#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA3	21	genome.wustl.edu	37	16	2345606	2345606	+	Missense_Mutation	SNP	C	C	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:2345606C>A	ENST00000301732.5	-	18	3099	c.2399G>T	c.(2398-2400)aGa>aTa	p.R800I	ABCA3_ENST00000382381.3_Missense_Mutation_p.R742I	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	800					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CGTGCTCTCTCTGGGAAGGAT	0.627																																																	0													148.0	150.0	149.0					16																	2345606		2198	4300	6498	SO:0001583	missense	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2399G>T	16.37:g.2345606C>A	ENSP00000301732:p.Arg800Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R800I	ENST00000301732.5	37	c.2399	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736258	0.30774	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	T	0.78707	-1.2	5.65	4.56	0.56223	.	0.099206	0.64402	D	0.000002	T	0.68174	0.2972	L	0.38838	1.175	0.80722	D	1	B;B;B	0.17465	0.001;0.005;0.022	B;B;B	0.17098	0.007;0.007;0.017	T	0.65084	-0.6254	10	0.66056	D	0.02	.	10.0058	0.41957	0.0:0.0806:0.0:0.9194	.	800;804;800	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	I	800;804	ENSP00000301732:R800I	ENSP00000301732:R800I	R	-	2	0	ABCA3	2285607	1.000000	0.71417	0.997000	0.53966	0.791000	0.44710	2.496000	0.45346	1.164000	0.42652	-0.302000	0.09304	AGA	ABCA3	-	NULL		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	C	NM_001089		2345606	-1	no_errors	ENST00000301732	ensembl	human	known	70_37	missense	SNP	1.000	A
ACIN1	22985	genome.wustl.edu	37	14	23532260	23532260	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr14:23532260G>A	ENST00000262710.1	-	14	3262	c.2935C>T	c.(2935-2937)Cga>Tga	p.R979*	ACIN1_ENST00000457657.1_Nonsense_Mutation_p.R939*|ACIN1_ENST00000555053.1_Nonsense_Mutation_p.R966*|ACIN1_ENST00000357481.2_Nonsense_Mutation_p.R221*|ACIN1_ENST00000557515.1_Nonsense_Mutation_p.R220*|ACIN1_ENST00000605057.1_Nonsense_Mutation_p.R921*|ACIN1_ENST00000338631.6_Nonsense_Mutation_p.R252*|ACIN1_ENST00000397341.3_Nonsense_Mutation_p.R221*	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	979					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		ATGGAACGTCGAGTTAAGGTA	0.498																																																	0													154.0	143.0	146.0					14																	23532260		2203	4300	6503	SO:0001587	stop_gained	22985			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2935C>T	14.37:g.23532260G>A	ENSP00000262710:p.Arg979*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Nonsense_Mutation	SNP	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.R979*	ENST00000262710.1	37	c.2935	CCDS9587.1	14	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366417	0.82463	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	.	.	.	5.5	1.57	0.23409	.	0.000000	0.34245	N	0.004124	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7541	5.8096	0.18460	0.1428:0.0:0.4439:0.4133	.	.	.	.	X	220;252;221;979;939;221;966	.	ENSP00000262710:R979X	R	-	1	2	ACIN1	22602100	1.000000	0.71417	0.085000	0.20634	0.986000	0.74619	4.090000	0.57693	0.117000	0.18138	-1.047000	0.02352	CGA	ACIN1	-	NULL		0.498	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACIN1	HGNC	protein_coding	OTTHUMT00000071707.3	G	NM_014977		23532260	-1	no_errors	ENST00000262710	ensembl	human	known	70_37	nonsense	SNP	0.741	A
ACTL6B	51412	genome.wustl.edu	37	7	100252740	100252740	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:100252740C>T	ENST00000160382.5	-	4	377	c.271G>A	c.(271-273)Gag>Aag	p.E91K		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	91					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TCCCAGTCCTCGACTGGGGCC	0.597																																																	0													136.0	99.0	112.0					7																	100252740		2203	4300	6503	SO:0001583	missense	51412			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.271G>A	7.37:g.100252740C>T	ENSP00000160382:p.Glu91Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2D0|O75421	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E91K	ENST00000160382.5	37	c.271	CCDS5702.1	7	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206127	0.79127	.	.	ENSG00000077080	ENST00000160382;ENST00000461605	D;D	0.94613	-3.47;-3.47	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000015	D	0.95541	0.8551	L	0.46819	1.47	0.80722	D	1	D	0.76494	0.999	D	0.64776	0.929	D	0.95436	0.8521	10	0.49607	T	0.09	.	15.7457	0.77939	0.0:1.0:0.0:0.0	.	91	O94805	ACL6B_HUMAN	K	91;10	ENSP00000160382:E91K;ENSP00000420151:E10K	ENSP00000160382:E91K	E	-	1	0	ACTL6B	100090676	1.000000	0.71417	0.987000	0.45799	0.181000	0.23173	7.543000	0.82106	2.323000	0.78572	0.462000	0.41574	GAG	ACTL6B	-	pfam_Actin-like,smart_Actin-like		0.597	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	C	NM_016188		100252740	-1	no_errors	ENST00000160382	ensembl	human	known	70_37	missense	SNP	1.000	T
ADAMTS7	11173	genome.wustl.edu	37	15	79058074	79058074	+	Silent	SNP	C	C	T	rs2929157		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:79058074C>T	ENST00000388820.4	-	19	4389	c.4179G>A	c.(4177-4179)ccG>ccA	p.P1393P	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1393					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGGAGCCAGCGGCTGGGTCT	0.682																																																	0													27.0	35.0	32.0					15																	79058074		2175	4261	6436	SO:0001819	synonymous_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4179G>A	15.37:g.79058074C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14F51|Q6P7J9	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1393	ENST00000388820.4	37	c.4179	CCDS32303.1	15																																																																																			ADAMTS7	-	NULL		0.682	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	C	NM_014272		79058074	-1	no_errors	ENST00000388820	ensembl	human	known	70_37	silent	SNP	0.000	T
ADRA1A	148	genome.wustl.edu	37	8	26722096	26722096	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:26722096G>A	ENST00000519229.1	-	1	397	c.391C>T	c.(391-393)Ccg>Tcg	p.P131S	ADRA1A_ENST00000380582.3_Missense_Mutation_p.P131S|ADRA1A_ENST00000354550.4_Missense_Mutation_p.P131S|ADRA1A_ENST00000380573.3_Missense_Mutation_p.P131S|ADRA1A_ENST00000380572.3_Missense_Mutation_p.P131S|ADRA1A_ENST00000276393.4_Missense_Mutation_p.P131S|ADRA1A_ENST00000380581.2_Missense_Mutation_p.P131S|ADRA1A_ENST00000380587.1_Missense_Mutation_p.P131S|ADRA1A_ENST00000380586.1_Missense_Mutation_p.P131S|ADRA1A_ENST00000358857.5_Missense_Mutation_p.P131S			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	201					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TAGCGCAGCGGGTAGCTCACG	0.612																																																	0													77.0	76.0	77.0					8																	26722096		2203	4300	6503	SO:0001583	missense	148			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.391C>T	8.37:g.26722096G>A	ENSP00000430793:p.Pro131Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adrene_rcpt_A1Cs,prints_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.P131S	ENST00000519229.1	37	c.391		8	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200316	0.58126	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	M	0.69185	2.1	0.80722	D	1	P;P;P;P;D;P	0.89917	0.815;0.815;0.88;0.815;1.0;0.88	B;B;P;B;D;P	0.91635	0.421;0.421;0.773;0.421;0.999;0.773	T	0.68205	-0.5470	10	0.16896	T	0.51	.	17.898	0.88895	0.0:0.0:1.0:0.0	.	131;131;131;131;131;131	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	S	131	ENSP00000369960:P131S;ENSP00000369961:P131S;ENSP00000369956:P131S;ENSP00000369955:P131S;ENSP00000430793:P131S;ENSP00000346557:P131S;ENSP00000276393:P131S;ENSP00000369947:P131S;ENSP00000369946:P131S;ENSP00000351725:P131S	ENSP00000276393:P131S	P	-	1	0	ADRA1A	26778013	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.365000	0.80145	0.563000	0.77884	CCG	ADRA1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.612	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	G	NM_033303		26722096	-1	no_errors	ENST00000380586	ensembl	human	known	70_37	missense	SNP	1.000	A
AEBP2	121536	genome.wustl.edu	37	12	19646858	19646858	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:19646858C>T	ENST00000398864.3	+	4	1138	c.1112C>T	c.(1111-1113)tCt>tTt	p.S371F	AEBP2_ENST00000266508.9_Missense_Mutation_p.S371F|AEBP2_ENST00000360995.4_Missense_Mutation_p.S155F|AEBP2_ENST00000541908.1_Missense_Mutation_p.S142F	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	371	Interaction with SUZ12.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					AAAGAAGAATCTCCTTCTAAA	0.433																																																	0													53.0	51.0	51.0					12																	19646858		1859	4116	5975	SO:0001583	missense	121536				CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.1112C>T	12.37:g.19646858C>T	ENSP00000381840:p.Ser371Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S371F	ENST00000398864.3	37	c.1112	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766014	0.90020	.	.	ENSG00000139154	ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	T;T;T;T	0.71461	-0.51;-0.39;-0.57;-0.42	5.45	5.45	0.79879	.	.	.	.	.	T	0.81118	0.4756	L	0.54323	1.7	0.58432	D	0.999997	D	0.71674	0.998	D	0.78314	0.991	T	0.78727	-0.2091	8	.	.	.	-5.4626	17.6619	0.88195	0.0:1.0:0.0:0.0	.	371	Q6ZN18	AEBP2_HUMAN	F	142;371;305;371;155	ENSP00000437983:S142F;ENSP00000381840:S371F;ENSP00000266508:S371F;ENSP00000354267:S155F	.	S	+	2	0	AEBP2	19538125	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.814000	0.75236	2.835000	0.97688	0.650000	0.86243	TCT	AEBP2	-	NULL		0.433	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	HGNC	protein_coding	OTTHUMT00000401575.1	C	NM_153207		19646858	+1	no_errors	ENST00000398864	ensembl	human	known	70_37	missense	SNP	1.000	T
AFP	174	genome.wustl.edu	37	4	74304004	74304004	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:74304004C>T	ENST00000395792.2	+	3	351	c.251C>T	c.(250-252)tCa>tTa	p.S84L	AFP_ENST00000226359.2_Missense_Mutation_p.S84L	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	84	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			gaacagtcttcagggtgttta	0.363									Alpha-Fetoprotein, Hereditary Persistence of																																								0													66.0	64.0	65.0					4																	74304004		2203	4300	6503	SO:0001583	missense	174	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.251C>T	4.37:g.74304004C>T	ENSP00000379138:p.Ser84Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBU3	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein,prints_Serum_albumin	p.S84L	ENST00000395792.2	37	c.251	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701987	0.30232	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.38240	1.15;1.15	5.0	-5.09	0.02920	Serum albumin-like (1);Serum albumin, N-terminal (3);	1.315330	0.05542	N	0.565959	T	0.19366	0.0465	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.18777	-1.0326	10	0.33940	T	0.23	.	1.2441	0.01969	0.4365:0.1848:0.2129:0.1658	.	84	P02771	FETA_HUMAN	L	84	ENSP00000379138:S84L;ENSP00000226359:S84L	ENSP00000226359:S84L	S	+	2	0	AFP	74522868	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.537000	0.06128	-0.763000	0.04658	0.561000	0.74099	TCA	AFP	-	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr		0.363	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	C			74304004	+1	no_errors	ENST00000395792	ensembl	human	known	70_37	missense	SNP	0.000	T
ALOX15	246	genome.wustl.edu	37	17	4541560	4541560	+	Silent	SNP	G	G	A	rs3887815	byFrequency	TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:4541560G>A	ENST00000570836.1	-	7	855	c.759C>T	c.(757-759)ttC>ttT	p.F253F	ALOX15_ENST00000293761.3_Silent_p.F253F|ALOX15_ENST00000574640.1_Silent_p.F214F|ALOX15_ENST00000545513.1_Silent_p.F275F			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	253	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		TGCCTGGAGGGAACACTAGGC	0.582																																																	0													1.0	1.0	1.0					17																	4541560		1054	2236	3290	SO:0001819	synonymous_variant	246			M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.759C>T	17.37:g.4541560G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2P4|B7ZA11|Q8N6R7|Q99657	Silent	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C	p.F275	ENST00000570836.1	37	c.825	CCDS11049.1	17																																																																																			ALOX15	-	pfam_LipOase_C,superfamily_LipOase_C		0.582	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15	HGNC	protein_coding	OTTHUMT00000207487.2	G			4541560	-1	no_errors	ENST00000545513	ensembl	human	known	70_37	silent	SNP	0.662	A
AKAP10	11216	genome.wustl.edu	37	17	19844226	19844226	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:19844226C>T	ENST00000225737.6	-	7	1316	c.1159G>A	c.(1159-1161)Gag>Aag	p.E387K	AKAP10_ENST00000395536.3_Missense_Mutation_p.E387K	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	387	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					AGGGCTGACTCACAGAAGAGA	0.443																																																	0													61.0	59.0	60.0					17																	19844226		2203	4300	6503	SO:0001583	missense	11216			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1159G>A	17.37:g.19844226C>T	ENSP00000225737:p.Glu387Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R650|Q96AJ7	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.E387K	ENST00000225737.6	37	c.1159	CCDS11214.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.769913	0.96914	.	.	ENSG00000108599	ENST00000225737;ENST00000395536	T	0.20881	2.04	5.9	5.9	0.94986	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.69823	2.125	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.983;0.975	T	0.39014	-0.9634	10	0.59425	D	0.04	-12.2104	19.2604	0.93966	0.0:1.0:0.0:0.0	.	387;387;387	E7EMD6;Q2XPN4;O43572	.;.;AKA10_HUMAN	K	387	ENSP00000225737:E387K	ENSP00000225737:E387K	E	-	1	0	AKAP10	19784818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.416000	0.80143	2.793000	0.96121	0.563000	0.77884	GAG	AKAP10	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal		0.443	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP10	HGNC	protein_coding	OTTHUMT00000132380.2	C	NM_007202		19844226	-1	no_errors	ENST00000225737	ensembl	human	known	70_37	missense	SNP	1.000	T
ANO4	121601	genome.wustl.edu	37	12	101480535	101480535	+	Missense_Mutation	SNP	A	A	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:101480535A>G	ENST00000392977.3	+	17	1844	c.1634A>G	c.(1633-1635)aAc>aGc	p.N545S	ANO4_ENST00000299222.9_Missense_Mutation_p.N65S|ANO4_ENST00000550015.1_Missense_Mutation_p.N65S|ANO4_ENST00000392979.3_Missense_Mutation_p.N510S			Q32M45	ANO4_HUMAN	anoctamin 4	545					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						ATCAGGAATAACTCTCAGGTT	0.502										HNSCC(74;0.22)																																							0													286.0	235.0	252.0					12																	101480535		2203	4300	6503	SO:0001583	missense	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1634A>G	12.37:g.101480535A>G	ENSP00000376703:p.Asn545Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.N545S	ENST00000392977.3	37	c.1634		12	.	.	.	.	.	.	.	.	.	.	A	18.17	3.565354	0.65651	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.69175	-0.38;-0.22;-0.38;-0.22	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	L	0.48986	1.54	0.58432	D	0.999997	P;P;P	0.47253	0.675;0.892;0.532	B;P;B	0.52343	0.364;0.696;0.431	T	0.66240	-0.5973	10	0.21014	T	0.42	.	15.924	0.79597	1.0:0.0:0.0:0.0	.	65;545;510	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	S	510;65;545;65	ENSP00000376705:N510S;ENSP00000299222:N65S;ENSP00000376703:N545S;ENSP00000450192:N65S	ENSP00000299222:N65S	N	+	2	0	ANO4	100004666	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.287000	0.95975	2.217000	0.71921	0.533000	0.62120	AAC	ANO4	-	pfam_Anoctamin		0.502	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	A	NM_178826		101480535	+1	no_errors	ENST00000392977	ensembl	human	known	70_37	missense	SNP	1.000	G
APBB3	10307	genome.wustl.edu	37	5	139943250	139943250	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:139943250C>T	ENST00000357560.4	-	3	662	c.219G>A	c.(217-219)acG>acA	p.T73T	APBB3_ENST00000507279.1_5'UTR|APBB3_ENST00000358580.5_Silent_p.T73T|SLC35A4_ENST00000514199.1_5'Flank|APBB3_ENST00000356738.2_Silent_p.T73T|APBB3_ENST00000412920.3_Silent_p.T73T|SLC35A4_ENST00000323146.3_5'Flank|APBB3_ENST00000508496.2_Intron|APBB3_ENST00000511201.2_Silent_p.T73T|APBB3_ENST00000354402.5_Silent_p.T73T	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	73						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATCCCCTCCGTTCCCTGTA	0.587																																																	0													88.0	78.0	82.0					5																	139943250		2203	4300	6503	SO:0001819	synonymous_variant	10307			AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.219G>A	5.37:g.139943250C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Silent	SNP	pfam_PTyr_interaction_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom,pfscan_WW_Rsp5_WWP	p.T73	ENST00000357560.4	37	c.219	CCDS4229.1	5																																																																																			APBB3	-	NULL		0.587	APBB3-003	KNOWN	basic|CCDS	protein_coding	APBB3	HGNC	protein_coding	OTTHUMT00000251677.2	C	NM_006051		139943250	-1	no_errors	ENST00000356738	ensembl	human	known	70_37	silent	SNP	0.000	T
APOD	347	genome.wustl.edu	37	3	195295997	195295997	+	Missense_Mutation	SNP	G	G	A	rs5954		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:195295997G>A	ENST00000343267.3	-	5	705	c.344C>T	c.(343-345)tCg>tTg	p.S115L		NM_001647.3	NP_001638.1	P05090	APOD_HUMAN	apolipoprotein D	115			S -> L (in dbSNP:rs5954). {ECO:0000269|PubMed:10391209}.		aging (GO:0007568)|angiogenesis (GO:0001525)|brain development (GO:0007420)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of lipoprotein lipid oxidation (GO:0060588)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of T cell migration (GO:2000405)|peripheral nervous system axon regeneration (GO:0014012)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to reactive oxygen species (GO:0000302)|tissue regeneration (GO:0042246)	cytosolic ribosome (GO:0022626)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		GTACGGTGCCGATGGCATAAC	0.512																																																	0													90.0	87.0	88.0					3																	195295997		2203	4300	6503	SO:0001583	missense	347				CCDS33925.1	3q29	2013-09-19			ENSG00000189058	ENSG00000189058		"""Lipocalins"", ""Apolipoproteins"""	612	protein-coding gene	gene with protein product		107740				2439269, 3453108	Standard	NM_001647		Approved		uc003fur.2	P05090	OTTHUMG00000155854	ENST00000343267.3:c.344C>T	3.37:g.195295997G>A	ENSP00000345179:p.Ser115Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R579|D3DNW6|Q6IBG6	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_Triabin_pallidipin/procalin,superfamily_Calycin-like,pirsf_Lipocalin_ApoD,prints_ApolipopD,prints_Invtbrt_color,prints_Lipocalin,prints_Lipocalin_bac	p.S115L	ENST00000343267.3	37	c.344	CCDS33925.1	3	.	.	.	.	.	.	.	.	.	.	G	9.701	1.154474	0.21371	.	.	ENSG00000189058	ENST00000343267;ENST00000421243;ENST00000453131	T;T;T	0.30448	1.53;1.53;1.53	5.92	4.02	0.46733	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.477428	0.24260	N	0.040090	T	0.23410	0.0566	L	0.39898	1.24	0.09310	N	1	P	0.39352	0.669	B	0.33196	0.159	T	0.10753	-1.0616	10	0.40728	T	0.16	-1.6329	13.017	0.58764	0.0:0.3074:0.6926:0.0	rs5954	115	P05090	APOD_HUMAN	L	115;143;115	ENSP00000345179:S115L;ENSP00000415235:S143L;ENSP00000393076:S115L	ENSP00000345179:S115L	S	-	2	0	APOD	196777286	0.000000	0.05858	0.009000	0.14445	0.133000	0.20885	0.808000	0.27154	1.456000	0.47831	0.561000	0.74099	TCG	APOD	-	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_Triabin_pallidipin/procalin,superfamily_Calycin-like,pirsf_Lipocalin_ApoD		0.512	APOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOD	HGNC	protein_coding	OTTHUMT00000342004.1	G	NM_001647		195295997	-1	no_errors	ENST00000343267	ensembl	human	known	70_37	missense	SNP	0.002	A
APPL2	55198	genome.wustl.edu	37	12	105589110	105589110	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:105589110C>T	ENST00000258530.3	-	14	1395	c.1170G>A	c.(1168-1170)ttG>ttA	p.L390L	APPL2_ENST00000551662.1_Silent_p.L396L|APPL2_ENST00000549573.1_5'Flank|APPL2_ENST00000539978.2_Silent_p.L347L	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.L390F(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CGGTCTGATTCAACTTGATCG	0.473																																																	1	Substitution - Missense(1)	lung(1)											139.0	118.0	125.0					12																	105589110		2203	4300	6503	SO:0001819	synonymous_variant	55198			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1170G>A	12.37:g.105589110C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	pfam_PTyr_interaction_dom,pfam_Pleckstrin_homology,pfam_PTB,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.L396	ENST00000258530.3	37	c.1188	CCDS9101.1	12																																																																																			APPL2	-	NULL		0.473	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL2	HGNC	protein_coding	OTTHUMT00000406238.3	C	NM_018171		105589110	-1	no_errors	ENST00000551662	ensembl	human	known	70_37	silent	SNP	1.000	T
ARGFX	503582	genome.wustl.edu	37	3	121304901	121304901	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:121304901G>C	ENST00000334384.3	+	4	412	c.402G>C	c.(400-402)aaG>aaC	p.K134N		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K134N(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		TCAAATTGAAGAAGCAGCAGC	0.517																																																	1	Substitution - Missense(1)	ovary(1)											83.0	80.0	81.0					3																	121304901		2203	4300	6503	SO:0001583	missense	503582				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.402G>C	3.37:g.121304901G>C	ENSP00000335578:p.Lys134Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.K134N	ENST00000334384.3	37	c.402	CCDS33834.1	3	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829574	0.50845	.	.	ENSG00000186103	ENST00000334384	D	0.98313	-4.86	3.17	2.3	0.28687	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.717195	0.11854	N	0.523099	D	0.98036	0.9353	M	0.86343	2.81	0.09310	N	1	P	0.47841	0.901	P	0.49683	0.619	D	0.94358	0.7585	10	0.87932	D	0	-4.2254	6.5352	0.22350	0.1356:0.0:0.8644:0.0	.	134	A6NJG6	ARGFX_HUMAN	N	134	ENSP00000335578:K134N	ENSP00000335578:K134N	K	+	3	2	ARGFX	122787591	0.017000	0.18338	0.022000	0.16811	0.399000	0.30720	1.225000	0.32551	0.908000	0.36671	-0.254000	0.11334	AAG	ARGFX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.517	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGFX	HGNC	protein_coding	OTTHUMT00000355096.2	G	NM_001012659		121304901	+1	no_errors	ENST00000334384	ensembl	human	known	70_37	missense	SNP	0.027	C
ARL9	132946	genome.wustl.edu	37	4	57377384	57377384	+	5'UTR	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:57377384G>C	ENST00000360096.2	+	0	201					NM_206919.1	NP_996802.1	Q6T311	ARL9_HUMAN	ADP-ribosylation factor-like 9						small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.D38Y(1)		lung(2)	2	Glioma(25;0.08)|all_neural(26;0.101)					GCTGGGCCTGGATGGAGCAGG	0.478																																																	1	Substitution - Missense(1)	lung(1)																																								SO:0001623	5_prime_UTR_variant	132946			AY439003	CCDS59474.1	4q12	2014-05-09				ENSG00000196503		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23592	protein-coding gene	gene with protein product		612405					Standard	NM_206919		Approved		uc003hby.1	Q6T311		ENST00000360096.2:c.-114G>C	4.37:g.57377384G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D27H	ENST00000360096.2	37	c.79	CCDS59474.1	4	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603251	0.87157	.	.	ENSG00000196503	ENST00000360096	.	.	.	5.87	5.87	0.94306	.	0.042659	0.85682	D	0.000000	T	0.77519	0.4142	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.79117	-0.1935	5	0.87932	D	0	-12.3	17.7047	0.88305	0.0:0.0:1.0:0.0	.	.	.	.	H	27	.	ENSP00000353210:D27H	D	+	1	0	ARL9	57072141	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.012000	0.93624	2.787000	0.95880	0.508000	0.49915	GAT	ARL9	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.478	ARL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL9	HGNC	protein_coding	OTTHUMT00000467724.1	G	NM_206919		57377384	+1	no_errors	ENST00000360096	ensembl	human	known	70_37	missense	SNP	1.000	C
ATP8B2	57198	genome.wustl.edu	37	1	154304127	154304127	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:154304127C>T	ENST00000368489.3	+	7	510	c.510C>T	c.(508-510)atC>atT	p.I170I	ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000341822.2_Silent_p.I156I|ATP8B2_ENST00000368487.3_Silent_p.I137I	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	156					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GTGATATTATCAAGCTAGAAA	0.478																																																	0													134.0	123.0	127.0					1																	154304127		2203	4300	6503	SO:0001819	synonymous_variant	57198			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.510C>T	1.37:g.154304127C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.I170	ENST00000368489.3	37	c.510	CCDS1066.1	1																																																																																			ATP8B2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl		0.478	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	C	NM_020452		154304127	+1	no_errors	ENST00000368489	ensembl	human	known	70_37	silent	SNP	1.000	T
AURKA	6790	genome.wustl.edu	37	20	54963252	54963252	+	Start_Codon_SNP	SNP	A	A	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr20:54963252A>C	ENST00000347343.2	-	2	269	c.2T>G	c.(1-3)aTg>aGg	p.M1R	AURKA_ENST00000395909.4_Start_Codon_SNP_p.M1R|AURKA_ENST00000395914.1_Start_Codon_SNP_p.M1R|AURKA_ENST00000395915.3_Start_Codon_SNP_p.M1R|AURKA_ENST00000312783.6_Start_Codon_SNP_p.M1R|AURKA_ENST00000395907.1_Start_Codon_SNP_p.M1R|AURKA_ENST00000395913.3_Start_Codon_SNP_p.M1R|AURKA_ENST00000371356.2_Start_Codon_SNP_p.M1R|AURKA_ENST00000395911.1_Start_Codon_SNP_p.M1R	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A	1					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			AGATCGGTCCATGATGCCTGA	0.388																																					Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)												0													107.0	114.0	112.0					20																	54963252		2203	4300	6503	SO:0001582	initiator_codon_variant	6790			BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.2T>G	20.37:g.54963252A>C	ENSP00000216911:p.Met1Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.M1R	ENST00000347343.2	37	c.2	CCDS13451.1	20	.	.	.	.	.	.	.	.	.	.	A	18.58	3.655680	0.67586	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907;ENST00000441357;ENST00000420474;ENST00000422322;ENST00000456249;ENST00000451915	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69926	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.44;-0.0;2.53;2.25;2.02;1.67	4.59	4.59	0.56863	.	0.276458	0.31010	N	0.008427	T	0.79446	0.4447	.	.	.	0.80722	D	1	D;D;D;D;P;D;D	0.76494	0.96;0.999;0.999;0.974;0.86;0.98;0.988	D;D;D;P;B;P;P	0.71656	0.944;0.974;0.942;0.497;0.377;0.677;0.676	T	0.81758	-0.0786	9	0.87932	D	0	-31.6162	10.2832	0.43552	1.0:0.0:0.0:0.0	.	1;1;1;1;1;1;1	Q5QPD1;Q5QPD2;A3KFJ1;Q5QPD4;A3KFJ0;B2R6Z3;O14965	.;.;.;.;.;.;AURKA_HUMAN	R	1	ENSP00000379245:M1R;ENSP00000379250:M1R;ENSP00000216911:M1R;ENSP00000379251:M1R;ENSP00000321591:M1R;ENSP00000360407:M1R;ENSP00000379249:M1R;ENSP00000379247:M1R;ENSP00000379243:M1R;ENSP00000393452:M1R;ENSP00000388073:M1R;ENSP00000405042:M1R;ENSP00000405170:M1R;ENSP00000401358:M1R	ENSP00000321591:M1R	M	-	2	0	AURKA	54396659	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.144000	0.58057	1.915000	0.55452	0.477000	0.44152	ATG	AURKA	-	NULL		0.388	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AURKA	HGNC	protein_coding	OTTHUMT00000079804.3	A	NM_003600	Missense_Mutation	54963252	-1	no_errors	ENST00000312783	ensembl	human	known	70_37	missense	SNP	1.000	C
BCR	613	genome.wustl.edu	37	22	23523873	23523873	+	Silent	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:23523873C>G	ENST00000305877.8	+	1	1477	c.726C>G	c.(724-726)gtC>gtG	p.V242V	BCR_ENST00000359540.3_Silent_p.V242V|BCR_ENST00000398512.5_Silent_p.V242V	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	242	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GCTGCGGCGTCGACGGCGACT	0.677			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													30.0	34.0	32.0					22																	23523873		2194	4273	6467	SO:0001819	synonymous_variant	613				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.726C>G	22.37:g.23523873C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	Silent	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.V242	ENST00000305877.8	37	c.726	CCDS13806.1	22																																																																																			BCR	-	NULL		0.677	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	C	NM_004327		23523873	+1	no_errors	ENST00000305877	ensembl	human	known	70_37	silent	SNP	0.068	G
BIN3	55909	genome.wustl.edu	37	8	22494060	22494060	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:22494060C>T	ENST00000276416.6	-	4	206	c.138G>A	c.(136-138)aaG>aaA	p.K46K	BIN3_ENST00000399977.4_Intron|BIN3_ENST00000519335.1_5'UTR|BIN3_ENST00000519513.1_Intron|BIN3_ENST00000520292.1_Silent_p.K46K	NM_018688.4	NP_061158.1	Q9NQY0	BIN3_HUMAN	bridging integrator 3	46	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				actin filament organization (GO:0007015)|barrier septum assembly (GO:0000917)|cytokinesis (GO:0000910)|myoblast migration involved in skeletal muscle regeneration (GO:0014839)|protein localization (GO:0008104)|regulation of lamellipodium assembly (GO:0010591)|skeletal muscle fiber development (GO:0048741)|unidimensional cell growth (GO:0009826)	actin filament (GO:0005884)|cytoplasm (GO:0005737)	cytoskeletal adaptor activity (GO:0008093)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	9		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CGGTGCTCTTCTTCATGTCTT	0.647																																																	0													109.0	130.0	123.0					8																	22494060		1967	4023	5990	SO:0001819	synonymous_variant	55909				CCDS47825.1	8p21.2	2008-07-04			ENSG00000147439	ENSG00000147439			1054	protein-coding gene	gene with protein product		606396				16524918	Standard	NM_018688		Approved		uc003xcl.3	Q9NQY0	OTTHUMG00000163844	ENST00000276416.6:c.138G>A	8.37:g.22494060C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BVG2|Q9NVY9	Silent	SNP	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom	p.K46	ENST00000276416.6	37	c.138	CCDS47825.1	8																																																																																			BIN3	-	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom		0.647	BIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIN3	HGNC	protein_coding	OTTHUMT00000375895.1	C			22494060	-1	no_errors	ENST00000276416	ensembl	human	known	70_37	silent	SNP	1.000	T
BMP3	651	genome.wustl.edu	37	4	81952680	81952680	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:81952680G>T	ENST00000282701.2	+	1	562	c.242G>T	c.(241-243)gGa>gTa	p.G81V		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	81					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.G81E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TCCCTGGAGGGAGGCTCGCAG	0.672																																																	1	Substitution - Missense(1)	lung(1)											14.0	17.0	16.0					4																	81952680		2201	4297	6498	SO:0001583	missense	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.242G>T	4.37:g.81952680G>T	ENSP00000282701:p.Gly81Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VAS5	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,pirsf_BMP3/GDF10	p.G81V	ENST00000282701.2	37	c.242	CCDS3588.1	4	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416362	0.25552	.	.	ENSG00000152785	ENST00000282701	T	0.66099	-0.19	4.62	1.86	0.25419	Transforming growth factor-beta, N-terminal (1);	0.816239	0.10799	N	0.632865	T	0.37293	0.0998	N	0.08118	0	0.09310	N	1	B	0.20164	0.042	B	0.19666	0.026	T	0.22417	-1.0217	10	0.33940	T	0.23	.	4.6419	0.12552	0.0836:0.1569:0.6075:0.152	.	81	P12645	BMP3_HUMAN	V	81	ENSP00000282701:G81V	ENSP00000282701:G81V	G	+	2	0	BMP3	82171704	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	0.060000	0.14342	0.259000	0.21709	0.655000	0.94253	GGA	BMP3	-	pfam_TGF-b_N,pirsf_BMP3/GDF10		0.672	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP3	HGNC	protein_coding	OTTHUMT00000252634.1	G			81952680	+1	no_errors	ENST00000282701	ensembl	human	known	70_37	missense	SNP	0.003	T
BTBD9	114781	genome.wustl.edu	37	6	38548069	38548069	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:38548069G>A	ENST00000481247.1	-	5	1110	c.959C>T	c.(958-960)tCc>tTc	p.S320F	BTBD9_ENST00000403056.1_Missense_Mutation_p.S320F|BTBD9_ENST00000314100.6_Missense_Mutation_p.S252F|BTBD9_ENST00000408958.1_Missense_Mutation_p.S252F|BTBD9_ENST00000419706.2_Missense_Mutation_p.S261F	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	320					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)			p.S252F(1)|p.S320F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						CTCGATGCCGGAACGGCAGTC	0.428																																																	2	Substitution - Missense(2)	breast(2)											140.0	134.0	136.0					6																	38548069		1899	4118	6017	SO:0001583	missense	114781				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.959C>T	6.37:g.38548069G>A	ENSP00000418751:p.Ser320Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_BTB/POZ_fold,superfamily_Galactose-bd-like,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S320F	ENST00000481247.1	37	c.959	CCDS47418.1	6	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855511	0.51376	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	D;D;T;D;D	0.98296	-4.85;-4.85;-1.04;-4.85;-4.85	5.48	5.48	0.80851	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.217432	0.49305	D	0.000141	D	0.96784	0.8950	L	0.34521	1.04	0.58432	D	0.999999	P;D	0.61697	0.593;0.99	B;P	0.56343	0.257;0.796	D	0.95508	0.8583	10	0.15952	T	0.53	.	19.3387	0.94332	0.0:0.0:1.0:0.0	.	261;320	Q494V9;Q96Q07	.;BTBD9_HUMAN	F	252;320;261;320;252	ENSP00000323408:S252F;ENSP00000418751:S320F;ENSP00000415365:S261F;ENSP00000386121:S320F;ENSP00000386211:S252F	ENSP00000323408:S252F	S	-	2	0	BTBD9	38656047	1.000000	0.71417	0.993000	0.49108	0.673000	0.39480	7.817000	0.86213	2.588000	0.87417	0.655000	0.94253	TCC	BTBD9	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like		0.428	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD9	HGNC	protein_coding	OTTHUMT00000040433.2	G	NM_152733		38548069	-1	no_errors	ENST00000403056	ensembl	human	known	70_37	missense	SNP	0.985	A
C12orf42	374470	genome.wustl.edu	37	12	103696206	103696206	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:103696206G>A	ENST00000378113.2	-	6	988	c.763C>T	c.(763-765)Cag>Tag	p.Q255*	C12orf42_ENST00000548883.1_Nonsense_Mutation_p.Q255*|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Nonsense_Mutation_p.Q188*	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	255										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						GGGTGTGCCTGAGCGCCTGCT	0.672																																																	0													48.0	57.0	54.0					12																	103696206		2085	4213	6298	SO:0001587	stop_gained	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.763C>T	12.37:g.103696206G>A	ENSP00000367353:p.Gln255*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A64|Q4G0S2	Nonsense_Mutation	SNP	NULL	p.Q255*	ENST00000378113.2	37	c.763	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084881	0.55861	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	.	.	.	3.37	0.0861	0.14444	.	2.548460	0.02268	N	0.068191	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.9191	1.2231	0.01928	0.138:0.2292:0.3986:0.2342	.	.	.	.	X	255;188;255	.	ENSP00000367353:Q255X	Q	-	1	0	C12orf42	102220336	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.656000	0.24948	0.131000	0.18576	0.491000	0.48974	CAG	C12orf42	-	NULL		0.672	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1	G	NM_198521		103696206	-1	no_errors	ENST00000378113	ensembl	human	known	70_37	nonsense	SNP	0.000	A
C12orf42	374470	genome.wustl.edu	37	12	103696275	103696275	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:103696275G>C	ENST00000378113.2	-	6	919	c.694C>G	c.(694-696)Ctg>Gtg	p.L232V	C12orf42_ENST00000548883.1_Missense_Mutation_p.L232V|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.L165V	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	232										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						GTGCTCTGCAGAGCGCCGGGC	0.642																																																	0													32.0	37.0	35.0					12																	103696275		1947	4148	6095	SO:0001583	missense	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.694C>G	12.37:g.103696275G>C	ENSP00000367353:p.Leu232Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A64|Q4G0S2	Missense_Mutation	SNP	NULL	p.L232V	ENST00000378113.2	37	c.694	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	0.205	-1.041466	0.02013	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.46451	0.87;0.87;0.87	4.24	-0.0954	0.13641	.	2.277640	0.02341	N	0.074858	T	0.26521	0.0648	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.09997	-1.0649	10	0.33940	T	0.23	7.5315	1.8633	0.03193	0.1907:0.3119:0.3566:0.1408	.	232	Q96LP6	CL042_HUMAN	V	232;165;232	ENSP00000447908:L232V;ENSP00000449362:L165V;ENSP00000367353:L232V	ENSP00000367353:L232V	L	-	1	2	C12orf42	102220405	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.123000	0.10611	-0.142000	0.11354	0.561000	0.74099	CTG	C12orf42	-	NULL		0.642	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1	G	NM_198521		103696275	-1	no_errors	ENST00000378113	ensembl	human	known	70_37	missense	SNP	0.000	C
C12orf42	374470	genome.wustl.edu	37	12	103696334	103696334	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:103696334G>A	ENST00000378113.2	-	6	860	c.635C>T	c.(634-636)tCt>tTt	p.S212F	C12orf42_ENST00000548883.1_Missense_Mutation_p.S212F|C12orf42_ENST00000315192.8_Intron|C12orf42_ENST00000548048.1_Missense_Mutation_p.S145F	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	212										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						TCTGGCGGCAGAACCTGGAAG	0.632																																																	0													23.0	26.0	25.0					12																	103696334		1979	4148	6127	SO:0001583	missense	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.635C>T	12.37:g.103696334G>A	ENSP00000367353:p.Ser212Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A64|Q4G0S2	Missense_Mutation	SNP	NULL	p.S212F	ENST00000378113.2	37	c.635	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607015	0.46527	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.54479	0.57;0.57;0.57	4.24	0.0602	0.14335	.	2.276010	0.02126	N	0.055969	T	0.39682	0.1087	L	0.27053	0.805	0.09310	N	1	B	0.25441	0.126	B	0.25614	0.062	T	0.34477	-0.9827	10	0.87932	D	0	0.7868	3.4212	0.07395	0.4523:0.2103:0.3374:0.0	.	212	Q96LP6	CL042_HUMAN	F	212;145;212	ENSP00000447908:S212F;ENSP00000449362:S145F;ENSP00000367353:S212F	ENSP00000367353:S212F	S	-	2	0	C12orf42	102220464	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	0.258000	0.18387	0.099000	0.17552	0.561000	0.74099	TCT	C12orf42	-	NULL		0.632	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1	G	NM_198521		103696334	-1	no_errors	ENST00000378113	ensembl	human	known	70_37	missense	SNP	0.000	A
C17orf50	146853	genome.wustl.edu	37	17	34091481	34091481	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:34091481G>T	ENST00000285023.4	+	3	401	c.369G>T	c.(367-369)gaG>gaT	p.E123D	C17orf50_ENST00000586491.1_Missense_Mutation_p.D94Y|C17orf50_ENST00000588628.1_Missense_Mutation_p.D131Y	NM_145272.3	NP_660315.2	Q8WW18	CQ050_HUMAN	chromosome 17 open reading frame 50	123													Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCGTGCTGGAGATCCGGCGAC	0.726																																																	0													3.0	5.0	4.0					17																	34091481		1761	3873	5634	SO:0001583	missense	146853			BC021727	CCDS42298.1	17q12	2014-05-06			ENSG00000154768	ENSG00000270806			29581	protein-coding gene	gene with protein product							Standard	NM_145272		Approved		uc002hjx.3	Q8WW18	OTTHUMG00000188389	ENST00000285023.4:c.369G>T	17.37:g.34091481G>T	ENSP00000285023:p.Glu123Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6Q621	Missense_Mutation	SNP	NULL	p.E123D	ENST00000285023.4	37	c.369	CCDS42298.1	17	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362822	0.61403	.	.	ENSG00000154768	ENST00000285023	T	0.56275	0.47	4.92	3.94	0.45596	.	0.330330	0.22065	N	0.065115	T	0.55449	0.1921	L	0.27053	0.805	0.27049	N	0.963821	D	0.64830	0.994	D	0.63703	0.917	T	0.49790	-0.8902	10	0.87932	D	0	-27.9992	10.4431	0.44477	0.0:0.0:0.8056:0.1944	.	123	Q8WW18	CQ050_HUMAN	D	123	ENSP00000285023:E123D	ENSP00000285023:E123D	E	+	3	2	C17orf50	31115594	1.000000	0.71417	0.990000	0.47175	0.318000	0.28184	1.820000	0.39032	1.258000	0.44101	0.557000	0.71058	GAG	C17orf50	-	NULL		0.726	C17orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf50	HGNC	protein_coding	OTTHUMT00000449132.1	G	NM_145272		34091481	+1	no_errors	ENST00000285023	ensembl	human	known	70_37	missense	SNP	0.929	T
C1orf54	79630	genome.wustl.edu	37	1	150248963	150248963	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:150248963G>A	ENST00000369102.1	+	6	993	c.223G>A	c.(223-225)Gag>Aag	p.E75K	C1orf54_ENST00000369099.3_Missense_Mutation_p.E75K|C1orf54_ENST00000369098.3_Missense_Mutation_p.E75K			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	75						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGAAGCAATAGAGACTACCAT	0.438																																																	0													144.0	121.0	129.0					1																	150248963		2203	4300	6503	SO:0001583	missense	79630			BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.223G>A	1.37:g.150248963G>A	ENSP00000358098:p.Glu75Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H5P3	Missense_Mutation	SNP	NULL	p.E75K	ENST00000369102.1	37	c.223	CCDS948.1	1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012191	0.35511	.	.	ENSG00000118292	ENST00000369102;ENST00000369099;ENST00000369098	.	.	.	4.52	4.52	0.55395	.	0.533599	0.17063	N	0.188498	T	0.30230	0.0758	L	0.43152	1.355	0.09310	N	1	B;B	0.25809	0.135;0.135	B;B	0.37480	0.214;0.251	T	0.16808	-1.0390	9	0.36615	T	0.2	-2.9398	12.9864	0.58594	0.0:0.0:1.0:0.0	.	75;75	Q5TB16;Q8WWF1	.;CA054_HUMAN	K	75	.	ENSP00000358094:E75K	E	+	1	0	C1orf54	148515587	0.660000	0.27420	0.074000	0.20217	0.021000	0.10359	4.008000	0.57103	2.512000	0.84698	0.551000	0.68910	GAG	C1orf54	-	NULL		0.438	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf54	HGNC	protein_coding	OTTHUMT00000035055.1	G	NM_024579		150248963	+1	no_errors	ENST00000369099	ensembl	human	known	70_37	missense	SNP	0.034	A
C20orf173	140873	genome.wustl.edu	37	20	34117114	34117114	+	Intron	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr20:34117114G>A	ENST00000246199.2	-	2	61				C20orf173_ENST00000444723.1_Missense_Mutation_p.S30L|RP3-477O4.5_ENST00000422009.1_RNA|C20orf173_ENST00000374345.4_Missense_Mutation_p.S30L			Q96LM9	CT173_HUMAN	chromosome 20 open reading frame 173											haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						CTGGGGTGCTGATTCAGGTGT	0.547																																																	0													157.0	132.0	140.0					20																	34117114		692	1591	2283	SO:0001627	intron_variant	140873			AL121586	CCDS46594.1	20q11.22	2012-10-30			ENSG00000125975	ENSG00000125975			16166	protein-coding gene	gene with protein product							Standard	NM_001145350		Approved	dJ477O4.4	uc010zvf.1	Q96LM9	OTTHUMG00000032340	ENST00000246199.2:c.218-38C>T	20.37:g.34117114G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6PVJ1|Q2M293|Q5JWS4|Q9H449	Missense_Mutation	SNP	NULL	p.S30L	ENST00000246199.2	37	c.89		20	.	.	.	.	.	.	.	.	.	.	G	12.53	1.964597	0.34659	.	.	ENSG00000125975	ENST00000444723;ENST00000374345	T	0.39592	1.07	4.15	-1.92	0.07618	.	2.720170	0.01334	N	0.011334	T	0.28400	0.0702	L	0.43152	1.355	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.11916	-1.0568	10	0.02654	T	1	-23.9084	3.7686	0.08633	0.5048:0.0:0.3143:0.1809	.	30	E9PFA0	.	L	30	ENSP00000403566:S30L	ENSP00000363465:S30L	S	-	2	0	C20orf173	33580528	0.000000	0.05858	0.000000	0.03702	0.678000	0.39670	-0.011000	0.12721	-0.302000	0.08869	0.558000	0.71614	TCA	C20orf173	-	NULL		0.547	C20orf173-001	KNOWN	basic	protein_coding	C20orf173	HGNC	protein_coding	OTTHUMT00000078874.6	G	NM_001145350		34117114	-1	no_errors	ENST00000444723	ensembl	human	known	70_37	missense	SNP	0.000	A
C2orf91	400950	genome.wustl.edu	37	2	42180244	42180244	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:42180244G>A	ENST00000378711.2	-	2	281	c.192C>T	c.(190-192)ctC>ctT	p.L64L	C2orf91_ENST00000403980.1_5'UTR	NM_001242815.1	NP_001229744.1	Q6ZV80	CB091_HUMAN	chromosome 2 open reading frame 91	64																	GTACTTGGCTGAGAGTGTGTC	0.527																																																	0																																										SO:0001819	synonymous_variant	400950				CCDS56116.1	2p21	2012-02-17			ENSG00000205086	ENSG00000205086			42966	protein-coding gene	gene with protein product							Standard	NM_001242815		Approved		uc002rsf.1	Q6ZV80	OTTHUMG00000152307	ENST00000378711.2:c.192C>T	2.37:g.42180244G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.L64	ENST00000378711.2	37	c.192	CCDS56116.1	2																																																																																			C2orf91	-	NULL		0.527	C2orf91-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf91	HGNC	protein_coding	OTTHUMT00000325755.1	G	NM_001242815		42180244	-1	no_errors	ENST00000378711	ensembl	human	novel	70_37	silent	SNP	0.001	A
CAAP1	79886	genome.wustl.edu	37	9	26842620	26842620	+	Silent	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:26842620G>C	ENST00000333916.5	-	6	853	c.765C>G	c.(763-765)ctC>ctG	p.L255L	CAAP1_ENST00000520187.1_Nonsense_Mutation_p.S110*|CAAP1_ENST00000535437.1_Silent_p.L110L	NM_001167575.1|NM_024828.3	NP_001161047.1|NP_079104.3	Q9H8G2	CAAP1_HUMAN	caspase activity and apoptosis inhibitor 1	255					apoptotic process (GO:0006915)												CATTTATACTGAGTACATCAC	0.413																																																	0													160.0	161.0	161.0					9																	26842620		2203	4300	6503	SO:0001819	synonymous_variant	79886			BC014658	CCDS6516.1	9p21.2	2012-04-20	2012-04-20	2012-04-20	ENSG00000120159	ENSG00000120159			25834	protein-coding gene	gene with protein product	"""conserved anti-apoptotic protein"""		"""chromosome 9 open reading frame 82"""	C9orf82		21980415	Standard	NM_024828		Approved	FLJ13657, CAAP	uc003zqc.3	Q9H8G2	OTTHUMG00000019706	ENST00000333916.5:c.765C>G	9.37:g.26842620G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DWT4|D3DRK4|Q5VY32|Q6IPE6|Q96C59	Nonsense_Mutation	SNP	NULL	p.S110*	ENST00000333916.5	37	c.329	CCDS6516.1	9	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415364	0.62511	.	.	ENSG00000120159	ENST00000520187	.	.	.	5.74	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.4594	15.8574	0.78989	0.0:0.0:0.8561:0.1439	.	.	.	.	X	110	.	ENSP00000427938:S110X	S	-	2	0	C9orf82	26832620	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.019000	0.41001	1.389000	0.46526	0.561000	0.74099	TCA	CAAP1	-	NULL		0.413	CAAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAAP1	HGNC	protein_coding	OTTHUMT00000051954.1	G	NM_024828		26842620	-1	no_errors	ENST00000520187	ensembl	human	putative	70_37	nonsense	SNP	1.000	C
C9orf114	51490	genome.wustl.edu	37	9	131588514	131588514	+	Intron	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:131588514C>G	ENST00000361256.5	-	7	549					NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114								poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						agtaccggctctgccacagac	0.642																																																	0																																										SO:0001627	intron_variant	51490				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.509-83G>C	9.37:g.131588514C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	RNA	SNP	-	NULL	ENST00000361256.5	37	NULL	CCDS6913.1	9																																																																																			C9orf114	-	-		0.642	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	HGNC	protein_coding	OTTHUMT00000054500.1	C	NM_016390		131588514	-1	no_errors	ENST00000466556	ensembl	human	known	70_37	rna	SNP	0.000	G
CACTIN	58509	genome.wustl.edu	37	19	3610756	3610756	+	3'UTR	SNP	G	G	A	rs201281300		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:3610756G>A	ENST00000429344.2	-	0	3494				CACTIN_ENST00000221899.3_Missense_Mutation_p.S838F|CACTIN-AS1_ENST00000592274.1_RNA|CACTIN_ENST00000248420.5_3'UTR	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit						cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										GAAACAAACGGAACTATTTCC	0.502																																																	0																																										SO:0001624	3_prime_UTR_variant	58509			BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.*1165C>T	19.37:g.3610756G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	pfam_Cactin_dom,pfam_Cactin_C	p.S838F	ENST00000429344.2	37	c.2513	CCDS45920.1	19	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.634541	0.00806	.	.	ENSG00000105298	ENST00000221899	.	.	.	2.79	-2.5	0.06384	.	.	.	.	.	T	0.35068	0.0919	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42189	-0.9466	5	0.87932	D	0	.	4.3226	0.11025	0.3123:0.2195:0.4682:0.0	.	.	.	.	F	838	.	ENSP00000221899:S838F	S	-	2	0	C19orf29	3561756	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.509000	0.06336	-0.530000	0.06349	-0.415000	0.06103	TCC	CACTIN	-	NULL		0.502	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	HGNC	protein_coding	OTTHUMT00000457370.2	G			3610756	-1	no_errors	ENST00000221899	ensembl	human	known	70_37	missense	SNP	0.000	A
CADPS	8618	genome.wustl.edu	37	3	62499350	62499350	+	Intron	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:62499350G>A	ENST00000383710.4	-	17	2931				CADPS_ENST00000283269.9_Silent_p.V871V|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCAAGCAGAAGACAGGATGCT	0.423																																																	0													118.0	93.0	102.0					3																	62499350		2203	4299	6502	SO:0001627	intron_variant	8618			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2582-907C>T	3.37:g.62499350G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V871	ENST00000383710.4	37	c.2613	CCDS46858.1	3																																																																																			CADPS	-	pfam_Ca-dep_secretion_activator		0.423	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	G	NM_003716, NM_183393, NM_183394		62499350	-1	no_errors	ENST00000283269	ensembl	human	known	70_37	silent	SNP	1.000	A
CAMTA1	23261	genome.wustl.edu	37	1	7724159	7724159	+	Missense_Mutation	SNP	G	G	A	rs140699847		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:7724159G>A	ENST00000303635.7	+	9	1759	c.1552G>A	c.(1552-1554)Ggg>Agg	p.G518R	CAMTA1_ENST00000439411.2_Missense_Mutation_p.G518R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTCGCCACCCGGGGAGCGGAG	0.597			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0									ARG/GLY	0,4406		0,0,2203	52.0	56.0	55.0		1552	5.0	0.0	1	dbSNP_134	55	1,8599	1.2+/-3.3	0,1,4299	no	missense	CAMTA1	NM_015215.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	518/1674	7724159	1,13005	2203	4300	6503	SO:0001583	missense	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1552G>A	1.37:g.7724159G>A	ENSP00000306522:p.Gly518Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.G518R	ENST00000303635.7	37	c.1552	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	g	1.316	-0.600933	0.03744	0.0	1.16E-4	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.20463	2.07;2.07	4.96	4.96	0.65561	.	0.749252	0.13010	N	0.420929	T	0.11110	0.0271	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.13926	-1.0491	10	0.30078	T	0.28	-2.5881	4.4848	0.11785	0.1714:0.0:0.6365:0.1921	.	518	Q9Y6Y1	CMTA1_HUMAN	R	518	ENSP00000306522:G518R;ENSP00000402561:G518R	ENSP00000306522:G518R	G	+	1	0	CAMTA1	7646746	0.104000	0.21937	0.008000	0.14137	0.065000	0.16274	1.784000	0.38674	2.313000	0.78055	0.493000	0.49557	GGG	CAMTA1	-	NULL		0.597	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	G	NM_015215		7724159	+1	no_errors	ENST00000303635	ensembl	human	known	70_37	missense	SNP	0.010	A
CATSPER2	117155	genome.wustl.edu	37	15	43931925	43931925	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:43931925G>A	ENST00000321596.5	-	6	832	c.633C>T	c.(631-633)atC>atT	p.I211I	CATSPER2_ENST00000354127.4_Silent_p.I211I|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000381761.1_Silent_p.I217I|CATSPER2_ENST00000396879.1_Silent_p.I211I|RNU6-610P_ENST00000384264.1_RNA|CATSPER2_ENST00000355438.2_Silent_p.I211I			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	211					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GCACCCGGCAGATCCTCAGAA	0.483																																																	0													49.0	58.0	55.0					15																	43931925		2191	4278	6469	SO:0001819	synonymous_variant	117155			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.633C>T	15.37:g.43931925G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NHT9|Q96P54|Q96P55	Silent	SNP	pfam_Ion_trans_dom	p.I211	ENST00000321596.5	37	c.633	CCDS10099.1	15																																																																																			CATSPER2	-	pfam_Ion_trans_dom		0.483	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	G	NM_054020		43931925	-1	no_errors	ENST00000299989	ensembl	human	known	70_37	silent	SNP	1.000	A
CCDC37	348807	genome.wustl.edu	37	3	126133025	126133025	+	Intron	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:126133025G>A	ENST00000352312.1	+	4	324				CCDC37_ENST00000510833.1_Silent_p.V76V|CCDC37_ENST00000393425.1_Intron|CCDC37_ENST00000505024.1_Intron	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37											NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		CTCTCTCCGTGAGTATCCAGG	0.557																																																	0													144.0	143.0	144.0					3																	126133025		2203	4300	6503	SO:0001627	intron_variant	348807			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.225+3G>A	3.37:g.126133025G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNA8|Q494V1|Q494V4|Q8N838	Silent	SNP	NULL	p.V76	ENST00000352312.1	37	c.228	CCDS3037.1	3																																																																																			CCDC37	-	NULL		0.557	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	G	NM_182628		126133025	+1	no_errors	ENST00000510833	ensembl	human	putative	70_37	silent	SNP	0.985	A
CCDC83	220047	genome.wustl.edu	37	11	85627082	85627082	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:85627082G>A	ENST00000342404.3	+	10	1102	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K	CCDC83_ENST00000376067.1_Missense_Mutation_p.E196K|CCDC83_ENST00000280245.4_Missense_Mutation_p.E327K|RP11-90K17.2_ENST00000531414.1_RNA			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	296										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				AGAGAAGTCAGAATTGCAACC	0.313																																																	0													96.0	98.0	97.0					11																	85627082		2203	4299	6502	SO:0001583	missense	220047			AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.886G>A	11.37:g.85627082G>A	ENSP00000344512:p.Glu296Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	NULL	p.E327K	ENST00000342404.3	37	c.979		11	.	.	.	.	.	.	.	.	.	.	G	1.903	-0.452553	0.04540	.	.	ENSG00000150676	ENST00000280245;ENST00000376067;ENST00000342404	T;T;T	0.42131	0.98;0.98;0.98	4.51	-4.48	0.03515	.	0.800320	0.11536	N	0.554260	T	0.17280	0.0415	N	0.11364	0.135	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.24119	-1.0169	9	.	.	.	-0.5004	6.6016	0.22703	0.2195:0.3487:0.4319:0.0	.	196;296;327	Q8IWF9-3;Q8IWF9;Q8IWF9-2	.;CCD83_HUMAN;.	K	327;196;296	ENSP00000280245:E327K;ENSP00000365235:E196K;ENSP00000344512:E296K	.	E	+	1	0	CCDC83	85304730	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.038000	0.13862	-0.742000	0.04790	-0.469000	0.05056	GAA	CCDC83	-	NULL		0.313	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	CCDC83	HGNC	protein_coding	OTTHUMT00000392215.1	G	NM_173556		85627082	+1	no_errors	ENST00000280245	ensembl	human	known	70_37	missense	SNP	0.000	A
CCNT2	905	genome.wustl.edu	37	2	135711875	135711875	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:135711875C>T	ENST00000264157.5	+	9	1880	c.1850C>T	c.(1849-1851)tCa>tTa	p.S617L	CCNT2_ENST00000537343.1_Missense_Mutation_p.S442L|CCNT2_ENST00000295238.6_Missense_Mutation_p.S617L	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	617	Poly-Ser.				cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		TCCAGCTCTTCAAGGAAGAGG	0.493																																																	0													144.0	136.0	139.0					2																	135711875		2203	4300	6503	SO:0001583	missense	905			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1850C>T	2.37:g.135711875C>T	ENSP00000264157:p.Ser617Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.S617L	ENST00000264157.5	37	c.1850	CCDS2174.1	2	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433281	0.25813	.	.	ENSG00000082258	ENST00000537343;ENST00000295238;ENST00000264157	T;T	0.37058	1.22;1.55	5.43	5.43	0.79202	.	0.330965	0.33753	N	0.004588	T	0.35653	0.0939	L	0.48642	1.525	0.43550	D	0.995858	B;B;P	0.35575	0.002;0.044;0.51	B;B;B	0.32864	0.003;0.024;0.154	T	0.18241	-1.0343	10	0.51188	T	0.08	.	19.2608	0.93967	0.0:1.0:0.0:0.0	.	442;617;617	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	L	442;617;617	ENSP00000295238:S617L;ENSP00000264157:S617L	ENSP00000264157:S617L	S	+	2	0	CCNT2	135428345	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.562000	0.60816	2.549000	0.85964	0.655000	0.94253	TCA	CCNT2	-	NULL		0.493	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT2	HGNC	protein_coding	OTTHUMT00000254629.1	C	NM_058241		135711875	+1	no_errors	ENST00000264157	ensembl	human	known	70_37	missense	SNP	0.997	T
CDH7	1005	genome.wustl.edu	37	18	63430284	63430284	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr18:63430284G>C	ENST00000397968.2	+	2	632	c.206G>C	c.(205-207)gGa>gCa	p.G69A	CDH7_ENST00000323011.3_Missense_Mutation_p.G69A|CDH7_ENST00000581601.1_3'UTR|CDH7_ENST00000536984.2_Missense_Mutation_p.G69A	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CTCTATGTAGGAAAGGTAGGG	0.408																																																	0													53.0	51.0	52.0					18																	63430284		2203	4299	6502	SO:0001583	missense	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.206G>C	18.37:g.63430284G>C	ENSP00000381058:p.Gly69Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G69A	ENST00000397968.2	37	c.206	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270463	0.80469	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.00311	8.15;8.15;8.15	5.45	5.45	0.79879	Cadherin (1);Cadherin-like (1);	0.000000	0.64402	D	0.000001	T	0.00695	0.0023	M	0.66378	2.025	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.87578	0.753;0.998	T	0.81420	-0.0941	10	0.72032	D	0.01	.	19.2996	0.94138	0.0:0.0:1.0:0.0	.	69;69	F5H5X9;Q9ULB5	.;CADH7_HUMAN	A	69	ENSP00000319166:G69A;ENSP00000443030:G69A;ENSP00000381058:G69A	ENSP00000319166:G69A	G	+	2	0	CDH7	61581264	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.029000	0.93718	2.555000	0.86185	0.655000	0.94253	GGA	CDH7	-	pfam_Cadherin,superfamily_Cadherin-like		0.408	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	G	NM_033646		63430284	+1	no_errors	ENST00000323011	ensembl	human	known	70_37	missense	SNP	1.000	C
CDK18	5129	genome.wustl.edu	37	1	205499656	205499656	+	Intron	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:205499656G>T	ENST00000360066.2	+	15	1613				CDK18_ENST00000429964.2_Intron|CDK18_ENST00000506784.1_Intron|CDK18_ENST00000509056.1_Intron	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CAGTGGAAATGAGACGCTGCC	0.627																																					Pancreas(180;489 2072 28461 40831 44265)												0																																										SO:0001627	intron_variant	5129			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1313-100G>T	1.37:g.205499656G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	-	NULL	ENST00000360066.2	37	NULL	CCDS44300.1	1																																																																																			CDK18	-	-		0.627	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	G	NM_002596		205499656	+1	no_errors	ENST00000459862	ensembl	human	known	70_37	rna	SNP	0.000	T
CEP192	55125	genome.wustl.edu	37	18	13049779	13049779	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr18:13049779C>T	ENST00000325971.8	+	15	2711	c.1118C>T	c.(1117-1119)tCt>tTt	p.S373F	CEP192_ENST00000430049.2_Missense_Mutation_p.S494F|CEP192_ENST00000506447.1_Missense_Mutation_p.S969F			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	373					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AAAAATACCTCTCCTGAGCAT	0.423																																																	0													91.0	92.0	92.0					18																	13049779		2203	4300	6503	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1118C>T	18.37:g.13049779C>T	ENSP00000317156:p.Ser373Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.S969F	ENST00000325971.8	37	c.2906		18	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642878	0.29246	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.79247	-1.25;-1.25;-1.25	5.29	4.42	0.53409	.	0.730819	0.12869	N	0.432499	T	0.80396	0.4615	M	0.62723	1.935	0.39126	D	0.961754	P;P;P	0.50272	0.487;0.933;0.933	B;B;P	0.52424	0.189;0.36;0.698	T	0.79240	-0.1885	10	0.54805	T	0.06	-13.0161	7.3628	0.26756	0.1765:0.7373:0.0:0.0862	.	494;969;373	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	F	969;373;373;494	ENSP00000427550:S969F;ENSP00000317156:S373F;ENSP00000389190:S494F	ENSP00000317156:S373F	S	+	2	0	CEP192	13039779	0.013000	0.17824	0.307000	0.25127	0.068000	0.16541	1.752000	0.38349	1.381000	0.46364	0.650000	0.86243	TCT	CEP192	-	NULL		0.423	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		C	NM_032142		13049779	+1	no_errors	ENST00000506447	ensembl	human	known	70_37	missense	SNP	0.995	T
CEP192	55125	genome.wustl.edu	37	18	13049781	13049781	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr18:13049781C>T	ENST00000325971.8	+	15	2713	c.1120C>T	c.(1120-1122)Cct>Tct	p.P374S	CEP192_ENST00000430049.2_Missense_Mutation_p.P495S|CEP192_ENST00000506447.1_Missense_Mutation_p.P970S			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	374					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AAATACCTCTCCTGAGCATGG	0.423																																																	0													91.0	92.0	92.0					18																	13049781		2203	4300	6503	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1120C>T	18.37:g.13049781C>T	ENSP00000317156:p.Pro374Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.P970S	ENST00000325971.8	37	c.2908		18	.	.	.	.	.	.	.	.	.	.	C	6.958	0.546605	0.13312	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.78126	-1.15;-1.15;-1.15	5.53	1.68	0.24146	.	0.878785	0.09901	N	0.741058	T	0.64103	0.2568	L	0.38531	1.155	0.37236	D	0.905886	B;B;B	0.31435	0.211;0.211;0.323	B;B;B	0.26770	0.04;0.04;0.073	T	0.54807	-0.8238	10	0.22706	T	0.39	-1.4712	7.5194	0.27618	0.0:0.6146:0.1178:0.2676	.	495;970;374	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	S	970;374;374;495	ENSP00000427550:P970S;ENSP00000317156:P374S;ENSP00000389190:P495S	ENSP00000317156:P374S	P	+	1	0	CEP192	13039781	0.001000	0.12720	0.232000	0.24009	0.068000	0.16541	0.332000	0.19751	0.382000	0.24878	-0.181000	0.13052	CCT	CEP192	-	NULL		0.423	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		C	NM_032142		13049781	+1	no_errors	ENST00000506447	ensembl	human	known	70_37	missense	SNP	0.994	T
CHD2	1106	genome.wustl.edu	37	15	93558026	93558026	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:93558026C>G	ENST00000394196.4	+	37	5861	c.4793C>G	c.(4792-4794)tCa>tGa	p.S1598*	CHD2_ENST00000557381.1_Nonsense_Mutation_p.S1598*	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1598					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCCCATACCTCACACAACCTT	0.527																																																	0													170.0	164.0	166.0					15																	93558026		2197	4298	6495	SO:0001587	stop_gained	1106			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4793C>G	15.37:g.93558026C>G	ENSP00000377747:p.Ser1598*	Somatic		WXS	Illumina HiSeq	Phase_IV	C6G482|Q96IP5	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.S1598*	ENST00000394196.4	37	c.4793	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	50	16.298595	0.99860	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000557759	.	.	.	5.8	5.8	0.92144	.	0.244717	0.20614	U	0.088912	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-1.0882	20.0544	0.97645	0.0:1.0:0.0:0.0	.	.	.	.	X	1598;1598;123	.	ENSP00000377747:S1598X	S	+	2	0	CHD2	91359030	0.900000	0.30661	0.246000	0.24233	0.990000	0.78478	5.330000	0.65899	2.746000	0.94184	0.591000	0.81541	TCA	CHD2	-	NULL		0.527	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	C	NM_001271		93558026	+1	no_errors	ENST00000557381	ensembl	human	putative	70_37	nonsense	SNP	0.616	G
CNOT1	23019	genome.wustl.edu	37	16	58581544	58581544	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:58581544G>A	ENST00000317147.5	-	26	3897	c.3565C>T	c.(3565-3567)Cgt>Tgt	p.R1189C	CNOT1_ENST00000569240.1_Missense_Mutation_p.R1184C|CNOT1_ENST00000441024.2_Missense_Mutation_p.R1189C|CNOT1_ENST00000245138.4_Intron|SNORA46_ENST00000384762.1_RNA	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1189	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AGCAAAGAACGATCTGAGAAA	0.363																																																	0													76.0	71.0	73.0					16																	58581544		2198	4300	6498	SO:0001583	missense	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3565C>T	16.37:g.58581544G>A	ENSP00000320949:p.Arg1189Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.R1189C	ENST00000317147.5	37	c.3565	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.266781	0.95399	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.20463	2.07;2.07	5.91	5.91	0.95273	.	0.048935	0.85682	D	0.000000	T	0.56485	0.1988	M	0.89715	3.055	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.999	D;P;D	0.79108	0.992;0.664;0.94	T	0.63637	-0.6592	10	0.87932	D	0	.	18.4816	0.90813	0.0:0.0:1.0:0.0	.	1189;1189;1184	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	1189;1184;1189	ENSP00000320949:R1189C;ENSP00000413113:R1189C	ENSP00000320949:R1189C	R	-	1	0	CNOT1	57139045	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.894000	0.87336	2.804000	0.96469	0.650000	0.86243	CGT	CNOT1	-	NULL		0.363	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	G	NM_016284		58581544	-1	no_errors	ENST00000317147	ensembl	human	known	70_37	missense	SNP	1.000	A
COL8A2	1296	genome.wustl.edu	37	1	36563680	36563680	+	Silent	SNP	C	C	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:36563680C>A	ENST00000397799.1	-	4	1826	c.1602G>T	c.(1600-1602)ggG>ggT	p.G534G	COL8A2_ENST00000303143.4_Silent_p.G534G|COL8A2_ENST00000481785.1_Silent_p.G469G			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	534	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATCGAAGGCCCCAGGGGCAC	0.751																																																	0													7.0	9.0	8.0					1																	36563680		2107	4173	6280	SO:0001819	synonymous_variant	1296			M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.1602G>T	1.37:g.36563680C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JV31|Q8TEJ5	Silent	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G534	ENST00000397799.1	37	c.1602	CCDS403.1	1																																																																																			COL8A2	-	pfam_Collagen		0.751	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	COL8A2	HGNC	protein_coding	OTTHUMT00000313674.1	C	NM_005202		36563680	-1	no_errors	ENST00000303143	ensembl	human	known	70_37	silent	SNP	0.760	A
CPT1A	1374	genome.wustl.edu	37	11	68579947	68579947	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:68579947G>A	ENST00000265641.5	-	3	393	c.239C>T	c.(238-240)tCg>tTg	p.S80L	CPT1A_ENST00000376618.2_Missense_Mutation_p.S80L|CPT1A_ENST00000540367.1_Missense_Mutation_p.S80L|CPT1A_ENST00000539743.1_Missense_Mutation_p.S80L	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	80					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TATTCCTAACGAGGGGTCGAT	0.483																																																	0													175.0	153.0	161.0					11																	68579947		2200	4294	6494	SO:0001583	missense	1374			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.239C>T	11.37:g.68579947G>A	ENSP00000265641:p.Ser80Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.S80L	ENST00000265641.5	37	c.239	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354589	0.82243	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.91771	0.7397	M	0.90650	3.135	0.80722	D	1	P;D;D	0.89917	0.876;1.0;1.0	B;D;D	0.91635	0.425;0.999;0.993	D	0.92816	0.6268	10	0.62326	D	0.03	.	18.815	0.92073	0.0:0.0:1.0:0.0	.	80;80;80	B2RAQ8;P50416;P50416-2	.;CPT1A_HUMAN;.	L	80	ENSP00000439084:S80L;ENSP00000365803:S80L;ENSP00000265641:S80L;ENSP00000446108:S80L	ENSP00000265641:S80L	S	-	2	0	CPT1A	68336523	1.000000	0.71417	0.959000	0.39883	0.292000	0.27327	9.181000	0.94874	2.669000	0.90835	0.561000	0.74099	TCG	CPT1A	-	NULL		0.483	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	G	NM_001876		68579947	-1	no_errors	ENST00000265641	ensembl	human	known	70_37	missense	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16956993	16956993	+	lincRNA	SNP	A	A	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:16956993A>G	ENST00000412962.1	-	0	294							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											ACTCCTCCCTACCCTGGCTCT	0.597																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16956993A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.597	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	A	NR_026752.1		16956993	-1	no_errors	ENST00000362058	ensembl	human	known	70_37	rna	SNP	0.002	G
CSF3R	1441	genome.wustl.edu	37	1	36933545	36933545	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:36933545G>A	ENST00000373106.1	-	14	2289	c.1742C>T	c.(1741-1743)tCc>tTc	p.S581F	CSF3R_ENST00000338937.5_Missense_Mutation_p.S581F|CSF3R_ENST00000361632.4_Missense_Mutation_p.S581F|CSF3R_ENST00000373103.1_Missense_Mutation_p.S581F|CSF3R_ENST00000331941.5_Missense_Mutation_p.S581F|CSF3R_ENST00000418048.2_Missense_Mutation_p.S581F|CSF3R_ENST00000373104.1_Missense_Mutation_p.S581F|CSF3R_ENST00000440588.2_Missense_Mutation_p.S581F|CSF3R_ENST00000487540.2_5'UTR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	581	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCCACGGGAGGAGGCATTCAG	0.632																																																	0													53.0	63.0	59.0					1																	36933545		2203	4300	6503	SO:0001583	missense	1441			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.1742C>T	1.37:g.36933545G>A	ENSP00000362198:p.Ser581Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S581F	ENST00000373106.1	37	c.1742	CCDS413.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.25|14.25	2.478984|2.478984	0.44044|0.44044	.|.	.|.	ENSG00000119535|ENSG00000119535	ENST00000464465|ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	.|T;T;T;T;T;T;T;T	.|0.59364	.|0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.32|5.32	5.32|5.32	0.75619|0.75619	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.738828	.|0.13986	.|N	.|0.349170	T|T	0.76227|0.76227	0.3958|0.3958	M|M	0.71581|0.71581	2.175|2.175	0.39493|0.39493	D|D	0.968079|0.968079	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;0.999;0.999	.|D;D;D;D;D;D	.|0.97110	.|1.0;1.0;0.999;1.0;0.987;0.987	T|T	0.77611|0.77611	-0.2523|-0.2523	5|10	.|0.72032	.|D	.|0.01	-29.8063|-29.8063	16.159|16.159	0.81683|0.81683	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|581;581;581;581;581;581	.|Q1ZYL6;E1B6W6;Q99062-3;Q99062;Q99062-4;Q99062-2	.|.;.;.;CSF3R_HUMAN;.;.	S|F	133|581	.|ENSP00000362198:S581F;ENSP00000362196:S581F;ENSP00000362195:S581F;ENSP00000355406:S581F;ENSP00000332180:S581F;ENSP00000401588:S581F;ENSP00000345013:S581F;ENSP00000397568:S581F	.|ENSP00000332180:S581F	P|S	-|-	1|2	0|0	CSF3R|CSF3R	36706132|36706132	1.000000|1.000000	0.71417|0.71417	0.672000|0.672000	0.29872|0.29872	0.028000|0.028000	0.11728|0.11728	5.900000|5.900000	0.69853|0.69853	2.491000|2.491000	0.84063|0.84063	0.650000|0.650000	0.86243|0.86243	CCT|TCC	CSF3R	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.632	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	G	NM_156039		36933545	-1	no_errors	ENST00000373103	ensembl	human	known	70_37	missense	SNP	0.981	A
CSPP1	79848	genome.wustl.edu	37	8	68026058	68026058	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:68026058C>T	ENST00000262210.5	+	10	1264	c.1233C>T	c.(1231-1233)ctC>ctT	p.L411L	CSPP1_ENST00000412460.1_Silent_p.L117L	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	446					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ATTTAGAACTCAGGGTTGCAG	0.318																																																	0													94.0	95.0	95.0					8																	68026058		1800	4059	5859	SO:0001819	synonymous_variant	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1233C>T	8.37:g.68026058C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND63|Q70F00|Q8TBC1	Silent	SNP	NULL	p.L411	ENST00000262210.5	37	c.1233	CCDS43744.1	8																																																																																			CSPP1	-	NULL		0.318	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	C	NM_024790		68026058	+1	no_errors	ENST00000262210	ensembl	human	known	70_37	silent	SNP	0.977	T
CTBP1-AS2	92070	genome.wustl.edu	37	4	1246210	1246210	+	RNA	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:1246210G>C	ENST00000507044.1	+	0	1478				CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA					CTBP1 antisense RNA 2 (head to head)																		AAACAACCAAGAATTTTTTAA	0.368																																																	0																																												92070			AK056133		4p16.3	2013-06-14	2013-06-14	2013-06-14	ENSG00000196810	ENSG00000196810		"""Long non-coding RNAs"""	28307	non-coding RNA	RNA, long non-coding			"""chromosome 4 open reading frame 42"", ""CTBP1 antisense RNA 1 (head to head)"""	C4orf42, CTBP1-AS1		12477932	Standard	NR_033339		Approved	MGC21675	uc003gcz.3		OTTHUMG00000160166		4.37:g.1246210G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000507044.1	37	NULL		4																																																																																			CTBP1-AS1	-	-		0.368	CTBP1-AS2-001	KNOWN	basic|exp_conf	antisense	CTBP1-AS1	HGNC	antisense	OTTHUMT00000359476.1	G	NR_033339		1246210	+1	no_errors	ENST00000581398	ensembl	human	known	70_37	rna	SNP	0.002	C
CUL7	9820	genome.wustl.edu	37	6	43020151	43020151	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:43020151C>T	ENST00000265348.3	-	2	461	c.376G>A	c.(376-378)Gag>Aag	p.E126K	CUL7_ENST00000535468.1_Missense_Mutation_p.E178K			Q14999	CUL7_HUMAN	cullin 7	126					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			ACACACTCCTCCAGCTGCCGA	0.582																																																	0													83.0	68.0	73.0					6																	43020151		2203	4300	6503	SO:0001583	missense	9820			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.376G>A	6.37:g.43020151C>T	ENSP00000265348:p.Glu126Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E178K	ENST00000265348.3	37	c.532	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404687	0.42613	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.64260	-0.09;-0.06	5.51	4.64	0.57946	Armadillo-like helical (1);	0.132632	0.52532	D	0.000075	T	0.22936	0.0554	N	0.08118	0	0.80722	D	1	P;B	0.38335	0.627;0.002	B;B	0.34652	0.187;0.003	T	0.19910	-1.0291	10	0.48119	T	0.1	-6.8293	9.4078	0.38473	0.1421:0.7851:0.0:0.0728	.	178;126	F5H0L1;Q14999	.;CUL7_HUMAN	K	126;178	ENSP00000265348:E126K;ENSP00000438788:E178K	ENSP00000265348:E126K	E	-	1	0	CUL7	43128129	0.997000	0.39634	1.000000	0.80357	0.959000	0.62525	1.956000	0.40382	1.314000	0.45095	0.561000	0.74099	GAG	CUL7	-	superfamily_ARM-type_fold		0.582	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	C	NM_014780		43020151	-1	no_errors	ENST00000535468	ensembl	human	known	70_37	missense	SNP	1.000	T
DCAF17	80067	genome.wustl.edu	37	2	172309709	172309709	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:172309709G>C	ENST00000375255.3	+	6	940	c.613G>C	c.(613-615)Gag>Cag	p.E205Q	DCAF17_ENST00000468592.1_3'UTR|DCAF17_ENST00000539783.1_Missense_Mutation_p.E205Q	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17	205					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						AGGGATTCTAGAGATCAACAA	0.308																																																	0													103.0	92.0	96.0					2																	172309709		1819	4091	5910	SO:0001583	missense	80067			AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.613G>C	2.37:g.172309709G>C	ENSP00000364404:p.Glu205Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTW5|Q53TN3|Q9H908	Missense_Mutation	SNP	NULL	p.E205Q	ENST00000375255.3	37	c.613	CCDS2243.2	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.382412|4.382412	0.82792|0.82792	.|.	.|.	ENSG00000115827|ENSG00000115827	ENST00000375255;ENST00000539783;ENST00000339506|ENST00000429466	T;T|.	0.78246|.	-1.16;-1.16|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65995|0.65995	0.2745|0.2745	L|L	0.60455|0.60455	1.87|1.87	0.50632|0.50632	D|D	0.999885|0.999885	D;D|.	0.89917|.	1.0;0.996|.	D;D|.	0.87578|.	0.998;0.991|.	T|T	0.60058|0.60058	-0.7337|-0.7337	9|6	.|0.02654	.|T	.|1	-15.5201|-15.5201	19.3568|19.3568	0.94418|0.94418	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	205;205|.	F5H7W1;Q5H9S7|.	.;DCA17_HUMAN|.	Q|T	205;205;26|25	ENSP00000364404:E205Q;ENSP00000442238:E205Q|.	.|ENSP00000389290:R25T	E|R	+|+	1|2	0|0	DCAF17|DCAF17	172017955|172017955	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.991000|0.991000	0.79684|0.79684	6.774000|6.774000	0.75012|0.75012	2.683000|2.683000	0.91414|0.91414	0.585000|0.585000	0.79938|0.79938	GAG|AGA	DCAF17	-	NULL		0.308	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF17	HGNC	protein_coding	OTTHUMT00000255342.2	G	NM_025000		172309709	+1	no_errors	ENST00000375255	ensembl	human	known	70_37	missense	SNP	1.000	C
DDX17	10521	genome.wustl.edu	37	22	38895463	38895463	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:38895463C>T	ENST00000396821.3	-	3	579	c.480G>A	c.(478-480)gtG>gtA	p.V160V	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Silent_p.V81V	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	160					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CTCCCCCCCTCACTGTAATCT	0.368																																					Ovarian(55;1085 1454 6392 21425)												0													160.0	147.0	151.0					22																	38895463		2203	4300	6503	SO:0001819	synonymous_variant	10521			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.480G>A	22.37:g.38895463C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHM0|Q69YT1|Q6ICD6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.V160	ENST00000396821.3	37	c.480	CCDS46706.1	22																																																																																			DDX17	-	NULL		0.368	DDX17-001	KNOWN	basic|CCDS	protein_coding	DDX17	HGNC	protein_coding	OTTHUMT00000321476.2	C	NM_030881		38895463	-1	no_errors	ENST00000396821	ensembl	human	known	70_37	silent	SNP	1.000	T
DDX39A	10212	genome.wustl.edu	37	19	14520578	14520578	+	Silent	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:14520578G>C	ENST00000242776.4	-	7	941	c.840C>G	c.(838-840)ctC>ctG	p.L280L	CTC-548K16.5_ENST00000590626.1_RNA|DDX39A_ENST00000592927.1_5'UTR	NM_005804.3	NP_005795.2	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A	280	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|lung(2)|ovary(1)|pancreas(1)	11						GCACATCCAAGAGATCAAAGA	0.557																																																	0													87.0	77.0	81.0					19																	14520578		2203	4300	6503	SO:0001819	synonymous_variant	10212			U90426	CCDS12308.1	19p13.12	2011-02-08	2011-02-08	2011-02-08	ENSG00000123136	ENSG00000123136		"""DEAD-boxes"""	17821	protein-coding gene	gene with protein product	"""UAP56-related helicase, 49 kDa"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 39"""	DDX39		7601445	Standard	NM_005804		Approved	DDXL, BAT1L, URH49	uc002myo.3	O00148		ENST00000242776.4:c.840C>G	19.37:g.14520578G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5M0|Q9BVP6|Q9H5W0	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L280	ENST00000242776.4	37	c.840	CCDS12308.1	19																																																																																			DDX39A	-	pfscan_Helicase_C		0.557	DDX39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39A	HGNC	protein_coding	OTTHUMT00000459880.1	G	NM_138998		14520578	-1	no_errors	ENST00000242776	ensembl	human	known	70_37	silent	SNP	0.420	C
DDX58	23586	genome.wustl.edu	37	9	32485206	32485206	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:32485206C>T	ENST00000379883.2	-	10	1604	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	DDX58_ENST00000379882.1_Missense_Mutation_p.E438K|DDX58_ENST00000545044.1_Missense_Mutation_p.E280K|DDX58_ENST00000379868.1_Missense_Mutation_p.E280K|DDX58_ENST00000542096.1_Missense_Mutation_p.E412K	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	483	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		GCCAGACTCTCTGTGTCCCTC	0.383																																																	0													136.0	134.0	134.0					9																	32485206		2203	4300	6503	SO:0001583	missense	23586			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.1447G>A	9.37:g.32485206C>T	ENSP00000369213:p.Glu483Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_DEATH-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E483K	ENST00000379883.2	37	c.1447	CCDS6526.1	9	.	.	.	.	.	.	.	.	.	.	C	15.01	2.705230	0.48412	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096;ENST00000545044	T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35	4.95	4.04	0.47022	.	0.242632	0.32273	N	0.006323	D	0.88782	0.6530	M	0.80183	2.485	0.46927	D	0.999257	D;D;D;D	0.89917	1.0;0.969;0.999;1.0	D;D;D;D	0.91635	0.999;0.916;0.968;0.991	D	0.87972	0.2737	10	0.35671	T	0.21	-15.1554	13.3514	0.60603	0.0:0.8403:0.1597:0.0	.	280;438;412;483	F5H5W6;O95786-2;B3KWW1;O95786	.;.;.;DDX58_HUMAN	K	438;483;280;412;280	ENSP00000369212:E438K;ENSP00000369213:E483K;ENSP00000369197:E280K;ENSP00000442160:E412K;ENSP00000443055:E280K	ENSP00000369197:E280K	E	-	1	0	DDX58	32475206	0.994000	0.37717	0.478000	0.27316	0.038000	0.13279	2.578000	0.46051	1.206000	0.43276	0.655000	0.94253	GAG	DDX58	-	NULL		0.383	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1	C	NM_014314		32485206	-1	no_errors	ENST00000379883	ensembl	human	known	70_37	missense	SNP	0.990	T
DHTKD1	55526	genome.wustl.edu	37	10	12159690	12159690	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:12159690C>T	ENST00000263035.4	+	14	2400	c.2338C>T	c.(2338-2340)Caa>Taa	p.Q780*	U6_ENST00000606801.1_RNA	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	780					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GTCAACTCTTCAAGAAATGGC	0.458																																																	0													190.0	164.0	173.0					10																	12159690		2203	4300	6503	SO:0001587	stop_gained	55526			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2338C>T	10.37:g.12159690C>T	ENSP00000263035:p.Gln780*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CU5|Q9BUM8|Q9HCE2	Nonsense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.Q780*	ENST00000263035.4	37	c.2338	CCDS7087.1	10	.	.	.	.	.	.	.	.	.	.	C	38	6.834853	0.97873	.	.	ENSG00000181192	ENST00000263035	.	.	.	5.42	2.38	0.29361	.	0.556803	0.19381	N	0.115652	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-0.1831	18.7083	0.91646	0.0:0.3809:0.6191:0.0	.	.	.	.	X	780	.	ENSP00000263035:Q780X	Q	+	1	0	DHTKD1	12199696	0.998000	0.40836	0.990000	0.47175	0.743000	0.42351	0.514000	0.22786	0.192000	0.20272	0.655000	0.94253	CAA	DHTKD1	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.458	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	C	NM_018706		12159690	+1	no_errors	ENST00000263035	ensembl	human	known	70_37	nonsense	SNP	0.996	T
DLGAP2	9228	genome.wustl.edu	37	8	1616650	1616650	+	Missense_Mutation	SNP	G	G	C	rs370770474		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:1616650G>C	ENST00000421627.2	+	6	1860	c.1726G>C	c.(1726-1728)Gac>Cac	p.D576H		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	655					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GTGGCCCCAGGACAGCCGCGG	0.667																																																	0													12.0	18.0	16.0					8																	1616650		2082	4185	6267	SO:0001583	missense	9228			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1726G>C	8.37:g.1616650G>C	ENSP00000400258:p.Asp576His	Somatic		WXS	Illumina HiSeq	Phase_IV	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.D576H	ENST00000421627.2	37	c.1726	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.89|19.89	3.910926|3.910926	0.72983|0.72983	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.19806|.	2.12|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.085855|.	0.85682|.	D|.	0.000000|.	T|T	0.75309|0.75309	0.3832|0.3832	M|M	0.67953|0.67953	2.075|2.075	0.43191|0.43191	D|D	0.995021|0.995021	D;D|.	0.76494|.	0.999;0.978|.	D;P|.	0.71414|.	0.973;0.867|.	T|T	0.73372|0.73372	-0.4003|-0.4003	10|5	0.72032|.	D|.	0.01|.	-9.8252|-9.8252	19.458|19.458	0.94903|0.94903	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	655;655|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	H|S	621;576|592	ENSP00000400258:D576H|.	ENSP00000348366:D621H|.	D|R	+|+	1|3	0|2	DLGAP2|DLGAP2	1604057|1604057	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.731000|0.731000	0.41821|0.41821	4.858000|4.858000	0.62947|0.62947	2.594000|2.594000	0.87642|0.87642	0.655000|0.655000	0.94253|0.94253	GAC|AGG	DLGAP2	-	NULL		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	G	NM_004745		1616650	+1	no_errors	ENST00000421627	ensembl	human	known	70_37	missense	SNP	1.000	C
DMXL2	23312	genome.wustl.edu	37	15	51868299	51868299	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:51868299C>G	ENST00000251076.5	-	2	454	c.167G>C	c.(166-168)gGa>gCa	p.G56A	DMXL2_ENST00000449909.3_Missense_Mutation_p.G56A|DMXL2_ENST00000560421.1_5'UTR|DMXL2_ENST00000543779.2_Missense_Mutation_p.G56A	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	56						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTGGATGTTTCCATGCTTAGC	0.323																																																	0													147.0	136.0	140.0					15																	51868299		2195	4293	6488	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.167G>C	15.37:g.51868299C>G	ENSP00000251076:p.Gly56Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G56A	ENST00000251076.5	37	c.167	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.071881	0.93950	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.11821	2.74;2.74;2.74	5.32	5.32	0.75619	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.40886	0.1135	M	0.73962	2.25	0.41549	D	0.988561	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.997;0.997	T	0.31447	-0.9943	10	0.72032	D	0.01	.	19.0042	0.92843	0.0:1.0:0.0:0.0	.	56;56;56	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	A	56	ENSP00000251076:G56A;ENSP00000441858:G56A;ENSP00000400855:G56A	ENSP00000251076:G56A	G	-	2	0	DMXL2	49655591	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.486000	0.83907	0.650000	0.86243	GGA	DMXL2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.323	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	C	NM_015263		51868299	-1	no_errors	ENST00000543779	ensembl	human	known	70_37	missense	SNP	1.000	G
DOCK2	1794	genome.wustl.edu	37	5	169186751	169186751	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:169186751G>A	ENST00000256935.8	+	24	2499	c.2419G>A	c.(2419-2421)Gaa>Aaa	p.E807K	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.E299K	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	807					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCATGATGTAGAAATGGTCTT	0.463																																																	0													268.0	242.0	251.0					5																	169186751		2203	4300	6503	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2419G>A	5.37:g.169186751G>A	ENSP00000256935:p.Glu807Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RNR-like,smart_SH3_domain,pfscan_SH3_domain	p.E807K	ENST00000256935.8	37	c.2419	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703253	0.88924	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T;T	0.28895	1.59;1.59;1.59	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	N	0.05177	-0.1	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.73380	0.957;0.98	T	0.04915	-1.0918	10	0.02654	T	1	.	17.8627	0.88786	0.0:0.0:1.0:0.0	.	299;807	E7ERW7;Q92608	.;DOCK2_HUMAN	K	807;188;299;11	ENSP00000256935:E807K;ENSP00000429283:E299K;ENSP00000428841:E11K	ENSP00000256935:E807K	E	+	1	0	DOCK2	169119329	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.294000	0.89934	2.593000	0.87608	0.655000	0.94253	GAA	DOCK2	-	superfamily_ARM-type_fold		0.463	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	G	NM_004946		169186751	+1	no_errors	ENST00000256935	ensembl	human	known	70_37	missense	SNP	1.000	A
DPY19L2	283417	genome.wustl.edu	37	12	64041078	64041078	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:64041078G>A	ENST00000324472.4	-	5	839	c.656C>T	c.(655-657)aCc>aTc	p.T219I	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	219					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		ATTCCAGCAGGTCTTAGTTTC	0.333																																																	0													45.0	48.0	47.0					12																	64041078		2199	4286	6485	SO:0001583	missense	283417				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.656C>T	12.37:g.64041078G>A	ENSP00000315988:p.Thr219Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	pfam_Dpy-19	p.T219I	ENST00000324472.4	37	c.656	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	G	8.416	0.845253	0.16963	.	.	ENSG00000177990	ENST00000324472	T	0.40476	1.03	2.35	2.35	0.29111	.	0.324485	0.26635	U	0.023290	T	0.32436	0.0829	L	0.48642	1.525	0.80722	D	1	B	0.19583	0.037	B	0.24701	0.055	T	0.09378	-1.0677	9	.	.	.	.	8.2163	0.31514	0.0:0.0:1.0:0.0	.	219	Q6NUT2	D19L2_HUMAN	I	219	ENSP00000315988:T219I	.	T	-	2	0	DPY19L2	62327345	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	1.112000	0.31172	1.313000	0.45069	0.184000	0.17185	ACC	DPY19L2	-	pfam_Dpy-19		0.333	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2	G	NM_173812		64041078	-1	no_errors	ENST00000324472	ensembl	human	known	70_37	missense	SNP	1.000	A
EIF4A3	9775	genome.wustl.edu	37	17	78115141	78115141	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:78115141C>G	ENST00000269349.3	-	4	570	c.349G>C	c.(349-351)Gag>Cag	p.E117Q		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	117	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			ACAGCCAACTCTCTTGTGGGA	0.398																																																	0													124.0	116.0	119.0					17																	78115141		2203	4300	6503	SO:0001583	missense	9775			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.349G>C	17.37:g.78115141C>G	ENSP00000269349:p.Glu117Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E117Q	ENST00000269349.3	37	c.349	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	c	18.68	3.675545	0.67928	.	.	ENSG00000141543	ENST00000269349	T	0.20200	2.09	5.05	5.05	0.67936	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	H	0.99535	4.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82776	-0.0290	10	0.87932	D	0	.	16.259	0.82532	0.0:1.0:0.0:0.0	.	117	P38919	IF4A3_HUMAN	Q	117	ENSP00000269349:E117Q	ENSP00000269349:E117Q	E	-	1	0	EIF4A3	75729736	1.000000	0.71417	0.381000	0.26106	0.359000	0.29487	7.004000	0.76317	2.507000	0.84556	0.655000	0.94253	GAG	EIF4A3	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.398	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	C	NM_014740		78115141	-1	no_errors	ENST00000269349	ensembl	human	known	70_37	missense	SNP	1.000	G
EMC1	23065	genome.wustl.edu	37	1	19550021	19550021	+	Missense_Mutation	SNP	C	C	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:19550021C>A	ENST00000477853.1	-	19	2287	c.2245G>T	c.(2245-2247)Gac>Tac	p.D749Y	RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000480380.1_5'Flank|EMC1_ENST00000375208.3_Missense_Mutation_p.D727Y|EMC1_ENST00000375199.3_Missense_Mutation_p.D748Y	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	749						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TGGTGCGCGTCTGTGCTCTCT	0.542																																																	0													162.0	135.0	144.0					1																	19550021		2203	4300	6503	SO:0001583	missense	23065				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2245G>T	1.37:g.19550021C>A	ENSP00000420608:p.Asp749Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	pfam_DUF1620,superfamily_Quinonprotein_ADH-like	p.D749Y	ENST00000477853.1	37	c.2245	CCDS190.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.27|18.27	3.587029|3.587029	0.66105|0.66105	.|.	.|.	ENSG00000127463|ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208|ENST00000375197	T;T;T|.	0.27557|.	1.66;1.66;1.66|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76877|0.76877	0.4049|0.4049	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	P;D;D;D|.	0.89917|.	0.937;0.971;1.0;1.0|.	P;P;D;D|.	0.76575|.	0.748;0.804;0.988;0.972|.	T|T	0.75869|0.75869	-0.3165|-0.3165	10|5	0.66056|.	D|.	0.02|.	-24.7626|-24.7626	18.3722|18.3722	0.90411|0.90411	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	727;748;748;749|.	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766|.	.;.;.;K0090_HUMAN|.	Y|I	749;748;727|482	ENSP00000420608:D749Y;ENSP00000364345:D748Y;ENSP00000364354:D727Y|.	ENSP00000364345:D748Y|.	D|R	-|-	1|2	0|0	KIAA0090|KIAA0090	19422608|19422608	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.127000|0.127000	0.20565|0.20565	7.487000|7.487000	0.81328|0.81328	2.687000|2.687000	0.91594|0.91594	0.462000|0.462000	0.41574|0.41574	GAC|AGA	EMC1	-	NULL		0.542	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	C	NM_015047		19550021	-1	no_errors	ENST00000477853	ensembl	human	known	70_37	missense	SNP	1.000	A
RAP1GDS1	5910	genome.wustl.edu	37	4	99182769	99182769	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:99182769C>T	ENST00000408927.3	+	1	117				RAP1GDS1_ENST00000264572.7_Intron|RP11-323J4.1_ENST00000356499.2_RNA|RAP1GDS1_ENST00000512857.1_Intron|RAP1GDS1_ENST00000380158.4_Intron|RAP1GDS1_ENST00000453712.2_Intron|RAP1GDS1_ENST00000408900.3_Intron|RAP1GDS1_ENST00000339360.5_Intron	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1						myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		TTTTCTTTCTCGGCGTGCTGC	0.617			T	NUP98	T-ALL																																			Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													45.0	57.0	53.0					4																	99182769		2004	4166	6170	SO:0001627	intron_variant	0				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.4+49C>T	4.37:g.99182769C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	RNA	SNP	-	NULL	ENST00000408927.3	37	NULL	CCDS43253.1	4																																																																																			RP11-323J4.1	-	-		0.617	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000214559	Clone_based_vega_gene	protein_coding	OTTHUMT00000363273.2	C	NM_001100426		99182769	-1	no_errors	ENST00000356499	ensembl	human	known	70_37	rna	SNP	0.992	T
LINC01356	100996702	genome.wustl.edu	37	1	113392570	113392570	+	lincRNA	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:113392570C>G	ENST00000401018.1	-	0	695				RP3-522D1.1_ENST00000456651.1_lincRNA	NR_103746.1																						CCCCCCGCGTCTCCCGGGAGC	0.647																																																	0																																												0																															1.37:g.113392570C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000401018.1	37	NULL		1																																																																																			RP11-426L16.8	-	-		0.647	RP11-426L16.8-001	KNOWN	basic	lincRNA	ENSG00000215866	Clone_based_vega_gene	lincRNA	OTTHUMT00000033258.1	C			113392570	-1	no_errors	ENST00000401018	ensembl	human	known	70_37	rna	SNP	0.000	G
WDFY3	23001	genome.wustl.edu	37	4	85609036	85609036	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:85609036C>T	ENST00000295888.4	-	62	9951				WDFY3_ENST00000322366.6_Intron|RN7SL552P_ENST00000462094.2_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3						aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ttcaggaggtcaccaaatcgg	0.527																																																	0																																										SO:0001627	intron_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.9543+202G>A	4.37:g.85609036C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	RNA	SNP	-	NULL	ENST00000295888.4	37	NULL	CCDS3609.1	4																																																																																			Metazoa_SRP	-	-		0.527	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000239466	RFAM	protein_coding	OTTHUMT00000252811.2	C	NM_014991		85609036	-1	no_errors	ENST00000462094	ensembl	human	novel	70_37	rna	SNP	0.005	T
NDUFS7	374291	genome.wustl.edu	37	19	1393525	1393525	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:1393525C>T	ENST00000233627.9	+	7	840				NDUFS7_ENST00000539480.1_Intron|AC005329.7_ENST00000585596.1_RNA|NDUFS7_ENST00000313408.7_3'UTR|NDUFS7_ENST00000546283.1_3'UTR|NDUFS7_ENST00000414651.2_3'UTR|NDUFS7_ENST00000540530.1_Intron|AC005329.7_ENST00000501448.1_RNA|AC005329.7_ENST00000589734.1_RNA	NM_024407.4	NP_077718.3	O75251	NDUS7_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|synaptic membrane (GO:0097060)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|quinone binding (GO:0048038)			ovary(1)	1		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)|Breast(49;0.00186)|Lung NSC(49;0.00292)|all_lung(49;0.00419)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Doxorubicin(DB00997)	ATTCAGGCATCAGAGGGATCA	0.577																																																	0																																										SO:0001627	intron_variant	0			AF115969	CCDS12063.1	19p13	2011-07-04	2002-08-29		ENSG00000115286	ENSG00000115286		"""Mitochondrial respiratory chain complex / Complex I"""	7714	protein-coding gene	gene with protein product	"""complex I 20kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial"""	601825	"""NADH dehydrogenase (ubiquinone) Fe-S protein 7 (20kD) (NADH-coenzyme Q reductase)"""			8938450	Standard	NM_024407		Approved	PSST, FLJ46880, FLJ45860, CI-20	uc002lse.4	O75251	OTTHUMG00000168077	ENST00000233627.9:c.544+196C>T	19.37:g.1393525C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRI2|Q2T9H7|Q9BV17	RNA	SNP	-	NULL	ENST00000233627.9	37	NULL	CCDS12063.1	19																																																																																			AC005329.7	-	-		0.577	NDUFS7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248015	Clone_based_vega_gene	protein_coding	OTTHUMT00000397984.1	C	NM_024407		1393525	-1	no_errors	ENST00000501448	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-271K11.5	0	genome.wustl.edu	37	17	29374613	29374613	+	RNA	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:29374613G>T	ENST00000583112.1	-	0	125																		p.?(1)									TCCAGAGGTTGAACTGTGGCT	0.547																																																	1	Unknown(1)	central_nervous_system(1)																																										0																															17.37:g.29374613G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000583112.1	37	NULL		17																																																																																			RP11-271K11.5	-	-		0.547	RP11-271K11.5-002	KNOWN	basic	processed_transcript	ENSG00000265798	Clone_based_vega_gene	pseudogene	OTTHUMT00000444574.1	G			29374613	-1	no_errors	ENST00000583112	ensembl	human	known	70_37	rna	SNP	0.011	T
NRD1	4898	genome.wustl.edu	37	1	52263779	52263779	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:52263779C>T	ENST00000354831.7	-	24	2998				RP4-657D16.6_ENST00000607338.1_RNA|NRD1_ENST00000485608.1_Intron|RP4-657D16.3_ENST00000591675.1_RNA|NRD1_ENST00000544028.1_Intron|RP4-657D16.3_ENST00000586761.1_RNA|NRD1_ENST00000539524.1_Intron|NRD1_ENST00000352171.7_Intron|RP4-657D16.3_ENST00000588291.1_RNA	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TGCCCAGCATCAGAGGGGTCA	0.473																																																	0																																										SO:0001627	intron_variant	0			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2808+141G>A	1.37:g.52263779C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	RNA	SNP	-	NULL	ENST00000354831.7	37	NULL	CCDS559.1	1																																																																																			RP4-657D16.3	-	-		0.473	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266993	Clone_based_vega_gene	protein_coding	OTTHUMT00000023045.1	C	NM_002525		52263779	+1	no_errors	ENST00000586761	ensembl	human	known	70_37	rna	SNP	0.000	T
ERCC8	1161	genome.wustl.edu	37	5	60195471	60195471	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:60195471G>A	ENST00000265038.5	-	8	743	c.701C>T	c.(700-702)tCa>tTa	p.S234L	ERCC8_ENST00000543101.1_Missense_Mutation_p.S81L|ERCC8_ENST00000462279.1_5'UTR|ERCC8_ENST00000426742.2_Missense_Mutation_p.S176L	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8	234					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				AACAGCTTGTGACTTTTTCCC	0.313																																																	0													175.0	166.0	169.0					5																	60195471		2203	4299	6502	SO:0001583	missense	1161			U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.701C>T	5.37:g.60195471G>A	ENSP00000265038:p.Ser234Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB64|Q6FHX5|Q96GB9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S234L	ENST00000265038.5	37	c.701	CCDS3978.1	5	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419394	0.62622	.	.	ENSG00000049167	ENST00000426742;ENST00000265038;ENST00000543101;ENST00000536596	T;T;T	0.73258	-0.73;-0.48;-0.28	5.07	5.07	0.68467	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058383	0.64402	D	0.000001	T	0.58509	0.2127	L	0.28054	0.825	0.58432	D	0.999999	B;B	0.19706	0.038;0.012	B;B	0.16722	0.016;0.008	T	0.54728	-0.8250	10	0.12103	T	0.63	-28.4084	18.4566	0.90722	0.0:0.0:1.0:0.0	.	81;234	B4DGZ9;Q13216	.;ERCC8_HUMAN	L	176;234;81;233	ENSP00000400110:S176L;ENSP00000265038:S234L;ENSP00000441732:S81L	ENSP00000265038:S234L	S	-	2	0	ERCC8	60231228	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.032000	0.93736	2.357000	0.79964	0.557000	0.71058	TCA	ERCC8	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.313	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC8	HGNC	protein_coding	OTTHUMT00000214971.2	G	NM_000082		60195471	-1	no_errors	ENST00000265038	ensembl	human	known	70_37	missense	SNP	1.000	A
ERVV-1	147664	genome.wustl.edu	37	19	53517474	53517474	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:53517474G>A	ENST00000602168.1	+	1	301	c.131G>A	c.(130-132)tGt>tAt	p.C44Y	CTD-2620I22.3_ENST00000596769.1_lincRNA	NM_152473.2	NP_689686.2	B6SEH8	ERVV1_HUMAN	endogenous retrovirus group V, member 1	44						integral component of membrane (GO:0016021)											CTAAGCAACTGTTGGATCTGC	0.408																																																	0																																										SO:0001583	missense	147664			AK056776, BC104018, BC104019	CCDS59419.1	19q13.41	2014-05-02			ENSG00000269526	ENSG00000269526			26501	other	endogenous retrovirus						18826608, 21542922	Standard	NM_152473		Approved	FLJ32214, HERV-V1, ENVV1	uc002qap.3	B6SEH8	OTTHUMG00000182942	ENST00000602168.1:c.131G>A	19.37:g.53517474G>A	ENSP00000473153:p.Cys44Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.C44Y	ENST00000602168.1	37	c.131	CCDS59419.1	19																																																																																			ERVV-1	-	NULL		0.408	ERVV-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVV-1	HGNC	protein_coding	OTTHUMT00000464402.1	G	NM_152473		53517474	+1	no_errors	ENST00000602168	ensembl	human	known	70_37	missense	SNP	0.018	A
ETF1	2107	genome.wustl.edu	37	5	137846286	137846286	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:137846286C>T	ENST00000360541.5	-	9	1272	c.1051G>A	c.(1051-1053)Gaa>Aaa	p.E351K	ETF1_ENST00000499810.2_Missense_Mutation_p.E318K|ETF1_ENST00000503014.1_Missense_Mutation_p.E337K	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	351					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTATCCTTTTCTTGCTCTGGA	0.373																																																	0													124.0	115.0	118.0					5																	137846286		2202	4300	6502	SO:0001583	missense	2107			AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.1051G>A	5.37:g.137846286C>T	ENSP00000353741:p.Glu351Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	pfam_eRF1_2,pfam_eRF1_3,pfam_eRF1_1_Pelota,superfamily_Release_factor_eRF1/aRF1_N,tigrfam_Peptide_chain-rel_eRF1/aRF1	p.E351K	ENST00000360541.5	37	c.1051	CCDS4207.1	5	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039137	0.75617	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	.	.	.	5.93	5.07	0.68467	eRF1 domain 3 (1);	0.000000	0.85682	D	0.000000	T	0.70518	0.3233	M	0.89534	3.04	0.80722	D	1	P;B	0.35507	0.506;0.004	B;B	0.36922	0.236;0.031	T	0.74362	-0.3690	9	0.48119	T	0.1	-10.5397	14.7429	0.69469	0.0:0.9303:0.0:0.0697	.	337;351	B7Z7P8;P62495	.;ERF1_HUMAN	K	318;351;337	.	ENSP00000353741:E351K	E	-	1	0	ETF1	137874185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.471000	0.80985	1.512000	0.48834	0.655000	0.94253	GAA	ETF1	-	pfam_eRF1_3,tigrfam_Peptide_chain-rel_eRF1/aRF1		0.373	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETF1	HGNC	protein_coding	OTTHUMT00000251276.2	C	NM_004730		137846286	-1	no_errors	ENST00000360541	ensembl	human	known	70_37	missense	SNP	1.000	T
F5	2153	genome.wustl.edu	37	1	169509926	169509926	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:169509926C>T	ENST00000367797.3	-	13	4603	c.4402G>A	c.(4402-4404)Gaa>Aaa	p.E1468K	F5_ENST00000367796.3_Missense_Mutation_p.E1473K	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1468	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TGACTAGATTCAGAAGGGTAG	0.458																																																	0													86.0	88.0	87.0					1																	169509926		2203	4300	6503	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4402G>A	1.37:g.169509926C>T	ENSP00000356771:p.Glu1468Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.E1473K	ENST00000367797.3	37	c.4417	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	c	22.2	4.257409	0.80246	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98400	-4.91;-4.9	5.26	5.26	0.73747	.	0.158165	0.29646	N	0.011573	D	0.95101	0.8413	L	0.57536	1.79	0.23076	N	0.998335	P	0.43094	0.799	B	0.37650	0.255	D	0.94584	0.7782	9	0.25751	T	0.34	-8.2452	14.7108	0.69229	0.0:1.0:0.0:0.0	.	1468	P12259	FA5_HUMAN	K	1468;1473	ENSP00000356771:E1468K;ENSP00000356770:E1473K	ENSP00000356770:E1473K	E	-	1	0	F5	167776550	0.509000	0.26163	0.199000	0.23439	0.072000	0.16883	1.948000	0.40303	2.612000	0.88384	0.591000	0.81541	GAA	F5	-	NULL		0.458	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	C	NM_000130		169509926	-1	no_errors	ENST00000367796	ensembl	human	known	70_37	missense	SNP	0.525	T
FAM193A	8603	genome.wustl.edu	37	4	2701482	2701482	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:2701482C>T	ENST00000324666.5	+	17	3061	c.2710C>T	c.(2710-2712)Cgg>Tgg	p.R904W	FAM193A_ENST00000545951.1_Missense_Mutation_p.R904W|FAM193A_ENST00000502458.1_Missense_Mutation_p.R926W|FAM193A_ENST00000505311.1_Missense_Mutation_p.R904W|FAM193A_ENST00000382839.3_Missense_Mutation_p.R904W	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	904	Glu-rich.									NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GCAGAGGCGGCGggaggagga	0.547																																																	0													22.0	23.0	23.0					4																	2701482		2202	4300	6502	SO:0001583	missense	8603			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2710C>T	4.37:g.2701482C>T	ENSP00000324587:p.Arg904Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	NULL	p.R904W	ENST00000324666.5	37	c.2710	CCDS58875.1	4	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808956	0.70797	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.37058	1.23;1.63;1.22;1.23;1.23	5.75	3.97	0.46021	.	0.379471	0.29624	N	0.011623	T	0.38957	0.1060	L	0.29908	0.895	0.49051	D	0.999743	D;D;D;D;D	0.69078	0.997;0.997;0.997;0.99;0.99	P;P;P;P;P	0.55667	0.781;0.681;0.781;0.681;0.681	T	0.20739	-1.0266	10	0.87932	D	0	-1.4555	10.5767	0.45231	0.1408:0.5874:0.2718:0.0	.	904;926;904;926;904	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	W	904;904;904;926;758	ENSP00000372290:R904W;ENSP00000324587:R904W;ENSP00000443617:R904W;ENSP00000427505:R926W;ENSP00000427260:R758W	ENSP00000324587:R904W	R	+	1	2	FAM193A	2671280	0.670000	0.27512	0.055000	0.19348	0.869000	0.49853	0.441000	0.21611	0.720000	0.32209	0.650000	0.86243	CGG	FAM193A	-	NULL		0.547	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	C	NM_003704		2701482	+1	no_errors	ENST00000324666	ensembl	human	known	70_37	missense	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126241227	126241227	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:126241227G>C	ENST00000394329.3	+	1	3674	c.3661G>C	c.(3661-3663)Gaa>Caa	p.E1221Q		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1221	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TACAATATCAGAATCAGCAGC	0.348																																																	0													42.0	41.0	41.0					4																	126241227		1840	4091	5931	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3661G>C	4.37:g.126241227G>C	ENSP00000377862:p.Glu1221Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.E1221Q	ENST00000394329.3	37	c.3661	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	18.40	3.614760	0.66672	.	.	ENSG00000196159	ENST00000394329	T	0.75938	-0.98	4.86	4.86	0.63082	Cadherin (3);Cadherin-like (1);	0.000000	0.34411	U	0.003993	D	0.91102	0.7199	H	0.96916	3.905	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.93959	0.7239	10	0.72032	D	0.01	.	18.1662	0.89727	0.0:0.0:1.0:0.0	.	1221	Q6V0I7	FAT4_HUMAN	Q	1221	ENSP00000377862:E1221Q	ENSP00000377862:E1221Q	E	+	1	0	FAT4	126460677	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.454000	0.97621	2.536000	0.85505	0.561000	0.74099	GAA	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.348	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	G	NM_024582		126241227	+1	no_errors	ENST00000394329	ensembl	human	known	70_37	missense	SNP	1.000	C
FBXW7	55294	genome.wustl.edu	37	4	153247280	153247280	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:153247280G>A	ENST00000281708.4	-	10	2751	c.1522C>T	c.(1522-1524)Caa>Taa	p.Q508*	FBXW7_ENST00000263981.5_Nonsense_Mutation_p.Q428*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.Q332*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.Q390*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.Q508*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.Q508*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	508				Q -> R (in Ref. 7; AAH37320). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCATCATATTGAACACAGCGG	0.473			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											171.0	163.0	166.0					4																	153247280		2203	4300	6503	SO:0001587	stop_gained	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1522C>T	4.37:g.153247280G>A	ENSP00000281708:p.Gln508*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q508*	ENST00000281708.4	37	c.1522	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.412237	0.97546	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-15.9911	20.2406	0.98372	0.0:0.0:1.0:0.0	.	.	.	.	X	508;390;428;332	.	ENSP00000263981:Q428X	Q	-	1	0	FBXW7	153466730	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.772000	0.98984	2.857000	0.98124	0.650000	0.86243	CAA	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.473	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	G			153247280	-1	no_errors	ENST00000281708	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FCN1	2219	genome.wustl.edu	37	9	137801746	137801746	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:137801746G>A	ENST00000371806.3	-	9	970	c.879C>T	c.(877-879)ctC>ctT	p.L293L		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	293	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)	p.L291fs*3(1)		endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GGGGTCCCATGAGGTAGAGAC	0.512																																																	1	Deletion - Frameshift(1)	prostate(1)											143.0	133.0	136.0					9																	137801746		2203	4300	6503	SO:0001819	synonymous_variant	2219			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.879C>T	9.37:g.137801746G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYV5|Q92596	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L293	ENST00000371806.3	37	c.879	CCDS6985.1	9																																																																																			FCN1	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C		0.512	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN1	HGNC	protein_coding	OTTHUMT00000054963.1	G	NM_002003		137801746	-1	no_errors	ENST00000371806	ensembl	human	known	70_37	silent	SNP	0.200	A
FGA	2243	genome.wustl.edu	37	4	155506809	155506809	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:155506809C>G	ENST00000302053.3	-	5	1850	c.1772G>C	c.(1771-1773)aGa>aCa	p.R591T	FGA_ENST00000403106.3_Missense_Mutation_p.R591T	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	591					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GGAGTCTCCTCTGTTGTAACT	0.453																																					NSCLC(143;340 1922 20892 22370 48145)												0													135.0	130.0	131.0					4																	155506809		2203	4300	6503	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1772G>C	4.37:g.155506809C>G	ENSP00000306361:p.Arg591Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.R591T	ENST00000302053.3	37	c.1772	CCDS3787.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.25|12.25	1.881855|1.881855	0.33255|0.33255	.|.	.|.	ENSG00000171560|ENSG00000171560	ENST00000457487|ENST00000302053;ENST00000403106	.|T;T	.|0.58797	.|0.31;2.68	6.03|6.03	-5.62|-5.62	0.02481|0.02481	.|.	.|4.629720	.|0.00166	.|N	.|0.000015	T|T	0.49167|0.49167	0.1541|0.1541	L|L	0.49126|0.49126	1.545|1.545	0.09310|0.09310	N|N	1|1	.|B;B	.|0.21071	.|0.051;0.03	.|B;B	.|0.15052	.|0.012;0.005	T|T	0.40664|0.40664	-0.9551|-0.9551	6|10	0.66056|0.49607	D|T	0.02|0.09	.|.	7.9885|7.9885	0.30226|0.30226	0.0:0.266:0.1906:0.5434|0.0:0.266:0.1906:0.5434	.|.	.|591;591	.|P02671-2;P02671	.|.;FIBA_HUMAN	Q|T	233|591	.|ENSP00000306361:R591T;ENSP00000385981:R591T	ENSP00000407891:E233Q|ENSP00000306361:R591T	E|R	-|-	1|2	0|0	FGA|FGA	155726259|155726259	0.210000|0.210000	0.23517|0.23517	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.182000|-0.182000	0.09726|0.09726	-1.187000|-1.187000	0.02709|0.02709	-0.982000|-0.982000	0.02568|0.02568	GAG|AGA	FGA	-	NULL		0.453	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	C	NM_000508		155506809	-1	no_errors	ENST00000302053	ensembl	human	known	70_37	missense	SNP	0.015	G
FGFR4	2264	genome.wustl.edu	37	5	176523330	176523330	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:176523330G>C	ENST00000292408.4	+	15	2232	c.1987G>C	c.(1987-1989)Gac>Cac	p.D663H	FGFR4_ENST00000292410.3_Missense_Mutation_p.D623H|FGFR4_ENST00000393637.1_Missense_Mutation_p.D623H|FGFR4_ENST00000393648.2_Missense_Mutation_p.D595H|FGFR4_ENST00000502906.1_Missense_Mutation_p.D663H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	663	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GGCCTTGTTTGACCGGGTGTA	0.647										TSP Lung(9;0.080)																																							0													79.0	77.0	78.0					5																	176523330		2203	4300	6503	SO:0001583	missense	2264			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1987G>C	5.37:g.176523330G>C	ENSP00000292408:p.Asp663His	Somatic		WXS	Illumina HiSeq	Phase_IV	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D663H	ENST00000292408.4	37	c.1987	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	g	23.8	4.459788	0.84317	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89;-2.89	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92616	0.7654	N	0.20845	0.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93629	0.6954	10	0.51188	T	0.08	.	17.1688	0.86824	0.0:0.0:1.0:0.0	.	595;623;663	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	H	663;595;663;623;623;891	ENSP00000292408:D663H;ENSP00000377259:D595H;ENSP00000424960:D663H;ENSP00000292410:D623H;ENSP00000377254:D623H	ENSP00000292408:D663H	D	+	1	0	FGFR4	176455936	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	9.866000	0.99616	2.142000	0.66516	0.556000	0.70494	GAC	FGFR4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom		0.647	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	G			176523330	+1	no_errors	ENST00000292408	ensembl	human	known	70_37	missense	SNP	1.000	C
FKBP7	51661	genome.wustl.edu	37	2	179330622	179330622	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:179330622C>T	ENST00000424785.2	-	4	602	c.544G>A	c.(544-546)Gag>Aag	p.E182K	FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Missense_Mutation_p.E181K	NM_001135212.1|NM_181342.2	NP_001128684.1|NP_851939.1	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7	219	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CGTGGCTTCTCATCTTTTTCA	0.348																																					Melanoma(26;682 927 5286 17599 46613)												0													135.0	135.0	135.0					2																	179330622		2202	4300	6502	SO:0001583	missense	51661			AF092137	CCDS2280.1, CCDS46462.1	2q31.2	2013-01-10	2001-11-28		ENSG00000079150	ENSG00000079150		"""EF-hand domain containing"""	3723	protein-coding gene	gene with protein product		607062	"""FK506-binding protein 7"""			9806833	Standard	NM_181342		Approved	FKBP23	uc002umk.3	Q9Y680	OTTHUMG00000132577	ENST00000424785.2:c.544G>A	2.37:g.179330622C>T	ENSP00000413152:p.Glu182Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG70|Q6V3B2|Q86U65|Q96DA4|Q9Y6B0	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.E182K	ENST00000424785.2	37	c.544	CCDS2280.1	2	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363828	0.41902	.	.	ENSG00000079150	ENST00000424785;ENST00000350591;ENST00000434643	T;T	0.71698	-0.59;-0.59	5.88	3.17	0.36434	.	0.460849	0.25854	N	0.027866	T	0.49287	0.1548	.	.	.	0.28586	N	0.909865	B;B	0.19200	0.034;0.032	B;B	0.25614	0.036;0.062	T	0.32851	-0.9891	9	0.06757	T	0.87	-0.5568	11.419	0.49969	0.0:0.813:0.0:0.187	.	181;182	Q9Y680-3;Q9Y680-2	.;.	K	182;217;181	ENSP00000413152:E182K;ENSP00000415486:E181K	ENSP00000335194:E217K	E	-	1	0	FKBP7	179038868	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.870000	0.48451	0.410000	0.25675	-0.794000	0.03295	GAG	FKBP7	-	NULL		0.348	FKBP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP7	HGNC	protein_coding	OTTHUMT00000255783.1	C	NM_181342		179330622	-1	no_errors	ENST00000424785	ensembl	human	known	70_37	missense	SNP	1.000	T
FREM3	166752	genome.wustl.edu	37	4	144619231	144619231	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:144619231G>A	ENST00000329798.5	-	1	2597	c.2598C>T	c.(2596-2598)ttC>ttT	p.F866F	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	866					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						GGACTAATATGAAGACAATTT	0.458																																																	0													98.0	83.0	87.0					4																	144619231		692	1591	2283	SO:0001819	synonymous_variant	166752			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.2598C>T	4.37:g.144619231G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.F866	ENST00000329798.5	37	c.2598	CCDS54808.1	4																																																																																			FREM3	-	NULL		0.458	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	G	XM_094074		144619231	-1	no_errors	ENST00000329798	ensembl	human	putative	70_37	silent	SNP	0.998	A
FRMD4A	55691	genome.wustl.edu	37	10	13782229	13782229	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:13782229G>C	ENST00000357447.2	-	11	1005	c.637C>G	c.(637-639)Ctc>Gtc	p.L213V	FRMD4A_ENST00000358621.4_Missense_Mutation_p.L198V|FRMD4A_ENST00000342409.2_Missense_Mutation_p.L229V|RP11-353M9.1_ENST00000449462.1_RNA|FRMD4A_ENST00000378503.1_Missense_Mutation_p.L213V	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	213	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TAGGTTGGGAGAGACTCCACG	0.438																																																	0													118.0	112.0	114.0					10																	13782229		2203	4300	6503	SO:0001583	missense	55691			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.637C>G	10.37:g.13782229G>C	ENSP00000350032:p.Leu213Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.L213V	ENST00000357447.2	37	c.637	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	G	22.9	4.356041	0.82243	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	5.9	5.9	0.94986	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.72894	2.215	0.80722	D	1	P;P;P	0.49696	0.872;0.877;0.927	P;P;P	0.58620	0.679;0.53;0.842	T	0.70605	-0.4826	10	0.59425	D	0.04	-24.3108	20.2789	0.98501	0.0:0.0:1.0:0.0	.	229;246;213	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	V	198;213;213;246;229	ENSP00000351438:L198V;ENSP00000350032:L213V;ENSP00000367764:L213V;ENSP00000264546:L246V;ENSP00000344237:L229V	ENSP00000264546:L246V	L	-	1	0	FRMD4A	13822235	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.489000	0.73641	2.788000	0.95919	0.650000	0.86243	CTC	FRMD4A	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam		0.438	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	G	NM_018027		13782229	-1	no_errors	ENST00000357447	ensembl	human	known	70_37	missense	SNP	1.000	C
GLB1	2720	genome.wustl.edu	37	3	33055739	33055739	+	Missense_Mutation	SNP	C	C	G	rs575625235		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:33055739C>G	ENST00000399402.3	-	15	1584	c.1453G>C	c.(1453-1455)Gac>Cac	p.D485H	GLB1_ENST00000307363.5_Missense_Mutation_p.D515H|GLB1_ENST00000445488.2_Missense_Mutation_p.D563H|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000307377.8_Missense_Mutation_p.D384H	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	515					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				TCCTCAGTGTCCAGTGGAAAG	0.562																																																	0													69.0	72.0	71.0					3																	33055739		2008	4163	6171	SO:0001583	missense	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1453G>C	3.37:g.33055739C>G	ENSP00000382333:p.Asp485His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.D563H	ENST00000399402.3	37	c.1687	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876135	0.51801	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79	5.82	-4.44	0.03557	Galactose-binding domain-like (1);	0.532875	0.24580	N	0.037312	D	0.92011	0.7469	M	0.72894	2.215	0.26593	N	0.973169	B;B;B;B	0.16603	0.005;0.018;0.005;0.01	B;B;B;B	0.12837	0.003;0.008;0.003;0.006	T	0.82667	-0.0344	10	0.51188	T	0.08	-9.4671	8.8275	0.35063	0.0:0.4452:0.0943:0.4604	.	515;384;515;563	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	H	485;515;563;384	ENSP00000382333:D485H;ENSP00000306920:D515H;ENSP00000393377:D563H;ENSP00000305920:D384H	ENSP00000306920:D515H	D	-	1	0	GLB1	33030743	0.986000	0.35501	0.387000	0.26183	0.500000	0.33767	0.223000	0.17719	-0.747000	0.04759	-1.722000	0.00706	GAC	GLB1	-	superfamily_Galactose-bd-like		0.562	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	C	NM_000404		33055739	-1	no_errors	ENST00000445488	ensembl	human	known	70_37	missense	SNP	0.957	G
GLB1	2720	genome.wustl.edu	37	3	33055755	33055755	+	Nonsense_Mutation	SNP	C	C	T	rs72555363		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:33055755C>T	ENST00000399402.3	-	15	1568	c.1437G>A	c.(1435-1437)tgG>tgA	p.W479*	GLB1_ENST00000307363.5_Nonsense_Mutation_p.W509*|GLB1_ENST00000445488.2_Nonsense_Mutation_p.W557*|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000307377.8_Nonsense_Mutation_p.W378*	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	509					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GAAAGATCGTCCAGTCCGTGA	0.557																																																	0			GRCh37	CM910190	GLB1	M	rs72555363						63.0	65.0	65.0					3																	33055755		2011	4166	6177	SO:0001587	stop_gained	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1437G>A	3.37:g.33055755C>T	ENSP00000382333:p.Trp479*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7H8|B7Z6B0|P16279	Nonsense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.W557*	ENST00000399402.3	37	c.1671	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.400994	0.96030	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5847	18.9383	0.92595	0.0:1.0:0.0:0.0	.	.	.	.	X	479;509;557;378	.	ENSP00000306920:W509X	W	-	3	0	GLB1	33030759	1.000000	0.71417	0.963000	0.40424	0.656000	0.38851	7.005000	0.76323	2.770000	0.95276	0.650000	0.86243	TGG	GLB1	-	superfamily_Galactose-bd-like		0.557	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	C	NM_000404		33055755	-1	no_errors	ENST00000445488	ensembl	human	known	70_37	nonsense	SNP	1.000	T
GHSR	2693	genome.wustl.edu	37	3	172165471	172165471	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:172165471C>T	ENST00000241256.2	-	1	775	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	GHSR_ENST00000427970.1_Missense_Mutation_p.G245S	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	245					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			ACAGCATCGCCGCGCCTCCTC	0.607																																					Esophageal Squamous(93;641 1401 20883 29581 34638)												0													63.0	57.0	59.0					3																	172165471		2203	4300	6503	SO:0001583	missense	2693			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.733G>A	3.37:g.172165471C>T	ENSP00000241256:p.Gly245Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14D12|Q6ISR8|Q92848|Q96RJ7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS1_rcpt,prints_GPCR_Rhodpsn	p.G245S	ENST00000241256.2	37	c.733	CCDS3218.1	3	.	.	.	.	.	.	.	.	.	.	C	3.222	-0.159253	0.06544	.	.	ENSG00000121853	ENST00000241256;ENST00000427970	T;T	0.70516	-0.49;-0.49	5.52	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.430671	0.27019	N	0.021325	T	0.39860	0.1094	N	0.05124	-0.11	0.32504	N	0.538474	B;B	0.18310	0.027;0.0	B;B	0.15870	0.014;0.001	T	0.29822	-0.9999	10	0.09084	T	0.74	-24.2261	4.3247	0.11034	0.1418:0.4869:0.2767:0.0946	.	245;245	Q92847-2;Q92847	.;GHSR_HUMAN	S	245	ENSP00000241256:G245S;ENSP00000395344:G245S	ENSP00000241256:G245S	G	-	1	0	GHSR	173648165	0.992000	0.36948	0.757000	0.31301	0.230000	0.25150	2.659000	0.46741	0.242000	0.21303	-0.384000	0.06662	GGC	GHSR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS1_rcpt		0.607	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHSR	HGNC	protein_coding	OTTHUMT00000346728.1	C	NM_004122		172165471	-1	no_errors	ENST00000241256	ensembl	human	known	70_37	missense	SNP	0.988	T
GLRA2	2742	genome.wustl.edu	37	X	14550433	14550433	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:14550433C>T	ENST00000218075.4	+	2	671	c.141C>T	c.(139-141)ttC>ttT	p.F47F	GLRA2_ENST00000355020.4_Silent_p.F47F|GLRA2_ENST00000443437.2_5'UTR	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	47					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	CTTCAGATTTCTTGGACAAGT	0.398																																																	0													129.0	120.0	123.0					X																	14550433		2203	4300	6503	SO:0001819	synonymous_variant	2742				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.141C>T	X.37:g.14550433C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A2,prints_Neur_channel,tigrfam_Neur_channel	p.F47	ENST00000218075.4	37	c.141	CCDS14160.1	X																																																																																			GLRA2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Glycine_rcpt_A,tigrfam_Neur_channel		0.398	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA2	HGNC	protein_coding	OTTHUMT00000055829.1	C			14550433	+1	no_errors	ENST00000218075	ensembl	human	known	70_37	silent	SNP	1.000	T
GLS2	27165	genome.wustl.edu	37	12	56872898	56872898	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:56872898C>G	ENST00000311966.4	-	4	750	c.472G>C	c.(472-474)Gag>Cag	p.E158Q	GLS2_ENST00000476991.1_5'Flank|GLS2_ENST00000539272.1_Intron	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	158					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	GTGAACTCCTCAAAATCAGGA	0.527																																																	0													106.0	95.0	99.0					12																	56872898		2203	4300	6503	SO:0001583	missense	27165				CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.472G>C	12.37:g.56872898C>G	ENSP00000310447:p.Glu158Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	pfam_Glutaminase,pfam_Ankyrin_rpt,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_Glutaminase	p.E158Q	ENST00000311966.4	37	c.472	CCDS8921.1	12	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525240	0.27299	.	.	ENSG00000135423	ENST00000311966	T	0.42513	0.97	4.75	4.75	0.60458	Beta-lactamase/transpeptidase-like (1);	0.250540	0.44097	D	0.000497	T	0.24509	0.0594	N	0.16368	0.405	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.07693	-1.0759	10	0.13470	T	0.59	-28.0468	11.3554	0.49613	0.0:0.8168:0.1832:0.0	.	158	Q9UI32	GLSL_HUMAN	Q	158	ENSP00000310447:E158Q	ENSP00000310447:E158Q	E	-	1	0	GLS2	55159165	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.131000	0.42074	2.644000	0.89710	0.655000	0.94253	GAG	GLS2	-	superfamily_Beta-lactam/transpept-like		0.527	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS2	HGNC	protein_coding	OTTHUMT00000277113.1	C	NM_013267		56872898	-1	no_errors	ENST00000311966	ensembl	human	known	70_37	missense	SNP	1.000	G
GNPTG	84572	genome.wustl.edu	37	16	1412296	1412296	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:1412296C>T	ENST00000204679.4	+	7	544	c.501C>T	c.(499-501)ctC>ctT	p.L167L	LA16c-316G12.2_ENST00000569831.1_RNA	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit	167					carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				AGACCCCCCTCGTCTGCCACC	0.682																																																	0													34.0	33.0	33.0					16																	1412296		2198	4298	6496	SO:0001819	synonymous_variant	84572			BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835	ENST00000204679.4:c.501C>T	16.37:g.1412296C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R556|Q6XYD7|Q96L13	Silent	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.L167	ENST00000204679.4	37	c.501	CCDS10436.1	16																																																																																			GNPTG	-	superfamily_Man6P_isomerase_rcpt-bd_dom		0.682	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTG	HGNC	protein_coding	OTTHUMT00000109058.2	C	NM_032520		1412296	+1	no_errors	ENST00000204679	ensembl	human	known	70_37	silent	SNP	0.179	T
GRIN1	2902	genome.wustl.edu	37	9	140051346	140051346	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:140051346G>A	ENST00000371561.3	+	6	1922	c.825G>A	c.(823-825)aaG>aaA	p.K275K	GRIN1_ENST00000371560.3_Silent_p.K296K|GRIN1_ENST00000315048.3_Silent_p.K275K|GRIN1_ENST00000350902.5_Silent_p.K275K|GRIN1_ENST00000371555.4_Silent_p.K296K|GRIN1_ENST00000371553.3_Silent_p.K296K|GRIN1_ENST00000371559.4_Silent_p.K275K|GRIN1_ENST00000371546.4_Silent_p.K296K|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371550.4_Silent_p.K275K	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	275					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCAACGGCAAGAACGAGTCGG	0.697																																					NSCLC(113;717 1653 2089 20474 37618)												0													30.0	31.0	31.0					9																	140051346		2196	4296	6492	SO:0001819	synonymous_variant	2902				CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.825G>A	9.37:g.140051346G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_CaM-bd_C0_NMDA_rcpt_NR1,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K275	ENST00000371561.3	37	c.825	CCDS7031.1	9																																																																																			GRIN1	-	pfam_ANF_lig-bd_rcpt		0.697	GRIN1-002	KNOWN	basic|CCDS	protein_coding	GRIN1	HGNC	protein_coding	OTTHUMT00000055267.3	G	NM_007327		140051346	+1	no_errors	ENST00000371561	ensembl	human	known	70_37	silent	SNP	1.000	A
H2BFWT	158983	genome.wustl.edu	37	X	103267770	103267770	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:103267770C>G	ENST00000217926.5	-	1	489	c.463G>C	c.(463-465)Gag>Cag	p.E155Q	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	155						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E155*(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						CCTTCGGACTCGGCGAGCTTG	0.662																																																	1	Substitution - Nonsense(1)	breast(1)											33.0	33.0	33.0					X																	103267770		2200	4296	6496	SO:0001583	missense	158983			BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.463G>C	X.37:g.103267770C>G	ENSP00000354723:p.Glu155Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AK72|Q147W3	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E155Q	ENST00000217926.5	37	c.463	CCDS35362.1	X	.	.	.	.	.	.	.	.	.	.	.	16.11	3.030678	0.54790	.	.	ENSG00000123569	ENST00000217926	T	0.21543	2.0	2.84	-0.0968	0.13635	Histone-fold (2);	0.659413	0.09928	U	0.737553	T	0.11580	0.0282	N	0.24115	0.695	0.21445	N	0.999683	B	0.24132	0.098	B	0.19148	0.024	T	0.30707	-0.9969	10	0.62326	D	0.03	.	2.481	0.04587	0.1878:0.51:0.181:0.1212	.	155	Q7Z2G1	H2BWT_HUMAN	Q	155	ENSP00000354723:E155Q	ENSP00000354723:E155Q	E	-	1	0	H2BFWT	103154426	0.972000	0.33761	0.000000	0.03702	0.000000	0.00434	2.059000	0.41384	-0.136000	0.11475	-0.229000	0.12294	GAG	H2BFWT	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B		0.662	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2BFWT	HGNC	protein_coding	OTTHUMT00000057756.2	C	NM_001002916		103267770	-1	no_errors	ENST00000217926	ensembl	human	known	70_37	missense	SNP	0.996	G
HECW1	23072	genome.wustl.edu	37	7	43484020	43484020	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:43484020G>T	ENST00000395891.2	+	11	1854	c.1249G>T	c.(1249-1251)Gag>Tag	p.E417*	HECW1_ENST00000453890.1_Nonsense_Mutation_p.E417*	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	417					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CAGACCAGCTGAGGAAGCAGC	0.612																																																	0													34.0	37.0	36.0					7																	43484020		2091	4228	6319	SO:0001587	stop_gained	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1249G>T	7.37:g.43484020G>T	ENSP00000379228:p.Glu417*	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E417*	ENST00000395891.2	37	c.1249	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	39	7.507832	0.98325	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	4.98	4.98	0.66077	.	7739.210000	0.00357	N	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	10.88	0.46933	0.1493:0.0:0.8507:0.0	.	.	.	.	X	417	.	ENSP00000265522:E417X	E	+	1	0	HECW1	43450545	0.995000	0.38212	0.991000	0.47740	0.039000	0.13416	2.402000	0.44521	2.679000	0.91253	0.655000	0.94253	GAG	HECW1	-	NULL		0.612	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	G	NM_015052		43484020	+1	no_errors	ENST00000395891	ensembl	human	known	70_37	nonsense	SNP	1.000	T
HEPACAM2	253012	genome.wustl.edu	37	7	92848495	92848495	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:92848495C>A	ENST00000394468.2	-	2	426	c.349G>T	c.(349-351)Gaa>Taa	p.E117*	HEPACAM2_ENST00000440868.1_Nonsense_Mutation_p.E105*|HEPACAM2_ENST00000453812.2_Nonsense_Mutation_p.E140*|HEPACAM2_ENST00000341723.4_Nonsense_Mutation_p.E105*	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	117					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TAATTGCCTTCATCAGGGAAC	0.463																																																	0													145.0	122.0	130.0					7																	92848495		2203	4300	6503	SO:0001587	stop_gained	253012			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.349G>T	7.37:g.92848495C>A	ENSP00000377980:p.Glu117*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E117*	ENST00000394468.2	37	c.349	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.626602	0.97718	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	.	.	.	5.72	5.72	0.89469	.	0.046168	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-25.9799	20.269	0.98464	0.0:1.0:0.0:0.0	.	.	.	.	X	117;105;105;140	.	ENSP00000340532:E105X	E	-	1	0	HEPACAM2	92686431	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.881000	0.69706	2.878000	0.98634	0.650000	0.86243	GAA	HEPACAM2	-	pfam_Ig_V-set,smart_Ig_sub		0.463	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	C	NM_198151		92848495	-1	no_errors	ENST00000394468	ensembl	human	known	70_37	nonsense	SNP	1.000	A
HIST1H2BC	8347	genome.wustl.edu	37	6	26124126	26124126	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:26124126C>G	ENST00000314332.5	-	1	12	c.7G>C	c.(7-9)Gag>Cag	p.E3Q	HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.E3Q|HIST1H2AC_ENST00000377791.2_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TTGGCTGGCTCAGGCATCTTA	0.502																																																	0													73.0	74.0	74.0					6																	26124126		2203	4300	6503	SO:0001583	missense	8347			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.7G>C	6.37:g.26124126C>G	ENSP00000321744:p.Glu3Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E3Q	ENST00000314332.5	37	c.7	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	22.6	4.305700	0.81247	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.18502	2.21;2.21	5.76	5.76	0.90799	.	.	.	.	.	T	0.10035	0.0246	.	.	.	0.38562	D	0.949726	B	0.31241	0.315	B	0.20577	0.03	T	0.03278	-1.1053	8	0.72032	D	0.01	.	19.3155	0.94211	0.0:1.0:0.0:0.0	.	3	P62807	H2B1C_HUMAN	Q	3	ENSP00000321744:E3Q;ENSP00000380180:E3Q	ENSP00000321744:E3Q	E	-	1	0	HIST1H2BC	26232105	0.999000	0.42202	1.000000	0.80357	0.876000	0.50452	5.585000	0.67497	2.879000	0.98667	0.650000	0.86243	GAG	HIST1H2BC	-	NULL		0.502	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	C	NM_003526		26124126	-1	no_errors	ENST00000314332	ensembl	human	known	70_37	missense	SNP	1.000	G
IFNGR1	3459	genome.wustl.edu	37	6	137527314	137527314	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:137527314G>C	ENST00000367739.4	-	3	453	c.332C>G	c.(331-333)tCt>tGt	p.S111C	IFNGR1_ENST00000367735.2_Missense_Mutation_p.S101C|IFNGR1_ENST00000543628.1_Missense_Mutation_p.S83C|IFNGR1_ENST00000478333.1_5'Flank	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	111					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TGCATAGGCAGATTCTTTTTG	0.333																																																	0													120.0	118.0	119.0					6																	137527314		2203	4300	6503	SO:0001583	missense	3459				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.332C>G	6.37:g.137527314G>C	ENSP00000356713:p.Ser111Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	pfam_Interferon_gamma_pox/mammal,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,prints_Interferon_gamma_rcpt_asu	p.S111C	ENST00000367739.4	37	c.332	CCDS5185.1	6	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075012	0.55646	.	.	ENSG00000027697	ENST00000367739;ENST00000418947;ENST00000543628;ENST00000458076;ENST00000367735;ENST00000414770	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	5.8	5.8	0.92144	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88941	0.6574	M	0.82716	2.605	0.49299	D	0.999772	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.89961	0.4086	10	0.87932	D	0	-21.5018	15.5631	0.76266	0.0:0.0:1.0:0.0	.	101;83;111	B4DFT7;F5H5M7;P15260	.;.;INGR1_HUMAN	C	111;111;83;77;101;101	ENSP00000356713:S111C;ENSP00000443282:S83C;ENSP00000389249:S77C;ENSP00000356709:S101C;ENSP00000394230:S101C	ENSP00000356709:S101C	S	-	2	0	IFNGR1	137569007	1.000000	0.71417	0.961000	0.40146	0.240000	0.25518	5.277000	0.65586	2.735000	0.93741	0.655000	0.94253	TCT	IFNGR1	-	superfamily_Fibronectin_type3,prints_Interferon_gamma_rcpt_asu		0.333	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR1	HGNC	protein_coding	OTTHUMT00000042401.1	G			137527314	-1	no_errors	ENST00000367739	ensembl	human	known	70_37	missense	SNP	0.985	C
IGHMBP2	3508	genome.wustl.edu	37	11	68702826	68702826	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:68702826C>T	ENST00000255078.3	+	12	1803	c.1692C>T	c.(1690-1692)gtC>gtT	p.V564V	IGHMBP2_ENST00000541229.1_3'UTR	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	564					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)	p.V564V(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TCAAGTCTGTCGATGGCTTCC	0.577																																																	1	Substitution - coding silent(1)	lung(1)											96.0	77.0	84.0					11																	68702826		2200	4294	6494	SO:0001819	synonymous_variant	3508			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.1692C>T	11.37:g.68702826C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJD2|Q00443|Q14177	Silent	SNP	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.V564	ENST00000255078.3	37	c.1692	CCDS8187.1	11																																																																																			IGHMBP2	-	tigrfam_DNA_helicase_put		0.577	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	C	NM_002180		68702826	+1	no_errors	ENST00000255078	ensembl	human	known	70_37	silent	SNP	0.098	T
IL25	64806	genome.wustl.edu	37	14	23844858	23844858	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr14:23844858C>T	ENST00000329715.2	+	2	561	c.303C>T	c.(301-303)ctC>ctT	p.L101L	CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000382809.2_5'Flank|IL25_ENST00000397242.2_Silent_p.L85L|CMTM5_ENST00000342473.4_5'Flank|CMTM5_ENST00000339180.4_5'Flank|CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000359320.3_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	101					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		TGAACCGGCTCCCCCAGGACC	0.652																																																	0													99.0	101.0	100.0					14																	23844858		2203	4300	6503	SO:0001819	synonymous_variant	64806			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.303C>T	14.37:g.23844858C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3F0|Q8IZV3|Q8WXB0	Silent	SNP	pfam_Interleukin-17	p.L101	ENST00000329715.2	37	c.303	CCDS9597.1	14																																																																																			IL25	-	pfam_Interleukin-17		0.652	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL25	HGNC	protein_coding	OTTHUMT00000071789.2	C			23844858	+1	no_errors	ENST00000329715	ensembl	human	known	70_37	silent	SNP	0.994	T
IL3RA	3563	genome.wustl.edu	37	X	1471018	1471018	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:1471018G>A	ENST00000331035.4	+	5	673	c.324G>A	c.(322-324)gaG>gaA	p.E108E	IL3RA_ENST00000381469.2_Silent_p.E30E	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	108					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)	p.E108D(1)		lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CAGGTGCGGAGAATCTGACCT	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											121.0	139.0	133.0					X																	1471018		2201	4294	6495	SO:0001819	synonymous_variant	3563			M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.324G>A	X.37:g.1471018G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Silent	SNP	pfam_IL6_recept-bd,superfamily_Fibronectin_type3	p.E108	ENST00000331035.4	37	c.324	CCDS14113.1	X																																																																																			IL3RA	-	pfam_IL6_recept-bd,superfamily_Fibronectin_type3		0.607	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL3RA	HGNC	protein_coding	OTTHUMT00000055600.3	G			1471018	+1	no_errors	ENST00000331035	ensembl	human	known	70_37	silent	SNP	0.000	A
IMPDH1	3614	genome.wustl.edu	37	7	128043784	128043784	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:128043784G>C	ENST00000480861.1	-	2	200	c.123C>G	c.(121-123)ttC>ttG	p.F41L	IMPDH1_ENST00000338791.6_Missense_Mutation_p.F126L|IMPDH1_ENST00000348127.6_Missense_Mutation_p.F90L|IMPDH1_ENST00000470772.1_Missense_Mutation_p.F41L|IMPDH1_ENST00000496200.1_Missense_Mutation_p.F41L|IMPDH1_ENST00000419067.2_Missense_Mutation_p.F93L|IMPDH1_ENST00000378717.4_Missense_Mutation_p.F57L|IMPDH1_ENST00000354269.5_Missense_Mutation_p.F116L|IMPDH1_ENST00000343214.4_Missense_Mutation_p.F41L	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						TGAAGTCTATGAATCCTGGGA	0.547																																																	0													124.0	108.0	114.0					7																	128043784		2203	4300	6503	SO:0001583	missense	3614				CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.123C>G	7.37:g.128043784G>C	ENSP00000420185:p.Phe41Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_Cysta_beta_synth_core,pfam_2Npropane_dOase,pfam_FMN-dep_DH,smart_Cysta_beta_synth_core,tigrfam_IMP_DH	p.F126L	ENST00000480861.1	37	c.378	CCDS55161.1	7	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508978	0.64410	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868;ENST00000489263	T;T;T;T;T;T;T;T;T;T;T	0.77358	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.09;-1.07	5.24	5.24	0.73138	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.100440	0.64402	D	0.000001	T	0.71204	0.3312	L	0.27053	0.805	0.58432	D	0.999998	B;B;B;B;B;B;B;B	0.23806	0.041;0.029;0.029;0.091;0.046;0.007;0.009;0.023	B;B;B;B;B;B;B;B	0.33690	0.06;0.12;0.068;0.119;0.168;0.017;0.029;0.073	T	0.67665	-0.5612	10	0.38643	T	0.18	-28.0	16.3295	0.83004	0.0:0.0:1.0:0.0	.	93;41;41;57;116;90;126;41	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	L	93;126;41;116;57;90;41;41;41;57;57	ENSP00000399400:F93L;ENSP00000345096:F126L;ENSP00000420803:F41L;ENSP00000346219:F116L;ENSP00000367989:F57L;ENSP00000265385:F90L;ENSP00000342438:F41L;ENSP00000417296:F41L;ENSP00000420185:F41L;ENSP00000419609:F57L;ENSP00000418592:F57L	ENSP00000345096:F126L	F	-	3	2	IMPDH1	127831020	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.106000	0.71511	2.448000	0.82819	0.561000	0.74099	TTC	IMPDH1	-	pfam_IMP_DH_GMPRt,tigrfam_IMP_DH		0.547	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	IMPDH1	HGNC	protein_coding	OTTHUMT00000349462.1	G	NM_000883		128043784	-1	no_errors	ENST00000338791	ensembl	human	known	70_37	missense	SNP	1.000	C
IPO13	9670	genome.wustl.edu	37	1	44433134	44433134	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:44433134G>C	ENST00000372343.3	+	19	3423	c.2761G>C	c.(2761-2763)Gaa>Caa	p.E921Q	DPH2_ENST00000412950.2_5'Flank|DPH2_ENST00000255108.3_5'Flank|DPH2_ENST00000396758.2_5'Flank|IPO13_ENST00000372339.3_Missense_Mutation_p.E139Q	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	921					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				CCTCAGCCCTGAACAGAAGGA	0.617																																																	0													33.0	35.0	34.0					1																	44433134		2203	4300	6503	SO:0001583	missense	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.2761G>C	1.37:g.44433134G>C	ENSP00000361418:p.Glu921Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.E921Q	ENST00000372343.3	37	c.2761	CCDS503.1	1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965312	0.53507	.	.	ENSG00000117408	ENST00000372343;ENST00000372339	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	L	0.31120	0.905	0.80722	D	1	P;B	0.39883	0.693;0.11	B;B	0.31751	0.135;0.04	T	0.23440	-1.0188	9	0.19147	T	0.46	-22.364	17.6936	0.88276	0.0:0.0:1.0:0.0	.	139;921	Q5T4X2;O94829	.;IPO13_HUMAN	Q	921;139	.	ENSP00000361414:E139Q	E	+	1	0	IPO13	44205721	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.693000	0.98684	2.151000	0.67156	0.450000	0.29827	GAA	IPO13	-	NULL		0.617	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	HGNC	protein_coding	OTTHUMT00000022846.1	G	NM_014652		44433134	+1	no_errors	ENST00000372343	ensembl	human	known	70_37	missense	SNP	1.000	C
IQCB1	9657	genome.wustl.edu	37	3	121547406	121547406	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:121547406G>A	ENST00000310864.6	-	4	388	c.174C>T	c.(172-174)ctC>ctT	p.L58L	IQCB1_ENST00000349820.6_Silent_p.L58L	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	58					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		AATATTGAATGAGATCATAAC	0.328																																																	0													80.0	75.0	77.0					3																	121547406		2203	4300	6503	SO:0001819	synonymous_variant	9657			D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.174C>T	3.37:g.121547406G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.L58	ENST00000310864.6	37	c.174	CCDS33837.1	3																																																																																			IQCB1	-	NULL		0.328	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCB1	HGNC	protein_coding	OTTHUMT00000250573.1	G	NM_014642		121547406	-1	no_errors	ENST00000310864	ensembl	human	known	70_37	silent	SNP	1.000	A
IRF5	3663	genome.wustl.edu	37	7	128587362	128587362	+	Missense_Mutation	SNP	C	C	T	rs199508964|rs60344245	byFrequency	TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:128587362C>T	ENST00000402030.2	+	6	584	c.512C>T	c.(511-513)cCg>cTg	p.P171L	IRF5_ENST00000473745.1_Missense_Mutation_p.P171L|IRF5_ENST00000249375.4_Missense_Mutation_p.P171L|IRF5_ENST00000357234.5_Missense_Mutation_p.P187L|IRF5_ENST00000477535.1_Intron	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	171					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						ACTCTGCAGCCGCCCACTCTG	0.657																																																	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											8.0	10.0	9.0					7																	128587362		2105	4225	6330	SO:0001583	missense	3663				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.512C>T	7.37:g.128587362C>T	ENSP00000385352:p.Pro171Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.P187L	ENST00000402030.2	37	c.560	CCDS5808.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	4.202|4.202|4.202	0.036307|0.036307|0.036307	0.08148|0.08148|0.08148	.|.|.	.|.|.	ENSG00000128604|ENSG00000128604|ENSG00000128604	ENST00000412326|ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745|ENST00000430204	.|D;D;D;D|.	.|0.97598|.	.|-4.45;-4.4;-4.4;-4.4|.	.|.|.	.|.|.	.|.|.	.|.|.	.|1.324570|.	.|0.05438|.	.|N|.	.|0.547170|.	.|T|T	.|0.44265|0.44265	.|0.1285|0.1285	M|M|M	0.62723|0.62723|0.62723	1.935|1.935|1.935	0.23198|0.23198|0.23198	N|N|N	0.998138|0.998138|0.998138	.|P;.|.	.|0.34837|.	.|0.472;.|.	.|B;.|.	.|0.28139|.	.|0.086;.|.	.|T|T	.|0.42172|0.42172	.|-0.9467|-0.9467	.|8|4	.|0.25106|0.62326	.|T|D	.|0.35|0.03	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|171;187|160	.|Q13568;Q13568-2|E9PC81	.|IRF5_HUMAN;.|.	.|L|C	-1|187;171;171;171|160	.|ENSP00000349770:P187L;ENSP00000385352:P171L;ENSP00000249375:P171L;ENSP00000419149:P171L|.	.|ENSP00000249375:P171L|ENSP00000409106:R160C	.|P|R	+|+|+	.|2|1	.|0|0	IRF5|IRF5|IRF5	128374598|128374598|128374598	0.019000|0.019000|0.019000	0.18553|0.18553|0.18553	0.335000|0.335000|0.335000	0.25508|0.25508|0.25508	0.069000|0.069000|0.069000	0.16628|0.16628|0.16628	0.105000|0.105000|0.105000	0.15333|0.15333|0.15333	0.119000|0.119000|0.119000	0.18210|0.18210|0.18210	0.121000|0.121000|0.121000	0.15741|0.15741|0.15741	.|CCG|CGC	IRF5	-	NULL		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	HGNC	protein_coding	OTTHUMT00000350934.1	C	NM_001098627		128587362	+1	no_errors	ENST00000357234	ensembl	human	known	70_37	missense	SNP	0.317	T
JUNB	3726	genome.wustl.edu	37	19	12903628	12903628	+	Nonstop_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:12903628G>C	ENST00000302754.4	+	1	1319	c.1043G>C	c.(1042-1044)tGa>tCa	p.*348S		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	0					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CACGCCTTCTGAACGTCCCCT	0.672																																																	0													37.0	33.0	34.0					19																	12903628		2203	4300	6503	SO:0001578	stop_lost	3726			M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.1043G>C	19.37:g.12903628G>C	ENSP00000303315:p.*348Serext*159	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96GH3	Nonstop_Mutation	SNP	pfam_JNK,pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.*348S	ENST00000302754.4	37	c.1043	CCDS12280.1	19	.	.	.	.	.	.	.	.	.	.	G	8.646	0.897016	0.17686	.	.	ENSG00000171223	ENST00000302754	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0435	0.71811	0.0:0.0:1.0:0.0	.	.	.	.	S	348	.	.	X	+	2	2	JUNB	12764628	1.000000	0.71417	0.999000	0.59377	0.523000	0.34469	3.220000	0.51207	1.834000	0.53371	0.448000	0.29417	TGA	JUNB	-	NULL		0.672	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUNB	HGNC	protein_coding	OTTHUMT00000451015.1	G	NM_002229		12903628	+1	no_errors	ENST00000302754	ensembl	human	known	70_37	nonstop	SNP	1.000	C
KCNE1L	23630	genome.wustl.edu	37	X	108867844	108867844	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:108867844C>T	ENST00000372101.2	-	1	549	c.406G>A	c.(406-408)Gcc>Acc	p.A136T		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	136					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GCGCCCTGGGCGAGGGCAGGC	0.746																																																	0													4.0	4.0	4.0					X																	108867844		1819	3537	5356	SO:0001583	missense	23630			AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.406G>A	X.37:g.108867844C>T	ENSP00000361173:p.Ala136Thr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.A136T	ENST00000372101.2	37	c.406	CCDS14547.1	X	.	.	.	.	.	.	.	.	.	.	c	12.34	1.907145	0.33628	.	.	ENSG00000176076	ENST00000372101	T	0.74315	-0.83	4.31	-3.53	0.04667	.	0.770020	0.11032	N	0.607099	T	0.52075	0.1712	L	0.27053	0.805	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.28522	-1.0041	10	0.41790	T	0.15	-1.8385	1.8647	0.03195	0.1327:0.2004:0.3889:0.278	.	136	Q9UJ90	KCE1L_HUMAN	T	136	ENSP00000361173:A136T	ENSP00000361173:A136T	A	-	1	0	KCNE1L	108754500	0.000000	0.05858	0.000000	0.03702	0.245000	0.25701	-1.293000	0.02770	-1.064000	0.03172	-0.195000	0.12781	GCC	KCNE1L	-	NULL		0.746	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE1L	HGNC	protein_coding	OTTHUMT00000057892.1	C	NM_012282		108867844	-1	no_errors	ENST00000372101	ensembl	human	known	70_37	missense	SNP	0.000	T
KCNMA1	3778	genome.wustl.edu	37	10	78850175	78850175	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:78850175C>G	ENST00000286628.8	-	10	1316	c.1317G>C	c.(1315-1317)gaG>gaC	p.E439D	KCNMA1_ENST00000372440.1_Missense_Mutation_p.E439D|KCNMA1_ENST00000404771.3_Missense_Mutation_p.E439D|KCNMA1_ENST00000354353.5_Missense_Mutation_p.E439D|KCNMA1_ENST00000406533.3_Missense_Mutation_p.E439D|KCNMA1_ENST00000372443.1_Missense_Mutation_p.E439D|KCNMA1_ENST00000404857.1_Missense_Mutation_p.E439D|KCNMA1_ENST00000286627.5_Missense_Mutation_p.E439D	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	439	RCK N-terminal.				blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	GAAAAACGATCTCCACATTGA	0.517																																																	0													225.0	190.0	202.0					10																	78850175		2203	4300	6503	SO:0001583	missense	3778			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1317G>C	10.37:g.78850175C>G	ENSP00000286628:p.Glu439Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.E439D	ENST00000286628.8	37	c.1317		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.12|17.12|17.12	3.307767|3.307767|3.307767	0.60305|0.60305|0.60305	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372403	.|T;T;T;T;T;T;T;T;T|.	.|0.68903|.	.|-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36|.	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|Potassium channel, calcium-activated, BK, alpha subunit (1);NAD(P)-binding domain (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.67344|0.67344|0.67344	0.2883|0.2883|0.2883	M|M|M	0.72479|0.72479|0.72479	2.2|2.2|2.2	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;P;P;D;P;D;D;P|.	.|0.76494|.	.|0.987;0.661;0.92;0.999;0.727;0.997;0.997;0.538|.	.|D;P;P;D;P;D;D;B|.	.|0.85130|.	.|0.977;0.644;0.767;0.997;0.508;0.933;0.954;0.309|.	T|T|T	0.67185|0.67185|0.67185	-0.5734|-0.5734|-0.5734	5|10|5	.|0.87932|.	.|D|.	.|0|.	-15.5206|-15.5206|-15.5206	10.7989|10.7989|10.7989	0.46476|0.46476|0.46476	0.0:0.8864:0.0:0.1136|0.0:0.8864:0.0:0.1136|0.0:0.8864:0.0:0.1136	.|.|.	.|439;439;439;439;439;221;439;439|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	H|D|T	428;118|439;376;374;413;376;439;439;413;439;439;439;221|390	.|ENSP00000361517:E439D;ENSP00000361485:E376D;ENSP00000361514:E374D;ENSP00000396608:E413D;ENSP00000361520:E439D;ENSP00000286627:E439D;ENSP00000385552:E439D;ENSP00000346321:E439D;ENSP00000385806:E439D|.	.|ENSP00000286627:E439D|.	D|E|R	-|-|-	1|3|2	0|2|0	KCNMA1|KCNMA1|KCNMA1	78520181|78520181|78520181	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.992000|0.992000|0.992000	0.81027|0.81027|0.81027	3.378000|3.378000|3.378000	0.52432|0.52432|0.52432	2.677000|2.677000|2.677000	0.91161|0.91161|0.91161	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|GAG|AGA	KCNMA1	-	prints_K_chnl_Ca-activ_BK_asu		0.517	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	C	NM_002247		78850175	-1	no_errors	ENST00000406533	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNT2	343450	genome.wustl.edu	37	1	196309572	196309572	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:196309572G>A	ENST00000294725.9	-	16	2597	c.1682C>T	c.(1681-1683)tCa>tTa	p.S561L	KCNT2_ENST00000609185.1_Missense_Mutation_p.S511L|KCNT2_ENST00000367431.4_Missense_Mutation_p.S511L|KCNT2_ENST00000367433.5_Missense_Mutation_p.S561L|KCNT2_ENST00000451324.2_Missense_Mutation_p.S172L|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	561					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.S561L(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTTAAATGCTGAATTCTCTTC	0.358																																																	1	Substitution - Missense(1)	lung(1)											104.0	99.0	101.0					1																	196309572		2203	4300	6503	SO:0001583	missense	343450			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1682C>T	1.37:g.196309572G>A	ENSP00000294725:p.Ser561Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.S561L	ENST00000294725.9	37	c.1682	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.473403	0.96274	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T;T	0.34667	2.06;1.93;1.35;2.3	5.84	5.84	0.93424	.	0.000000	0.52532	D	0.000066	T	0.50837	0.1639	M	0.83012	2.62	0.80722	D	1	B;P;B;P;B	0.38335	0.344;0.48;0.281;0.627;0.344	B;B;B;B;B	0.42827	0.1;0.204;0.204;0.399;0.1	T	0.46707	-0.9172	10	0.22706	T	0.39	-14.3671	20.13	0.97997	0.0:0.0:1.0:0.0	.	561;543;561;511;561	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	L	561;511;382;172;561	ENSP00000356403:S561L;ENSP00000356401:S511L;ENSP00000405474:S172L;ENSP00000294725:S561L	ENSP00000294725:S561L	S	-	2	0	KCNT2	194576195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.806000	0.99153	2.751000	0.94390	0.650000	0.86243	TCA	KCNT2	-	NULL		0.358	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	G	NM_198503		196309572	-1	no_errors	ENST00000294725	ensembl	human	known	70_37	missense	SNP	1.000	A
KDELR1	10945	genome.wustl.edu	37	19	48894602	48894602	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:48894602C>T	ENST00000330720.2	-	1	208	c.14G>A	c.(13-15)cGa>cAa	p.R5Q	KDELR1_ENST00000597017.1_5'Flank	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	5					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		TCCCAGGAATCGGAAGAGATT	0.662											OREG0025606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													30.0	28.0	28.0					19																	48894602		2178	4262	6440	SO:0001583	missense	10945			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.14G>A	19.37:g.48894602C>T	ENSP00000329471:p.Arg5Gln	Somatic	958	WXS	Illumina HiSeq	Phase_IV	B2R6N4|Q54A39|Q8NBW7	Missense_Mutation	SNP	pfam_ER_ret_rcpt,prints_ER_ret_rcpt	p.R5Q	ENST00000330720.2	37	c.14	CCDS12718.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.838149	0.97009	.	.	ENSG00000105438	ENST00000330720	T	0.52526	0.66	4.22	4.22	0.49857	.	0.275088	0.22950	N	0.053680	T	0.69663	0.3136	H	0.96333	3.805	0.58432	D	0.999997	D	0.67145	0.996	P	0.49752	0.621	T	0.82263	-0.0544	10	0.66056	D	0.02	.	15.9157	0.79517	0.0:1.0:0.0:0.0	.	5	P24390	ERD21_HUMAN	Q	5	ENSP00000329471:R5Q	ENSP00000329471:R5Q	R	-	2	0	KDELR1	53586414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.467000	0.80930	2.363000	0.80096	0.555000	0.69702	CGA	KDELR1	-	prints_ER_ret_rcpt		0.662	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR1	HGNC	protein_coding	OTTHUMT00000465708.1	C			48894602	-1	no_errors	ENST00000330720	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA1407	57577	genome.wustl.edu	37	3	113724628	113724628	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:113724628C>T	ENST00000295878.3	-	10	1741	c.1595G>A	c.(1594-1596)gGc>gAc	p.G532D	KIAA1407_ENST00000545063.1_Missense_Mutation_p.G363D	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	532										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CTCGTTGCTGCCAGGCTGTTG	0.527																																																	0													186.0	187.0	187.0					3																	113724628		2203	4300	6503	SO:0001583	missense	57577			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1595G>A	3.37:g.113724628C>T	ENSP00000295878:p.Gly532Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.G532D	ENST00000295878.3	37	c.1595	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	C	8.584	0.882945	0.17467	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.44482	1.54;0.92;0.94	5.23	2.46	0.29980	.	0.617360	0.18029	N	0.153996	T	0.29458	0.0734	L	0.53249	1.67	0.09310	N	1	B;B;B	0.24368	0.058;0.102;0.102	B;B;B	0.20955	0.022;0.032;0.022	T	0.23404	-1.0189	10	0.12103	T	0.63	.	3.6566	0.08223	0.1362:0.5798:0.1323:0.1517	.	519;408;532	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	D	532;363;519	ENSP00000295878:G532D;ENSP00000446381:G363D;ENSP00000418099:G519D	ENSP00000295878:G532D	G	-	2	0	KIAA1407	115207318	0.000000	0.05858	0.015000	0.15790	0.007000	0.05969	0.458000	0.21892	0.349000	0.23975	-0.140000	0.14226	GGC	KIAA1407	-	NULL		0.527	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2	C	NM_020817		113724628	-1	no_errors	ENST00000295878	ensembl	human	known	70_37	missense	SNP	0.000	T
KIAA2026	158358	genome.wustl.edu	37	9	6007613	6007613	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:6007613C>G	ENST00000399933.3	-	1	174	c.175G>C	c.(175-177)Gag>Cag	p.E59Q	MIR4665_ENST00000581132.1_RNA|KIAA2026_ENST00000381461.2_Missense_Mutation_p.E59Q	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	59								p.E59Q(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GCCTCCATCTCTTCCTCCTGA	0.662																																																	1	Substitution - Missense(1)	lung(1)											34.0	41.0	39.0					9																	6007613		2075	4203	6278	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.175G>C	9.37:g.6007613C>G	ENSP00000382815:p.Glu59Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.E59Q	ENST00000399933.3	37	c.175		9	.	.	.	.	.	.	.	.	.	.	C	6.037	0.375123	0.11409	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	3.71	2.8	0.32819	.	.	.	.	.	T	0.14743	0.0356	N	0.08118	0	0.09310	N	1	P	0.40476	0.718	B	0.34931	0.192	T	0.07635	-1.0762	8	0.33141	T	0.24	.	11.1019	0.48179	0.1856:0.8144:0.0:0.0	.	59	Q5HYC2	K2026_HUMAN	Q	59	.	ENSP00000370870:E59Q	E	-	1	0	KIAA2026	5997613	0.002000	0.14202	0.008000	0.14137	0.064000	0.16182	1.417000	0.34770	0.893000	0.36288	0.491000	0.48974	GAG	KIAA2026	-	NULL		0.662	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	C	NM_001017969		6007613	-1	no_errors	ENST00000399933	ensembl	human	novel	70_37	missense	SNP	0.004	G
KLHDC7B	113730	genome.wustl.edu	37	22	50988006	50988006	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:50988006G>A	ENST00000395676.2	+	1	1545	c.1411G>A	c.(1411-1413)Gat>Aat	p.D471N	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	471										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCGTGAAGGATGCTTGGGA	0.662																																																	0													70.0	74.0	72.0					22																	50988006		2203	4298	6501	SO:0001583	missense	113730			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1411G>A	22.37:g.50988006G>A	ENSP00000379034:p.Asp471Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.D471N	ENST00000395676.2	37	c.1411	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366221	0.82463	.	.	ENSG00000130487	ENST00000395676	T	0.65364	-0.15	5.35	4.33	0.51752	Kelch-type beta propeller (1);	0.000000	0.43260	U	0.000590	T	0.59998	0.2235	L	0.48362	1.52	0.39282	D	0.964588	P	0.40515	0.719	P	0.48304	0.573	T	0.56263	-0.8008	10	0.11182	T	0.66	.	11.916	0.52765	0.0855:0.0:0.9145:0.0	.	471	Q96G42	KLD7B_HUMAN	N	471	ENSP00000379034:D471N	ENSP00000379034:D471N	D	+	1	0	KLHDC7B	49334872	1.000000	0.71417	0.379000	0.26080	0.850000	0.48378	4.637000	0.61346	1.273000	0.44346	0.491000	0.48974	GAT	KLHDC7B	-	smart_Kelch_1		0.662	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	G	NM_138433		50988006	+1	no_errors	ENST00000395676	ensembl	human	known	70_37	missense	SNP	0.997	A
KLHDC7B	113730	genome.wustl.edu	37	22	50988318	50988318	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:50988318G>T	ENST00000395676.2	+	1	1857	c.1723G>T	c.(1723-1725)Ggg>Tgg	p.G575W	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	575										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGGGAGCACCGGGGTCCTCAG	0.632																																																	0													17.0	15.0	15.0					22																	50988318		2195	4292	6487	SO:0001583	missense	113730			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1723G>T	22.37:g.50988318G>T	ENSP00000379034:p.Gly575Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.G575W	ENST00000395676.2	37	c.1723	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348107	0.82132	.	.	ENSG00000130487	ENST00000395676	T	0.22336	1.96	5.45	5.45	0.79879	.	0.179711	0.26149	U	0.026057	T	0.49457	0.1558	M	0.78456	2.415	0.46203	D	0.998924	D	0.89917	1.0	D	0.97110	1.0	T	0.51252	-0.8729	10	0.72032	D	0.01	.	16.7632	0.85517	0.0:0.0:1.0:0.0	.	575	Q96G42	KLD7B_HUMAN	W	575	ENSP00000379034:G575W	ENSP00000379034:G575W	G	+	1	0	KLHDC7B	49335184	1.000000	0.71417	0.248000	0.24265	0.006000	0.05464	7.349000	0.79376	2.576000	0.86940	0.491000	0.48974	GGG	KLHDC7B	-	NULL		0.632	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	G	NM_138433		50988318	+1	no_errors	ENST00000395676	ensembl	human	known	70_37	missense	SNP	0.975	T
KLHDC7B	113730	genome.wustl.edu	37	22	50988354	50988354	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:50988354G>A	ENST00000395676.2	+	1	1893	c.1759G>A	c.(1759-1761)Gag>Aag	p.E587K	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	587										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCTGCCCCCTGAGGACCGGCT	0.657																																																	0													13.0	11.0	12.0					22																	50988354		2201	4288	6489	SO:0001583	missense	113730			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1759G>A	22.37:g.50988354G>A	ENSP00000379034:p.Glu587Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.E587K	ENST00000395676.2	37	c.1759	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239384	0.22711	.	.	ENSG00000130487	ENST00000395676	T	0.12984	2.63	5.45	-6.45	0.01914	.	0.866994	0.09514	N	0.791946	T	0.01765	0.0056	N	0.00399	-1.545	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41448	-0.9508	10	0.02654	T	1	.	0.7498	0.00988	0.4133:0.1586:0.2045:0.2237	.	587	Q96G42	KLD7B_HUMAN	K	587	ENSP00000379034:E587K	ENSP00000379034:E587K	E	+	1	0	KLHDC7B	49335220	0.000000	0.05858	0.000000	0.03702	0.595000	0.36748	-0.318000	0.08050	-0.500000	0.06614	0.491000	0.48974	GAG	KLHDC7B	-	NULL		0.657	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	G	NM_138433		50988354	+1	no_errors	ENST00000395676	ensembl	human	known	70_37	missense	SNP	0.000	A
KRT1	3848	genome.wustl.edu	37	12	53072416	53072416	+	Missense_Mutation	SNP	C	C	T	rs542753485		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:53072416C>T	ENST00000252244.3	-	2	774	c.716G>A	c.(715-717)cGa>cAa	p.R239Q		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	239	Coil 1B.|Rod.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						CACTCTCCTTCGGAGATTGTT	0.473																																																	0													163.0	147.0	152.0					12																	53072416		2203	4300	6503	SO:0001583	missense	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.716G>A	12.37:g.53072416C>T	ENSP00000252244:p.Arg239Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.R239Q	ENST00000252244.3	37	c.716	CCDS8836.1	12	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000446	0.54147	.	.	ENSG00000167768	ENST00000252244	D	0.92595	-3.07	4.98	4.09	0.47781	Filament (1);	.	.	.	.	D	0.93458	0.7913	L	0.60455	1.87	0.31353	N	0.682278	D	0.52996	0.957	P	0.58266	0.836	D	0.91945	0.5566	9	0.56958	D	0.05	.	10.969	0.47428	0.0:0.8483:0.0:0.1517	.	239	P04264	K2C1_HUMAN	Q	239	ENSP00000252244:R239Q	ENSP00000252244:R239Q	R	-	2	0	KRT1	51358683	0.005000	0.15991	0.097000	0.21041	0.010000	0.07245	2.158000	0.42329	1.240000	0.43803	0.655000	0.94253	CGA	KRT1	-	pfam_F		0.473	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	C	NM_006121		53072416	-1	no_errors	ENST00000252244	ensembl	human	known	70_37	missense	SNP	0.930	T
LIAS	11019	genome.wustl.edu	37	4	39465151	39465151	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:39465151G>A	ENST00000261434.3	+	4	437	c.319G>A	c.(319-321)Gag>Aag	p.E107K	LIAS_ENST00000515061.1_3'UTR|LIAS_ENST00000381846.1_Missense_Mutation_p.E107K|LIAS_ENST00000513731.1_Intron|LIAS_ENST00000340169.2_Missense_Mutation_p.E107K	NM_006859.2	NP_006850.2			lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						ACAGGTATGTGAGGAAGCTCG	0.463																																																	0													113.0	98.0	103.0					4																	39465151		2203	4300	6503	SO:0001583	missense	11019			AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000261434.3:c.319G>A	4.37:g.39465151G>A	ENSP00000261434:p.Glu107Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_rSAM,smart_Elp3/MiaB/NifB,pirsf_Lipoyl_synth,tigrfam_Lipoyl_synth	p.E107K	ENST00000261434.3	37	c.319	CCDS3453.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.667185	0.96745	.	.	ENSG00000121897	ENST00000340169;ENST00000261434;ENST00000381846	T;T;T	0.78246	-1.16;-1.16;-1.16	5.28	5.28	0.74379	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.88709	0.6510	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	0.969;0.999;1.0	P;D;D	0.77557	0.868;0.967;0.99	D	0.90136	0.4210	10	0.87932	D	0	-18.8601	17.8926	0.88877	0.0:0.0:1.0:0.0	.	107;107;107	C9JCF6;O43766;Q6P5Q6	.;LIAS_HUMAN;.	K	107	ENSP00000340676:E107K;ENSP00000261434:E107K;ENSP00000371270:E107K	ENSP00000261434:E107K	E	+	1	0	LIAS	39141546	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.343000	0.97047	2.473000	0.83533	0.655000	0.94253	GAG	LIAS	-	pirsf_Lipoyl_synth,tigrfam_Lipoyl_synth		0.463	LIAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIAS	HGNC	protein_coding	OTTHUMT00000216815.1	G	NM_194451		39465151	+1	no_errors	ENST00000261434	ensembl	human	known	70_37	missense	SNP	1.000	A
LINGO1	84894	genome.wustl.edu	37	15	77907603	77907603	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:77907603C>T	ENST00000355300.6	-	2	820	c.646G>A	c.(646-648)Ggc>Agc	p.G216S	LINGO1_ENST00000561030.1_Missense_Mutation_p.G210S	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	216					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						ACGATGAGGCCGTGCAGGTGG	0.612																																																	0													108.0	118.0	115.0					15																	77907603		2177	4273	6450	SO:0001583	missense	84894			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.646G>A	15.37:g.77907603C>T	ENSP00000347451:p.Gly216Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G216S	ENST00000355300.6	37	c.646	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	C	4.861	0.160104	0.09287	.	.	ENSG00000169783	ENST00000355300	T	0.77620	-1.11	5.47	3.54	0.40534	.	0.232561	0.51477	N	0.000091	T	0.49881	0.1583	N	0.02412	-0.56	0.58432	D	0.999997	B	0.20459	0.045	B	0.20384	0.029	T	0.37596	-0.9699	10	0.08599	T	0.76	.	11.2121	0.48804	0.0:0.8458:0.0:0.1542	.	216	Q96FE5	LIGO1_HUMAN	S	216	ENSP00000347451:G216S	ENSP00000347451:G216S	G	-	1	0	LINGO1	75694658	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.643000	0.46604	0.634000	0.30469	0.561000	0.74099	GGC	LINGO1	-	smart_Leu-rich_rpt_typical-subtyp		0.612	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	C	NM_032808		77907603	-1	no_errors	ENST00000355300	ensembl	human	known	70_37	missense	SNP	1.000	T
LINGO3	645191	genome.wustl.edu	37	19	2290031	2290031	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:2290031C>T	ENST00000585527.1	-	1	1992	c.1745G>A	c.(1744-1746)gGa>gAa	p.G582E	LINGO3_ENST00000404279.1_Missense_Mutation_p.G582E			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	582						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCGCGCGCCTCCCTggcccgc	0.697																																																	0													5.0	7.0	6.0					19																	2290031		1633	3727	5360	SO:0001583	missense	645191			AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1745G>A	19.37:g.2290031C>T	ENSP00000467753:p.Gly582Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G637E	ENST00000585527.1	37	c.1910	CCDS45905.1	19	.	.	.	.	.	.	.	.	.	.	c	14.38	2.518251	0.44763	.	.	ENSG00000220008	ENST00000404279	T	0.55588	0.51	4.33	4.33	0.51752	.	.	.	.	.	T	0.41442	0.1159	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.22661	-1.0210	9	0.25106	T	0.35	.	15.8092	0.78543	0.0:1.0:0.0:0.0	.	582	P0C6S8	LIGO3_HUMAN	E	582	ENSP00000384979:G582E	ENSP00000384979:G582E	G	-	2	0	LINGO3	2241031	1.000000	0.71417	0.881000	0.34555	0.689000	0.40095	5.922000	0.70036	1.944000	0.56390	0.561000	0.74099	GGA	LINGO3	-	NULL		0.697	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	LINGO3	HGNC	protein_coding	OTTHUMT00000451291.2	C	NM_001101391		2290031	-1	no_errors	ENST00000585527	ensembl	human	known	70_37	missense	SNP	1.000	T
LMO7	4008	genome.wustl.edu	37	13	76395705	76395705	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr13:76395705C>T	ENST00000321797.8	+	12	2622	c.1901C>T	c.(1900-1902)tCt>tTt	p.S634F	LMO7_ENST00000465261.2_Missense_Mutation_p.S634F|LMO7_ENST00000357063.3_Missense_Mutation_p.S919F|LMO7_ENST00000526202.1_Missense_Mutation_p.S484F|LMO7_ENST00000377534.3_Missense_Mutation_p.S919F|LMO7_ENST00000341547.4_Missense_Mutation_p.S585F			Q8WWI1	LMO7_HUMAN	LIM domain 7	919					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CCCTTTGGCTCTCAGACAAGG	0.438																																																	0													59.0	56.0	57.0					13																	76395705		2202	4300	6502	SO:0001583	missense	4008			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1901C>T	13.37:g.76395705C>T	ENSP00000317802:p.Ser634Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.S919F	ENST00000321797.8	37	c.2756		13	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292480	0.40594	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261	T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.91	4.12	0.48240	.	0.665350	0.16070	N	0.231035	T	0.38506	0.1043	M	0.61703	1.905	0.28199	N	0.927416	B;B;B;B;B	0.13145	0.007;0.0;0.003;0.0;0.004	B;B;B;B;B	0.14023	0.003;0.004;0.002;0.002;0.01	T	0.36939	-0.9727	10	0.52906	T	0.07	-2.4257	6.7083	0.23262	0.0:0.5875:0.0:0.4125	.	484;585;919;634;867	E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5	.;.;LMO7_HUMAN;.;.	F	585;919;919;533;634;484;634	ENSP00000342112:S585F;ENSP00000349571:S919F;ENSP00000366757:S919F;ENSP00000366719:S533F;ENSP00000317802:S634F;ENSP00000431129:S484F;ENSP00000433352:S634F	ENSP00000317802:S634F	S	+	2	0	LMO7	75293706	0.035000	0.19736	0.853000	0.33588	0.996000	0.88848	0.464000	0.21988	0.772000	0.33382	0.650000	0.86243	TCT	LMO7	-	NULL		0.438	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045301.3	C	NM_005358		76395705	+1	no_errors	ENST00000357063	ensembl	human	known	70_37	missense	SNP	0.988	T
MAGEA4	4103	genome.wustl.edu	37	X	151080888	151080888	+	5'Flank	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:151080888G>A	ENST00000370337.4	+	0	0				RP11-366F6.2_ENST00000424126.1_RNA|MAGEA4_ENST00000276344.2_5'Flank|RP11-366F6.2_ENST00000411474.1_RNA|RP11-366F6.2_ENST00000445330.1_RNA|MAGEA4_ENST00000393920.1_5'Flank|MAGEA4_ENST00000393921.1_5'Flank	NM_002362.4	NP_002353.3	P43358	MAGA4_HUMAN	melanoma antigen family A, 4											breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					cacccTGGCCGAATCCGGTTC	0.627																																																	0																																										SO:0001631	upstream_gene_variant	100507199				CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174		X.37:g.151080888G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14798	RNA	SNP	-	NULL	ENST00000370337.4	37	NULL	CCDS14702.1	X																																																																																			RP11-366F6.2	-	-		0.627	MAGEA4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100507199	Clone_based_vega_gene	protein_coding	OTTHUMT00000060898.1	G	NM_002362		151080888	-1	no_errors	ENST00000424126	ensembl	human	known	70_37	rna	SNP	0.001	A
AP000525.9	0	genome.wustl.edu	37	22	16157762	16157762	+	RNA	SNP	C	C	T	rs199985193		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:16157762C>T	ENST00000447898.1	-	0	293				LL22NC03-N14H11.1_ENST00000608286.1_RNA																							CTCTTGGCTTCGGGGACCGCA	0.706																																																	0																																												101060615																															22.37:g.16157762C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.P59	ENST00000447898.1	37	c.177		22																																																																																			AP000525.1	-	NULL		0.706	AP000525.9-002	KNOWN	basic	lincRNA	LOC101060615	Clone_based_ensembl_gene	processed_transcript	OTTHUMT00000276780.1	C			16157762	-1	no_errors	ENST00000383146	ensembl	human	known	70_37	silent	SNP	0.154	T
LINC00969	440993	genome.wustl.edu	37	3	195393269	195393269	+	lincRNA	SNP	C	C	T	rs368239064		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:195393269C>T	ENST00000445430.1	+	0	796									long intergenic non-protein coding RNA 969																		gtgaggacagcagcacctgcc	0.532																																																	0																																												440993			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195393269C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			AC069513.3	-	-		0.532	LINC00969-038	KNOWN	basic	lincRNA	LOC440993	Clone_based_vega_gene	lincRNA	OTTHUMT00000341951.1	C			195393269	+1	no_errors	ENST00000457233	ensembl	human	known	70_37	rna	SNP	0.002	T
LPPR4	9890	genome.wustl.edu	37	1	99771315	99771315	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:99771315G>A	ENST00000370185.3	+	7	1538	c.1041G>A	c.(1039-1041)ctG>ctA	p.L347L	LPPR4_ENST00000457765.1_Silent_p.L289L|LPPR4_ENST00000370184.1_Silent_p.L189L	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		347					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TCAGGTCTCTGACAGACCTCA	0.458																																																	0													153.0	150.0	151.0					1																	99771315		2203	4300	6503	SO:0001819	synonymous_variant	9890																														ENST00000370185.3:c.1041G>A	1.37:g.99771315G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.L347	ENST00000370185.3	37	c.1041	CCDS757.1	1																																																																																			LPPR4	-	NULL		0.458	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Uniprot_genename	protein_coding	OTTHUMT00000029670.2	G			99771315	+1	no_errors	ENST00000370185	ensembl	human	known	70_37	silent	SNP	1.000	A
LRRC16A	55604	genome.wustl.edu	37	6	25606388	25606388	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:25606388C>T	ENST00000329474.6	+	35	4102	c.3734C>T	c.(3733-3735)tCt>tTt	p.S1245F		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1245	Poly-Ser.				actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						GGCTCCAGGTCTCGGAGCTCA	0.582																																																	0													56.0	66.0	63.0					6																	25606388		1933	4148	6081	SO:0001583	missense	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3734C>T	6.37:g.25606388C>T	ENSP00000331983:p.Ser1245Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S1245F	ENST00000329474.6	37	c.3734	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	C	16.76	3.213014	0.58452	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.17691	2.26	5.85	5.85	0.93711	.	0.458260	0.24022	N	0.042275	T	0.09113	0.0225	L	0.44542	1.39	0.80722	D	1	B;P;B	0.35208	0.134;0.49;0.432	B;B;B	0.32149	0.044;0.11;0.141	T	0.03103	-1.1072	10	0.59425	D	0.04	-2.8044	14.3299	0.66548	0.0:0.9296:0.0:0.0704	.	1245;1239;1200	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	F	1245;1200	ENSP00000331983:S1245F	ENSP00000331983:S1245F	S	+	2	0	LRRC16A	25714367	0.438000	0.25602	0.908000	0.35775	0.901000	0.52897	3.508000	0.53378	2.753000	0.94483	0.655000	0.94253	TCT	LRRC16A	-	NULL		0.582	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	C	NM_017640		25606388	+1	no_errors	ENST00000329474	ensembl	human	novel	70_37	missense	SNP	0.697	T
LRRC3	81543	genome.wustl.edu	37	21	45876948	45876948	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr21:45876948C>T	ENST00000291592.4	+	2	738	c.421C>T	c.(421-423)Cgc>Tgc	p.R141C	LRRC3DN_ENST00000596691.1_5'Flank|LRRC3-AS1_ENST00000426578.1_RNA	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	141						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		CGCCAAGATACGCCTGTCCCA	0.672																																																	0													40.0	42.0	41.0					21																	45876948		2203	4300	6503	SO:0001583	missense	81543			AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.421C>T	21.37:g.45876948C>T	ENSP00000291592:p.Arg141Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VDJ2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.R141C	ENST00000291592.4	37	c.421	CCDS13711.1	21	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163856	0.78226	.	.	ENSG00000160233	ENST00000291592	D	0.90385	-2.66	4.82	4.82	0.62117	.	0.186781	0.46758	D	0.000271	D	0.93344	0.7878	L	0.54323	1.7	0.58432	D	0.999997	D	0.89917	1.0	D	0.63703	0.917	D	0.92710	0.6182	10	0.39692	T	0.17	-60.251	17.9134	0.88942	0.0:1.0:0.0:0.0	.	141	Q9BY71	LRRC3_HUMAN	C	141	ENSP00000291592:R141C	ENSP00000291592:R141C	R	+	1	0	LRRC3	44701376	0.967000	0.33354	1.000000	0.80357	0.988000	0.76386	0.761000	0.26489	2.397000	0.81536	0.561000	0.74099	CGC	LRRC3	-	NULL		0.672	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3	HGNC	protein_coding	OTTHUMT00000098095.3	C			45876948	+1	no_errors	ENST00000291592	ensembl	human	known	70_37	missense	SNP	1.000	T
LRRC66	339977	genome.wustl.edu	37	4	52861239	52861239	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:52861239G>A	ENST00000343457.3	-	4	1955	c.1949C>T	c.(1948-1950)tCa>tTa	p.S650L		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	650						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTAGTGGGCTGAAAGCGCTTC	0.532																																																	0													78.0	77.0	77.0					4																	52861239		2014	4176	6190	SO:0001583	missense	339977			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1949C>T	4.37:g.52861239G>A	ENSP00000341944:p.Ser650Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S650L	ENST00000343457.3	37	c.1949	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	G	9.093	1.002210	0.19121	.	.	ENSG00000188993	ENST00000343457	T	0.33865	1.39	3.83	2.1	0.27182	.	1.436050	0.04422	N	0.367703	T	0.23649	0.0572	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20605	-1.0270	10	0.42905	T	0.14	2.3561	6.2094	0.20621	0.3162:0.0:0.6838:0.0	.	650	Q68CR7	LRC66_HUMAN	L	650	ENSP00000341944:S650L	ENSP00000341944:S650L	S	-	2	0	LRRC66	52555996	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	1.370000	0.34238	0.592000	0.29728	-0.216000	0.12614	TCA	LRRC66	-	NULL		0.532	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	G	NM_001024611		52861239	-1	no_errors	ENST00000343457	ensembl	human	known	70_37	missense	SNP	0.000	A
LYN	4067	genome.wustl.edu	37	8	56910991	56910991	+	Silent	SNP	C	C	G	rs1050875		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:56910991C>G	ENST00000519728.1	+	11	1433	c.1137C>G	c.(1135-1137)ctC>ctG	p.L379L	LYN_ENST00000420292.1_3'UTR|LYN_ENST00000520220.2_Silent_p.L358L	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	379	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	CCGAGTCACTCATGTGCAAAA	0.423																																																	0													118.0	113.0	114.0					8																	56910991		2203	4300	6503	SO:0001819	synonymous_variant	4067			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1137C>G	8.37:g.56910991C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVQ5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.L379	ENST00000519728.1	37	c.1137	CCDS6162.1	8																																																																																			LYN	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.423	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	HGNC	protein_coding	OTTHUMT00000378155.1	C	NM_002350		56910991	+1	no_errors	ENST00000519728	ensembl	human	known	70_37	silent	SNP	1.000	G
MACF1	23499	genome.wustl.edu	37	1	39801471	39801471	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:39801471G>A	ENST00000372915.3	+	36	9313	c.9226G>A	c.(9226-9228)Gaa>Aaa	p.E3076K	MACF1_ENST00000567887.1_Missense_Mutation_p.E3108K|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.E1511K|MACF1_ENST00000564288.1_Missense_Mutation_p.E3071K|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3076					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACAGGCCAATGAAGGAAAAGT	0.383																																																	0													41.0	46.0	44.0					1																	39801471		2201	4299	6500	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.9226G>A	1.37:g.39801471G>A	ENSP00000362006:p.Glu3076Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E3108K	ENST00000372915.3	37	c.9322		1	.	.	.	.	.	.	.	.	.	.	G	6.746	0.506376	0.12883	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.62941	-0.01;1.1	5.16	3.15	0.36227	.	1.477850	0.04066	N	0.307152	T	0.51193	0.1660	N	0.24115	0.695	0.22903	N	0.998584	B	0.02656	0.0	B	0.04013	0.001	T	0.42766	-0.9432	10	0.62326	D	0.03	.	8.4203	0.32696	0.0:0.1682:0.6576:0.1741	.	3076	Q9UPN3	MACF1_HUMAN	K	3076;1511	ENSP00000362006:E3076K;ENSP00000289893:E1511K	ENSP00000289893:E1511K	E	+	1	0	MACF1	39574058	0.977000	0.34250	0.055000	0.19348	0.404000	0.30871	2.181000	0.42547	1.120000	0.41904	0.467000	0.42956	GAA	MACF1	-	superfamily_RNaseH-like_dom		0.383	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	G	NM_033044		39801471	+1	no_errors	ENST00000567887	ensembl	human	putative	70_37	missense	SNP	0.125	A
MAFF	23764	genome.wustl.edu	37	22	38610546	38610546	+	Silent	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:38610546C>G	ENST00000338483.2	+	3	518	c.156C>G	c.(154-156)ctC>ctG	p.L52L	MAFF_ENST00000407965.1_Silent_p.L52L|MAFF_ENST00000426621.2_Silent_p.L52L|MAFF_ENST00000538999.1_Silent_p.L23L|MAFF_ENST00000538320.1_Silent_p.L52L			Q9ULX9	MAFF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F	52	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				blood coagulation (GO:0007596)|in utero embryonic development (GO:0001701)|parturition (GO:0007567)|regulation of epidermal cell differentiation (GO:0045604)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)|skin(1)	3	Melanoma(58;0.045)					TGACACGGCTCAAGCAGCGGC	0.677																																																	0													13.0	15.0	14.0					22																	38610546		2196	4292	6488	SO:0001819	synonymous_variant	23764			AJ010857	CCDS13968.1, CCDS54528.1	22q13.1	2013-07-09	2013-07-09		ENSG00000185022	ENSG00000185022			6780	protein-coding gene	gene with protein product		604877				10591208	Standard	NM_012323		Approved	hMafF	uc011anr.2	Q9ULX9	OTTHUMG00000151163	ENST00000338483.2:c.156C>G	22.37:g.38610546C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DV49|Q9Y525	Silent	SNP	pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.L52	ENST00000338483.2	37	c.156	CCDS13968.1	22																																																																																			MAFF	-	pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP		0.677	MAFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAFF	HGNC	protein_coding	OTTHUMT00000321624.1	C	NM_001161572		38610546	+1	no_errors	ENST00000338483	ensembl	human	known	70_37	silent	SNP	1.000	G
MAP7D2	256714	genome.wustl.edu	37	X	20074858	20074858	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:20074858C>G	ENST00000379651.3	-	4	442	c.424G>C	c.(424-426)Gag>Cag	p.E142Q	MAP7D2_ENST00000379643.5_Missense_Mutation_p.E142Q|MAP7D2_ENST00000543767.1_Missense_Mutation_p.E13Q|MAP7D2_ENST00000443379.3_Missense_Mutation_p.E142Q|MAP7D2_ENST00000452324.3_Missense_Mutation_p.E98Q	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	142					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						TTTTTCAGCTCCAGCTGCTGT	0.562																																																	0													118.0	82.0	95.0					X																	20074858		2203	4300	6503	SO:0001583	missense	256714			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.424G>C	X.37:g.20074858C>G	ENSP00000368972:p.Glu142Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	pfam_E-MAP-115	p.E142Q	ENST00000379651.3	37	c.424	CCDS14195.1	X	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482885	0.44147	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000452324;ENST00000330274	T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000010	T	0.24547	0.0595	L	0.39397	1.21	0.46609	D	0.999126	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.963;0.983;0.983;0.999;0.963;0.983	T	0.01472	-1.1346	10	0.27082	T	0.32	-26.559	17.2777	0.87120	0.0:1.0:0.0:0.0	.	142;98;142;142;142;13	B7Z3S7;C9JYW0;Q96T17-2;B5ME62;Q96T17;F5GYC2	.;.;.;.;MA7D2_HUMAN;.	Q	142;142;13;142;98;142	ENSP00000368972:E142Q;ENSP00000368964:E142Q;ENSP00000440691:E13Q;ENSP00000388239:E142Q;ENSP00000413301:E98Q	ENSP00000332677:E142Q	E	-	1	0	MAP7D2	19984779	1.000000	0.71417	0.998000	0.56505	0.342000	0.28953	6.395000	0.73228	2.349000	0.79799	0.506000	0.49869	GAG	MAP7D2	-	NULL		0.562	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	C	NM_152780		20074858	-1	no_errors	ENST00000379643	ensembl	human	known	70_37	missense	SNP	1.000	G
MAP7D3	79649	genome.wustl.edu	37	X	135328486	135328486	+	Missense_Mutation	SNP	C	C	G	rs371629235		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:135328486C>G	ENST00000316077.9	-	2	305	c.85G>C	c.(85-87)Gag>Cag	p.E29Q	MAP7D3_ENST00000370661.1_Missense_Mutation_p.E29Q|MAP7D3_ENST00000370663.5_Missense_Mutation_p.E11Q	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	29					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TTAGCAATCTCGTTTGCTGCA	0.388																																																	0													68.0	62.0	64.0					X																	135328486		2022	4167	6189	SO:0001583	missense	79649			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.85G>C	X.37:g.135328486C>G	ENSP00000318086:p.Glu29Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	pfam_E-MAP-115	p.E11Q	ENST00000316077.9	37	c.31	CCDS44004.1	X	.	.	.	.	.	.	.	.	.	.	C	9.871	1.198923	0.22121	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.64618	2.12;-0.11;-0.11;2.13	5.46	3.7	0.42460	.	0.256941	0.20517	N	0.090779	T	0.34019	0.0883	N	0.03608	-0.345	0.09310	N	1	P;P;P;P	0.40794	0.55;0.537;0.609;0.729	B;B;B;B	0.34652	0.067;0.131;0.091;0.187	T	0.10683	-1.0619	10	0.35671	T	0.21	-14.9463	10.3567	0.43969	0.0:0.7919:0.1322:0.0759	.	11;29;29;29	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	Q	29;29;11;29	ENSP00000359695:E29Q;ENSP00000318086:E29Q;ENSP00000359697:E11Q;ENSP00000359694:E29Q	ENSP00000318086:E29Q	E	-	1	0	MAP7D3	135156152	0.158000	0.22850	0.000000	0.03702	0.000000	0.00434	1.664000	0.37439	0.593000	0.29745	-0.209000	0.12711	GAG	MAP7D3	-	NULL		0.388	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	C			135328486	-1	no_errors	ENST00000370663	ensembl	human	known	70_37	missense	SNP	0.013	G
MAGEA11	4110	genome.wustl.edu	37	X	148794829	148794829	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:148794829C>T	ENST00000355220.5	+	2	112	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	MAGEA11_ENST00000333104.4_Intron	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	4						cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GATGGAGACTCAGTTCCGCAG	0.592																																																	0													78.0	67.0	71.0					X																	148794829		2203	4300	6503	SO:0001587	stop_gained	4110				CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.10C>T	X.37:g.148794829C>T	ENSP00000347358:p.Gln4*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5ETU4|Q6ZRZ5	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.Q4*	ENST00000355220.5	37	c.10	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	12.16	1.853374	0.32791	.	.	ENSG00000185247	ENST00000355220	.	.	.	1.23	0.331	0.15933	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	3.4082	0.07348	0.0:0.7091:0.0:0.2909	.	.	.	.	X	4	.	ENSP00000347358:Q4X	Q	+	1	0	MAGEA11	148579576	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.734000	0.04893	0.046000	0.15833	-0.260000	0.10688	CAG	MAGEA11	-	NULL		0.592	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	C	NM_005366		148794829	+1	no_errors	ENST00000355220	ensembl	human	known	70_37	nonsense	SNP	0.000	T
MAPK6	5597	genome.wustl.edu	37	15	52356856	52356856	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr15:52356856C>T	ENST00000261845.5	+	6	2632	c.1825C>T	c.(1825-1827)Cag>Tag	p.Q609*	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	609					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTTCATAAATCAGTTTTGTGA	0.408																																																	0													74.0	75.0	75.0					15																	52356856		2195	4293	6488	SO:0001587	stop_gained	5597			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1825C>T	15.37:g.52356856C>T	ENSP00000261845:p.Gln609*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R945|B5BU65|Q68DH4|Q8IYN8	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_MAPK_ERK3/4,pfscan_Prot_kinase_cat_dom	p.Q609*	ENST00000261845.5	37	c.1825	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	C	43	9.919301	0.99295	.	.	ENSG00000069956	ENST00000261845	.	.	.	5.27	4.33	0.51752	.	0.100405	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.1715	15.8865	0.79255	0.0:0.8642:0.1358:0.0	.	.	.	.	X	609	.	ENSP00000261845:Q609X	Q	+	1	0	MAPK6	50144148	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	3.797000	0.55514	1.234000	0.43709	0.543000	0.68304	CAG	MAPK6	-	NULL		0.408	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	C	NM_002748		52356856	+1	no_errors	ENST00000261845	ensembl	human	known	70_37	nonsense	SNP	1.000	T
MASP1	5648	genome.wustl.edu	37	3	186944295	186944295	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:186944295G>A	ENST00000337774.5	-	12	1844	c.1455C>T	c.(1453-1455)atC>atT	p.I485I		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	485	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CGGCGGTCACGATCCAGCTGG	0.562																																																	0													111.0	92.0	98.0					3																	186944295		2203	4300	6503	SO:0001819	synonymous_variant	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1455C>T	3.37:g.186944295G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.I485	ENST00000337774.5	37	c.1455	CCDS33907.1	3																																																																																			MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A		0.562	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	G	NM_001879		186944295	-1	no_errors	ENST00000337774	ensembl	human	known	70_37	silent	SNP	0.659	A
MED24	9862	genome.wustl.edu	37	17	38176820	38176820	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:38176820C>T	ENST00000394128.2	-	24	2705				MED24_ENST00000394126.1_Intron|MED24_ENST00000394127.2_Intron|MED24_ENST00000501516.3_Intron|MED24_ENST00000356271.3_Intron	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					gcaggaggatcgcttgagtcc	0.527																																																	0																																										SO:0001627	intron_variant	9862			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2624-214G>A	17.37:g.38176820C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	RNA	SNP	-	NULL	ENST00000394128.2	37	NULL	CCDS11359.1	17																																																																																			MED24	-	-		0.527	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	C	NM_014815		38176820	-1	no_errors	ENST00000470126	ensembl	human	known	70_37	rna	SNP	0.001	T
MOB3C	148932	genome.wustl.edu	37	1	47078756	47078756	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:47078756C>G	ENST00000319928.3	-	2	468	c.238G>C	c.(238-240)Gag>Cag	p.E80Q	MOB3C_ENST00000371940.1_Missense_Mutation_p.E103Q|MOB3C_ENST00000477318.1_5'UTR|MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000271139.8_Missense_Mutation_p.E132Q	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	80							metal ion binding (GO:0046872)										CTGCAGCGCTCCGCCATAGTG	0.662																																																	0													81.0	61.0	68.0					1																	47078756		2203	4300	6503	SO:0001583	missense	148932			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.238G>C	1.37:g.47078756C>G	ENSP00000315113:p.Glu80Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.E132Q	ENST00000319928.3	37	c.394	CCDS540.1	1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642855	0.87859	.	.	ENSG00000142961	ENST00000319928;ENST00000271139;ENST00000371940	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.85044	0.5607	M	0.94063	3.49	0.80722	D	1	D	0.55605	0.972	P	0.59889	0.865	D	0.89186	0.3547	9	0.87932	D	0	-38.9417	17.8765	0.88826	0.0:1.0:0.0:0.0	.	80	Q70IA8	MOB3C_HUMAN	Q	80;132;103	.	ENSP00000271139:E132Q	E	-	1	0	MOBKL2C	46851343	1.000000	0.71417	0.902000	0.35471	0.296000	0.27459	7.805000	0.86005	2.467000	0.83353	0.563000	0.77884	GAG	MOB3C	-	pfam_Mob1_phocein,superfamily_Mob1_phocein		0.662	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3C	HGNC	protein_coding		C	NM_145279		47078756	-1	no_errors	ENST00000271139	ensembl	human	known	70_37	missense	SNP	1.000	G
MORC2	22880	genome.wustl.edu	37	22	31318350	31318350	+	IGR	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:31318350G>A	ENST00000397641.3	-	0	5181				MORC2-AS1_ENST00000441558.1_RNA|MORC2-AS1_ENST00000609557.1_RNA|MORC2-AS1_ENST00000432624.2_RNA|MORC2-AS1_ENST00000422995.2_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						GCGGGATTGCGGAAGCCCTCC	0.587																																																	0																																										SO:0001628	intergenic_variant	150291			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193		22.37:g.31318350G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNB1|Q9UF28|Q9Y6V2	RNA	SNP	-	NULL	ENST00000397641.3	37	NULL		22																																																																																			MORC2-AS1	-	-		0.587	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2-AS1	HGNC	protein_coding	OTTHUMT00000321710.2	G	NM_014941		31318350	+1	no_errors	ENST00000422995	ensembl	human	known	70_37	rna	SNP	0.000	A
MORC2	22880	genome.wustl.edu	37	22	31318401	31318401	+	IGR	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:31318401G>A	ENST00000397641.3	-	0	5181				MORC2-AS1_ENST00000441558.1_RNA|MORC2-AS1_ENST00000609557.1_RNA|MORC2-AS1_ENST00000432624.2_RNA|MORC2-AS1_ENST00000422995.2_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CGTTCATAACGGGCGTTAATA	0.577																																																	0																																										SO:0001628	intergenic_variant	150291			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193		22.37:g.31318401G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNB1|Q9UF28|Q9Y6V2	RNA	SNP	-	NULL	ENST00000397641.3	37	NULL		22																																																																																			MORC2-AS1	-	-		0.577	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2-AS1	HGNC	protein_coding	OTTHUMT00000321710.2	G	NM_014941		31318401	+1	no_errors	ENST00000422995	ensembl	human	known	70_37	rna	SNP	0.004	A
MTUS2	23281	genome.wustl.edu	37	13	30054349	30054349	+	Missense_Mutation	SNP	G	G	A	rs576374624		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr13:30054349G>A	ENST00000380808.2	+	3	400	c.184G>A	c.(184-186)Gag>Aag	p.E62K	MTUS2-AS1_ENST00000587588.1_RNA|MTUS2-AS1_ENST00000323380.5_RNA|MTUS2_ENST00000431530.3_Missense_Mutation_p.E1093K|MTUS2_ENST00000542829.1_5'UTR	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1083						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GAGGCGGTTCGAGGACGAGGT	0.577																																																	0													7.0	11.0	9.0					13																	30054349		1922	4084	6006	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.184G>A	13.37:g.30054349G>A	ENSP00000370186:p.Glu62Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.E1093K	ENST00000380808.2	37	c.3277	CCDS41874.1	13	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900674	0.72754	.	.	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000417109	T;T	0.25250	2.43;1.81	5.44	4.59	0.56863	.	0.138051	0.64402	N	0.000004	T	0.29061	0.0722	L	0.34521	1.04	0.80722	D	1	P;D	0.57257	0.886;0.979	B;P	0.52646	0.233;0.705	T	0.01863	-1.1258	9	.	.	.	.	12.8996	0.58119	0.0782:0.0:0.9218:0.0	.	62;1083	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	K	1093;62;45	ENSP00000392057:E1093K;ENSP00000370186:E62K	.	E	+	1	0	MTUS2	28952349	1.000000	0.71417	0.852000	0.33557	0.933000	0.57130	7.379000	0.79691	1.539000	0.49286	0.650000	0.86243	GAG	MTUS2	-	NULL		0.577	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044335.2	G	XM_166270		30054349	+1	no_errors	ENST00000431530	ensembl	human	known	70_37	missense	SNP	0.994	A
MUC16	94025	genome.wustl.edu	37	19	9060012	9060012	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:9060012G>C	ENST00000397910.4	-	3	27637	c.27434C>G	c.(27433-27435)tCt>tGt	p.S9145C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9147	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTGAGAAAGAGGCAGAGCT	0.493																																																	0													74.0	71.0	72.0					19																	9060012		2037	4193	6230	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27434C>G	19.37:g.9060012G>C	ENSP00000381008:p.Ser9145Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S9145C	ENST00000397910.4	37	c.27434	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	3.119	-0.180853	0.06380	.	.	ENSG00000181143	ENST00000397910	T	0.36520	1.25	2.34	0.162	0.14981	.	.	.	.	.	T	0.37999	0.1024	N	0.24115	0.695	.	.	.	D	0.76494	0.999	D	0.73380	0.98	T	0.44967	-0.9293	8	0.87932	D	0	.	4.5322	0.12011	0.3305:0.0:0.6695:0.0	.	9145	B5ME49	.	C	9145	ENSP00000381008:S9145C	ENSP00000381008:S9145C	S	-	2	0	MUC16	8921012	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.123000	0.10611	0.116000	0.18110	0.298000	0.19748	TCT	MUC16	-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	G	NM_024690		9060012	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.001	C
MUC16	94025	genome.wustl.edu	37	19	9071029	9071029	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:9071029G>C	ENST00000397910.4	-	3	16620	c.16417C>G	c.(16417-16419)Cag>Gag	p.Q5473E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5475	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.Q5473*(2)|p.Q1106*(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTTAGTCTGAGAGATATTA	0.498																																																	3	Substitution - Nonsense(3)	lung(3)											129.0	127.0	127.0					19																	9071029		2028	4174	6202	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16417C>G	19.37:g.9071029G>C	ENSP00000381008:p.Gln5473Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.Q5473E	ENST00000397910.4	37	c.16417	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	0.504	-0.869581	0.02570	.	.	ENSG00000181143	ENST00000397910	T	0.09445	2.98	2.06	-4.12	0.03916	.	.	.	.	.	T	0.03053	0.0090	N	0.01576	-0.805	.	.	.	B	0.02656	0.0	B	0.04013	0.001	T	0.39901	-0.9591	8	0.87932	D	0	.	2.827	0.05488	0.148:0.4141:0.3151:0.1228	.	5473	B5ME49	.	E	5473	ENSP00000381008:Q5473E	ENSP00000381008:Q5473E	Q	-	1	0	MUC16	8932029	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.145000	0.10265	-1.472000	0.01883	-2.140000	0.00339	CAG	MUC16	-	NULL		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	G	NM_024690		9071029	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.000	C
MYH13	8735	genome.wustl.edu	37	17	10209931	10209931	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:10209931C>T	ENST00000418404.3	-	36	5474	c.5311G>A	c.(5311-5313)Gag>Aag	p.E1771K	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.E1771K			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1771					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTTAGCTCCTCAGCCATCATG	0.582																																																	0													85.0	82.0	83.0					17																	10209931		2203	4300	6503	SO:0001583	missense	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5311G>A	17.37:g.10209931C>T	ENSP00000404570:p.Glu1771Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1771K	ENST00000418404.3	37	c.5311	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647133	0.87958	.	.	ENSG00000006788	ENST00000252172	T	0.80738	-1.41	4.35	3.38	0.38709	Myosin tail (1);	.	.	.	.	D	0.90369	0.6986	M	0.92833	3.35	0.41919	D	0.990509	P	0.51147	0.942	P	0.62435	0.902	D	0.92152	0.5729	9	0.66056	D	0.02	.	12.7831	0.57489	0.0:0.92:0.0:0.08	.	1771	Q9UKX3	MYH13_HUMAN	K	1771	ENSP00000252172:E1771K	ENSP00000252172:E1771K	E	-	1	0	MYH13	10150656	1.000000	0.71417	0.839000	0.33178	0.979000	0.70002	7.615000	0.83006	1.183000	0.42943	0.591000	0.81541	GAG	MYH13	-	pfam_Myosin_tail		0.582	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	C	NM_003802		10209931	-1	no_errors	ENST00000252172	ensembl	human	known	70_37	missense	SNP	0.998	T
MYH2	4620	genome.wustl.edu	37	17	10432195	10432195	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:10432195C>T	ENST00000245503.5	-	27	3940	c.3556G>A	c.(3556-3558)Gag>Aag	p.E1186K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.E1186K|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1186					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGGGTGGCCTCCTCCAGGTCC	0.592																																																	0													87.0	91.0	90.0					17																	10432195		2203	4300	6503	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3556G>A	17.37:g.10432195C>T	ENSP00000245503:p.Glu1186Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1186K	ENST00000245503.5	37	c.3556	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.253731	0.95336	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.89485	-2.52;-2.52	5.18	5.18	0.71444	Myosin tail (1);	0.000000	0.39687	U	0.001290	D	0.96288	0.8789	H	0.98005	4.125	0.58432	D	0.999999	P	0.42941	0.794	P	0.54544	0.755	D	0.97421	1.0009	10	0.87932	D	0	.	18.8905	0.92399	0.0:1.0:0.0:0.0	.	1186	Q9UKX2	MYH2_HUMAN	K	1186	ENSP00000245503:E1186K;ENSP00000380367:E1186K	ENSP00000245503:E1186K	E	-	1	0	MYH2	10372920	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.425000	0.80255	2.707000	0.92482	0.655000	0.94253	GAG	MYH2	-	pfam_Myosin_tail		0.592	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	C	NM_017534		10432195	-1	no_errors	ENST00000245503	ensembl	human	known	70_37	missense	SNP	1.000	T
NKIRAS2	28511	genome.wustl.edu	37	17	40173651	40173651	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:40173651C>T	ENST00000307641.5	+	2	677	c.56C>T	c.(55-57)tCa>tTa	p.S19L	NKIRAS2_ENST00000393885.4_Missense_Mutation_p.S19L|NKIRAS2_ENST00000449471.4_Missense_Mutation_p.S19L|NKIRAS2_ENST00000479407.1_Missense_Mutation_p.S19L|NKIRAS2_ENST00000393881.3_Missense_Mutation_p.S19L|NKIRAS2_ENST00000393884.2_Missense_Mutation_p.S19L|NKIRAS2_ENST00000393880.1_Missense_Mutation_p.S19L|NKIRAS2_ENST00000316082.4_Missense_Mutation_p.S19L|NKIRAS2_ENST00000462043.2_Missense_Mutation_p.S19L	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2	19	Small GTPase-like.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GGCAAAACTTCAATCCTGGAG	0.498																																																	0													202.0	179.0	187.0					17																	40173651		2203	4300	6503	SO:0001583	missense	28511			AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503	ENST00000307641.5:c.56C>T	17.37:g.40173651C>T	ENSP00000303580:p.Ser19Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S19L	ENST00000307641.5	37	c.56	CCDS11415.1	17	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426082	0.83667	.	.	ENSG00000168256	ENST00000307641;ENST00000393884;ENST00000449471;ENST00000393880;ENST00000393881;ENST00000393885;ENST00000462043;ENST00000316082	D;D;D;D;D;D;T;T	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.08;-1.08	5.78	4.79	0.61399	Small GTP-binding protein domain (1);	0.051947	0.85682	D	0.000000	D	0.87341	0.6153	M	0.74647	2.275	0.47276	D	0.999378	B;P;B	0.44877	0.012;0.845;0.096	B;P;B	0.49192	0.01;0.602;0.201	D	0.89115	0.3499	10	0.87932	D	0	-7.452	16.953	0.86250	0.0:0.8722:0.1278:0.0	.	19;19;19	B4DNM3;E9PAZ8;Q9NYR9	.;.;KBRS2_HUMAN	L	19	ENSP00000303580:S19L;ENSP00000377462:S19L;ENSP00000401976:S19L;ENSP00000377458:S19L;ENSP00000377459:S19L;ENSP00000377463:S19L;ENSP00000419929:S19L;ENSP00000312773:S19L	ENSP00000303580:S19L	S	+	2	0	NKIRAS2	37427177	1.000000	0.71417	0.993000	0.49108	0.911000	0.54048	7.754000	0.85163	1.525000	0.49052	0.591000	0.81541	TCA	NKIRAS2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.498	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NKIRAS2	HGNC	protein_coding	OTTHUMT00000257457.1	C	NM_017595		40173651	+1	no_errors	ENST00000307641	ensembl	human	known	70_37	missense	SNP	1.000	T
NMT2	9397	genome.wustl.edu	37	10	15151821	15151821	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:15151821G>C	ENST00000378165.4	-	11	1436	c.1356C>G	c.(1354-1356)ttC>ttG	p.F452L	NMT2_ENST00000466201.1_5'UTR|NMT2_ENST00000535341.1_Missense_Mutation_p.F439L|NMT2_ENST00000540259.1_Missense_Mutation_p.F264L|NMT2_ENST00000378150.1_Missense_Mutation_p.F439L|RPP38_ENST00000451677.1_Intron	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	452					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						CCAGTGCATTGAATACATCAA	0.308																																					Melanoma(117;1345 1645 4130 12688 30625)												0													97.0	99.0	98.0					10																	15151821		2202	4300	6502	SO:0001583	missense	9397			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1356C>G	10.37:g.15151821G>C	ENSP00000367407:p.Phe452Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.F483L	ENST00000378165.4	37	c.1449	CCDS7109.1	10	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082198	0.76528	.	.	ENSG00000152465	ENST00000441445;ENST00000378165;ENST00000378150;ENST00000378143;ENST00000540259;ENST00000535341	T	0.53640	0.61	5.51	5.51	0.81932	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77115	-0.2707	10	0.87932	D	0	-25.1591	13.0545	0.58971	0.0737:0.0:0.9263:0.0	.	439;452	Q5VUC6;O60551	.;NMT2_HUMAN	L	16;452;439;483;264;439	ENSP00000367407:F452L	ENSP00000367385:F483L	F	-	3	2	NMT2	15191827	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.510000	0.67018	2.756000	0.94617	0.655000	0.94253	TTC	NMT2	-	pfam_MyristoylCoA_TrFase_C,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase		0.308	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT2	HGNC	protein_coding	OTTHUMT00000046958.2	G	NM_004808		15151821	-1	no_errors	ENST00000378143	ensembl	human	known	70_37	missense	SNP	1.000	C
NMT2	9397	genome.wustl.edu	37	10	15161425	15161425	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:15161425G>T	ENST00000378165.4	-	9	1167	c.1087C>A	c.(1087-1089)Cat>Aat	p.H363N	NMT2_ENST00000535341.1_Missense_Mutation_p.H350N|NMT2_ENST00000540259.1_Missense_Mutation_p.H175N|NMT2_ENST00000378150.1_Missense_Mutation_p.H350N|RPP38_ENST00000451677.1_Intron	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	363					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GGAGCCAGATGAAACTGCTTC	0.448																																					Melanoma(117;1345 1645 4130 12688 30625)												0													211.0	193.0	199.0					10																	15161425		2203	4300	6503	SO:0001583	missense	9397			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1087C>A	10.37:g.15161425G>T	ENSP00000367407:p.His363Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.H394N	ENST00000378165.4	37	c.1180	CCDS7109.1	10	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581232	0.28180	.	.	ENSG00000152465	ENST00000378165;ENST00000378150;ENST00000378143;ENST00000540259;ENST00000535341	T	0.40225	1.04	5.55	4.65	0.58169	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.154928	0.64402	D	0.000018	T	0.20618	0.0496	N	0.11201	0.11	0.39483	D	0.967911	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.14023	0.003;0.002;0.01	T	0.09228	-1.0684	9	.	.	.	-23.4527	6.7354	0.23407	0.1502:0.0:0.697:0.1528	.	363;350;363	B2RCF3;Q5VUC6;O60551	.;.;NMT2_HUMAN	N	363;350;394;175;350	ENSP00000367407:H363N	.	H	-	1	0	NMT2	15201431	1.000000	0.71417	0.936000	0.37596	0.938000	0.57974	5.180000	0.65048	1.334000	0.45468	0.655000	0.94253	CAT	NMT2	-	pfam_MyristoylCoA_TrFase_C,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase		0.448	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT2	HGNC	protein_coding	OTTHUMT00000046958.2	G	NM_004808		15161425	-1	no_errors	ENST00000378143	ensembl	human	known	70_37	missense	SNP	1.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120497829	120497829	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:120497829C>G	ENST00000256646.2	-	13	2272	c.2053G>C	c.(2053-2055)Gag>Cag	p.E685Q		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	685	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGGCACACTCATCAATGTCA	0.493			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													201.0	143.0	162.0					1																	120497829		2203	4300	6503	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2053G>C	1.37:g.120497829C>G	ENSP00000256646:p.Glu685Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.E685Q	ENST00000256646.2	37	c.2053	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.206158	0.95033	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.98862	-5.19	5.71	5.71	0.89125	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.36034	U	0.002838	D	0.99184	0.9717	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.99814	1.1043	10	0.66056	D	0.02	.	18.8491	0.92220	0.0:1.0:0.0:0.0	.	646;685;685	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	Q	685;646	ENSP00000256646:E685Q	ENSP00000256646:E685Q	E	-	1	0	NOTCH2	120299352	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.776000	0.85560	2.700000	0.92200	0.650000	0.86243	GAG	NOTCH2	-	pirsf_Notch,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.493	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	C	NM_024408		120497829	-1	no_errors	ENST00000256646	ensembl	human	known	70_37	missense	SNP	1.000	G
NPIPB7	440350	genome.wustl.edu	37	16	28468131	28468131	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:28468131G>C	ENST00000452313.1	-	7	967	c.859C>G	c.(859-861)Ctt>Gtt	p.L287V	RP11-57A19.5_ENST00000602838.1_lincRNA			O75200	NPIB7_HUMAN	nuclear pore complex interacting protein family, member B7	287	Pro-rich.					extracellular region (GO:0005576)											AGAGGAGCAAGAGGACACTCC	0.512																																																	0																																										SO:0001583	missense	440350			BC156858, AC002425		16p11.2	2013-06-11	2013-06-11	2013-06-11	ENSG00000233232	ENSG00000233232			33832	other	unknown			"""nuclear pore complex interacting protein-like 1"""	NPIPL1			Standard	NG_023370		Approved	LOC440350	uc010vcq.2	O75200	OTTHUMG00000156915	ENST00000452313.1:c.859C>G	16.37:g.28468131G>C	ENSP00000405348:p.Leu287Val	Somatic		WXS	Illumina HiSeq	Phase_IV	E7ERT9	Missense_Mutation	SNP	pfam_NPIP	p.L287V	ENST00000452313.1	37	c.859		16	.	.	.	.	.	.	.	.	.	.	N	0.015	-1.570812	0.00895	.	.	ENSG00000233232	ENST00000452313	T	0.48836	0.8	.	.	.	.	.	.	.	.	T	0.38081	0.1027	.	.	.	0.09310	N	1	B	0.26809	0.16	B	0.42882	0.401	T	0.51188	-0.8737	6	0.28530	T	0.3	.	.	.	.	.	287	E7ERT9	.	V	287	ENSP00000405348:L287V	ENSP00000405348:L287V	L	-	1	0	NPIPL1	28375632	0.156000	0.22821	0.058000	0.19502	0.059000	0.15707	0.064000	0.14437	-1.764000	0.01305	-1.783000	0.00646	CTT	NPIPL1	-	pfam_NPIP		0.512	NPIPB7-001	NOVEL	basic|appris_principal	protein_coding	NPIPL1	HGNC	protein_coding	OTTHUMT00000346596.1	G	NG_023370		28468131	-1	no_errors	ENST00000452313	ensembl	human	novel	70_37	missense	SNP	0.060	C
NR0B1	190	genome.wustl.edu	37	X	30327072	30327072	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:30327072C>T	ENST00000378970.4	-	1	643	c.409G>A	c.(409-411)Gaa>Aaa	p.E137K	NR0B1_ENST00000453287.1_Missense_Mutation_p.E137K|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	137	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GGGTGGTCTTCACCACAAAAG	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													22.0	22.0	22.0					X																	30327072		2201	4293	6494	SO:0001583	missense	190			S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.409G>A	X.37:g.30327072C>T	ENSP00000368253:p.Glu137Lys	Somatic	816	WXS	Illumina HiSeq	Phase_IV	Q96F69	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	p.E137K	ENST00000378970.4	37	c.409	CCDS14223.1	X	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440964	0.43326	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97642	-3.6;-4.47	3.96	3.09	0.35607	.	0.176969	0.27473	N	0.019215	D	0.94857	0.8338	L	0.57536	1.79	0.31802	N	0.628244	B	0.24426	0.103	B	0.25614	0.062	D	0.93930	0.7213	10	0.49607	T	0.09	-8.2607	10.4704	0.44633	0.0:0.8056:0.1944:0.0	.	137	P51843	NR0B1_HUMAN	K	137	ENSP00000368253:E137K;ENSP00000396403:E137K	ENSP00000368253:E137K	E	-	1	0	NR0B1	30236993	0.725000	0.28048	0.663000	0.29738	0.958000	0.62258	1.339000	0.33885	1.008000	0.39264	0.513000	0.50165	GAA	NR0B1	-	NULL		0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B1	HGNC	protein_coding	OTTHUMT00000056161.1	C	NM_000475		30327072	-1	no_errors	ENST00000378970	ensembl	human	known	70_37	missense	SNP	0.850	T
NUDT22	84304	genome.wustl.edu	37	11	63995093	63995093	+	Silent	SNP	G	G	A	rs139747440		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:63995093G>A	ENST00000279206.3	+	3	690	c.534G>A	c.(532-534)gtG>gtA	p.V178V	TRPT1_ENST00000540472.1_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|TRPT1_ENST00000394547.3_5'Flank|DNAJC4_ENST00000355040.4_5'Flank|DNAJC4_ENST00000321685.3_5'Flank|TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000546089.1_5'Flank|TRPT1_ENST00000546133.1_5'Flank|NUDT22_ENST00000441250.2_Intron|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000317459.6_5'Flank	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	178	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						GGCAGCTGGTGGTACATGAAC	0.612																																																	0													102.0	92.0	95.0					11																	63995093		2201	4297	6498	SO:0001819	synonymous_variant	84304			BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.534G>A	11.37:g.63995093G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JY06|Q71RD5	Silent	SNP	superfamily_NUDIX_hydrolase_dom-like	p.V178	ENST00000279206.3	37	c.534	CCDS8061.1	11																																																																																			NUDT22	-	NULL		0.612	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	NUDT22	HGNC	protein_coding	OTTHUMT00000396304.2	G	NM_032344		63995093	+1	no_errors	ENST00000279206	ensembl	human	known	70_37	silent	SNP	0.851	A
NUP188	23511	genome.wustl.edu	37	9	131764003	131764003	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:131764003C>T	ENST00000372577.2	+	35	4060	c.4039C>T	c.(4039-4041)Cag>Tag	p.Q1347*	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1347					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GGCTCGCACTCAGCAGGTAGG	0.592																																																	0													34.0	29.0	31.0					9																	131764003		2203	4300	6503	SO:0001587	stop_gained	23511			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4039C>T	9.37:g.131764003C>T	ENSP00000361658:p.Gln1347*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Nonsense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.Q1347*	ENST00000372577.2	37	c.4039	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	C	42	9.698689	0.99241	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	.	.	.	5.39	5.39	0.77823	.	0.109383	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5916	18.1417	0.89642	0.0:1.0:0.0:0.0	.	.	.	.	X	1236;1347	.	ENSP00000349125:Q1236X	Q	+	1	0	NUP188	130803824	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.479000	0.81095	2.537000	0.85549	0.462000	0.41574	CAG	NUP188	-	NULL		0.592	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	C			131764003	+1	no_errors	ENST00000372577	ensembl	human	known	70_37	nonsense	SNP	1.000	T
OPALIN	93377	genome.wustl.edu	37	10	98105853	98105853	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:98105853G>C	ENST00000371172.3	-	6	676	c.271C>G	c.(271-273)Cat>Gat	p.H91D	OPALIN_ENST00000419479.1_Missense_Mutation_p.H81D|OPALIN_ENST00000393870.2_Missense_Mutation_p.H80D|OPALIN_ENST00000393871.1_Missense_Mutation_p.H68D|OPALIN_ENST00000536387.1_Missense_Mutation_p.H81D	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	91						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TTCTTCTCATGTGTGGGTGAT	0.423																																																	0													156.0	143.0	147.0					10																	98105853		2203	4300	6503	SO:0001583	missense	93377			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.271C>G	10.37:g.98105853G>C	ENSP00000360214:p.His91Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.H91D	ENST00000371172.3	37	c.271	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	G	4.553	0.102600	0.08731	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.12	2.05	0.26809	.	1.026550	0.07747	N	0.947918	T	0.32285	0.0824	L	0.29908	0.895	0.09310	N	1	B;B;B	0.30281	0.275;0.275;0.001	B;B;B	0.27076	0.076;0.055;0.002	T	0.32955	-0.9887	9	0.87932	D	0	-0.6172	9.8563	0.41088	0.0:0.4106:0.5894:0.0	.	68;91;81	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	D	91;68;81;80;81	.	ENSP00000360214:H91D	H	-	1	0	OPALIN	98095843	0.168000	0.22989	0.021000	0.16686	0.079000	0.17450	1.049000	0.30392	1.057000	0.40506	0.650000	0.86243	CAT	OPALIN	-	NULL		0.423	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	G	NM_033207		98105853	-1	no_errors	ENST00000371172	ensembl	human	known	70_37	missense	SNP	0.001	C
OR1D5	8386	genome.wustl.edu	37	17	2966880	2966880	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:2966880C>T	ENST00000575751.1	-	1	21	c.22G>A	c.(22-24)Gag>Aag	p.E8K		NM_014566.1	NP_055381.1	P58170	OR1D5_HUMAN	olfactory receptor, family 1, subfamily D, member 5	8					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|lung(10)	11						TGTGAGTTCTCACTCTGGTTA	0.468																																																	0													20.0	17.0	18.0					17																	2966880		1649	3094	4743	SO:0001583	missense	8386			AF087923	CCDS58499.1	17p13.3	2012-10-09			ENSG00000262628	ENSG00000262628		"""GPCR / Class A : Olfactory receptors"""	8186	protein-coding gene	gene with protein product						10673334	Standard	NM_014566		Approved	OR17-31	uc021tns.1	P58170	OTTHUMG00000177676	ENST00000575751.1:c.22G>A	17.37:g.2966880C>T	ENSP00000459028:p.Glu8Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96RA6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E8K	ENST00000575751.1	37	c.22	CCDS58499.1	17																																																																																			OR1D5	-	NULL		0.468	OR1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D5	HGNC	protein_coding	OTTHUMT00000438410.2	C	NM_014566		2966880	-1	no_errors	ENST00000575751	ensembl	human	known	70_37	missense	SNP	0.955	T
PACSIN3	29763	genome.wustl.edu	37	11	47200581	47200581	+	Splice_Site	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:47200581C>T	ENST00000539589.1	-	9	1243	c.901G>A	c.(901-903)Gag>Aag	p.E301K	ARFGAP2_ENST00000524782.1_5'Flank|PACSIN3_ENST00000298838.6_Splice_Site_p.E301K|ARFGAP2_ENST00000319543.6_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	301	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						AAGGACCACTCCTGTGGGGAC	0.577																																																	0													153.0	152.0	152.0					11																	47200581		2201	4298	6499	SO:0001630	splice_region_variant	29763			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.901-1G>A	11.37:g.47200581C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.E301K	ENST00000539589.1	37	c.901	CCDS31481.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.427290|5.427290	0.96131|0.96131	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462|ENST00000533686	T;T;T|.	0.15952|.	2.38;2.38;2.38|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.720175|.	0.13143|.	N|.	0.410509|.	D|D	0.83422|0.83422	0.5251|0.5251	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	D|.	0.59767|.	0.986|.	D|.	0.64776|.	0.929|.	D|D	0.84423|0.84423	0.0572|0.0572	10|5	0.59425|.	D|.	0.04|.	7.3216|7.3216	19.7642|19.7642	0.96334|0.96334	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	301|.	Q9UKS6|.	PACN3_HUMAN|.	K|E	301|23	ENSP00000298838:E301K;ENSP00000440945:E301K;ENSP00000437252:E301K|.	ENSP00000298838:E301K|.	E|G	-|-	1|2	0|0	PACSIN3|PACSIN3	47157157|47157157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.262000|7.262000	0.78410|0.78410	2.755000|2.755000	0.94549|0.94549	0.655000|0.655000	0.94253|0.94253	GAG|GGA	PACSIN3	-	NULL		0.577	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	C	NM_016223	Missense_Mutation	47200581	-1	no_errors	ENST00000298838	ensembl	human	known	70_37	missense	SNP	1.000	T
OR8K1	390157	genome.wustl.edu	37	11	56114370	56114370	+	Missense_Mutation	SNP	C	C	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:56114370C>A	ENST00000279783.2	+	1	950	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					GTTTTATACCCTGTTGATTCC	0.368										HNSCC(65;0.19)																																							0													102.0	97.0	99.0					11																	56114370		2201	4296	6497	SO:0001583	missense	390157			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.856C>A	11.37:g.56114370C>A	ENSP00000279783:p.Leu286Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L286M	ENST00000279783.2	37	c.856	CCDS31528.1	11	.	.	.	.	.	.	.	.	.	.	C	11.48	1.652603	0.29336	.	.	ENSG00000150261	ENST00000279783	T	0.00188	8.59	5.0	-5.25	0.02781	GPCR, rhodopsin-like superfamily (1);	0.201519	0.24269	N	0.040002	T	0.00109	0.0003	L	0.35542	1.07	0.09310	N	1	P	0.51933	0.949	P	0.49597	0.616	T	0.52094	-0.8621	10	0.13470	T	0.59	-8.2569	0.701	0.00908	0.2412:0.1794:0.1754:0.404	.	286	Q8NGG5	OR8K1_HUMAN	M	286	ENSP00000279783:L286M	ENSP00000279783:L286M	L	+	1	2	OR8K1	55870946	0.000000	0.05858	0.010000	0.14722	0.486000	0.33341	-2.940000	0.00683	-0.693000	0.05121	-0.311000	0.09066	CTG	OR8K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.368	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K1	HGNC	protein_coding	OTTHUMT00000391605.1	C	NM_001002907		56114370	+1	no_errors	ENST00000279783	ensembl	human	known	70_37	missense	SNP	0.000	A
PCDHB5	26167	genome.wustl.edu	37	5	140517210	140517210	+	Missense_Mutation	SNP	C	C	T	rs140766491		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:140517210C>T	ENST00000231134.5	+	1	2411	c.2194C>T	c.(2194-2196)Cca>Tca	p.P732S		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	732					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCCCCTTTCCAGGGCATCT	0.652																																																	0													84.0	101.0	95.0					5																	140517210		2203	4300	6503	SO:0001583	missense	26167			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2194C>T	5.37:g.140517210C>T	ENSP00000231134:p.Pro732Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q549F4|Q9UFU9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P732S	ENST00000231134.5	37	c.2194	CCDS4247.1	5	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091202	0.36855	.	.	ENSG00000113209	ENST00000231134	T	0.51071	0.72	4.56	1.59	0.23543	.	.	.	.	.	T	0.56891	0.2016	M	0.92026	3.265	0.09310	N	1	B	0.33238	0.403	B	0.37239	0.244	T	0.53816	-0.8385	9	0.59425	D	0.04	.	8.7159	0.34411	0.0:0.6365:0.2839:0.0796	.	732	Q9Y5E4	PCDB5_HUMAN	S	732	ENSP00000231134:P732S	ENSP00000231134:P732S	P	+	1	0	PCDHB5	140497394	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.993000	0.29680	0.082000	0.17018	-0.431000	0.05894	CCA	PCDHB5	-	NULL		0.652	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB5	HGNC	protein_coding	OTTHUMT00000251811.1	C	NM_015669		140517210	+1	no_errors	ENST00000231134	ensembl	human	known	70_37	missense	SNP	0.052	T
PCDHGA2	56113	genome.wustl.edu	37	5	140719613	140719613	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:140719613G>C	ENST00000394576.2	+	1	1075	c.1075G>C	c.(1075-1077)Gac>Cac	p.D359H	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	359	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTTCTGAAGACTCTCTTCC	0.463																																																	0													85.0	88.0	87.0					5																	140719613		2203	4300	6503	SO:0001583	missense	56113			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1075G>C	5.37:g.140719613G>C	ENSP00000378077:p.Asp359His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D359H	ENST00000394576.2	37	c.1075	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	11.88	1.771081	0.31320	.	.	ENSG00000081853	ENST00000394576	T	0.61040	0.14	5.13	4.24	0.50183	Cadherin (3);Cadherin-like (1);	0.167681	0.27464	U	0.019259	T	0.73799	0.3633	M	0.82823	2.61	0.25967	N	0.982546	D;B	0.69078	0.997;0.203	D;B	0.63877	0.919;0.335	T	0.67205	-0.5729	10	0.72032	D	0.01	.	11.8834	0.52587	0.1408:0.0:0.8592:0.0	.	359;359	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	H	359	ENSP00000378077:D359H	ENSP00000378077:D359H	D	+	1	0	PCDHGA2	140699797	1.000000	0.71417	0.997000	0.53966	0.167000	0.22549	3.801000	0.55545	2.560000	0.86352	0.561000	0.74099	GAC	PCDHGA2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.463	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	G	NM_018915		140719613	+1	no_errors	ENST00000394576	ensembl	human	known	70_37	missense	SNP	0.997	C
PCMTD1	115294	genome.wustl.edu	37	8	52732893	52732894	+	3'UTR	INS	-	-	C	rs138060787		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:52732893_52732894insC	ENST00000360540.5	-	0	1497_1498				PCMTD1_ENST00000544451.1_3'UTR|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1							cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CAGTAGGCATTTTTCTTCTTGA	0.302																																																	0																																										SO:0001624	3_prime_UTR_variant	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.*18->G	8.37:g.52732893_52732894insC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96FK9	RNA	INS	-	NULL	ENST00000360540.5	37	NULL	CCDS6148.1	8																																																																																			PCMTD1	-	-		0.302	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	HGNC	protein_coding	OTTHUMT00000377909.2	-	NM_052937		52732894	-1	no_errors	ENST00000519559	ensembl	human	known	70_37	rna	INS	0.206:0.021	C
PDE4DIP	9659	genome.wustl.edu	37	1	144931290	144931290	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:144931290C>T	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000529945.1_Missense_Mutation_p.C140Y|PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.C140Y|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000530740.1_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCCACCCAGCACTCAAACCC	0.572			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													147.0	145.0	146.0					1																	144931290		2203	4300	6503	SO:0001627	intron_variant	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7469G>A	1.37:g.144931290C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.C140Y	ENST00000369354.3	37	c.419	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641360	0.29157	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.11385	2.78;2.78	5.3	4.35	0.52113	.	.	.	.	.	T	0.01592	0.0051	N	0.04636	-0.2	0.80722	D	1	B	0.20052	0.041	B	0.17722	0.019	T	0.47129	-0.9141	9	0.17832	T	0.49	.	7.5268	0.27660	0.0:0.7423:0.1683:0.0894	.	140	Q5VU43-2	.	Y	140	ENSP00000316434:C140Y;ENSP00000433392:C140Y	ENSP00000316434:C140Y	C	-	2	0	PDE4DIP	143642647	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.911000	0.48774	2.467000	0.83353	0.462000	0.41574	TGC	PDE4DIP	-	NULL		0.572	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	C	NM_022359		144931290	-1	no_errors	ENST00000313431	ensembl	human	known	70_37	missense	SNP	1.000	T
PDE7B	27115	genome.wustl.edu	37	6	136476786	136476786	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:136476786C>G	ENST00000308191.6	+	8	904	c.601C>G	c.(601-603)Ctg>Gtg	p.L201V	RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA|RP13-143G15.4_ENST00000417643.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	201	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	CCTCACGCCTCTGGACATCAT	0.438																																																	0													69.0	65.0	66.0					6																	136476786		2203	4300	6503	SO:0001583	missense	27115			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.601C>G	6.37:g.136476786C>G	ENSP00000310661:p.Leu201Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W154	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.L201V	ENST00000308191.6	37	c.601	CCDS5175.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.08|17.08	3.297064|3.297064	0.60086|0.60086	.|.	.|.	ENSG00000171408|ENSG00000171408	ENST00000308191;ENST00000367787|ENST00000446774	D|.	0.83914|.	-1.78|.	5.56|5.56	4.69|4.69	0.59074|0.59074	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);|.	0.071641|.	0.56097|.	D|.	0.000024|.	T|T	0.41834|0.41834	0.1176|0.1176	L|L	0.45228|0.45228	1.405|1.405	0.44330|0.44330	D|D	0.997214|0.997214	P;P|.	0.50819|.	0.939;0.661|.	P;P|.	0.50590|.	0.645;0.497|.	T|T	0.40040|0.40040	-0.9584|-0.9584	10|5	0.66056|.	D|.	0.02|.	.|.	8.8564|8.8564	0.35231|0.35231	0.0:0.7621:0.0:0.2379|0.0:0.7621:0.0:0.2379	.|.	253;201|.	A1E5M1;Q9NP56|.	.;PDE7B_HUMAN|.	V|C	201;337|95	ENSP00000310661:L201V|.	ENSP00000310661:L201V|.	L|S	+|+	1|2	2|0	PDE7B|PDE7B	136518479|136518479	0.310000|0.310000	0.24527|0.24527	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.724000|0.724000	0.25954|0.25954	1.482000|1.482000	0.48325|0.48325	0.650000|0.650000	0.86243|0.86243	CTG|TCT	PDE7B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase		0.438	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7B	HGNC	protein_coding	OTTHUMT00000042371.1	C			136476786	+1	no_errors	ENST00000308191	ensembl	human	known	70_37	missense	SNP	0.998	G
PHKA2	5256	genome.wustl.edu	37	X	18919625	18919625	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:18919625C>G	ENST00000379942.4	-	27	3670	c.3005G>C	c.(3004-3006)aGa>aCa	p.R1002T		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1002					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ACTCCTCAGTCTGTTAATGCC	0.552																																																	0													206.0	153.0	171.0					X																	18919625		2203	4300	6503	SO:0001583	missense	5256				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3005G>C	X.37:g.18919625C>G	ENSP00000369274:p.Arg1002Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.R1002T	ENST00000379942.4	37	c.3005	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627596	0.46944	.	.	ENSG00000044446	ENST00000379942	D	0.90732	-2.72	6.06	5.19	0.71726	.	0.041854	0.85682	D	0.000000	D	0.83566	0.5282	L	0.37630	1.12	0.30875	N	0.732048	P	0.38048	0.616	B	0.35278	0.199	T	0.82694	-0.0330	10	0.52906	T	0.07	-21.1675	6.3036	0.21127	0.1591:0.6884:0.0:0.1525	.	1002	P46019	KPB2_HUMAN	T	1002	ENSP00000369274:R1002T	ENSP00000369274:R1002T	R	-	2	0	PHKA2	18829546	1.000000	0.71417	0.791000	0.31998	0.997000	0.91878	1.955000	0.40372	1.299000	0.44798	0.600000	0.82982	AGA	PHKA2	-	NULL		0.552	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	C	NM_000292		18919625	-1	no_errors	ENST00000379942	ensembl	human	known	70_37	missense	SNP	0.794	G
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PIK3R3	8503	genome.wustl.edu	37	1	46509304	46509304	+	3'UTR	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:46509304G>C	ENST00000262741.5	-	0	2116				PIK3R3_ENST00000340332.6_3'UTR|PIK3R3_ENST00000488808.1_5'UTR|PIK3R3_ENST00000420542.1_3'UTR|PIK3R3_ENST00000372006.1_3'UTR|PIK3R3_ENST00000354242.4_3'UTR	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)						insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	AAAAACTGTAGAAAAAAATGC	0.453																																																	0													58.0	58.0	58.0					1																	46509304		2203	4300	6503	SO:0001624	3_prime_UTR_variant	8503			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.*41C>G	1.37:g.46509304G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	RNA	SNP	-	NULL	ENST00000262741.5	37	NULL	CCDS529.1	1																																																																																			PIK3R3	-	-		0.453	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1	G	NM_003629		46509304	-1	no_errors	ENST00000488808	ensembl	human	known	70_37	rna	SNP	1.000	C
PLRG1	5356	genome.wustl.edu	37	4	155470015	155470015	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:155470015C>T	ENST00000499023.2	-	2	208	c.82G>A	c.(82-84)Gat>Aat	p.D28N	PLRG1_ENST00000302078.5_Missense_Mutation_p.D28N|PLRG1_ENST00000393905.2_Missense_Mutation_p.D28N	NM_001201564.1|NM_002669.3	NP_001188493.1|NP_002660.1	O43660	PLRG1_HUMAN	pleiotropic regulator 1	28					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|protein localization to nucleus (GO:0034504)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|skin(1)|urinary_tract(1)	22	all_hematologic(180;0.215)	Renal(120;0.0854)				TTTCCATTATCAGCTACAAAC	0.368																																																	0													104.0	99.0	100.0					4																	155470015		2203	4300	6503	SO:0001583	missense	5356			AF044333	CCDS34083.1, CCDS56341.1	4q31.2-q32.1	2013-01-10	2011-05-19		ENSG00000171566	ENSG00000171566		"""WD repeat domain containing"""	9089	protein-coding gene	gene with protein product	"""transport and golgi organization 4 homolog (Drosophila)"""	605961	"""pleiotropic regulator 1 (PRL1, Arabidopsis homolog)"", ""pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)"""				Standard	NM_002669		Approved	PRL1, Prp46, PRPF46, Cwc1, TANGO4	uc003iny.3	O43660	OTTHUMG00000161411	ENST00000499023.2:c.82G>A	4.37:g.155470015C>T	ENSP00000424417:p.Asp28Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMK4|Q3KQY5|Q8WUD8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D28N	ENST00000499023.2	37	c.82	CCDS34083.1	4	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474538	0.84640	.	.	ENSG00000171566	ENST00000499023;ENST00000393905;ENST00000302078;ENST00000504341	T;T;T	0.65916	-0.18;-0.17;-0.13	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.69369	0.3103	L	0.28556	0.865	0.80722	D	1	D;B	0.76494	0.999;0.103	D;B	0.69479	0.964;0.023	T	0.63207	-0.6689	10	0.21540	T	0.41	-27.5696	19.8891	0.96923	0.0:1.0:0.0:0.0	.	28;28	O43660-2;O43660	.;PLRG1_HUMAN	N	28;28;28;26	ENSP00000424417:D28N;ENSP00000377483:D28N;ENSP00000303191:D28N	ENSP00000303191:D28N	D	-	1	0	PLRG1	155689465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.435000	0.80391	2.689000	0.91719	0.655000	0.94253	GAT	PLRG1	-	NULL		0.368	PLRG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLRG1	HGNC	protein_coding	OTTHUMT00000364824.1	C	NM_002669		155470015	-1	no_errors	ENST00000393905	ensembl	human	known	70_37	missense	SNP	1.000	T
PMEL	6490	genome.wustl.edu	37	12	56352293	56352293	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:56352293G>A	ENST00000548747.1	-	4	1095	c.433C>T	c.(433-435)Cag>Tag	p.Q145*	PMEL_ENST00000539511.1_Nonsense_Mutation_p.Q59*|PMEL_ENST00000536427.1_Nonsense_Mutation_p.Q145*|PMEL_ENST00000550464.1_Nonsense_Mutation_p.Q59*|PMEL_ENST00000360714.4_Nonsense_Mutation_p.Q145*|PMEL_ENST00000548493.1_Nonsense_Mutation_p.Q145*|PMEL_ENST00000552882.1_Nonsense_Mutation_p.Q145*|PMEL_ENST00000449260.2_Nonsense_Mutation_p.Q145*|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000550447.1_Nonsense_Mutation_p.Q108*			P40967	PMEL_HUMAN	premelanosome protein	145					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTTCTCTTCTGAGACCAAGAG	0.527																																																	0													90.0	76.0	81.0					12																	56352293		2203	4300	6503	SO:0001587	stop_gained	6490			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.433C>T	12.37:g.56352293G>A	ENSP00000448828:p.Gln145*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Nonsense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.Q145*	ENST00000548747.1	37	c.433	CCDS8897.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.53|17.53	3.412421|3.412421	0.62511|0.62511	.|.	.|.	ENSG00000185664|ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000550464;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000539511;ENST00000550447;ENST00000548803;ENST00000547137;ENST00000546543;ENST00000549418|ENST00000549404	.|T	.|0.08282	.|3.11	4.46|4.46	4.46|4.46	0.54185|0.54185	.|.	0.145221|.	0.32518|.	N|.	0.005982|.	.|T	.|0.11324	.|0.0276	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.10753	.|-1.0616	.|5	0.02654|0.27785	T|T	1|0.31	8.7463|8.7463	10.6672|10.6672	0.45736|0.45736	0.0937:0.0:0.9063:0.0|0.0937:0.0:0.9063:0.0	.|.	.|.	.|.	.|.	X|L	145;145;59;145;145;145;145;59;108;145;145;96;145|32	.|ENSP00000449520:S32L	ENSP00000353940:Q145X|ENSP00000449520:S32L	Q|S	-|-	1|2	0|0	PMEL|PMEL	54638560|54638560	0.828000|0.828000	0.29307|0.29307	0.985000|0.985000	0.45067|0.45067	0.906000|0.906000	0.53458|0.53458	3.361000|3.361000	0.52306|0.52306	2.487000|2.487000	0.83934|0.83934	0.462000|0.462000	0.41574|0.41574	CAG|TCA	PMEL	-	NULL		0.527	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	G	NM_006928		56352293	-1	no_errors	ENST00000360714	ensembl	human	known	70_37	nonsense	SNP	0.994	A
PNKP	11284	genome.wustl.edu	37	19	50368512	50368512	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:50368512G>A	ENST00000322344.3	-	4	479	c.370C>T	c.(370-372)Ctg>Ttg	p.L124L	PNKP_ENST00000595792.1_5'Flank|PNKP_ENST00000596014.1_Silent_p.L124L|PNKP_ENST00000600910.1_Silent_p.L124L|PNKP_ENST00000600573.1_Silent_p.L124L	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	124					dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)	p.L124V(2)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TGGGACACCAGAGGGGTGCCA	0.572								Other BER factors																																									2	Substitution - Missense(2)	lung(2)											70.0	68.0	69.0					19																	50368512		2203	4300	6503	SO:0001819	synonymous_variant	11284			AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.370C>T	19.37:g.50368512G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Silent	SNP	pfam_PNK3P,superfamily_HAD-like_dom,superfamily_SMAD_FHA_domain,tigrfam_PNK_3Pase_met,tigrfam_Polynucleotide_phosphatase,tigrfam_HAD-SF_hydro_IIIA	p.L124	ENST00000322344.3	37	c.370	CCDS12783.1	19																																																																																			PNKP	-	tigrfam_PNK_3Pase_met		0.572	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNKP	HGNC	protein_coding	OTTHUMT00000465830.1	G	NM_007254		50368512	-1	no_errors	ENST00000322344	ensembl	human	known	70_37	silent	SNP	0.158	A
POC1B	282809	genome.wustl.edu	37	12	89860565	89860565	+	Silent	SNP	T	T	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:89860565T>C	ENST00000313546.3	-	9	1142	c.1014A>G	c.(1012-1014)gaA>gaG	p.E338E	POC1B_ENST00000549035.1_Silent_p.E296E|POC1B_ENST00000541909.1_Silent_p.E208E|POC1B_ENST00000393179.4_Silent_p.E208E|POC1B_ENST00000378528.2_Missense_Mutation_p.K125R|POC1B_ENST00000549504.1_Missense_Mutation_p.K89R	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	338					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						TCTCAACTTTTTCCTCATGGG	0.348																																																	0													195.0	183.0	187.0					12																	89860565		2203	4300	6503	SO:0001819	synonymous_variant	282809			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.1014A>G	12.37:g.89860565T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	G3V1X0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K125R	ENST00000313546.3	37	c.374	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	T	13.03	2.116543	0.37339	.	.	ENSG00000139323	ENST00000378528;ENST00000549504	T	0.74002	-0.8	5.71	-8.47	0.00939	.	.	.	.	.	T	0.70378	0.3217	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.71790	-0.4486	6	0.87932	D	0	.	11.7659	0.51930	0.0:0.5595:0.2084:0.2321	.	.	.	.	R	125;89	ENSP00000367789:K125R	ENSP00000367789:K125R	K	-	2	0	POC1B	88384696	0.000000	0.05858	0.000000	0.03702	0.382000	0.30200	-0.776000	0.04674	-1.774000	0.01288	-0.250000	0.11733	AAA	POC1B	-	NULL		0.348	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1	T	NM_172240		89860565	-1	no_errors	ENST00000378528	ensembl	human	known	70_37	missense	SNP	0.000	C
POLE	5426	genome.wustl.edu	37	12	133240966	133240966	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:133240966C>G	ENST00000320574.5	-	22	2594	c.2551G>C	c.(2551-2553)Gag>Cag	p.E851Q	POLE_ENST00000535270.1_Missense_Mutation_p.E824Q	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	851					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CCAATCTGCTCGATCAGCTCC	0.622								DNA polymerases (catalytic subunits)																																									0													88.0	71.0	77.0					12																	133240966		2203	4300	6503	SO:0001583	missense	5426				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2551G>C	12.37:g.133240966C>G	ENSP00000322570:p.Glu851Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.E862Q	ENST00000320574.5	37	c.2584	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.117599	0.94385	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.53	5.53	0.82687	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.87456	2.885	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.74023	0.969;0.982	T	0.65738	-0.6095	10	0.87932	D	0	.	19.5142	0.95155	0.0:1.0:0.0:0.0	.	824;851	F5H1D6;Q07864	.;DPOE1_HUMAN	Q	851;862;824;631;786	ENSP00000322570:E851Q;ENSP00000406383:E862Q;ENSP00000445753:E824Q;ENSP00000442519:E631Q	ENSP00000322570:E851Q	E	-	1	0	POLE	131751039	1.000000	0.71417	0.980000	0.43619	0.913000	0.54294	7.447000	0.80620	2.624000	0.88883	0.638000	0.83543	GAG	POLE	-	pfam_DNA-dir_DNA_pol_B_multi_dom,smart_DNA-dir_DNA_pol_B		0.622	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	C	NM_006231		133240966	-1	no_errors	ENST00000455752	ensembl	human	known	70_37	missense	SNP	1.000	G
PPIL3	53938	genome.wustl.edu	37	2	201736079	201736079	+	3'UTR	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:201736079C>G	ENST00000392283.4	-	0	793				PPIL3_ENST00000286175.8_3'UTR|PPIL3_ENST00000465823.1_5'UTR|PPIL3_ENST00000409361.1_3'UTR|PPIL3_ENST00000409449.1_3'UTR	NM_130906.2	NP_570981.1	Q9H2H8	PPIL3_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 3						mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(1)|lung(2)	3						TAAGTGTGTTCCAGCAATTTG	0.373																																																	0													145.0	131.0	136.0					2																	201736079		2203	4300	6503	SO:0001624	3_prime_UTR_variant	53938			AF251049	CCDS2332.1, CCDS2333.1	2q33.1	2008-02-05			ENSG00000240344	ENSG00000240344			9262	protein-coding gene	gene with protein product	"""Cyclophilin J"""	615811				11435694	Standard	NM_032472		Approved	CyPJ	uc002uwi.3	Q9H2H8	OTTHUMG00000132782	ENST00000392283.4:c.*39G>C	2.37:g.201736079C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86WF9|Q96IA9|Q9BXZ1	RNA	SNP	-	NULL	ENST00000392283.4	37	NULL	CCDS2333.1	2																																																																																			PPIL3	-	-		0.373	PPIL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL3	HGNC	protein_coding	OTTHUMT00000256190.3	C			201736079	-1	no_errors	ENST00000465823	ensembl	human	known	70_37	rna	SNP	0.000	G
PPL	5493	genome.wustl.edu	37	16	4937187	4937187	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:4937187G>C	ENST00000345988.2	-	21	2645	c.2556C>G	c.(2554-2556)atC>atG	p.I852M	PPL_ENST00000590782.2_Missense_Mutation_p.I850M	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	852					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCTGTCTGTTGATGGCATAAA	0.463																																																	0													172.0	174.0	173.0					16																	4937187		2197	4300	6497	SO:0001583	missense	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2556C>G	16.37:g.4937187G>C	ENSP00000340510:p.Ile852Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.I852M	ENST00000345988.2	37	c.2556	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118652	0.56505	.	.	ENSG00000118898	ENST00000345988	T	0.50277	0.75	5.41	5.41	0.78517	.	0.310478	0.31323	N	0.007858	T	0.42223	0.1193	L	0.41236	1.265	0.38682	D	0.952576	P	0.43477	0.808	B	0.41088	0.347	T	0.44390	-0.9331	10	0.42905	T	0.14	.	14.7302	0.69374	0.0:0.2569:0.7431:0.0	.	852	O60437	PEPL_HUMAN	M	852	ENSP00000340510:I852M	ENSP00000340510:I852M	I	-	3	3	PPL	4877188	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.873000	0.39558	2.539000	0.85634	0.655000	0.94253	ATC	PPL	-	smart_Spectrin/alpha-actinin		0.463	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	G	NM_002705		4937187	-1	no_errors	ENST00000345988	ensembl	human	known	70_37	missense	SNP	1.000	C
PPM1K	152926	genome.wustl.edu	37	4	89192227	89192227	+	Intron	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:89192227G>T	ENST00000608933.1	-	4	931				PPM1K_ENST00000315194.4_Missense_Mutation_p.S219Y|PPM1K_ENST00000295908.7_Intron|PPM1K_ENST00000506423.1_5'UTR|PPM1K_ENST00000508256.1_Intron	NM_152542.4	NP_689755.3	Q8N3J5	PPM1K_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1K						protein dephosphorylation (GO:0006470)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		TCCAGGATAGGAACCGCTGGA	0.478																																																	0													48.0	46.0	46.0					4																	89192227		876	1991	2867	SO:0001627	intron_variant	152926			BC037552	CCDS3629.1	4q22.1	2012-04-17	2010-03-05		ENSG00000163644	ENSG00000163644	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	25415	protein-coding gene	gene with protein product	"""PP2C-type mitochondrial phosphoprotein phosphatase"", ""protein phosphatase 2C kappa"", ""branched-chain &#945;-ketoacid dehydrogenase phosphatase"""	611065	"""protein phosphatase 1K (PP2C domain containing)"""			22291014	Standard	NM_152542		Approved	DKFZp761G058, PP2Ckappa, hPTMP, PP2Cm, BDP	uc003hrm.5	Q8N3J5	OTTHUMG00000130952	ENST00000608933.1:c.542-2169C>A	4.37:g.89192227G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAZ1|Q05CT5|Q49AB5|Q4W5E6|Q56AN8|Q8IUZ7|Q8IXG7|Q8ND70|Q96NT4	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like	p.S219Y	ENST00000608933.1	37	c.656	CCDS3629.1	4	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292984	0.60086	.	.	ENSG00000163644	ENST00000506423;ENST00000315194	T;T	0.50548	0.74;0.74	4.69	4.69	0.59074	.	.	.	.	.	T	0.69913	0.3164	.	.	.	0.40939	D	0.984452	D	0.76494	0.999	D	0.76071	0.987	T	0.74300	-0.3710	8	0.87932	D	0	.	17.5923	0.88000	0.0:0.0:1.0:0.0	.	219	Q8N3J5-2	.	Y	219	ENSP00000424155:S219Y;ENSP00000324761:S219Y	ENSP00000324761:S219Y	S	-	2	0	PPM1K	89411251	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.334000	0.72944	2.885000	0.99019	0.655000	0.94253	TCC	PPM1K	-	NULL		0.478	PPM1K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1K	HGNC	protein_coding	OTTHUMT00000253553.4	G	NM_152542		89192227	-1	no_errors	ENST00000315194	ensembl	human	known	70_37	missense	SNP	1.000	T
PPP1R32	220004	genome.wustl.edu	37	11	61257393	61257393	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:61257393C>T	ENST00000338608.2	+	12	1308	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	PPP1R32_ENST00000366212.4_Missense_Mutation_p.R25W|PPP1R32_ENST00000432063.2_Missense_Mutation_p.R375W|PPP1R32_ENST00000538185.1_Missense_Mutation_p.R72W	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	395							phosphatase binding (GO:0019902)										GGAGAGCCTGCGGCACCTGCA	0.662																																																	0													56.0	46.0	49.0					11																	61257393		2202	4298	6500	SO:0001583	missense	220004			AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.1183C>T	11.37:g.61257393C>T	ENSP00000344140:p.Arg395Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0P4|Q96M77	Missense_Mutation	SNP	NULL	p.R395W	ENST00000338608.2	37	c.1183	CCDS8008.1	11	.	.	.	.	.	.	.	.	.	.	C	16.28	3.078925	0.55753	.	.	ENSG00000162148	ENST00000432063;ENST00000338608;ENST00000542951;ENST00000366212;ENST00000538185	T;T;T;T;T	0.75477	0.4;1.0;0.8;-0.94;0.25	4.73	-1.52	0.08637	.	0.291362	0.23589	N	0.046569	T	0.81645	0.4866	M	0.72894	2.215	0.09310	N	1	D;D	0.89917	0.999;1.0	P;D	0.63703	0.855;0.917	T	0.77362	-0.2616	10	0.87932	D	0	-10.1003	14.167	0.65483	0.7803:0.2197:0.0:0.0	.	375;395	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	W	375;395;146;25;72	ENSP00000391560:R375W;ENSP00000344140:R395W;ENSP00000441053:R146W;ENSP00000439468:R25W;ENSP00000444387:R72W	ENSP00000344140:R395W	R	+	1	2	C11orf66	61013969	0.006000	0.16342	0.149000	0.22428	0.682000	0.39822	-0.127000	0.10547	-0.248000	0.09583	0.555000	0.69702	CGG	PPP1R32	-	NULL		0.662	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R32	HGNC	protein_coding	OTTHUMT00000398621.1	C	NM_145017		61257393	+1	no_errors	ENST00000338608	ensembl	human	known	70_37	missense	SNP	0.003	T
PPP2R5E	5529	genome.wustl.edu	37	14	63848852	63848852	+	Missense_Mutation	SNP	T	T	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr14:63848852T>C	ENST00000337537.3	-	13	1828	c.1226A>G	c.(1225-1227)aAt>aGt	p.N409S	PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000422769.2_Missense_Mutation_p.N333S|PPP2R5E_ENST00000555899.1_Missense_Mutation_p.N409S	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	409					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		CTTCAACACATTGTACACCAA	0.398																																																	0													124.0	91.0	102.0					14																	63848852		2203	4300	6503	SO:0001583	missense	5529			L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.1226A>G	14.37:g.63848852T>C	ENSP00000337641:p.Asn409Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.N409S	ENST00000337537.3	37	c.1226	CCDS9758.1	14	.	.	.	.	.	.	.	.	.	.	T	22.0	4.227762	0.79576	.	.	ENSG00000154001	ENST00000337537;ENST00000555899;ENST00000422769	.	.	.	5.4	5.4	0.78164	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	M	0.83852	2.665	0.80722	D	1	D;D	0.54397	0.966;0.96	P;P	0.56278	0.534;0.795	T	0.81675	-0.0825	9	0.87932	D	0	-11.1154	15.7304	0.77800	0.0:0.0:0.0:1.0	.	409;409	B7ZKK9;Q16537	.;2A5E_HUMAN	S	409;409;333	.	ENSP00000337641:N409S	N	-	2	0	PPP2R5E	62918605	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.997000	0.88414	2.184000	0.69523	0.528000	0.53228	AAT	PPP2R5E	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.398	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5E	HGNC	protein_coding	OTTHUMT00000276973.1	T	NM_006246		63848852	-1	no_errors	ENST00000337537	ensembl	human	known	70_37	missense	SNP	1.000	C
PRIM2	5558	genome.wustl.edu	37	6	57512788	57512789	+	3'UTR	INS	-	-	TA	rs376103961|rs386701662|rs79832250		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:57512788_57512789insTA	ENST00000389488.2	+	0	1703_1704				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcactctgttgtgtaattgtg	0.436																																																	0																																										SO:0001624	3_prime_UTR_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1701->TA	6.37:g.57512788_57512789insTA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-		0.436	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	-	NM_000947		57512789	+1	no_errors	ENST00000389488	ensembl	human	known	70_37	rna	INS	0.034:0.053	TA
FBXL15	79176	genome.wustl.edu	37	10	104180693	104180693	+	5'UTR	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr10:104180693G>A	ENST00000224862.3	+	0	1123				FBXL15_ENST00000369956.2_5'UTR|CUEDC2_ENST00000465409.1_5'Flank|PSD_ENST00000492902.2_5'UTR|PSD_ENST00000406432.1_5'Flank|PSD_ENST00000020673.5_5'Flank	NM_024326.3	NP_077302.3	Q9H469	FXL15_HUMAN	F-box and leucine-rich repeat protein 15						bone mineralization (GO:0030282)|dorsal/ventral pattern formation (GO:0009953)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of BMP signaling pathway (GO:0030513)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)				kidney(1)	1		Colorectal(252;0.207)		Epithelial(162;1.19e-08)|all cancers(201;2.65e-07)		CCGAGAAGGCGAGGCCTAATG	0.577																																																	0																																										SO:0001623	5_prime_UTR_variant	5662			BC036120	CCDS31273.1	10q24.32	2011-06-09	2004-06-15	2004-06-16	ENSG00000107872	ENSG00000107872		"""F-boxes / Leucine-rich repeats"""	28155	protein-coding gene	gene with protein product		610287	"""F-box only protein 37"""	FBXO37			Standard	NM_024326		Approved	MGC11279, Fbl15	uc001kvk.2	Q9H469	OTTHUMG00000018957	ENST00000224862.3:c.-194G>A	10.37:g.104180693G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4J8|B1AKX8|B1AKX9|B1AKY0|B1AKY1|C9JWA4|Q0D2Q3|Q49AL7|Q5JWA5	RNA	SNP	-	NULL	ENST00000224862.3	37	NULL	CCDS31273.1	10																																																																																			PSD	-	-		0.577	FBXL15-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD	HGNC	protein_coding		G	XM_370575		104180693	-1	no_errors	ENST00000492902	ensembl	human	known	70_37	rna	SNP	0.370	A
PSMB11	122706	genome.wustl.edu	37	14	23511492	23511492	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr14:23511492C>T	ENST00000408907.2	+	1	117	c.58C>T	c.(58-60)Cac>Tac	p.H20Y		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	20					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		ACCATCACCTCACCTGCCTCG	0.617																																																	0													73.0	85.0	81.0					14																	23511492		2091	4214	6305	SO:0001583	missense	122706				CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.58C>T	14.37:g.23511492C>T	ENSP00000386212:p.His20Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.H20Y	ENST00000408907.2	37	c.58	CCDS41923.1	14	.	.	.	.	.	.	.	.	.	.	C	2.870	-0.234159	0.05983	.	.	ENSG00000222028	ENST00000408907	T	0.27104	1.69	5.53	2.76	0.32466	.	0.833594	0.10571	N	0.659137	T	0.11495	0.0280	N	0.08118	0	0.20703	N	0.999868	B	0.06786	0.001	B	0.04013	0.001	T	0.35649	-0.9780	10	0.07482	T	0.82	-4.0103	8.6401	0.33972	0.0:0.7584:0.0:0.2416	.	20	A5LHX3	PSB11_HUMAN	Y	20	ENSP00000386212:H20Y	ENSP00000386212:H20Y	H	+	1	0	PSMB11	22581332	0.001000	0.12720	0.230000	0.23976	0.571000	0.35966	1.412000	0.34714	0.309000	0.22966	-0.137000	0.14449	CAC	PSMB11	-	NULL		0.617	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB11	HGNC	protein_coding	OTTHUMT00000408294.1	C	NM_001099780		23511492	+1	no_errors	ENST00000408907	ensembl	human	known	70_37	missense	SNP	0.639	T
PTPRF	5792	genome.wustl.edu	37	1	44063670	44063670	+	Missense_Mutation	SNP	G	G	A	rs201745531	byFrequency	TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:44063670G>A	ENST00000359947.4	+	12	2405	c.2065G>A	c.(2065-2067)Gac>Aac	p.D689N	PTPRF_ENST00000422171.2_Intron|PTPRF_ENST00000372413.3_Missense_Mutation_p.D689N|PTPRF_ENST00000372414.3_Missense_Mutation_p.D689N|PTPRF_ENST00000438120.1_Missense_Mutation_p.D689N	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	689	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGCACACACAGACGTGGGCCC	0.701																																																	0													29.0	31.0	30.0					1																	44063670		2126	4166	6292	SO:0001583	missense	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2065G>A	1.37:g.44063670G>A	ENSP00000353030:p.Asp689Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.D689N	ENST00000359947.4	37	c.2065	CCDS489.2	1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005334	0.54254	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	3.36	3.36	0.38483	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59824	0.2222	L	0.42581	1.335	0.80722	D	1	P;D;D;B	0.71674	0.482;0.979;0.998;0.444	P;P;D;P	0.63703	0.497;0.777;0.917;0.486	T	0.55425	-0.8143	9	0.19147	T	0.46	.	15.0753	0.72071	0.0:0.0:1.0:0.0	.	345;448;689;689	Q59FI2;Q5W9G3;P10586-2;P10586	.;.;.;PTPRF_HUMAN	N	689	ENSP00000353030:D689N;ENSP00000398822:D689N;ENSP00000361491:D689N;ENSP00000361490:D689N	ENSP00000353030:D689N	D	+	1	0	PTPRF	43836257	1.000000	0.71417	0.997000	0.53966	0.775000	0.43874	6.398000	0.73244	1.613000	0.50231	0.313000	0.20887	GAC	PTPRF	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.701	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	G			44063670	+1	no_errors	ENST00000359947	ensembl	human	known	70_37	missense	SNP	0.998	A
RAB40C	57799	genome.wustl.edu	37	16	675917	675917	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:675917C>T	ENST00000248139.3	+	5	564	c.361C>T	c.(361-363)Cgg>Tgg	p.R121W	RAB40C_ENST00000538492.1_Missense_Mutation_p.R121W|RAB40C_ENST00000535977.1_Missense_Mutation_p.R121W|RAB40C_ENST00000539661.1_Missense_Mutation_p.R121W	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	121					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				CGGAGTCCCCCGGATCTTGGT	0.647																																					Melanoma(123;1631 1690 28262 44104 44957)												0													31.0	35.0	34.0					16																	675917		2198	4299	6497	SO:0001583	missense	57799			Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.361C>T	16.37:g.675917C>T	ENSP00000248139:p.Arg121Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R121W	ENST00000248139.3	37	c.361	CCDS10413.1	16	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535574	0.64972	.	.	ENSG00000197562	ENST00000535977;ENST00000539661;ENST00000538492;ENST00000248139	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.22	4.26	0.50523	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85961	0.5819	L	0.52905	1.665	0.54753	D	0.999987	D	0.76494	0.999	D	0.70227	0.968	D	0.86779	0.1978	10	0.87932	D	0	.	12.2567	0.54627	0.308:0.692:0.0:0.0	.	121	Q96S21	RB40C_HUMAN	W	121	ENSP00000438492:R121W;ENSP00000445050:R121W;ENSP00000438382:R121W;ENSP00000248139:R121W	ENSP00000248139:R121W	R	+	1	2	RAB40C	615918	0.493000	0.26035	1.000000	0.80357	0.675000	0.39556	1.109000	0.31135	1.189000	0.43028	0.561000	0.74099	CGG	RAB40C	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.647	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40C	HGNC	protein_coding	OTTHUMT00000109079.4	C	NM_021168		675917	+1	no_errors	ENST00000248139	ensembl	human	known	70_37	missense	SNP	1.000	T
RFX2	5990	genome.wustl.edu	37	19	6042128	6042128	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:6042128G>A	ENST00000303657.5	-	4	336	c.187C>T	c.(187-189)Ccg>Tcg	p.P63S	RFX2_ENST00000592546.1_Missense_Mutation_p.P63S|RFX2_ENST00000359161.3_Missense_Mutation_p.P63S	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	63					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						TGCTGCACCGGCTGCACCTGA	0.582																																					Colon(38;171 817 19800 47433 48051)												0													119.0	86.0	97.0					19																	6042128		2203	4300	6503	SO:0001583	missense	5990				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.187C>T	19.37:g.6042128G>A	ENSP00000306335:p.Pro63Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.P63S	ENST00000303657.5	37	c.187	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716495	0.30413	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T;T	0.28255	1.62;1.62	4.37	2.2	0.27929	RFX1 transcription activation region (1);	0.768710	0.12733	N	0.443686	T	0.15869	0.0382	L	0.28400	0.85	0.20563	N	0.999885	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.30794	-0.9966	10	0.10902	T	0.67	-14.5705	1.5788	0.02630	0.1845:0.1675:0.475:0.173	.	63;63	P48378-2;P48378	.;RFX2_HUMAN	S	63;63;18	ENSP00000306335:P63S;ENSP00000352076:P63S	ENSP00000306335:P63S	P	-	1	0	RFX2	5993128	0.938000	0.31826	0.714000	0.30535	0.856000	0.48823	-0.023000	0.12456	0.476000	0.27440	0.456000	0.33151	CCG	RFX2	-	pfam_RFX1_trans_act		0.582	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	G	NM_000635		6042128	-1	no_errors	ENST00000303657	ensembl	human	known	70_37	missense	SNP	0.993	A
RNF217	154214	genome.wustl.edu	37	6	125379248	125379248	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:125379248G>A	ENST00000521654.2	+	3	1277	c.1277G>A	c.(1276-1278)tGc>tAc	p.C426Y	RNF217_ENST00000368414.2_5'UTR|RNF217_ENST00000275184.6_Missense_Mutation_p.C70Y|RNF217_ENST00000359704.2_Missense_Mutation_p.C134Y|RNF217_ENST00000560949.1_Missense_Mutation_p.C191Y			Q8TC41	RN217_HUMAN	ring finger protein 217	426					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		TGTCCAAAGTGCAAGGTGAGA	0.398																																																	0													74.0	70.0	71.0					6																	125379248		2203	4300	6503	SO:0001583	missense	154214			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1277G>A	6.37:g.125379248G>A	ENSP00000428698:p.Cys426Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_C6HC	p.C191Y	ENST00000521654.2	37	c.572		6	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429370	0.83776	.	.	ENSG00000146373	ENST00000521654;ENST00000359704;ENST00000275184	D;D	0.99458	-5.93;-5.93	5.37	5.37	0.77165	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97598	1.0121	10	0.87932	D	0	.	19.4677	0.94950	0.0:0.0:1.0:0.0	.	134;191	Q8TC41;F2Z2M4	RN217_HUMAN;.	Y	191;134;70	ENSP00000352734:C134Y;ENSP00000275184:C70Y	ENSP00000275184:C70Y	C	+	2	0	RNF217	125420947	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.420000	0.97426	2.693000	0.91896	0.579000	0.79373	TGC	RNF217	-	pfam_Znf_C6HC,smart_Znf_C6HC		0.398	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	HGNC	protein_coding	OTTHUMT00000042063.3	G	NM_152553		125379248	+1	no_errors	ENST00000560949	ensembl	human	known	70_37	missense	SNP	1.000	A
RNPC3	55599	genome.wustl.edu	37	1	104068792	104068792	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:104068792C>T	ENST00000533099.1	+	2	336	c.100C>T	c.(100-102)Ctg>Ttg	p.L34L	RNPC3_ENST00000423855.2_Silent_p.L34L|RP11-153F1.1_ENST00000444810.1_RNA|RP11-153F1.1_ENST00000447322.2_RNA|RNPC3_ENST00000524631.1_Silent_p.L34L|RN7SKP285_ENST00000410137.1_RNA			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	34	Necessary for interaction with PDCD7.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GGTCAGGCACCTGCCGGCTGA	0.617																																																	0													41.0	40.0	40.0					1																	104068792		692	1591	2283	SO:0001819	synonymous_variant	55599			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.100C>T	1.37:g.104068792C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L34	ENST00000533099.1	37	c.100	CCDS781.1	1																																																																																			RNPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.617	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	C	NM_017619		104068792	+1	no_errors	ENST00000423855	ensembl	human	known	70_37	silent	SNP	1.000	T
NUP88	4927	genome.wustl.edu	37	17	5324784	5324784	+	5'Flank	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:5324784C>T	ENST00000573584.1	-	0	0				RPAIN_ENST00000327154.6_Nonsense_Mutation_p.Q84*|RPAIN_ENST00000381208.5_Nonsense_Mutation_p.Q84*|RPAIN_ENST00000574003.1_Nonsense_Mutation_p.Q84*|RPAIN_ENST00000536255.2_Nonsense_Mutation_p.Q84*|RPAIN_ENST00000381209.3_Nonsense_Mutation_p.Q84*|RPAIN_ENST00000405578.4_Nonsense_Mutation_p.Q84*	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						AGACTTGGCTCAGGTCAGGCT	0.493																																																	0													78.0	67.0	70.0					17																	5324784		2203	4300	6503	SO:0001631	upstream_gene_variant	84268			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453		17.37:g.5324784C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTM2|Q9BWE5	Nonsense_Mutation	SNP	NULL	p.Q84*	ENST00000573584.1	37	c.250	CCDS11070.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.646637	0.97730	.	.	ENSG00000129197	ENST00000381209;ENST00000381208;ENST00000539417;ENST00000536255;ENST00000405578;ENST00000540734;ENST00000327154	.	.	.	5.2	5.2	0.72013	.	0.496219	0.24162	N	0.040972	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-6.5612	14.1706	0.65508	0.0:1.0:0.0:0.0	.	.	.	.	X	84	.	ENSP00000315069:Q84X	Q	+	1	0	RPAIN	5265508	0.998000	0.40836	0.998000	0.56505	0.335000	0.28730	4.200000	0.58433	2.729000	0.93468	0.461000	0.40582	CAG	RPAIN	-	NULL		0.493	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAIN	HGNC	protein_coding	OTTHUMT00000216918.3	C	NM_002532		5324784	+1	no_errors	ENST00000405578	ensembl	human	known	70_37	nonsense	SNP	0.998	T
RPN1	6184	genome.wustl.edu	37	3	128363805	128363805	+	Missense_Mutation	SNP	C	C	G	rs376078228		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr3:128363805C>G	ENST00000296255.3	-	2	331	c.283G>C	c.(283-285)Gag>Cag	p.E95Q	RPN1_ENST00000497289.1_5'UTR	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	95					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		AAATTGTTCTCTTCCTCATCT	0.338			T	EVI1	AML																																			Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	0													250.0	215.0	227.0					3																	128363805		2203	4300	6503	SO:0001583	missense	6184				CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.283G>C	3.37:g.128363805C>G	ENSP00000296255:p.Glu95Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5Z0|D3DNB6|Q68DT1	Missense_Mutation	SNP	pfam_Ribophorin_I	p.E95Q	ENST00000296255.3	37	c.283	CCDS3051.1	3	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192548	0.78902	.	.	ENSG00000163902	ENST00000296255;ENST00000545956	.	.	.	5.01	5.01	0.66863	.	0.165190	0.53938	D	0.000056	T	0.54159	0.1841	L	0.40543	1.245	0.80722	D	1	B	0.19073	0.033	B	0.21151	0.033	T	0.49204	-0.8964	9	0.17832	T	0.49	-15.6971	17.6567	0.88180	0.0:1.0:0.0:0.0	.	95	P04843	RPN1_HUMAN	Q	95;69	.	ENSP00000296255:E95Q	E	-	1	0	RPN1	129846495	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.657000	0.67996	2.483000	0.83821	0.591000	0.81541	GAG	RPN1	-	pfam_Ribophorin_I		0.338	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN1	HGNC	protein_coding	OTTHUMT00000356934.2	C	NM_002950		128363805	-1	no_errors	ENST00000296255	ensembl	human	known	70_37	missense	SNP	1.000	G
RRS1	23212	genome.wustl.edu	37	8	67342188	67342188	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:67342188C>T	ENST00000320270.2	+	1	926	c.822C>T	c.(820-822)gtC>gtT	p.V274V	ADHFE1_ENST00000396623.3_5'Flank|ADHFE1_ENST00000379385.4_5'Flank|ADHFE1_ENST00000415254.1_5'Flank|RP11-346I3.4_ENST00000499642.1_lincRNA	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	274					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TGCTTCGTGTCATGAACAGCA	0.557																																																	0													27.0	31.0	30.0					8																	67342188		2203	4300	6503	SO:0001819	synonymous_variant	23212			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.822C>T	8.37:g.67342188C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUX8	Silent	SNP	pfam_Ribosom_reg	p.V274	ENST00000320270.2	37	c.822	CCDS6189.1	8																																																																																			RRS1	-	NULL		0.557	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRS1	HGNC	protein_coding	OTTHUMT00000380126.1	C	NM_015169		67342188	+1	no_errors	ENST00000320270	ensembl	human	known	70_37	silent	SNP	0.995	T
RSBN1	54665	genome.wustl.edu	37	1	114311001	114311001	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:114311001C>T	ENST00000261441.5	-	5	1732	c.1669G>A	c.(1669-1671)Gaa>Aaa	p.E557K	RSBN1_ENST00000369581.2_5'Flank	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	557						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTTTTATTTCATTCATTGAT	0.388																																																	0													114.0	114.0	114.0					1																	114311001		2203	4300	6503	SO:0001583	missense	54665			AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.1669G>A	1.37:g.114311001C>T	ENSP00000261441:p.Glu557Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	NULL	p.E557K	ENST00000261441.5	37	c.1669	CCDS862.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.702565	0.96812	.	.	ENSG00000081019	ENST00000261441	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.80803	0.4693	M	0.78801	2.425	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.81959	-0.0694	9	0.72032	D	0.01	-11.6252	19.8336	0.96646	0.0:1.0:0.0:0.0	.	557	Q5VWQ0	RSBN1_HUMAN	K	557	.	ENSP00000261441:E557K	E	-	1	0	RSBN1	114112524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.692000	0.91855	0.655000	0.94253	GAA	RSBN1	-	NULL		0.388	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1	HGNC	protein_coding	OTTHUMT00000033022.2	C	NM_018364		114311001	-1	no_errors	ENST00000261441	ensembl	human	known	70_37	missense	SNP	1.000	T
RTN4IP1	84816	genome.wustl.edu	37	6	107076725	107076725	+	Silent	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:107076725G>T	ENST00000369063.3	-	1	637	c.172C>A	c.(172-174)Cga>Aga	p.R58R	RTN4IP1_ENST00000539449.1_Silent_p.R58R|QRSL1_ENST00000369044.1_5'Flank|QRSL1_ENST00000369046.4_5'Flank	NM_032730.4	NP_116119.2	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1	58						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		TGAGTGAATCGAAGCACTTCA	0.408																																																	0													152.0	132.0	139.0					6																	107076725		2203	4300	6503	SO:0001819	synonymous_variant	84816			AF336861	CCDS5056.1	6q21	2008-02-05			ENSG00000130347	ENSG00000130347			18647	protein-coding gene	gene with protein product		610502					Standard	NM_032730		Approved	NIMP	uc003prj.3	Q8WWV3	OTTHUMG00000015304	ENST00000369063.3:c.172C>A	6.37:g.107076725G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N9B3|Q8WZ66|Q9BRA4	Silent	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.R58	ENST00000369063.3	37	c.172	CCDS5056.1	6																																																																																			RTN4IP1	-	superfamily_GroES-like,smart_PKS_ER		0.408	RTN4IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4IP1	HGNC	protein_coding	OTTHUMT00000041673.1	G			107076725	-1	no_errors	ENST00000369063	ensembl	human	known	70_37	silent	SNP	1.000	T
RTN4RL2	349667	genome.wustl.edu	37	11	57244279	57244279	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr11:57244279C>T	ENST00000335099.3	+	3	1475	c.1158C>T	c.(1156-1158)ccC>ccT	p.P386P	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						AGATGTGCCCCGGCGCTGCCT	0.751																																																	0													8.0	11.0	10.0					11																	57244279		2054	4084	6138	SO:0001819	synonymous_variant	349667			BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.1158C>T	11.37:g.57244279C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P386	ENST00000335099.3	37	c.1158	CCDS7957.1	11																																																																																			RTN4RL2	-	NULL		0.751	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4RL2	HGNC	protein_coding	OTTHUMT00000392537.1	C	NM_178570		57244279	+1	no_errors	ENST00000335099	ensembl	human	known	70_37	silent	SNP	0.883	T
SASH3	54440	genome.wustl.edu	37	X	128913963	128913963	+	5'UTR	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:128913963G>A	ENST00000356892.3	+	0	4				SASH3_ENST00000476532.1_3'UTR	NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3						homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						AGTGGCAGCTGAAGGCTCGGT	0.627																																																	0																																										SO:0001623	5_prime_UTR_variant	54440			BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.-111G>A	X.37:g.128913963G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCH1|A8K7K8|Q5JZ38	RNA	SNP	-	NULL	ENST00000356892.3	37	NULL	CCDS14614.1	X																																																																																			SASH3	-	-		0.627	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH3	HGNC	protein_coding	OTTHUMT00000058208.1	G	NM_018990		128913963	+1	no_errors	ENST00000476532	ensembl	human	known	70_37	rna	SNP	0.005	A
SCG2	7857	genome.wustl.edu	37	2	224462210	224462210	+	Silent	SNP	G	G	A	rs201064129		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:224462210G>A	ENST00000305409.2	-	2	2023	c.1791C>T	c.(1789-1791)ctC>ctT	p.L597L		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTTCTTGGTTGAGGTATTCCA	0.443																																																	0													150.0	148.0	149.0					2																	224462210		2203	4300	6503	SO:0001819	synonymous_variant	7857			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1791C>T	2.37:g.224462210G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	pfam_Granin	p.L597	ENST00000305409.2	37	c.1791	CCDS2457.1	2																																																																																			SCG2	-	pfam_Granin		0.443	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	G	NM_003469		224462210	-1	no_errors	ENST00000305409	ensembl	human	known	70_37	silent	SNP	0.999	A
SDCCAG8	10806	genome.wustl.edu	37	1	243507587	243507587	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:243507587G>A	ENST00000366541.3	+	12	1545	c.1427G>A	c.(1426-1428)aGa>aAa	p.R476K	SDCCAG8_ENST00000343783.6_Missense_Mutation_p.R331K|MIR4677_ENST00000584153.1_RNA|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.R433K	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	476	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AAGGAGCACAGAGAGTTCAGA	0.378																																																	0													113.0	109.0	110.0					1																	243507587		2203	4300	6503	SO:0001583	missense	10806			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1427G>A	1.37:g.243507587G>A	ENSP00000355499:p.Arg476Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	NULL	p.R476K	ENST00000366541.3	37	c.1427	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285995	0.40394	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.48836	0.91;0.86;0.87;0.8	6.07	2.09	0.27110	.	0.288299	0.38005	N	0.001842	T	0.27169	0.0666	L	0.32530	0.975	0.41601	D	0.988857	B;B	0.17268	0.003;0.021	B;B	0.16722	0.009;0.016	T	0.19745	-1.0296	10	0.02654	T	1	-2.4805	5.8955	0.18937	0.2558:0.0:0.6213:0.1229	.	433;476	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	K	433;476;331;256	ENSP00000348137:R433K;ENSP00000355499:R476K;ENSP00000341260:R331K;ENSP00000410200:R256K	ENSP00000341260:R331K	R	+	2	0	SDCCAG8	241574210	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	2.271000	0.43364	0.137000	0.18759	-0.225000	0.12378	AGA	SDCCAG8	-	NULL		0.378	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	G	NM_006642		243507587	+1	no_errors	ENST00000366541	ensembl	human	known	70_37	missense	SNP	1.000	A
SERPINF2	5345	genome.wustl.edu	37	17	1657566	1657566	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:1657566C>T	ENST00000324015.3	+	10	1291	c.1214C>T	c.(1213-1215)tCc>tTc	p.S405F	SERPINF2_ENST00000450523.2_Missense_Mutation_p.S341F|SERPINF2_ENST00000382061.4_Missense_Mutation_p.S405F	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	405		Reactive bond for chymotrypsin.			acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	TCCCGCATGTCCCTGTCCTCC	0.657																																																	0													146.0	120.0	129.0					17																	1657566		2203	4300	6503	SO:0001583	missense	5345			D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1214C>T	17.37:g.1657566C>T	ENSP00000321853:p.Ser405Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S405F	ENST00000324015.3	37	c.1214	CCDS11011.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608883	0.87258	.	.	ENSG00000167711	ENST00000324015;ENST00000450523;ENST00000382061	T;T;T	0.39592	1.07;1.07;1.07	5.63	5.63	0.86233	Serpin domain (3);	0.000000	0.85682	D	0.000000	T	0.70692	0.3253	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.74140	-0.3761	9	.	.	.	.	18.6627	0.91477	0.0:1.0:0.0:0.0	.	341;405	B4E1B7;P08697	.;A2AP_HUMAN	F	405;341;405	ENSP00000321853:S405F;ENSP00000403877:S341F;ENSP00000371493:S405F	.	S	+	2	0	SERPINF2	1604316	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.299000	0.78831	2.654000	0.90174	0.655000	0.94253	TCC	SERPINF2	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.657	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF2	HGNC	protein_coding	OTTHUMT00000207078.3	C	NM_000934		1657566	+1	no_errors	ENST00000324015	ensembl	human	known	70_37	missense	SNP	0.998	T
SFRP1	6422	genome.wustl.edu	37	8	41122839	41122839	+	Silent	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:41122839G>C	ENST00000220772.3	-	3	1129	c.792C>G	c.(790-792)ctC>ctG	p.L264L	SFRP1_ENST00000379845.3_Silent_p.L128L	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	264	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			AGTGGTGGCTGAGGTTGTCCA	0.532																																																	0													137.0	118.0	124.0					8																	41122839		2203	4300	6503	SO:0001819	synonymous_variant	6422			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.792C>G	8.37:g.41122839G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O00546|O14779	Silent	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.L264	ENST00000220772.3	37	c.792	CCDS34886.1	8																																																																																			SFRP1	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain		0.532	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	G	NM_003012		41122839	-1	no_errors	ENST00000220772	ensembl	human	known	70_37	silent	SNP	0.969	C
SGCD	6444	genome.wustl.edu	37	5	156016295	156016295	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr5:156016295G>A	ENST00000435422.3	+	4	833	c.346G>A	c.(346-348)Gac>Aac	p.D116N	SGCD_ENST00000447401.1_Missense_Mutation_p.D117N|SGCD_ENST00000337851.4_Missense_Mutation_p.D117N|SGCD_ENST00000517913.1_Missense_Mutation_p.D117N	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	116					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATTCTCAATGACCAGACTAA	0.388																																																	0													62.0	57.0	59.0					5																	156016295		1889	4106	5995	SO:0001583	missense	6444			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.346G>A	5.37:g.156016295G>A	ENSP00000403003:p.Asp116Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	pfam_Sarcoglycan	p.D117N	ENST00000435422.3	37	c.349	CCDS47327.1	5	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682373	0.47991	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	4.67	4.67	0.58626	.	0.405259	0.27023	N	0.021301	D	0.85561	0.5725	N	0.03608	-0.345	0.37164	D	0.902711	B;B;B	0.19817	0.0;0.0;0.039	B;B;B	0.24006	0.001;0.0;0.05	T	0.82202	-0.0574	10	0.07030	T	0.85	-2.3472	17.564	0.87914	0.0:0.0:1.0:0.0	.	116;117;117	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	N	117;116;117;117	ENSP00000429378:D117N;ENSP00000403003:D116N;ENSP00000338343:D117N;ENSP00000408324:D117N	ENSP00000338343:D117N	D	+	1	0	SGCD	155948873	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.086000	0.76885	2.154000	0.67381	0.561000	0.74099	GAC	SGCD	-	pfam_Sarcoglycan		0.388	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3	G			156016295	+1	no_errors	ENST00000337851	ensembl	human	known	70_37	missense	SNP	1.000	A
SHPRH	257218	genome.wustl.edu	37	6	146275945	146275945	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:146275945C>T	ENST00000367505.2	-	2	778	c.514G>A	c.(514-516)Gac>Aac	p.D172N	SHPRH_ENST00000438092.2_Missense_Mutation_p.D172N|SHPRH_ENST00000275233.7_Missense_Mutation_p.D172N|SHPRH_ENST00000367503.3_Missense_Mutation_p.D172N			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	172					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		ATACCCTTGTCACAAATACTC	0.368																																																	0													114.0	104.0	107.0					6																	146275945		1827	4089	5916	SO:0001583	missense	257218			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.514G>A	6.37:g.146275945C>T	ENSP00000356475:p.Asp172Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5,superfamily_Znf_FYVE_PHD,superfamily_WW_Rsp5_WWP,smart_Helicase_ATP-bd,smart_Histone_H1/H5,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.D172N	ENST00000367505.2	37	c.514	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	C	8.606	0.887921	0.17540	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.66	4.78	0.61160	.	0.776501	0.11614	N	0.546457	T	0.36331	0.0963	L	0.36672	1.1	0.09310	N	0.999995	B;B;B;P	0.37276	0.034;0.047;0.078;0.589	B;B;B;B	0.28011	0.036;0.024;0.053;0.085	T	0.16158	-1.0412	10	0.30078	T	0.28	-4.1158	15.0315	0.71710	0.0:0.9307:0.0:0.0693	.	61;172;172;61	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	N	172;172;172;172;61	ENSP00000356475:D172N;ENSP00000356473:D172N;ENSP00000412797:D172N;ENSP00000275233:D172N	ENSP00000275233:D172N	D	-	1	0	SHPRH	146317638	0.029000	0.19370	0.124000	0.21820	0.156000	0.22039	2.156000	0.42310	1.365000	0.46057	0.655000	0.94253	GAC	SHPRH	-	NULL		0.368	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	C	NM_173082		146275945	-1	no_errors	ENST00000367503	ensembl	human	known	70_37	missense	SNP	0.492	T
SLC19A1	6573	genome.wustl.edu	37	21	46935896	46935896	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr21:46935896C>T	ENST00000311124.4	-	6	1604	c.1452G>A	c.(1450-1452)ctG>ctA	p.L484L	SLC19A1_ENST00000485649.2_Silent_p.L444L|SLC19A1_ENST00000380010.4_Intron|SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000567670.1_Intron	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	484					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	CCTGCACGCTCAGTGCCTGTG	0.736																																																	0													9.0	9.0	9.0					21																	46935896		2155	4211	6366	SO:0001819	synonymous_variant	6573			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.1452G>A	21.37:g.46935896C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Silent	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.L484	ENST00000311124.4	37	c.1452	CCDS13725.1	21																																																																																			SLC19A1	-	pirsf_Folate_carrier,tigrfam_Folate_carrier		0.736	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	C			46935896	-1	no_errors	ENST00000311124	ensembl	human	known	70_37	silent	SNP	0.001	T
SLC19A1	6573	genome.wustl.edu	37	21	46951727	46951727	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr21:46951727G>A	ENST00000311124.4	-	3	677	c.525C>T	c.(523-525)gtC>gtT	p.V175V	SLC19A1_ENST00000485649.2_Silent_p.V135V|SLC19A1_ENST00000380010.4_Silent_p.V175V|SLC19A1_ENST00000567670.1_Silent_p.V175V	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	175					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	GGCCCACAGTGACCAGCAGCT	0.677																																																	0													62.0	43.0	49.0					21																	46951727		2192	4286	6478	SO:0001819	synonymous_variant	6573			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.525C>T	21.37:g.46951727G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Silent	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.V175	ENST00000311124.4	37	c.525	CCDS13725.1	21																																																																																			SLC19A1	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier		0.677	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	G			46951727	-1	no_errors	ENST00000311124	ensembl	human	known	70_37	silent	SNP	0.993	A
SLC19A1	6573	genome.wustl.edu	37	21	46951839	46951839	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr21:46951839G>C	ENST00000311124.4	-	3	565	c.413C>G	c.(412-414)tCc>tGc	p.S138C	SLC19A1_ENST00000485649.2_Missense_Mutation_p.S98C|SLC19A1_ENST00000380010.4_Missense_Mutation_p.S138C|SLC19A1_ENST00000567670.1_Missense_Mutation_p.S138C	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	138					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	GAAGATGTAGGAGGAATAGGC	0.672																																																	0													19.0	21.0	20.0					21																	46951839		2190	4289	6479	SO:0001583	missense	6573			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.413C>G	21.37:g.46951839G>C	ENSP00000308895:p.Ser138Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.S138C	ENST00000311124.4	37	c.413	CCDS13725.1	21	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447961	0.63178	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649;ENST00000427839;ENST00000443742	D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5	4.95	4.95	0.65309	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.95793	0.8631	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.998;0.997	D	0.96785	0.9578	10	0.87932	D	0	-59.2487	17.1012	0.86651	0.0:0.0:1.0:0.0	.	98;160;138;138	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	C	138;138;98;138;138	ENSP00000308895:S138C;ENSP00000369347:S138C;ENSP00000441772:S98C;ENSP00000401850:S138C;ENSP00000411345:S138C	ENSP00000308895:S138C	S	-	2	0	SLC19A1	45776267	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	9.327000	0.96396	2.460000	0.83146	0.462000	0.41574	TCC	SLC19A1	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier		0.672	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	G			46951839	-1	no_errors	ENST00000311124	ensembl	human	known	70_37	missense	SNP	1.000	C
CDH15	1013	genome.wustl.edu	37	16	89264650	89264650	+	IGR	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:89264650C>G	ENST00000289746.2	+	0	2847				SLC22A31_ENST00000562855.2_Missense_Mutation_p.E378Q	NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCTGCCGCCTCCAGGCCGGCC	0.667																																																	0																																										SO:0001628	intergenic_variant	146429			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045		16.37:g.89264650C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000289746.2	37	NULL	CCDS10976.1	16																																																																																			SLC22A31	-	-		0.667	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A31	HGNC	protein_coding	OTTHUMT00000269920.1	C	NM_004933		89264650	-1	no_errors	ENST00000562855	ensembl	human	known	70_37	rna	SNP	0.998	G
SLC30A1	7779	genome.wustl.edu	37	1	211749179	211749179	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:211749179C>G	ENST00000367001.4	-	2	1204	c.1075G>C	c.(1075-1077)Gaa>Caa	p.E359Q		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	359					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)	p.E359*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TTTCGAAGTTCTTTTATCAAA	0.338																																																	1	Substitution - Nonsense(1)	large_intestine(1)											62.0	63.0	63.0					1																	211749179		2203	4299	6502	SO:0001583	missense	7779			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1075G>C	1.37:g.211749179C>G	ENSP00000355968:p.Glu359Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E359Q	ENST00000367001.4	37	c.1075	CCDS1499.1	1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653619	0.47362	.	.	ENSG00000170385	ENST00000367001	T	0.63913	-0.07	5.54	4.58	0.56647	.	0.527793	0.22800	N	0.055486	T	0.47600	0.1454	L	0.33668	1.02	0.35520	D	0.801324	P	0.49185	0.92	P	0.45195	0.473	T	0.53443	-0.8438	10	0.24483	T	0.36	-12.3439	4.168	0.10315	0.0:0.5945:0.2153:0.1901	.	359	Q9Y6M5	ZNT1_HUMAN	Q	359	ENSP00000355968:E359Q	ENSP00000355968:E359Q	E	-	1	0	SLC30A1	209815802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.942000	0.40243	2.607000	0.88179	0.563000	0.77884	GAA	SLC30A1	-	pfam_Cation_efflux		0.338	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	HGNC	protein_coding	OTTHUMT00000104738.2	C			211749179	-1	no_errors	ENST00000367001	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC46A3	283537	genome.wustl.edu	37	13	29284946	29284946	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr13:29284946G>A	ENST00000266943.6	-	4	1464	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	SLC46A3_ENST00000380814.4_Silent_p.F365F	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	365					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		GTAGAACAGAGAATGGCACAA	0.388																																																	0													139.0	133.0	135.0					13																	29284946		2203	4300	6503	SO:0001819	synonymous_variant	283537				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1095C>T	13.37:g.29284946G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F365	ENST00000266943.6	37	c.1095	CCDS9332.1	13																																																																																			SLC46A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.388	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	G	NM_181785		29284946	-1	no_errors	ENST00000266943	ensembl	human	known	70_37	silent	SNP	0.088	A
SLC4A10	57282	genome.wustl.edu	37	2	162813641	162813641	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:162813641C>T	ENST00000446997.1	+	20	2777	c.2684C>T	c.(2683-2685)tCa>tTa	p.S895L	SLC4A10_ENST00000421911.1_Missense_Mutation_p.S895L|SLC4A10_ENST00000415876.2_Missense_Mutation_p.S865L|SLC4A10_ENST00000375514.5_Missense_Mutation_p.S876L|SLC4A10_ENST00000272716.5_Missense_Mutation_p.S865L	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	895					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TCAGAATGCTCAGCTCCAGGA	0.468																																																	0													61.0	64.0	63.0					2																	162813641		2148	4289	6437	SO:0001583	missense	57282				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2684C>T	2.37:g.162813641C>T	ENSP00000393066:p.Ser895Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.S895L	ENST00000446997.1	37	c.2684	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.163955	0.94727	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.28	5.28	0.74379	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88235	0.6382	M	0.81239	2.535	0.80722	D	1	D;D;D	0.63046	0.989;0.989;0.992	D;D;D	0.64506	0.923;0.923;0.926	D	0.88573	0.3131	10	0.52906	T	0.07	.	19.2695	0.94003	0.0:1.0:0.0:0.0	.	876;865;895	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	L	876;865;865;864;895;895;894	ENSP00000364664:S876L;ENSP00000395797:S865L;ENSP00000272716:S865L;ENSP00000393066:S895L;ENSP00000404486:S895L	ENSP00000272716:S865L	S	+	2	0	SLC4A10	162521887	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.608000	0.88229	0.655000	0.94253	TCA	SLC4A10	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.468	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	C	NM_022058		162813641	+1	no_errors	ENST00000446997	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC4A8	9498	genome.wustl.edu	37	12	51863470	51863470	+	Silent	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:51863470C>G	ENST00000453097.2	+	12	1639	c.1422C>G	c.(1420-1422)ctC>ctG	p.L474L	SLC4A8_ENST00000546663.1_3'UTR|SLC4A8_ENST00000514353.3_Silent_p.L421L|SLC4A8_ENST00000358657.3_Silent_p.L501L|SLC4A8_ENST00000535225.2_Silent_p.L421L|SLC4A8_ENST00000394856.1_Silent_p.L421L	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		GAGATGCACTCAGCTTACAGT	0.547																																																	0													260.0	214.0	230.0					12																	51863470		2203	4300	6503	SO:0001819	synonymous_variant	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1422C>G	12.37:g.51863470C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L474	ENST00000453097.2	37	c.1422	CCDS44890.1	12																																																																																			SLC4A8	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk		0.547	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	C	NM_004858		51863470	+1	no_errors	ENST00000453097	ensembl	human	known	70_37	silent	SNP	0.999	G
SNAI1	6615	genome.wustl.edu	37	20	48604490	48604490	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr20:48604490C>G	ENST00000244050.2	+	3	753	c.692C>G	c.(691-693)tCa>tGa	p.S231*		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	231	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CAGACCCACTCAGATGTCAAG	0.637																																																	0													139.0	116.0	124.0					20																	48604490		2203	4300	6503	SO:0001587	stop_gained	6615			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.692C>G	20.37:g.48604490C>G	ENSP00000244050:p.Ser231*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R842|Q9P113|Q9UBP7|Q9UHH7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S231*	ENST00000244050.2	37	c.692	CCDS13423.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.262899	0.95399	.	.	ENSG00000124216	ENST00000244050	.	.	.	4.97	4.97	0.65823	.	0.058631	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-5.5005	18.6122	0.91290	0.0:1.0:0.0:0.0	.	.	.	.	X	231	.	ENSP00000244050:S231X	S	+	2	0	SNAI1	48037897	1.000000	0.71417	0.988000	0.46212	0.738000	0.42128	7.445000	0.80570	2.467000	0.83353	0.462000	0.41574	TCA	SNAI1	-	pfscan_Znf_C2H2		0.637	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	HGNC	protein_coding	OTTHUMT00000080350.1	C			48604490	+1	no_errors	ENST00000244050	ensembl	human	known	70_37	nonsense	SNP	1.000	G
MAGED2	10916	genome.wustl.edu	37	X	54840906	54840906	+	Intron	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:54840906C>T	ENST00000375068.1	+	11	1504				MAGED2_ENST00000375058.1_Intron|MAGED2_ENST00000375060.1_Intron|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000218439.4_Intron|MAGED2_ENST00000375062.4_Intron|MAGED2_ENST00000396224.1_Intron|MAGED2_ENST00000375053.2_Intron|MAGED2_ENST00000347546.4_Intron			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2							membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						CTTGTGGCTTCCCTATGAACA	0.507																																																	0													308.0	272.0	283.0					X																	54840906		876	1991	2867	SO:0001627	intron_variant	677799			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1272-188C>T	X.37:g.54840906C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	RNA	SNP	-	NULL	ENST00000375068.1	37	NULL	CCDS14362.1	X																																																																																			SNORA11	-	-		0.507	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNORA11	HGNC	protein_coding	OTTHUMT00000056821.2	C	NM_014599		54840906	+1	no_errors	ENST00000408789	ensembl	human	known	70_37	rna	SNP	0.000	T
SOS2	6655	genome.wustl.edu	37	14	50616733	50616733	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr14:50616733G>A	ENST00000216373.5	-	14	2651	c.2377C>T	c.(2377-2379)Ctt>Ttt	p.L793F	SOS2_ENST00000543680.1_Missense_Mutation_p.L760F	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	793	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					TACCTGTAAAGATCAGACTCC	0.333																																																	0													130.0	124.0	126.0					14																	50616733		2203	4300	6503	SO:0001583	missense	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2377C>T	14.37:g.50616733G>A	ENSP00000216373:p.Leu793Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L793F	ENST00000216373.5	37	c.2377	CCDS9697.1	14	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410822	0.83340	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.36340	1.26;1.26	5.52	5.52	0.82312	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.52338	0.1728	M	0.91196	3.185	0.80722	D	1	P;P	0.48911	0.907;0.917	B;B	0.41088	0.347;0.278	T	0.66874	-0.5813	10	0.54805	T	0.06	.	19.4316	0.94772	0.0:0.0:1.0:0.0	.	760;793	B7ZKT6;Q07890	.;SOS2_HUMAN	F	793;760	ENSP00000216373:L793F;ENSP00000445328:L760F	ENSP00000216373:L793F	L	-	1	0	SOS2	49686483	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.027000	0.88791	2.606000	0.88127	0.655000	0.94253	CTT	SOS2	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.333	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	G			50616733	-1	no_errors	ENST00000216373	ensembl	human	known	70_37	missense	SNP	1.000	A
SPHK2	56848	genome.wustl.edu	37	19	49132817	49132817	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:49132817C>T	ENST00000245222.4	+	7	2118	c.1752C>T	c.(1750-1752)ttC>ttT	p.F584F	SPHK2_ENST00000599029.1_Silent_p.F548F|SPHK2_ENST00000599748.1_Silent_p.F548F|SPHK2_ENST00000340932.3_Silent_p.F546F|SPHK2_ENST00000600537.1_Silent_p.F525F|SPHK2_ENST00000598088.1_Silent_p.F584F|SPHK2_ENST00000443164.1_Silent_p.F646F	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	584					blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)	p.F584L(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TGCGCCTTTTCTTGGCCATGG	0.701																																																	1	Substitution - Missense(1)	urinary_tract(1)											20.0	17.0	18.0					19																	49132817		2195	4294	6489	SO:0001819	synonymous_variant	56848			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.1752C>T	19.37:g.49132817C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.F646	ENST00000245222.4	37	c.1938	CCDS12727.1	19																																																																																			SPHK2	-	NULL		0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	C			49132817	+1	no_errors	ENST00000443164	ensembl	human	known	70_37	silent	SNP	0.999	T
SPHK2	56848	genome.wustl.edu	37	19	49132889	49132889	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:49132889C>T	ENST00000245222.4	+	7	2190	c.1824C>T	c.(1822-1824)ttC>ttT	p.F608F	SPHK2_ENST00000599029.1_Silent_p.F572F|SPHK2_ENST00000599748.1_Silent_p.F572F|SPHK2_ENST00000340932.3_Silent_p.F570F|SPHK2_ENST00000600537.1_Silent_p.F549F|SPHK2_ENST00000598088.1_Silent_p.F608F|SPHK2_ENST00000443164.1_Silent_p.F670F	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	608					blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CCCGTGCCTTCCGCCTAGAGC	0.677																																																	0													18.0	16.0	17.0					19																	49132889		2198	4295	6493	SO:0001819	synonymous_variant	56848			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.1824C>T	19.37:g.49132889C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.F670	ENST00000245222.4	37	c.2010	CCDS12727.1	19																																																																																			SPHK2	-	NULL		0.677	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	C			49132889	+1	no_errors	ENST00000443164	ensembl	human	known	70_37	silent	SNP	1.000	T
SPTLC3	55304	genome.wustl.edu	37	20	13074214	13074214	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr20:13074214C>G	ENST00000399002.2	+	6	1090	c.816C>G	c.(814-816)ttC>ttG	p.F272L	SPTLC3_ENST00000378194.4_Missense_Mutation_p.F272L	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	272					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						TAAGAATCTTCAAACACAACA	0.423																																																	0													89.0	91.0	91.0					20																	13074214		2083	4257	6340	SO:0001583	missense	55304			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.816C>G	20.37:g.13074214C>G	ENSP00000381968:p.Phe272Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.F272L	ENST00000399002.2	37	c.816	CCDS13115.2	20	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337646	0.81911	.	.	ENSG00000172296	ENST00000399002;ENST00000378194	D;D	0.91237	-2.81;-2.81	5.19	5.19	0.71726	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.96734	0.8934	H	0.97896	4.1	0.80722	D	1	D	0.63046	0.992	D	0.65773	0.938	D	0.97388	0.9987	10	0.87932	D	0	-21.1678	12.0647	0.53581	0.0:0.9158:0.0:0.0842	.	272	Q9NUV7	SPTC3_HUMAN	L	272	ENSP00000381968:F272L;ENSP00000367436:F272L	ENSP00000367436:F272L	F	+	3	2	SPTLC3	13022214	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.428000	0.59894	2.582000	0.87167	0.655000	0.94253	TTC	SPTLC3	-	pfam_Aminotransferase_I/II,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom		0.423	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	HGNC	protein_coding	OTTHUMT00000254544.1	C	NM_018327		13074214	+1	no_errors	ENST00000399002	ensembl	human	known	70_37	missense	SNP	1.000	G
TACC3	10460	genome.wustl.edu	37	4	1742569	1742569	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr4:1742569G>A	ENST00000313288.4	+	13	2185	c.2079G>A	c.(2077-2079)caG>caA	p.Q693Q		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	693					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TTCAGAAGCAGAAGGAACTTT	0.458																																					Ovarian(120;482 2294 11894 35824)												0													77.0	77.0	77.0					4																	1742569		2203	4300	6503	SO:0001819	synonymous_variant	10460			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.2079G>A	4.37:g.1742569G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKK4|Q3KQS5|Q9UMQ1	Silent	SNP	pfam_TACC	p.Q693	ENST00000313288.4	37	c.2079	CCDS3352.1	4																																																																																			TACC3	-	pfam_TACC		0.458	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	G			1742569	+1	no_errors	ENST00000313288	ensembl	human	known	70_37	silent	SNP	1.000	A
TAF1B	9014	genome.wustl.edu	37	2	9989550	9989550	+	Missense_Mutation	SNP	A	A	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr2:9989550A>C	ENST00000263663.5	+	3	354	c.166A>C	c.(166-168)Aaa>Caa	p.K56Q	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	56	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TACCCAAATAAAAGCCCTCAA	0.338																																																	0													34.0	35.0	34.0					2																	9989550		2201	4298	6499	SO:0001583	missense	9014			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.166A>C	2.37:g.9989550A>C	ENSP00000263663:p.Lys56Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	pfam_TF_Rrn7	p.K56Q	ENST00000263663.5	37	c.166	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	A	3.120	-0.180683	0.06380	.	.	ENSG00000115750	ENST00000263663;ENST00000402170;ENST00000404869	T	0.11712	2.75	5.57	3.59	0.41128	.	0.276982	0.42294	N	0.000738	T	0.02304	0.0071	N	0.00182	-1.905	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.39563	-0.9608	9	.	.	.	-10.6768	11.9368	0.52878	0.2542:0.7458:0.0:0.0	.	56;56;56	B5MD29;Q53T94;Q53T94-2	.;TAF1B_HUMAN;.	Q	56	ENSP00000263663:K56Q	.	K	+	1	0	TAF1B	9907001	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	1.975000	0.40569	0.660000	0.30964	0.482000	0.46254	AAA	TAF1B	-	NULL		0.338	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	A	NM_005680		9989550	+1	no_errors	ENST00000263663	ensembl	human	known	70_37	missense	SNP	0.999	C
TAPBP	6892	genome.wustl.edu	37	6	33272263	33272263	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:33272263G>A	ENST00000489157.1	-	4	972	c.760C>T	c.(760-762)Cag>Tag	p.Q254*	TAPBP_ENST00000475304.1_Nonsense_Mutation_p.Q359*|TAPBP_ENST00000426633.2_Nonsense_Mutation_p.Q341*|TAPBP_ENST00000434618.2_Nonsense_Mutation_p.Q341*|TAPBP_ENST00000456592.2_Nonsense_Mutation_p.Q341*			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	341					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)			endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						TCGGCCTTCTGAGAGCGGCCC	0.677																																																	0													20.0	25.0	23.0					6																	33272263		2196	4287	6483	SO:0001587	stop_gained	6892			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.760C>T	6.37:g.33272263G>A	ENSP00000419659:p.Gln254*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Nonsense_Mutation	SNP	pfam_Ig_C1-set,pfscan_Ig-like,prints_Tapasin	p.Q341*	ENST00000489157.1	37	c.1021	CCDS34427.2	6	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222028	0.58560	.	.	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540	.	.	.	5.27	2.23	0.28157	.	0.682102	0.13826	N	0.360070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-2.6408	7.9919	0.30246	0.0:0.1473:0.5305:0.3222	.	.	.	.	X	341;359;254;341;341;341	.	ENSP00000404833:Q341X	Q	-	1	0	TAPBP	33380241	0.000000	0.05858	0.001000	0.08648	0.314000	0.28054	0.564000	0.23563	0.667000	0.31107	0.549000	0.68633	CAG	TAPBP	-	pfam_Ig_C1-set,pfscan_Ig-like		0.677	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	TAPBP	HGNC	protein_coding	OTTHUMT00000276425.2	G			33272263	-1	no_errors	ENST00000426633	ensembl	human	known	70_37	nonsense	SNP	0.000	A
TAS1R3	83756	genome.wustl.edu	37	1	1267263	1267263	+	Nonsense_Mutation	SNP	C	C	A	rs373465255		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:1267263C>A	ENST00000339381.5	+	2	469	c.437C>A	c.(436-438)tCg>tAg	p.S146*		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	146					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		GGGCCCCACTCGTCAGAGCTC	0.662																																																	0													41.0	46.0	44.0					1																	1267263		2200	4297	6497	SO:0001587	stop_gained	83756			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.437C>A	1.37:g.1267263C>A	ENSP00000344411:p.Ser146*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TA49|Q8NGW9	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.S146*	ENST00000339381.5	37	c.437	CCDS30556.1	1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990002	0.54041	.	.	ENSG00000169962	ENST00000339381	.	.	.	4.63	4.63	0.57726	.	0.769292	0.11567	N	0.551151	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	10.8226	0.46614	0.1436:0.7171:0.1393:0.0	.	.	.	.	X	146	.	ENSP00000344411:S146X	S	+	2	0	TAS1R3	1257126	.	.	0.836000	0.33094	0.153000	0.21895	.	.	2.133000	0.65898	0.561000	0.74099	TCG	TAS1R3	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3		0.662	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1	C			1267263	+1	no_errors	ENST00000339381	ensembl	human	known	70_37	nonsense	SNP	0.085	A
TAS1R2	80834	genome.wustl.edu	37	1	19180914	19180914	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:19180914G>A	ENST00000375371.3	-	3	1071	c.1050C>T	c.(1048-1050)ctC>ctT	p.L350L	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	350					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGGTCCTGCTGAGGGGTGGCG	0.637																																																	0													80.0	75.0	77.0					1																	19180914		2203	4300	6503	SO:0001819	synonymous_variant	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1050C>T	1.37:g.19180914G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TZ19	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.L350	ENST00000375371.3	37	c.1050	CCDS187.1	1																																																																																			TAS1R2	-	pfam_ANF_lig-bd_rcpt		0.637	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	G			19180914	-1	no_errors	ENST00000375371	ensembl	human	novel	70_37	silent	SNP	0.000	A
TCP10	6953	genome.wustl.edu	37	6	167786724	167786724	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:167786724G>A	ENST00000397829.4	-	8	1081	c.914C>T	c.(913-915)tCc>tTc	p.S305F	TCP10_ENST00000366827.2_Intron	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	332						cytosol (GO:0005829)		p.S305F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		CGGGAAACCGGACCGCCGGCA	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											111.0	111.0	111.0					6																	167786724		1860	4098	5958	SO:0001583	missense	6953			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.914C>T	6.37:g.167786724G>A	ENSP00000380929:p.Ser305Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.S305F	ENST00000397829.4	37	c.914	CCDS43527.1	6	.	.	.	.	.	.	.	.	.	.	g	4.544	0.100917	0.08731	.	.	ENSG00000203690	ENST00000397829	T	0.24908	1.83	1.83	-3.66	0.04489	.	.	.	.	.	T	0.02848	0.0085	N	0.08118	0	0.09310	N	0.999999	B	0.15719	0.014	B	0.06405	0.002	T	0.39143	-0.9628	9	0.72032	D	0.01	.	2.7736	0.05341	0.4347:0.0:0.2087:0.3566	.	332	Q12799	TCP10_HUMAN	F	305	ENSP00000380929:S305F	ENSP00000380929:S305F	S	-	2	0	TCP10	167706714	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.495000	0.06443	-1.720000	0.01380	-0.362000	0.07510	TCC	TCP10	-	NULL		0.552	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	G	NM_004610		167786724	-1	no_errors	ENST00000397829	ensembl	human	known	70_37	missense	SNP	0.000	A
TENM1	10178	genome.wustl.edu	37	X	124097521	124097521	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:124097521C>T	ENST00000371130.3	-	1	145	c.82G>A	c.(82-84)Gat>Aat	p.D28N	TENM1_ENST00000422452.2_Missense_Mutation_p.D28N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	28	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCACTCTCATCAGAAGAACTG	0.453																																																	0													293.0	261.0	272.0					X																	124097521		2203	4300	6503	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.82G>A	X.37:g.124097521C>T	ENSP00000360171:p.Asp28Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.D28N	ENST00000371130.3	37	c.82	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424573	0.83667	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.28895	1.59;1.59	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.42017	0.1184	L	0.36672	1.1	0.58432	D	0.999997	P;P;D	0.53619	0.899;0.899;0.961	P;P;P	0.55749	0.677;0.677;0.783	T	0.09618	-1.0666	10	0.41790	T	0.15	.	18.9267	0.92548	0.0:1.0:0.0:0.0	.	28;28;28	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	28	ENSP00000360171:D28N;ENSP00000403954:D28N	ENSP00000360171:D28N	D	-	1	0	ODZ1	123925202	1.000000	0.71417	0.961000	0.40146	0.995000	0.86356	7.221000	0.78016	2.417000	0.82017	0.600000	0.82982	GAT	TENM1	-	pfam_Ten_N		0.453	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	C	NM_014253		124097521	-1	no_errors	ENST00000422452	ensembl	human	known	70_37	missense	SNP	1.000	T
TEX30	93081	genome.wustl.edu	37	13	103418790	103418790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr13:103418790C>T	ENST00000376032.4	-	6	834	c.645G>A	c.(643-645)tgG>tgA	p.W215*	TEX30_ENST00000376022.1_3'UTR|TEX30_ENST00000487260.1_5'Flank|TEX30_ENST00000376021.4_Nonsense_Mutation_p.W174*|TEX30_ENST00000376029.3_3'UTR|TEX30_ENST00000376027.1_3'UTR|TEX30_ENST00000376019.1_Nonsense_Mutation_p.W174*	NM_138779.3	NP_620134.3	Q5JUR7	TEX30_HUMAN	testis expressed 30	215										lung(1)|urinary_tract(1)	2						TTTCTTGGATCCAAAACAAAA	0.333																																																	0													120.0	115.0	117.0					13																	103418790		2203	4300	6503	SO:0001587	stop_gained	93081			AF070559	CCDS9503.2, CCDS66577.1, CCDS66578.1	13q33.1	2012-02-09	2012-02-09	2012-02-09	ENSG00000151287	ENSG00000151287			25188	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 27"""	C13orf27			Standard	XM_005254097		Approved		uc001vpo.3	Q5JUR7	OTTHUMG00000017306	ENST00000376032.4:c.645G>A	13.37:g.103418790C>T	ENSP00000365200:p.Trp215*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JUR8|Q96KZ8	Nonsense_Mutation	SNP	pfam_Dienelactn_hydro	p.W215*	ENST00000376032.4	37	c.645	CCDS9503.2	13	.	.	.	.	.	.	.	.	.	.	C	36	5.903578	0.97087	.	.	ENSG00000151287	ENST00000376019;ENST00000376021;ENST00000376032	.	.	.	6.17	6.17	0.99709	.	0.050930	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6663	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	174;174;215	.	ENSP00000365187:W174X	W	-	3	0	C13orf27	102216791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.588000	0.67517	2.941000	0.99782	0.655000	0.94253	TGG	TEX30	-	NULL		0.333	TEX30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX30	HGNC	protein_coding	OTTHUMT00000045691.4	C	NM_138779		103418790	-1	no_errors	ENST00000376032	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TMC5	79838	genome.wustl.edu	37	16	19468108	19468108	+	Intron	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:19468108C>G	ENST00000396229.2	+	6	1797				TMC5_ENST00000219821.5_Nonsense_Mutation_p.S27*|TMC5_ENST00000564959.1_Intron|TMC5_ENST00000381414.4_Intron|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Intron|TMC5_ENST00000561503.1_Intron	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CACCCATCCTCAAATCAGATT	0.443																																																	0													99.0	86.0	90.0					16																	19468108		2197	4300	6497	SO:0001627	intron_variant	79838			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1049-3449C>G	16.37:g.19468108C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Nonsense_Mutation	SNP	pfam_TMC	p.S27*	ENST00000396229.2	37	c.80	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	38	6.894136	0.97916	.	.	ENSG00000103534	ENST00000219821	.	.	.	3.71	2.72	0.32119	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	8.4858	0.33071	0.231:0.769:0.0:0.0	.	.	.	.	X	27	.	ENSP00000219821:S27X	S	+	2	0	TMC5	19375609	0.000000	0.05858	0.004000	0.12327	0.782000	0.44232	0.421000	0.21280	1.103000	0.41568	0.650000	0.86243	TCA	TMC5	-	NULL		0.443	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	C	NM_024780		19468108	+1	no_errors	ENST00000219821	ensembl	human	known	70_37	nonsense	SNP	0.006	G
TMC5	79838	genome.wustl.edu	37	16	19468272	19468272	+	Intron	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:19468272C>G	ENST00000396229.2	+	6	1797				TMC5_ENST00000219821.5_Missense_Mutation_p.Q82E|TMC5_ENST00000564959.1_Intron|TMC5_ENST00000381414.4_Intron|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Intron|TMC5_ENST00000561503.1_Intron	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GTCGATGTCTCAGACCCTTCA	0.453																																																	0													122.0	106.0	112.0					16																	19468272		2197	4300	6497	SO:0001627	intron_variant	79838			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1049-3285C>G	16.37:g.19468272C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.Q82E	ENST00000396229.2	37	c.244	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	7.854	0.724568	0.15439	.	.	ENSG00000103534	ENST00000219821	T	0.69435	-0.4	3.87	1.86	0.25419	.	.	.	.	.	T	0.45558	0.1348	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.24048	-1.0171	9	0.02654	T	1	.	10.2452	0.43336	0.0:0.6077:0.3923:0.0	.	82;82	Q6UXY8-3;B3KUQ8	.;.	E	82	ENSP00000219821:Q82E	ENSP00000219821:Q82E	Q	+	1	0	TMC5	19375773	0.040000	0.19996	0.036000	0.18154	0.002000	0.02628	1.694000	0.37752	0.593000	0.29745	-0.165000	0.13383	CAG	TMC5	-	NULL		0.453	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	C	NM_024780		19468272	+1	no_errors	ENST00000219821	ensembl	human	known	70_37	missense	SNP	0.041	G
TMEM181	57583	genome.wustl.edu	37	6	159029698	159029698	+	Missense_Mutation	SNP	G	G	C	rs139585306		TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr6:159029698G>C	ENST00000367090.3	+	10	1234	c.1223G>C	c.(1222-1224)aGa>aCa	p.R408T		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	408					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TAGGGAGAAAGAAAGTGTTTA	0.328																																																	0													136.0	127.0	130.0					6																	159029698		1821	4086	5907	SO:0001583	missense	57583			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.1223G>C	6.37:g.159029698G>C	ENSP00000356057:p.Arg408Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VTU1	Missense_Mutation	SNP	NULL	p.R408T	ENST00000367090.3	37	c.1223	CCDS43520.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981038	0.74474	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	T	0.58797	0.31	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.71745	0.3376	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.73316	-0.4021	10	0.62326	D	0.03	.	18.4811	0.90812	0.0:0.0:1.0:0.0	.	408	Q9P2C4	TM181_HUMAN	T	315;408	ENSP00000356057:R408T	ENSP00000323755:R315T	R	+	2	0	TMEM181	158949686	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	7.013000	0.76373	2.652000	0.90054	0.655000	0.94253	AGA	TMEM181	-	NULL		0.328	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM181	HGNC	protein_coding	OTTHUMT00000042873.1	G	NM_020823		159029698	+1	no_errors	ENST00000367090	ensembl	human	known	70_37	missense	SNP	0.997	C
TNFRSF8	943	genome.wustl.edu	37	1	12183349	12183349	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:12183349G>A	ENST00000263932.2	+	9	1177	c.955G>A	c.(955-957)Gag>Aag	p.E319K	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.E208K|TNFRSF8_ENST00000413146.2_5'Flank	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	319					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	AGATATGGCTGAGAAGGACAC	0.632																																																	0													33.0	32.0	33.0					1																	12183349		2203	4300	6503	SO:0001583	missense	943			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.955G>A	1.37:g.12183349G>A	ENSP00000263932:p.Glu319Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.E319K	ENST00000263932.2	37	c.955	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121751	0.37436	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.06687	3.27;3.27	3.0	1.05	0.20165	.	32.982500	0.00166	N	0.000000	T	0.07593	0.0191	L	0.39147	1.195	0.09310	N	1	P;B	0.44734	0.842;0.264	B;B	0.37731	0.257;0.132	T	0.26916	-1.0089	10	0.29301	T	0.29	-10.6031	3.4317	0.07430	0.1388:0.0:0.6088:0.2524	.	208;319	D3YTD8;P28908	.;TNR8_HUMAN	K	319;208	ENSP00000263932:E319K;ENSP00000390650:E208K	ENSP00000263932:E319K	E	+	1	0	TNFRSF8	12105936	0.001000	0.12720	0.001000	0.08648	0.019000	0.09904	0.936000	0.28938	0.306000	0.22856	0.561000	0.74099	GAG	TNFRSF8	-	NULL		0.632	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1	G			12183349	+1	no_errors	ENST00000263932	ensembl	human	known	70_37	missense	SNP	0.001	A
TMEM59	9528	genome.wustl.edu	37	1	54509139	54509139	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:54509139G>A	ENST00000234831.5	-	4	699	c.450C>T	c.(448-450)ttC>ttT	p.F150F	TMEM59_ENST00000371341.1_Silent_p.F19F|TMEM59_ENST00000371348.1_Silent_p.F19F|TMEM59_ENST00000371344.1_Silent_p.F19F	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	150					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						TGTCACTCCAGAATGACCTCA	0.358																																																	0													67.0	70.0	69.0					1																	54509139		2203	4300	6503	SO:0001819	synonymous_variant	9528			AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.450C>T	1.37:g.54509139G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Silent	SNP	pfam_Uncharacterised_TMEM59,superfamily_Prot_inh_Kunz-m	p.F150	ENST00000234831.5	37	c.450	CCDS586.1	1																																																																																			TMEM59	-	pfam_Uncharacterised_TMEM59		0.358	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM59	HGNC	protein_coding	OTTHUMT00000023254.2	G	NM_004872		54509139	-1	no_errors	ENST00000234831	ensembl	human	known	70_37	silent	SNP	1.000	A
TNS3	64759	genome.wustl.edu	37	7	47408885	47408885	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:47408885C>T	ENST00000398879.1	-	17	1724	c.1358G>A	c.(1357-1359)gGg>gAg	p.G453E	TNS3_ENST00000355730.3_Intron|TNS3_ENST00000311160.9_Missense_Mutation_p.G453E			Q68CZ2	TENS3_HUMAN	tensin 3	453					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GTGGCGGGTCCCACTGTACTT	0.577																																																	0													71.0	76.0	74.0					7																	47408885		2130	4237	6367	SO:0001583	missense	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1358G>A	7.37:g.47408885C>T	ENSP00000381854:p.Gly453Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.G453E	ENST00000398879.1	37	c.1358	CCDS5506.2	7	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446352	0.63178	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000457718;ENST00000450444	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.45	5.45	0.79879	.	0.304354	0.30901	N	0.008642	T	0.42854	0.1221	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.24941	-1.0146	10	0.59425	D	0.04	-33.8379	16.7473	0.85476	0.0:1.0:0.0:0.0	.	453	Q68CZ2	TENS3_HUMAN	E	453;563;453;556;542	ENSP00000312143:G453E;ENSP00000381854:G453E;ENSP00000414358:G556E;ENSP00000396914:G542E	ENSP00000312143:G453E	G	-	2	0	TNS3	47375410	0.203000	0.23435	0.535000	0.28026	0.297000	0.27493	2.900000	0.48687	2.544000	0.85801	0.655000	0.94253	GGG	TNS3	-	NULL		0.577	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	C	NM_022748		47408885	-1	no_errors	ENST00000311160	ensembl	human	known	70_37	missense	SNP	1.000	T
TPP2	7174	genome.wustl.edu	37	13	103309409	103309409	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr13:103309409G>A	ENST00000376065.4	+	24	2992	c.2956G>A	c.(2956-2958)Gta>Ata	p.V986I	TPP2_ENST00000376052.3_Missense_Mutation_p.V999I|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	986					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCGTAGGATGTAATCCCTGT	0.338																																																	0													94.0	92.0	93.0					13																	103309409		2203	4299	6502	SO:0001583	missense	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2956G>A	13.37:g.103309409G>A	ENSP00000365233:p.Val986Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.V986I	ENST00000376065.4	37	c.2956	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575852	0.28092	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.78	1.05	0.20165	.	0.310900	0.39341	N	0.001398	T	0.36441	0.0967	N	0.16656	0.425	0.43771	D	0.996291	B	0.02656	0.0	B	0.04013	0.001	T	0.07849	-1.0751	9	0.22109	T	0.4	.	11.1837	0.48644	0.3752:0.0:0.6248:0.0	.	986	P29144	TPP2_HUMAN	I	986;999	.	ENSP00000365220:V999I	V	+	1	0	TPP2	102107410	1.000000	0.71417	0.986000	0.45419	0.850000	0.48378	0.717000	0.25851	0.163000	0.19507	-0.136000	0.14681	GTA	TPP2	-	NULL		0.338	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	G			103309409	+1	no_errors	ENST00000376065	ensembl	human	known	70_37	missense	SNP	0.997	A
TRIM16L	147166	genome.wustl.edu	37	17	18625638	18625638	+	5'UTR	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr17:18625638C>G	ENST00000449552.2	+	0	1444				TRIM16L_ENST00000395671.4_5'UTR|TRIM16L_ENST00000395672.2_5'UTR|TRIM16L_ENST00000414850.2_5'UTR|TRIM16L_ENST00000571708.1_5'UTR|TRIM16L_ENST00000572555.1_5'UTR|TRIM16L_ENST00000395902.3_Missense_Mutation_p.S41C			Q309B1	TR16L_HUMAN	tripartite motif containing 16-like							cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)	9						AACCAAAAGTCTGTTCTGGTA	0.527																																																	0																																										SO:0001623	5_prime_UTR_variant	147166			DQ232882	CCDS32588.1	17p11.2	2011-02-10	2011-01-25		ENSG00000108448	ENSG00000108448			32670	protein-coding gene	gene with protein product			"""tripartite motif-containing 16-like"""				Standard	XM_005256479		Approved	TRIM70	uc002gui.1	Q309B1	OTTHUMG00000059050	ENST00000449552.2:c.-41C>G	17.37:g.18625638C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PK10|B2RUW6|B4DQK2|B4DWQ8	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.S41C	ENST00000449552.2	37	c.122	CCDS32588.1	17	.	.	.	.	.	.	.	.	.	.	c	13.92	2.380832	0.42207	.	.	ENSG00000108448	ENST00000395902	T	0.70164	-0.46	2.79	2.79	0.32731	.	.	.	.	.	T	0.71829	0.3386	.	.	.	0.80722	D	1	D;D	0.67145	0.996;0.958	P;P	0.55161	0.77;0.617	T	0.74682	-0.3583	8	0.87932	D	0	.	9.1863	0.37172	0.0:1.0:0.0:0.0	.	41;203	B4DE22;B3KMJ2	.;.	C	41	ENSP00000379239:S41C	ENSP00000379239:S41C	S	+	2	0	TRIM16L	18566363	0.994000	0.37717	0.991000	0.47740	0.709000	0.40893	3.721000	0.54941	1.553000	0.49476	0.184000	0.17185	TCT	TRIM16L	-	NULL		0.527	TRIM16L-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM16L	HGNC	protein_coding	OTTHUMT00000130670.3	C	NM_001037330		18625638	+1	no_errors	ENST00000395902	ensembl	human	known	70_37	missense	SNP	0.994	G
TRIM35	23087	genome.wustl.edu	37	8	27145094	27145094	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:27145094G>A	ENST00000305364.4	-	6	1538	c.1455C>T	c.(1453-1455)atC>atT	p.I485I		NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	485	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		CCTTGACACTGATGTGCAAGG	0.632																																																	0													17.0	17.0	17.0					8																	27145094		2201	4297	6498	SO:0001819	synonymous_variant	23087			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.1455C>T	8.37:g.27145094G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86XQ0|Q8WVA4	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.I485	ENST00000305364.4	37	c.1455	CCDS6056.2	8																																																																																			TRIM35	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY		0.632	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM35	HGNC	protein_coding	OTTHUMT00000219848.2	G	NM_171982		27145094	-1	no_errors	ENST00000305364	ensembl	human	known	70_37	silent	SNP	0.211	A
TRPC5	7224	genome.wustl.edu	37	X	111078180	111078180	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:111078180G>A	ENST00000262839.2	-	7	2783	c.1865C>T	c.(1864-1866)gCt>gTt	p.A622V		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	622					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GTTCATCATAGCAATCAGCAT	0.448																																																	0													271.0	217.0	235.0					X																	111078180		2203	4300	6503	SO:0001583	missense	7224			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1865C>T	X.37:g.111078180G>A	ENSP00000262839:p.Ala622Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.A622V	ENST00000262839.2	37	c.1865	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	G	29.2	4.984200	0.93044	.	.	ENSG00000072315	ENST00000262839	D	0.99232	-5.6	5.67	4.8	0.61643	Ion transport (1);	0.049197	0.85682	D	0.000000	D	0.99533	0.9833	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.98	D	0.98036	1.0379	10	0.87932	D	0	-11.586	15.6406	0.76997	0.0:0.1341:0.8659:0.0	.	623;622	Q59G51;Q9UL62	.;TRPC5_HUMAN	V	622	ENSP00000262839:A622V	ENSP00000262839:A622V	A	-	2	0	TRPC5	110964836	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.810000	0.99221	1.125000	0.41998	0.544000	0.68410	GCT	TRPC5	-	pfam_Ion_trans_dom,prints_TRPC_channel,tigrfam_TRP_channel		0.448	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	G	NM_012471		111078180	-1	no_errors	ENST00000262839	ensembl	human	known	70_37	missense	SNP	1.000	A
TRPM6	140803	genome.wustl.edu	37	9	77417025	77417025	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:77417025C>T	ENST00000360774.1	-	16	2035	c.1798G>A	c.(1798-1800)Gag>Aag	p.E600K	RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000361255.3_Missense_Mutation_p.E595K|TRPM6_ENST00000449912.2_Missense_Mutation_p.E595K|TRPM6_ENST00000451710.3_Missense_Mutation_p.E600K|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.E600K|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	600					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CCAGTAGACTCAGGGTCATCT	0.398																																																	0													112.0	92.0	99.0					9																	77417025		2203	4300	6503	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1798G>A	9.37:g.77417025C>T	ENSP00000354006:p.Glu600Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.E600K	ENST00000360774.1	37	c.1798	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919199	0.52546	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	5.28	4.38	0.52667	.	0.609179	0.17660	N	0.166342	T	0.68339	0.2990	M	0.78223	2.4	0.46981	D	0.999273	B;B	0.31174	0.311;0.123	B;B	0.38378	0.272;0.209	T	0.70828	-0.4766	10	0.87932	D	0	.	13.6154	0.62105	0.0:0.9254:0.0:0.0746	.	600;595	Q9BX84;Q9BX84-3	TRPM6_HUMAN;.	K	600;600;595;595;600;263;263	ENSP00000354006:E600K;ENSP00000407341:E600K;ENSP00000396672:E595K;ENSP00000354962:E595K;ENSP00000366060:E600K	ENSP00000309693:E263K	E	-	1	0	TRPM6	76606845	1.000000	0.71417	0.105000	0.21289	0.118000	0.20060	4.652000	0.61454	1.222000	0.43521	0.585000	0.79938	GAG	TRPM6	-	NULL		0.398	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	C	NM_017662		77417025	-1	no_errors	ENST00000451710	ensembl	human	known	70_37	missense	SNP	0.970	T
UBAP2L	9898	genome.wustl.edu	37	1	154223781	154223781	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:154223781C>T	ENST00000361546.2	+	12	1520	c.1478C>T	c.(1477-1479)tCc>tTc	p.S493F	UBAP2L_ENST00000271877.7_Missense_Mutation_p.S504F|UBAP2L_ENST00000428931.1_Missense_Mutation_p.S493F|UBAP2L_ENST00000343815.6_Missense_Mutation_p.S493F			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	493					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AAAAAAGCCTCCTTGACTTCT	0.448																																																	0													50.0	56.0	54.0					1																	154223781		2203	4300	6503	SO:0001583	missense	9898			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1478C>T	1.37:g.154223781C>T	ENSP00000355343:p.Ser493Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S493F	ENST00000361546.2	37	c.1478	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638850	0.87760	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000361546	T;T;T;T	0.14022	2.54;2.55;2.54;2.55	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.18964	0.0455	N	0.24115	0.695	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.999;0.997;0.997;0.995	D;D;D;D;D	0.80764	0.986;0.979;0.994;0.994;0.986	T	0.02805	-1.1108	10	0.87932	D	0	-6.5549	18.891	0.92403	0.0:1.0:0.0:0.0	.	407;504;486;493;493	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	F	493;493;504;493	ENSP00000345308:S493F;ENSP00000389445:S493F;ENSP00000271877:S504F;ENSP00000355343:S493F	ENSP00000271877:S504F	S	+	2	0	UBAP2L	152490405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.062000	0.76706	2.941000	0.99782	0.655000	0.94253	TCC	UBAP2L	-	NULL		0.448	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	C	NM_014847		154223781	+1	no_errors	ENST00000361546	ensembl	human	known	70_37	missense	SNP	1.000	T
UBN1	29855	genome.wustl.edu	37	16	4921180	4921180	+	Silent	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:4921180G>A	ENST00000396658.4	+	11	2287	c.1584G>A	c.(1582-1584)aaG>aaA	p.K528K	UBN1_ENST00000590769.1_Silent_p.K528K|UBN1_ENST00000545171.1_Silent_p.K528K|UBN1_ENST00000262376.6_Silent_p.K528K	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	528					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AGGTGGTGAAGATCAAACTGG	0.532																																																	0													113.0	108.0	110.0					16																	4921180		2197	4300	6497	SO:0001819	synonymous_variant	29855			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1584G>A	16.37:g.4921180G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Silent	SNP	NULL	p.K528	ENST00000396658.4	37	c.1584	CCDS10525.1	16																																																																																			UBN1	-	NULL		0.532	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBN1	HGNC	protein_coding	OTTHUMT00000251719.1	G	NM_016936		4921180	+1	no_errors	ENST00000262376	ensembl	human	known	70_37	silent	SNP	1.000	A
VPS13A	23230	genome.wustl.edu	37	9	79853265	79853265	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr9:79853265G>C	ENST00000360280.3	+	19	2123	c.1863G>C	c.(1861-1863)ttG>ttC	p.L621F	VPS13A_ENST00000376636.3_Missense_Mutation_p.L621F|VPS13A_ENST00000376634.4_Missense_Mutation_p.L621F|VPS13A_ENST00000357409.5_Missense_Mutation_p.L621F	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	621					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CAGCAACTTTGACAAAACTGG	0.338																																																	0													67.0	68.0	67.0					9																	79853265		2203	4300	6503	SO:0001583	missense	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.1863G>C	9.37:g.79853265G>C	ENSP00000353422:p.Leu621Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.L621F	ENST00000360280.3	37	c.1863	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	16.05	3.011616	0.54468	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.44	4.55	0.56014	.	0.079486	0.51477	D	0.000094	T	0.66538	0.2799	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.76494	0.981;0.996;0.999;0.999	P;D;D;D	0.72982	0.841;0.935;0.979;0.979	T	0.68762	-0.5323	10	0.52906	T	0.07	.	11.2875	0.49230	0.1469:0.0:0.8531:0.0	.	621;621;621;621	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	F	621	ENSP00000365821:L621F;ENSP00000365823:L621F;ENSP00000353422:L621F;ENSP00000349985:L621F	ENSP00000349985:L621F	L	+	3	2	VPS13A	79043085	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.095000	0.30964	1.313000	0.45069	-0.237000	0.12165	TTG	VPS13A	-	NULL		0.338	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	G	NM_015186		79853265	+1	no_errors	ENST00000360280	ensembl	human	known	70_37	missense	SNP	1.000	C
WIZ	58525	genome.wustl.edu	37	19	15550742	15550742	+	Missense_Mutation	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:15550742C>T	ENST00000389282.4	-	3	1132	c.919G>A	c.(919-921)Ggg>Agg	p.G307R	WIZ_ENST00000263381.7_Intron			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	307					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CCACACTCCCCGCAGGCCAGC	0.662																																																	0																																										SO:0001583	missense	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.919G>A	19.37:g.15550742C>T	ENSP00000373933:p.Gly307Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G307R	ENST00000389282.4	37	c.919		19	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.931669	0.00488	.	.	ENSG00000011451	ENST00000389282	T	0.15487	2.42	5.3	-2.18	0.07037	.	0.487065	0.18241	N	0.147258	T	0.15912	0.0383	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24870	-1.0148	7	0.31617	T	0.26	-8.2211	11.5846	0.50910	0.0:0.3022:0.0:0.6978	.	.	.	.	R	307	ENSP00000373933:G307R	ENSP00000373933:G307R	G	-	1	0	WIZ	15411742	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.182000	0.09726	-0.212000	0.10109	0.549000	0.68633	GGG	WIZ	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.662	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		C	NM_021241		15550742	-1	no_errors	ENST00000389282	ensembl	human	known	70_37	missense	SNP	0.000	T
WRN	7486	genome.wustl.edu	37	8	31012235	31012235	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr8:31012235C>T	ENST00000298139.5	+	32	4032	c.3783C>T	c.(3781-3783)atC>atT	p.I1261I		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1261					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CTATGGCCATCACATACTCTT	0.348			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													88.0	82.0	84.0					8																	31012235		2203	4298	6501	SO:0001819	synonymous_variant	7486	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3783C>T	8.37:g.31012235C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1KYY9	Silent	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/RNaseD_C,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.I1261	ENST00000298139.5	37	c.3783	CCDS6082.1	8																																																																																			WRN	-	NULL		0.348	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	C			31012235	+1	no_errors	ENST00000298139	ensembl	human	known	70_37	silent	SNP	0.994	T
YIPF1	54432	genome.wustl.edu	37	1	54325793	54325793	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr1:54325793G>A	ENST00000072644.1	-	10	1201	c.865C>T	c.(865-867)Ctc>Ttc	p.L289F	YIPF1_ENST00000371399.1_Missense_Mutation_p.L106F|YIPF1_ENST00000539954.1_Missense_Mutation_p.L314F	NM_018982.4	NP_061855.1	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	289						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|skin(1)|urinary_tract(2)	19						GTTGTTGGGAGATGGTCCATC	0.438																																																	0													133.0	120.0	124.0					1																	54325793		2203	4300	6503	SO:0001583	missense	54432			BC009674	CCDS584.1	1p33-p32.1	2008-02-05			ENSG00000058799	ENSG00000058799		"""Yip1 domain family"""	25231	protein-coding gene	gene with protein product						12477932	Standard	NM_018982		Approved	DJ167A19.1, FinGER1	uc001cvu.3	Q9Y548	OTTHUMG00000008074	ENST00000072644.1:c.865C>T	1.37:g.54325793G>A	ENSP00000072644:p.Leu289Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCM7|D3DQ40|Q9NWJ1	Missense_Mutation	SNP	pfam_Yip1,superfamily_Ribonuclease/ribotoxin	p.L314F	ENST00000072644.1	37	c.940	CCDS584.1	1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134280	0.37630	.	.	ENSG00000058799	ENST00000371399;ENST00000072644;ENST00000539954	.	.	.	5.06	4.15	0.48705	.	0.566181	0.16025	N	0.233134	T	0.36799	0.0980	L	0.40543	1.245	0.30960	N	0.723801	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	9	0.27785	T	0.31	-45.3277	9.4936	0.38976	0.1614:0.0:0.8386:0.0	.	289	Q9Y548	YIPF1_HUMAN	F	106;289;314	.	ENSP00000072644:L289F	L	-	1	0	YIPF1	54098381	0.905000	0.30787	0.973000	0.42090	0.904000	0.53231	1.145000	0.31577	1.358000	0.45922	0.655000	0.94253	CTC	YIPF1	-	NULL		0.438	YIPF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF1	HGNC	protein_coding	OTTHUMT00000022103.5	G	NM_018982		54325793	-1	no_errors	ENST00000539954	ensembl	human	known	70_37	missense	SNP	0.914	A
ZDHHC8	29801	genome.wustl.edu	37	22	20127392	20127392	+	Silent	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr22:20127392G>T	ENST00000334554.7	+	4	675	c.534G>T	c.(532-534)ctG>ctT	p.L178L	ZDHHC8_ENST00000320602.7_Intron|ZDHHC8_ENST00000405930.3_Silent_p.L178L|ZDHHC8_ENST00000468112.1_Intron	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	178					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CTGAGGGGCTGGGAGCCGCGC	0.602																																																	0													63.0	55.0	58.0					22																	20127392		2203	4299	6502	SO:0001819	synonymous_variant	29801			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.534G>T	22.37:g.20127392G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.L178	ENST00000334554.7	37	c.534	CCDS13776.1	22																																																																																			ZDHHC8	-	NULL		0.602	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC8	HGNC	protein_coding	OTTHUMT00000318564.1	G	NM_013373		20127392	+1	no_errors	ENST00000405930	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF112	7771	genome.wustl.edu	37	19	44832961	44832961	+	Nonsense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:44832961G>C	ENST00000337401.4	-	5	1455	c.1367C>G	c.(1366-1368)tCa>tGa	p.S456*	ZNF112_ENST00000536500.1_Nonsense_Mutation_p.S473*|ZNF112_ENST00000354340.4_Nonsense_Mutation_p.S450*	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CTGAAAATGTGAGGCCAGACT	0.378																																																	0													98.0	92.0	94.0					19																	44832961		2203	4300	6503	SO:0001587	stop_gained	7771			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1367C>G	19.37:g.44832961G>C	ENSP00000337081:p.Ser456*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU53|Q9HCA7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S473*	ENST00000337401.4	37	c.1418	CCDS54276.1	19	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072333	0.55646	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	.	.	.	4.73	3.69	0.42338	.	0.331959	0.17078	N	0.187910	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.2345	8.6303	0.33915	0.1796:0.0:0.8204:0.0	.	.	.	.	X	456;456;450;473;455	.	ENSP00000253426:S455X	S	-	2	0	ZNF285	49524801	0.702000	0.27816	0.030000	0.17652	0.383000	0.30230	2.824000	0.48088	1.343000	0.45638	0.561000	0.74099	TCA	ZFP112	-	pfscan_Znf_C2H2		0.378	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP112	HGNC	protein_coding	OTTHUMT00000460744.1	G	NM_013380		44832961	-1	no_errors	ENST00000536500	ensembl	human	known	70_37	nonsense	SNP	0.005	C
ZNF12	7559	genome.wustl.edu	37	7	6730664	6730664	+	Missense_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:6730664C>G	ENST00000405858.1	-	5	2450	c.1909G>C	c.(1909-1911)Gag>Cag	p.E637Q	ZNF12_ENST00000404360.1_Missense_Mutation_p.E563Q|ZNF12_ENST00000342651.5_Missense_Mutation_p.E599Q|AC073343.2_ENST00000577401.1_RNA|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	637					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TTTCCACACTCATTACATTCA	0.393																																																	0													89.0	95.0	93.0					7																	6730664		2201	4300	6501	SO:0001583	missense	7559			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.1909G>C	7.37:g.6730664C>G	ENSP00000385939:p.Glu637Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E637Q	ENST00000405858.1	37	c.1909	CCDS47538.1	7	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.572633	0.00887	.	.	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476	T;T;T	0.18502	2.21;2.21;2.21	4.17	1.38	0.22167	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.173614	0.27739	N	0.018052	T	0.06690	0.0171	N	0.12611	0.24	0.09310	N	1	P;B	0.41524	0.753;0.172	B;B	0.31101	0.124;0.018	T	0.31251	-0.9950	10	0.39692	T	0.17	.	7.9416	0.29961	0.0:0.7144:0.0:0.2856	.	637;599	P17014;P17014-5	ZNF12_HUMAN;.	Q	563;637;599;695	ENSP00000384405:E563Q;ENSP00000385939:E637Q;ENSP00000344745:E599Q	ENSP00000344745:E599Q	E	-	1	0	ZNF12	6697189	0.000000	0.05858	0.017000	0.16124	0.514000	0.34195	-0.109000	0.10840	0.313000	0.23062	0.650000	0.86243	GAG	ZNF12	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	HGNC	protein_coding	OTTHUMT00000324373.2	C	NM_016265		6730664	-1	no_errors	ENST00000405858	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF382	84911	genome.wustl.edu	37	19	37117673	37117673	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:37117673G>A	ENST00000292928.2	+	5	987	c.874G>A	c.(874-876)Gaa>Aaa	p.E292K	CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000435416.1_Missense_Mutation_p.E291K|ZNF382_ENST00000423582.1_Missense_Mutation_p.E243K|ZNF382_ENST00000439428.1_Missense_Mutation_p.E291K	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	292					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ACCTCAAACAGAAGAGAAACC	0.398																																																	0													99.0	101.0	101.0					19																	37117673		2203	4300	6503	SO:0001583	missense	84911			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.874G>A	19.37:g.37117673G>A	ENSP00000292928:p.Glu292Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E292K	ENST00000292928.2	37	c.874	CCDS33004.1	19	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250160	0.59212	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	4.52	3.48	0.39840	.	0.162046	0.29383	N	0.012301	T	0.22126	0.0533	L	0.31420	0.93	0.29868	N	0.827033	B;B;B	0.27732	0.187;0.187;0.118	B;B;B	0.25140	0.058;0.058;0.026	T	0.19224	-1.0312	10	0.87932	D	0	.	10.4783	0.44678	0.0967:0.0:0.9033:0.0	.	291;291;292	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	K	243;292;291;291	ENSP00000389722:E243K;ENSP00000292928:E292K;ENSP00000407593:E291K;ENSP00000410113:E291K	ENSP00000292928:E292K	E	+	1	0	ZNF382	41809513	0.980000	0.34600	0.966000	0.40874	0.962000	0.63368	4.262000	0.58847	1.252000	0.44001	0.467000	0.42956	GAA	ZNF382	-	NULL		0.398	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF382	HGNC	protein_coding	OTTHUMT00000109562.2	G	NM_032825		37117673	+1	no_errors	ENST00000292928	ensembl	human	known	70_37	missense	SNP	0.996	A
ZNF384	171017	genome.wustl.edu	37	12	6776880	6776880	+	Nonstop_Mutation	SNP	C	C	G			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr12:6776880C>G	ENST00000396801.3	-	11	1941	c.1734G>C	c.(1732-1734)taG>taC	p.*578Y	RP4-761J14.8_ENST00000586338.1_RNA|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000361959.3_Nonstop_Mutation_p.*578Y|ZNF384_ENST00000355772.4_Nonstop_Mutation_p.*462Y|ZNF384_ENST00000396799.2_Nonstop_Mutation_p.*517Y|ZNF384_ENST00000396795.1_Nonstop_Mutation_p.*517Y|ZNF384_ENST00000319770.3_Nonstop_Mutation_p.*501Y	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	0					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						GCACGGATCTCTAAGAGCTGG	0.542			T	"""EWSR1, TAF15 """	ALL																																			Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													147.0	149.0	149.0					12																	6776880		2203	4300	6503	SO:0001578	stop_lost	171017			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1734G>C	12.37:g.6776880C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O15407|Q7Z722|Q8N938	Nonstop_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.*578Y	ENST00000396801.3	37	c.1734	CCDS44817.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.98|16.98	3.271351|3.271351	0.59649|0.59649	.|.	.|.	ENSG00000219410|ENSG00000126746	ENST00000407384|ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000355772;ENST00000396799	.|.	.|.	.|.	5.83|5.83	4.89|4.89	0.63831|0.63831	.|.	.|.	.|.	.|.	.|.	T|.	0.51483|.	0.1677|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.43925|.	-0.9361|.	5|.	0.87932|.	D|.	0|.	.|.	16.4123|16.4123	0.83722|0.83722	0.0:0.8686:0.1314:0.0|0.0:0.8686:0.1314:0.0	.|.	.|.	.|.	.|.	V|Y	62|501;517;578;578;462;517	.|.	ENSP00000384049:L62V|.	L|X	+|-	1|3	2|2	AC125494.1|ZNF384	6647141|6647141	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.599000|1.599000	0.36751|0.36751	2.757000|2.757000	0.94681|0.94681	0.591000|0.591000	0.81541|0.81541	CTA|TAG	ZNF384	-	NULL		0.542	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF384	HGNC	protein_coding	OTTHUMT00000400712.1	C			6776880	-1	no_errors	ENST00000361959	ensembl	human	known	70_37	nonstop	SNP	1.000	G
ZNF578	147660	genome.wustl.edu	37	19	53014094	53014094	+	Missense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:53014094G>T	ENST00000421239.2	+	6	704	c.460G>T	c.(460-462)Gat>Tat	p.D154Y	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GCCTATTAAAGATCAGCTTGG	0.418																																																	0													151.0	152.0	152.0					19																	53014094		2203	4300	6503	SO:0001583	missense	147660			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.460G>T	19.37:g.53014094G>T	ENSP00000459216:p.Asp154Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D154Y	ENST00000421239.2	37	c.460	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	6.697	0.497283	0.12762	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.4	0.237	0.15475	.	.	.	.	.	T	0.42223	0.1193	L	0.37800	1.135	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.21861	-1.0233	7	.	.	.	.	4.4291	0.11518	0.7864:0.0:0.2136:0.0	.	154	G3V4F6	.	Y	154	.	.	D	+	1	0	ZNF578	57705906	0.000000	0.05858	0.011000	0.14972	0.215000	0.24574	-0.700000	0.05081	-0.132000	0.11557	0.089000	0.15464	GAT	ZNF578	-	NULL		0.418	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	G	NM_152472		53014094	+1	no_errors	ENST00000421239	ensembl	human	known	70_37	missense	SNP	0.013	T
ZNF525	170958	genome.wustl.edu	37	19	53885136	53885136	+	Missense_Mutation	SNP	G	G	C			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr19:53885136G>C	ENST00000355326.3	+	1	458	c.458G>C	c.(457-459)gGa>gCa	p.G153A	ZNF525_ENST00000474037.1_Missense_Mutation_p.G435A|ZNF525_ENST00000467003.1_Missense_Mutation_p.G399A|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						ATTCATAATGGAGAGAAACTG	0.403																																																	0																																										SO:0001583	missense	170958			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.458G>C	19.37:g.53885136G>C	ENSP00000408929:p.Gly153Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G153A	ENST00000355326.3	37	c.458		19	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622316	0.28889	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	T;T;T	0.26373	1.74;1.74;1.74	1.54	1.54	0.23209	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27134	0.0665	.	.	.	0.28888	N	0.894007	P	0.37548	0.599	B	0.42282	0.382	T	0.23084	-1.0198	8	0.87932	D	0	.	10.0797	0.42381	0.0:0.0:1.0:0.0	.	153	Q8N782	ZN525_HUMAN	A	435;399;153	ENSP00000417696:G435A;ENSP00000419136:G399A;ENSP00000408929:G153A	ENSP00000408929:G153A	G	+	2	0	ZNF525	58576948	0.008000	0.16893	0.042000	0.18584	0.015000	0.08874	-0.041000	0.12084	0.851000	0.35264	0.175000	0.17021	GGA	ZNF525	-	pfscan_Znf_C2H2		0.403	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		G	NR_003699		53885136	+1	no_errors	ENST00000355326	ensembl	human	known	70_37	missense	SNP	1.000	C
ZNF646	9726	genome.wustl.edu	37	16	31089785	31089785	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr16:31089785G>T	ENST00000394979.2	+	1	2563	c.2140G>T	c.(2140-2142)Gaa>Taa	p.E714*	ZNF646_ENST00000300850.5_Nonsense_Mutation_p.E714*			O15015	ZN646_HUMAN	zinc finger protein 646	714					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCCTTCAGGGGAAAGTCCTCA	0.577																																																	0													61.0	69.0	66.0					16																	31089785		2197	4300	6497	SO:0001587	stop_gained	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.2140G>T	16.37:g.31089785G>T	ENSP00000378429:p.Glu714*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVD8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E714*	ENST00000394979.2	37	c.2140		16	.	.	.	.	.	.	.	.	.	.	G	39	7.482920	0.98312	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	.	.	.	5.12	0.681	0.17986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-1.0904	5.5822	0.17256	0.2728:0.15:0.5771:0.0	.	.	.	.	X	714	.	ENSP00000300850:E714X	E	+	1	0	ZNF646	30997286	0.006000	0.16342	0.001000	0.08648	0.009000	0.06853	0.166000	0.16583	0.325000	0.23359	-0.244000	0.11960	GAA	ZNF646	-	NULL		0.577	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	G	NM_014699		31089785	+1	no_errors	ENST00000300850	ensembl	human	known	70_37	nonsense	SNP	0.000	T
ZNF655	79027	genome.wustl.edu	37	7	99169959	99169959	+	Silent	SNP	C	C	T			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chr7:99169959C>T	ENST00000394163.2	+	3	411	c.228C>T	c.(226-228)ctC>ctT	p.L76L	ZNF655_ENST00000424881.1_Silent_p.L111L|ZNF655_ENST00000252713.4_Silent_p.L76L|ZNF655_ENST00000419215.2_3'UTR|ZNF655_ENST00000493277.1_Silent_p.L111L|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000425063.1_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	76					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					TAGGAAGACTCAAACACGATA	0.393																																																	0													80.0	81.0	80.0					7																	99169959		2203	4299	6502	SO:0001819	synonymous_variant	79027			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.228C>T	7.37:g.99169959C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L111	ENST00000394163.2	37	c.333	CCDS5669.1	7																																																																																			ZNF655	-	NULL		0.393	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	C	NM_138494		99169959	+1	no_errors	ENST00000424881	ensembl	human	known	70_37	silent	SNP	0.998	T
ZXDB	158586	genome.wustl.edu	37	X	57620102	57620102	+	Missense_Mutation	SNP	G	G	A			TCGA-JW-A5VJ-01A-11D-A28B-09	TCGA-JW-A5VJ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8f4516f0-ef3b-4f1a-881c-a1289520ada8	19f2afb8-2dd8-4f73-bd4d-571cf4a16341	g.chrX:57620102G>A	ENST00000374888.1	+	1	1834	c.1621G>A	c.(1621-1623)Gat>Aat	p.D541N		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	541	Required for interaction with ZXDC. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						ACACCTGCAGGATGTGGACAC	0.512																																																	0													28.0	27.0	27.0					X																	57620102		2202	4277	6479	SO:0001583	missense	158586			L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.1621G>A	X.37:g.57620102G>A	ENSP00000364023:p.Asp541Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K151|Q9UBB3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D541N	ENST00000374888.1	37	c.1621	CCDS35313.1	X	.	.	.	.	.	.	.	.	.	.	.	19.73	3.881873	0.72294	.	.	ENSG00000198455	ENST00000374888	T	0.38077	1.16	3.5	3.5	0.40072	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.46639	0.1403	L	0.53671	1.685	0.80722	D	1	D	0.59357	0.985	P	0.55999	0.789	T	0.51132	-0.8744	10	0.87932	D	0	.	12.0103	0.53282	0.0:0.0:1.0:0.0	.	541	P98169	ZXDB_HUMAN	N	541	ENSP00000364023:D541N	ENSP00000364023:D541N	D	+	1	0	ZXDB	57636827	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.704000	0.91351	1.762000	0.52044	0.483000	0.47432	GAT	ZXDB	-	pfscan_Znf_C2H2		0.512	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDB	HGNC	protein_coding	OTTHUMT00000056922.1	G	NM_007157		57620102	+1	no_errors	ENST00000374888	ensembl	human	known	70_37	missense	SNP	1.000	A
