	25	2338	c.2237C>T	c.(2236-2238)cCg>cTg	p.P746L	TPCN2_ENST00000542467.1_Missense_Mutation_p.P564L|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	746					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGCCAGCACCCGCACCTGTGG	0.642																																																	0													23.0	28.0	27.0					11																	68855399		2200	4294	6494	SO:0001583	missense	219931			AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.2237C>T	11.37:g.68855399C>T	ENSP00000294309:p.Pro746Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NT82	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.P746L	ENST00000294309.3	37	c.2237	CCDS8189.1	11	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291559	0.40494	.	.	ENSG00000162341	ENST00000294309;ENST00000542467	D;D	0.99691	-4.31;-6.42	4.12	3.19	0.36642	.	0.257695	0.30285	N	0.009971	D	0.99569	0.9845	M	0.78637	2.42	0.38354	D	0.944412	D;D	0.89917	0.993;1.0	P;D	0.69307	0.738;0.963	D	0.98492	1.0610	10	0.87932	D	0	-27.6018	13.6192	0.62128	0.0:0.8426:0.1574:0.0	.	564;746	E7ETX0;Q8NHX9	.;TPC2_HUMAN	L	746;564	ENSP00000294309:P746L;ENSP00000445551:P564L	ENSP00000294309:P746L	P	+	2	0	TPCN2	68611975	0.993000	0.37304	0.375000	0.26029	0.020000	0.10135	3.631000	0.54280	0.853000	0.35312	-0.502000	0.04539	CCG	TPCN2	-	NULL		0.642	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN2	HGNC	protein_coding	OTTHUMT00000396878.2	C	NM_139075		68855399	+1	no_errors	ENST00000294309	ensembl	human	known	70_37	missense	SNP	0.987	T
TPSD1	23430	genome.wustl.edu	37	16	1306681	1306681	+	Missense_Mutation	SNP	A	A	C	rs1141967	byFrequency	TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr16:1306681A>C	ENST00000211076.3	+	2	395	c.247A>C	c.(247-249)Atg>Ctg	p.M83L	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Missense_Mutation_p.M76L	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	83	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		V -> M (in dbSNP:rs3993987). {ECO:0000269|PubMed:12391231, ECO:0000269|PubMed:18854315, ECO:0000269|PubMed:9920877}.			extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				GGCGCACTGCGTGGAACCGTG	0.706																																																	0													39.0	47.0	44.0					16																	1306681		2199	4298	6497	SO:0001583	missense	23430			AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.247A>C	16.37:g.1306681A>C	ENSP00000211076:p.Met83Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V83L	ENST00000211076.3	37	c.247	CCDS10432.1	16																																																																																			TPSD1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.706	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPSD1	HGNC	protein_coding	OTTHUMT00000250320.2	A			1306681	+1	no_errors	ENST00000211076	ensembl	human	known	70_37	missense	SNP	0.026	C
TUBA4A	7277	genome.wustl.edu	37	2	220118077	220118077	+	Intron	DEL	G	G	-	rs60456844		TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:220118077delG	ENST00000248437.4	-	1	177				TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000498660.1_Intron|TUBA4A_ENST00000392088.2_Intron	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GCTGAGTCACGGGGGGGGGGT	0.647																																																	0																																										SO:0001627	intron_variant	80086			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500C>-	2.37:g.220118077delG		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUB1|B3KNQ6|P05215	RNA	DEL	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																			TUBA4B	-	-		0.647	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	HGNC	protein_coding	OTTHUMT00000256816.3	G	NM_006000		220118077	+1	no_errors	ENST00000473885	ensembl	human	known	70_37	rna	DEL	0.000	-
UBXN4	23190	genome.wustl.edu	37	2	136540402	136540402	+	Missense_Mutation	SNP	A	A	G			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr2:136540402A>G	ENST00000272638.9	+	13	1783	c.1472A>G	c.(1471-1473)gAt>gGt	p.D491G	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	491					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						AGGACTCAAGATGATGGTGAA	0.363																																																	0													118.0	119.0	119.0					2																	136540402		1858	4102	5960	SO:0001583	missense	23190			D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.1472A>G	2.37:g.136540402A>G	ENSP00000272638:p.Asp491Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.D491G	ENST00000272638.9	37	c.1472	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	A	16.95	3.264082	0.59431	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.51574	0.7	5.48	5.48	0.80851	.	0.048508	0.85682	D	0.000000	T	0.53899	0.1825	L	0.59436	1.845	0.58432	D	0.999996	D	0.53151	0.958	P	0.49502	0.613	T	0.54814	-0.8237	10	0.41790	T	0.15	.	15.5684	0.76313	1.0:0.0:0.0:0.0	.	491	Q92575	UBXN4_HUMAN	G	491;473	ENSP00000272638:D491G	ENSP00000272638:D491G	D	+	2	0	UBXN4	136256872	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.891000	0.92485	2.067000	0.61834	0.523000	0.50628	GAT	UBXN4	-	NULL		0.363	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	A	NM_014607		136540402	+1	no_errors	ENST00000272638	ensembl	human	known	70_37	missense	SNP	1.000	G
VCAN	1462	genome.wustl.edu	37	5	82876847	82876847	+	3'UTR	DEL	G	G	-			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr5:82876847delG	ENST00000265077.3	+	0	11350				VCAN_ENST00000512590.2_3'UTR|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_3'UTR|VCAN_ENST00000343200.5_3'UTR|VCAN-AS1_ENST00000513899.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GGTGCAGTTTGCTTCTACATG	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.*594G>-	5.37:g.82876847delG		Somatic		WXS	Illumina HiSeq	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	RNA	DEL	-	NULL	ENST00000265077.3	37	NULL	CCDS4060.1	5																																																																																			VCAN	-	-		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	G	NM_004385		82876847	+1	no_errors	ENST00000513016	ensembl	human	known	70_37	rna	DEL	0.002	-
VKORC1L1	154807	genome.wustl.edu	37	7	65419185	65419185	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr7:65419185C>T	ENST00000360768.3	+	3	534	c.429C>T	c.(427-429)atC>atT	p.I143I	VKORC1L1_ENST00000434382.2_Missense_Mutation_p.R107C	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1	143					cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	TCATCTGCATCGTCACGTACG	0.502																																																	0													194.0	146.0	162.0					7																	65419185		2203	4300	6503	SO:0001819	synonymous_variant	154807				CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.429C>T	7.37:g.65419185C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E222|E7ETM5|Q6AHW9|Q6TEK6	Missense_Mutation	SNP	pfam_VKOR	p.R107C	ENST00000360768.3	37	c.319	CCDS5529.1	7	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292738	0.40594	.	.	ENSG00000196715	ENST00000434382	D	0.97209	-4.29	5.78	3.96	0.45880	.	.	.	.	.	D	0.93893	0.8046	.	.	.	0.38739	D	0.953854	B	0.13594	0.008	B	0.04013	0.001	D	0.92027	0.5630	8	0.45353	T	0.12	.	9.4913	0.38962	0.0:0.7392:0.1215:0.1394	.	107	E7ETM5	.	C	107	ENSP00000403077:R107C	ENSP00000403077:R107C	R	+	1	0	VKORC1L1	65056620	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	2.975000	0.49281	1.592000	0.50018	0.591000	0.81541	CGT	VKORC1L1	-	NULL		0.502	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1L1	HGNC	protein_coding	OTTHUMT00000251612.3	C	NM_173517		65419185	+1	no_errors	ENST00000434382	ensembl	human	novel	70_37	missense	SNP	1.000	T
ZNF526	116115	genome.wustl.edu	37	19	42729913	42729913	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:42729913C>T	ENST00000301215.3	+	3	1583	c.1358C>T	c.(1357-1359)tCa>tTa	p.S453L		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TCCTTTGCCTCAGCTTCCCGG	0.682																																																	0													32.0	34.0	33.0					19																	42729913		2202	4298	6500	SO:0001583	missense	116115			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1358C>T	19.37:g.42729913C>T	ENSP00000301215:p.Ser453Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S453L	ENST00000301215.3	37	c.1358	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141506	0.37825	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.79141	-1.24	4.76	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.348369	0.22087	N	0.064801	T	0.65396	0.2687	L	0.28115	0.83	0.09310	N	1	P	0.48589	0.912	B	0.44315	0.446	T	0.56902	-0.7902	10	0.11794	T	0.64	-11.8669	12.9581	0.58442	0.2868:0.7132:0.0:0.0	.	453	Q8TF50	ZN526_HUMAN	L	309;453	ENSP00000301215:S453L	ENSP00000301215:S453L	S	+	2	0	ZNF526	47421753	0.000000	0.05858	0.002000	0.10522	0.934000	0.57294	0.053000	0.14184	0.701000	0.31803	0.650000	0.86243	TCA	ZNF526	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.682	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	C	XM_057401		42729913	+1	no_errors	ENST00000301215	ensembl	human	known	70_37	missense	SNP	0.157	T
ZNF672	79894	genome.wustl.edu	37	1	249142781	249142781	+	Silent	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr1:249142781C>T	ENST00000306562.3	+	4	2054	c.1308C>T	c.(1306-1308)ctC>ctT	p.L436L		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GCACTGCCCTCGTCTTTGAGG	0.642																																																	0													12.0	11.0	11.0					1																	249142781		2077	4091	6168	SO:0001819	synonymous_variant	79894			AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.1308C>T	1.37:g.249142781C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96H65|Q96IM3|Q9H6G5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L436	ENST00000306562.3	37	c.1308	CCDS1638.1	1																																																																																			ZNF672	-	NULL		0.642	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF672	HGNC	protein_coding	OTTHUMT00000097125.2	C	NM_024836		249142781	+1	no_errors	ENST00000306562	ensembl	human	known	70_37	silent	SNP	0.000	T
ZNF791	163049	genome.wustl.edu	37	19	12734618	12734619	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:12734618_12734619insT	ENST00000343325.4	+	2	270_271	c.108_109insT	c.(109-111)ttcfs	p.F37fs	ZNF791_ENST00000446165.1_Frame_Shift_Ins_p.F37fs|ZNF791_ENST00000458122.3_Frame_Shift_Ins_p.F5fs|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000540038.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						TGCAGGAAACATTCAAGAACCT	0.446																																																	0																																										SO:0001589	frameshift_variant	163049			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.110dupT	19.37:g.12734620_12734620dupT	ENSP00000342974:p.Phe37fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z586|Q8NC99	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K37fs	ENST00000343325.4	37	c.108_109	CCDS12273.1	19																																																																																			ZNF791	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.446	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF791	HGNC	protein_coding	OTTHUMT00000344140.1	-	NM_153358		12734619	+1	no_errors	ENST00000343325	ensembl	human	known	70_37	frame_shift_ins	INS	0.638:0.608	T
ZNF714	148206	genome.wustl.edu	37	19	21300204	21300204	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VI-01A-11D-A28B-09	TCGA-JW-A5VI-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3fa0d743-1312-4aa6-967d-7ec81af780cd	4cf0c64a-057d-4e79-85f2-dffc58753ffd	g.chr19:21300204C>T	ENST00000596143.1	+	5	1059	c.734C>T	c.(733-735)aCa>aTa	p.T245I	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	245					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						CACCTTACTACACATAAGGTA	0.398																																																	0													34.0	36.0	35.0					19																	21300204		2178	4295	6473	SO:0001583	missense	148206			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.734C>T	19.37:g.21300204C>T	ENSP00000472368:p.Thr245Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T245I	ENST00000596143.1	37	c.734	CCDS54239.1	19	.	.	.	.	.	.	.	.	.	.	.	8.112	0.778931	0.16120	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	1.02	-2.03	0.07365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24851	0.0603	N	0.12887	0.27	0.09310	N	1	B;P;D	0.57571	0.066;0.833;0.98	B;P;P	0.62740	0.033;0.582;0.906	T	0.10753	-1.0616	8	0.37606	T	0.19	.	2.0826	0.03638	0.3699:0.2318:0.0:0.3983	.	246;245;246	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	I	245	.	ENSP00000291770:T245I	T	+	2	0	ZNF714	21092044	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	-6.571000	0.00061	-0.529000	0.06358	-0.538000	0.04264	ACA	ZNF714	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.398	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF714	HGNC	protein_coding	OTTHUMT00000463930.1	C	NM_182515		21300204	+1	no_errors	ENST00000596143	ensembl	human	known	70_37	missense	SNP	0.001	T
