#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA7	10347	genome.wustl.edu	37	19	1050958	1050958	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr19:1050958C>G	ENST00000263094.6	+	19	2822	c.2591C>G	c.(2590-2592)tCt>tGt	p.S864C	ABCA7_ENST00000435683.2_Missense_Mutation_p.S726C|ABCA7_ENST00000433129.1_Missense_Mutation_p.S864C	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	864	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTGGTGGCTCTGCCTTCATC	0.607																																																	0													62.0	63.0	63.0					19																	1050958		2197	4286	6483	SO:0001583	missense	10347			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2591C>G	19.37:g.1050958C>G	ENSP00000263094:p.Ser864Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S864C	ENST00000263094.6	37	c.2591	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	C	15.21	2.765187	0.49574	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.94280	-3.39;-3.39	3.66	3.66	0.41972	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.97025	0.9028	M	0.91561	3.22	0.42057	D	0.991147	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.984	D	0.97925	1.0317	9	0.87932	D	0	.	13.6496	0.62304	0.0:1.0:0.0:0.0	.	726;864	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	C	864	ENSP00000263094:S864C;ENSP00000414062:S864C	ENSP00000263094:S864C	S	+	2	0	ABCA7	1001958	0.996000	0.38824	0.857000	0.33713	0.070000	0.16714	7.583000	0.82559	1.996000	0.58369	0.462000	0.41574	TCT	ABCA7	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.607	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	C	NM_019112		1050958	+1	no_errors	ENST00000263094	ensembl	human	known	70_37	missense	SNP	1.000	G
ABHD3	171586	genome.wustl.edu	37	18	19239206	19239206	+	Missense_Mutation	SNP	T	T	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr18:19239206T>C	ENST00000289119.2	-	6	906	c.767A>G	c.(766-768)gAg>gGg	p.E256G	ABHD3_ENST00000578270.1_Missense_Mutation_p.E61G|RP11-13N13.5_ENST00000584148.1_RNA|ABHD3_ENST00000580981.1_Missense_Mutation_p.E203G	NM_138340.4	NP_612213.2	Q8WU67	ABHD3_HUMAN	abhydrolase domain containing 3	256						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(2)	10						TTCCAATGACTCTGAGCAAGC	0.398																																																	0													86.0	89.0	88.0					18																	19239206		2203	4300	6503	SO:0001583	missense	171586			AK024880	CCDS32802.1	18q11.1	2011-02-16			ENSG00000158201	ENSG00000158201		"""Abhydrolase domain containing"""	18718	protein-coding gene	gene with protein product		612197					Standard	NM_138340		Approved	LABH3	uc002ktl.2	Q8WU67		ENST00000289119.2:c.767A>G	18.37:g.19239206T>C	ENSP00000289119:p.Glu256Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YIV0|B7Z5C2|O43411	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	p.E256G	ENST00000289119.2	37	c.767	CCDS32802.1	18	.	.	.	.	.	.	.	.	.	.	T	13.10	2.136600	0.37728	.	.	ENSG00000158201	ENST00000289119	T	0.10288	2.89	5.5	5.5	0.81552	.	0.147316	0.64402	D	0.000010	T	0.13030	0.0316	L	0.55103	1.725	0.39488	D	0.968006	B	0.19935	0.04	B	0.29440	0.102	T	0.08973	-1.0696	10	0.26408	T	0.33	-0.4332	10.7985	0.46474	0.1413:0.0:0.0:0.8587	.	256	Q8WU67	ABHD3_HUMAN	G	256	ENSP00000289119:E256G	ENSP00000289119:E256G	E	-	2	0	ABHD3	17493204	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	2.377000	0.44300	2.093000	0.63338	0.528000	0.53228	GAG	ABHD3	-	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT		0.398	ABHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD3	HGNC	protein_coding	OTTHUMT00000444757.1	T			19239206	-1	no_errors	ENST00000289119	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD30BL	554226	genome.wustl.edu	37	2	132911192	132911192	+	Intron	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr2:132911192G>A	ENST00000409867.1	-	4	864				ANKRD30BL_ENST00000470729.1_Intron|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CTTCAGCACAGATGTCAACAT	0.378																																																	0																																										SO:0001627	intron_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.614+1042C>T	2.37:g.132911192G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZL7	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I230	ENST00000409867.1	37	c.690		2																																																																																			ANKRD30BL	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.378	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331353.2	G	NR_027019		132911192	-1	no_errors	ENST00000295181	ensembl	human	known	70_37	silent	SNP	0.046	A
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0																																										SO:0001628	intergenic_variant	344454																															2.37:g.201619768_201619769delTG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	0	0.406					AOX2P	HGNC			TG			201619759	+1	no_errors	ENST00000472376	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
APOBEC3G	60489	genome.wustl.edu	37	22	39477172	39477172	+	Missense_Mutation	SNP	C	C	T	rs142694979	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr22:39477172C>T	ENST00000407997.3	+	3	763	c.406C>T	c.(406-408)Cgc>Tgc	p.R136C	APOBEC3G_ENST00000452957.2_Missense_Mutation_p.R136C|APOBEC3G_ENST00000461827.1_3'UTR	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	136					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					GGAGGCGCTTCGCAGCCTGTG	0.562																																																	0								C	CYS/ARG	4,4402		0,4,2199	82.0	81.0	82.0		406	-3.5	0.0	22	dbSNP_134	82	0,8600		0,0,4300	no	missense	APOBEC3G	NM_021822.3	180	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	136/385	39477172	4,13002	2203	4300	6503	SO:0001583	missense	60489			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.406C>T	22.37:g.39477172C>T	ENSP00000385057:p.Arg136Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.R136C	ENST00000407997.3	37	c.406	CCDS13984.1	22	.	.	.	.	.	.	.	.	.	.	.	7.721	0.697190	0.15106	9.08E-4	0.0	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.71698	-0.59;-0.59	2.02	-3.49	0.04724	APOBEC-like, C-terminal (1);	.	.	.	.	T	0.68760	0.3036	L	0.37850	1.14	0.09310	N	1	D	0.76494	0.999	D	0.70487	0.969	T	0.58255	-0.7668	9	0.46703	T	0.11	.	2.7885	0.05380	0.2155:0.2918:0.0:0.4926	.	136	Q9HC16	ABC3G_HUMAN	C	136	ENSP00000413376:R136C;ENSP00000385057:R136C	ENSP00000385057:R136C	R	+	1	0	APOBEC3G	37807118	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.065000	0.11617	-0.872000	0.04037	0.462000	0.41574	CGC	APOBEC3G	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like		0.562	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	HGNC	protein_coding	OTTHUMT00000321219.1	C	NM_021822		39477172	+1	no_errors	ENST00000407997	ensembl	human	known	70_37	missense	SNP	0.000	T
AR	367	genome.wustl.edu	37	X	66937348	66937348	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chrX:66937348G>C	ENST00000374690.3	+	5	2726	c.2202G>C	c.(2200-2202)caG>caC	p.Q734H	AR_ENST00000396044.3_Intron|AR_ENST00000396043.2_Missense_Mutation_p.Q202H	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	733	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TGGACGACCAGATGGCTGTCA	0.557									Androgen Insensitivity Syndrome																																								0			GRCh37	CM983649	AR	M							133.0	89.0	104.0					X																	66937348		2203	4300	6503	SO:0001583	missense	367	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2202G>C	X.37:g.66937348G>C	ENSP00000363822:p.Gln734His	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.Q734H	ENST00000374690.3	37	c.2202	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	g	18.19	3.569864	0.65765	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.99901	-7.65;-7.65	4.99	4.99	0.66335	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	D	0.96886	0.9649	10	0.87932	D	0	.	8.1717	0.31258	0.1073:0.0:0.8927:0.0	.	202;733	F1D8N5;P10275	.;ANDR_HUMAN	H	544;734;202	ENSP00000363822:Q734H;ENSP00000379358:Q202H	ENSP00000363822:Q734H	Q	+	3	2	AR	66854073	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.941000	0.40233	2.306000	0.77630	0.597000	0.82753	CAG	AR	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.557	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	G	NM_000044		66937348	+1	no_errors	ENST00000374690	ensembl	human	known	70_37	missense	SNP	1.000	C
ATP10A	57194	genome.wustl.edu	37	15	25958932	25958932	+	Missense_Mutation	SNP	C	C	T	rs372138642		TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr15:25958932C>T	ENST00000356865.6	-	10	2344	c.2233G>A	c.(2233-2235)Gtc>Atc	p.V745I		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	745					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTCTTGCGGACGGAATCGAAA	0.612																																																	0								C	ILE/VAL	0,4406		0,0,2203	86.0	80.0	82.0		2233	0.7	1.0	15		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP10A	NM_024490.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	745/1500	25958932	1,13005	2203	4300	6503	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2233G>A	15.37:g.25958932C>T	ENSP00000349325:p.Val745Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.V745I	ENST00000356865.6	37	c.2233	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	5.807	0.333105	0.11013	0.0	1.16E-4	ENSG00000206190	ENST00000356865	D	0.82526	-1.62	4.49	0.664	0.17890	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.392893	0.31031	N	0.008388	T	0.63379	0.2506	N	0.11927	0.2	0.09310	N	0.999997	B	0.13145	0.007	B	0.13407	0.009	T	0.47394	-0.9121	10	0.17832	T	0.49	-9.6666	8.7896	0.34843	0.0:0.4518:0.0:0.5482	.	745	O60312	AT10A_HUMAN	I	745	ENSP00000349325:V745I	ENSP00000349325:V745I	V	-	1	0	ATP10A	23510025	1.000000	0.71417	0.962000	0.40283	0.666000	0.39218	0.722000	0.25925	0.169000	0.19679	-0.417000	0.06048	GTC	ATP10A	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl		0.612	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	C	NM_024490		25958932	-1	no_errors	ENST00000356865	ensembl	human	known	70_37	missense	SNP	0.997	T
BEND6	221336	genome.wustl.edu	37	6	56846694	56846694	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr6:56846694C>G	ENST00000370746.3	+	2	355	c.86C>G	c.(85-87)tCa>tGa	p.S29*	BEND6_ENST00000370745.1_Nonsense_Mutation_p.S29*|BEND6_ENST00000370750.2_Nonsense_Mutation_p.S29*|BEND6_ENST00000370748.3_Nonsense_Mutation_p.S29*	NM_152731.2	NP_689944.2	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	29					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	17						ACAATGGACTCAGAAAATGCA	0.343																																																	0													177.0	183.0	181.0					6																	56846694		1865	4095	5960	SO:0001587	stop_gained	221336			AK054724	CCDS43476.1	6p12.1	2012-11-22	2008-10-03	2008-10-03	ENSG00000151917	ENSG00000151917		"""BEN domain containing"""	20871	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 65"""	C6orf65			Standard	NM_152731		Approved	FLJ30162, bA203B9.1	uc010kab.3	Q5SZJ8	OTTHUMG00000014914	ENST00000370746.3:c.86C>G	6.37:g.56846694C>G	ENSP00000359782:p.Ser29*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0W8|Q8N662|Q96NS6	Nonsense_Mutation	SNP	pfam_BEN_domain	p.S29*	ENST00000370746.3	37	c.86	CCDS43476.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.564405	0.96527	.	.	ENSG00000151917	ENST00000322055;ENST00000370750;ENST00000370748;ENST00000370746;ENST00000370745	.	.	.	4.82	4.82	0.62117	.	0.000000	0.46758	D	0.000278	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.9391	15.4322	0.75108	0.0:1.0:0.0:0.0	.	.	.	.	X	29	.	ENSP00000322773:S29X	S	+	2	0	BEND6	56954653	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.421000	0.59848	2.379000	0.81126	0.650000	0.86243	TCA	BEND6	-	NULL		0.343	BEND6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND6	HGNC	protein_coding	OTTHUMT00000041032.4	C	NM_152731		56846694	+1	no_errors	ENST00000370746	ensembl	human	known	70_37	nonsense	SNP	1.000	G
BVES	11149	genome.wustl.edu	37	6	105577278	105577278	+	Silent	SNP	C	C	T	rs139347341	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr6:105577278C>T	ENST00000314641.5	-	3	543	c.327G>A	c.(325-327)tcG>tcA	p.S109S	BVES_ENST00000336775.5_Silent_p.S109S|BVES_ENST00000446408.2_Silent_p.S109S	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	109					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				ATAAAAGATACGACAGATGCA	0.353																																																	0								T	,,	2,4404	4.2+/-10.8	0,2,2201	61.0	57.0	58.0		327,327,327	-11.0	0.6	6	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	BVES	NM_001199563.1,NM_007073.4,NM_147147.3	,,	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	,,	109/361,109/361,109/361	105577278	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	11149			AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.327G>A	6.37:g.105577278C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Silent	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.S109	ENST00000314641.5	37	c.327	CCDS5051.1	6																																																																																			BVES	-	NULL		0.353	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BVES	HGNC	protein_coding	OTTHUMT00000406075.1	C	NM_147147		105577278	-1	no_errors	ENST00000314641	ensembl	human	known	70_37	silent	SNP	0.094	T
C16orf62	57020	genome.wustl.edu	37	16	19584549	19584549	+	Missense_Mutation	SNP	G	G	A	rs144556424		TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr16:19584549G>A	ENST00000251143.5	+	4	406	c.394G>A	c.(394-396)Gaa>Aaa	p.E132K	C16orf62_ENST00000542263.1_Missense_Mutation_p.E221K|C16orf62_ENST00000538853.1_Missense_Mutation_p.E221K|C16orf62_ENST00000438132.3_Missense_Mutation_p.E221K|C16orf62_ENST00000417362.2_Missense_Mutation_p.E132K			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	132						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CACCACTACCGAAAAGCTGTC	0.458																																																	0								G	LYS/GLU	2,4392	2.1+/-5.4	0,2,2195	110.0	112.0	111.0		661	5.3	0.3	16	dbSNP_134	111	0,8600		0,0,4300	no	missense	C16orf62	NM_020314.5	56	0,2,6495	AA,AG,GG		0.0,0.0455,0.0154	probably-damaging	221/1053	19584549	2,12992	2197	4300	6497	SO:0001583	missense	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.394G>A	16.37:g.19584549G>A	ENSP00000251143:p.Glu132Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.E221K	ENST00000251143.5	37	c.661		16	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698145	0.88830	4.55E-4	0.0	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	T;T;T;T;T	0.62232	1.55;0.04;1.55;1.55;1.55	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.78578	0.4305	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.988;0.992;0.998	T	0.77627	-0.2517	10	0.40728	T	0.16	-23.9504	17.9978	0.89189	0.0:0.0:1.0:0.0	.	221;132;221	F5H7K1;Q7Z3J2;E7EWW0	.;CP062_HUMAN;.	K	221;221;221;132;132	ENSP00000400815:E221K;ENSP00000444363:E221K;ENSP00000442468:E221K;ENSP00000251143:E132K;ENSP00000395973:E132K	ENSP00000251143:E132K	E	+	1	0	C16orf62	19492050	1.000000	0.71417	0.253000	0.24343	0.461000	0.32589	9.491000	0.97954	2.488000	0.83962	0.557000	0.71058	GAA	C16orf62	-	NULL		0.458	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		G	NM_020314		19584549	+1	no_errors	ENST00000438132	ensembl	human	known	70_37	missense	SNP	1.000	A
C16orf82	162083	genome.wustl.edu	37	16	27079690	27079690	+	lincRNA	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr16:27079690C>G	ENST00000505035.1	+	0	1663				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		CTGTCCATATCAAGAACCATC	0.502																																																	0																																												162083			BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27079690C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGC2|Q8NEF0	RNA	SNP	-	NULL	ENST00000505035.1	37	NULL		16																																																																																			C16orf82	-	-		0.502	C16orf82-001	KNOWN	basic	lincRNA	C16orf82	HGNC	lincRNA	OTTHUMT00000366634.1	C	NM_001145545		27079690	+1	no_errors	ENST00000418886	ensembl	human	known	70_37	rna	SNP	0.000	G
C9orf78	51759	genome.wustl.edu	37	9	132596001	132596001	+	Intron	DEL	A	A	-			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr9:132596001delA	ENST00000372447.3	-	3	197				USP20_ENST00000358355.1_5'Flank|USP20_ENST00000372429.3_5'Flank|USP20_ENST00000315480.4_5'Flank|C9orf78_ENST00000461762.1_5'UTR	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				GAGCAAAACCAAAAAAAAAAG	0.478																																																	0													28.0	25.0	26.0					9																	132596001		2203	4299	6502	SO:0001627	intron_variant	51759			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-13T>-	9.37:g.132596001delA		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPX8|Q8WVU6|Q9NT39	RNA	DEL	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			C9orf78	-	-		0.478	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1	A	NM_016520		132596001	-1	no_errors	ENST00000461762	ensembl	human	known	70_37	rna	DEL	0.115	-
CABP1	9478	genome.wustl.edu	37	12	121094061	121094061	+	Intron	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:121094061G>A	ENST00000316803.3	+	2	788				CABP1_ENST00000351200.2_Intron|CABP1_ENST00000288616.3_Missense_Mutation_p.E71K|CABP1_ENST00000453000.1_Missense_Mutation_p.E150K	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGGCTTCGCTGAGAACAGGCA	0.617																																																	0													20.0	18.0	19.0					12																	121094061		2203	4300	6503	SO:0001627	intron_variant	9478			AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-3620G>A	12.37:g.121094061G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95663|Q8N6H5|Q9NZU8	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E71K	ENST00000316803.3	37	c.211	CCDS31913.1	12	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244758	0.59103	.	.	ENSG00000157782	ENST00000288616;ENST00000453000	T;T	0.72282	-0.59;-0.64	5.98	5.98	0.97165	.	.	.	.	.	T	0.60090	0.2242	N	0.17082	0.46	0.40321	D	0.978821	B;B	0.22003	0.063;0.035	B;B	0.22386	0.039;0.026	T	0.53711	-0.8400	9	0.34782	T	0.22	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	150;71	C9J8G2;Q9NZU7-1	.;.	K	71;150	ENSP00000288616:E71K;ENSP00000398959:E150K	ENSP00000288616:E71K	E	+	1	0	CABP1	119578444	1.000000	0.71417	0.950000	0.38849	0.988000	0.76386	4.118000	0.57884	2.847000	0.97988	0.591000	0.81541	GAG	CABP1	-	NULL		0.617	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	HGNC	protein_coding	OTTHUMT00000345822.1	G	NM_001033677		121094061	+1	no_errors	ENST00000288616	ensembl	human	known	70_37	missense	SNP	0.999	A
CAMK1	8536	genome.wustl.edu	37	3	9802348	9802348	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr3:9802348G>C	ENST00000256460.3	-	8	914	c.737C>G	c.(736-738)tCt>tGt	p.S246C	OGG1_ENST00000302036.7_Intron|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302008.8_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	246	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		ACCAGAGTCAGAGATGTCGTC	0.532																																																	0													139.0	129.0	133.0					3																	9802348		2203	4300	6503	SO:0001583	missense	8536			L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.737C>G	3.37:g.9802348G>C	ENSP00000256460:p.Ser246Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KPF6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S246C	ENST00000256460.3	37	c.737	CCDS2582.1	3	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671919	0.88348	.	.	ENSG00000134072	ENST00000256460	T	0.52754	0.65	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85909	0.1439	10	0.87932	D	0	-9.4414	18.4238	0.90602	0.0:0.0:1.0:0.0	.	246	Q14012	KCC1A_HUMAN	C	246	ENSP00000256460:S246C	ENSP00000256460:S246C	S	-	2	0	CAMK1	9777348	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.689000	0.98673	2.431000	0.82371	0.655000	0.94253	TCT	CAMK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.532	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1	HGNC	protein_coding	OTTHUMT00000250206.1	G	NM_003656		9802348	-1	no_errors	ENST00000256460	ensembl	human	known	70_37	missense	SNP	1.000	C
CEP192	55125	genome.wustl.edu	37	18	13100368	13100368	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr18:13100368C>G	ENST00000325971.8	+	36	6533	c.4940C>G	c.(4939-4941)tCc>tGc	p.S1647C	CEP192_ENST00000506447.1_Missense_Mutation_p.S2243C|CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000430049.2_Missense_Mutation_p.S1768C			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1647					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGTTTGACCTCCAAACCATTT	0.368																																																	0													80.0	79.0	79.0					18																	13100368		2203	4300	6503	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4940C>G	18.37:g.13100368C>G	ENSP00000317156:p.Ser1647Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.S2243C	ENST00000325971.8	37	c.6728		18	.	.	.	.	.	.	.	.	.	.	C	11.39	1.623190	0.28889	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.06768	3.26;3.26;3.26	5.52	4.63	0.57726	.	0.216274	0.45361	D	0.000377	T	0.22513	0.0543	M	0.63843	1.955	0.31734	N	0.636616	D;P;B;D	0.76494	0.999;0.621;0.102;0.998	D;B;B;P	0.63113	0.911;0.363;0.051;0.891	T	0.01496	-1.1340	10	0.44086	T	0.13	-10.5982	14.242	0.65963	0.0:0.9226:0.0:0.0774	.	1768;2243;247;845	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	C	2243;1647;1647;1768;247	ENSP00000427550:S2243C;ENSP00000317156:S1647C;ENSP00000389190:S1768C	ENSP00000317156:S1647C	S	+	2	0	CEP192	13090368	0.071000	0.21146	0.530000	0.27963	0.245000	0.25701	2.243000	0.43115	2.756000	0.94617	0.655000	0.94253	TCC	CEP192	-	NULL		0.368	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		C	NM_032142		13100368	+1	no_errors	ENST00000506447	ensembl	human	known	70_37	missense	SNP	0.775	G
CFHR5	81494	genome.wustl.edu	37	1	196977674	196977674	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:196977674G>A	ENST00000256785.4	+	10	1680	c.1571G>A	c.(1570-1572)aGa>aAa	p.R524K	CFHR5_ENST00000367414.5_Missense_Mutation_p.R548K			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	524	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						TTAAAATGGAGAAACGATGGA	0.323																																																	0													77.0	72.0	74.0					1																	196977674		2203	4300	6503	SO:0001583	missense	81494			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.1571G>A	1.37:g.196977674G>A	ENSP00000256785:p.Arg524Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKK2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R548K	ENST00000256785.4	37	c.1643	CCDS1387.1	1	.	.	.	.	.	.	.	.	.	.	G	0.443	-0.897702	0.02472	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	D;D	0.82711	-1.64;-1.64	4.45	-8.91	0.00778	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.58637	0.2136	N	0.20357	0.565	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50389	-0.8834	9	0.05833	T	0.94	.	4.7964	0.13274	0.1468:0.1053:0.4954:0.2525	.	524	Q9BXR6	FHR5_HUMAN	K	548;524	ENSP00000356384:R548K;ENSP00000256785:R524K	ENSP00000256785:R524K	R	+	2	0	CFHR5	195244297	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.224000	0.00140	-2.992000	0.00279	-1.263000	0.01449	AGA	CFHR5	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP		0.323	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	HGNC	protein_coding	OTTHUMT00000088814.2	G	NM_030787		196977674	+1	no_errors	ENST00000367414	ensembl	human	known	70_37	missense	SNP	0.000	A
CHN2	1124	genome.wustl.edu	37	7	29552182	29552182	+	Missense_Mutation	SNP	T	T	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr7:29552182T>G	ENST00000222792.6	+	13	1768	c.1238T>G	c.(1237-1239)gTt>gGt	p.V413G	CHN2_ENST00000495789.2_Missense_Mutation_p.V426G|CHN2_ENST00000539406.1_Missense_Mutation_p.V488G|CHN2_ENST00000421775.2_Missense_Mutation_p.V219G|CHN2_ENST00000424025.2_Missense_Mutation_p.V232G|CHN2_ENST00000546235.1_Missense_Mutation_p.V398G|CHN2_ENST00000410098.1_3'UTR|CHN2_ENST00000439711.2_Missense_Mutation_p.V231G|AC007255.8_ENST00000450540.2_RNA|CHN2_ENST00000409041.4_Missense_Mutation_p.V277G|CHN2_ENST00000539389.1_Missense_Mutation_p.V269G|AC007255.8_ENST00000447171.1_RNA|CHN2_ENST00000435288.2_Missense_Mutation_p.V137G	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	413	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						TTTTGCAGGGTTACTATGAAT	0.418																																					Ovarian(1;44 48 13232 18918 31480)												0													72.0	75.0	74.0					7																	29552182		2203	4300	6503	SO:0001583	missense	1124			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.1238T>G	7.37:g.29552182T>G	ENSP00000222792:p.Val413Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.V488G	ENST00000222792.6	37	c.1463	CCDS5420.1	7	.	.	.	.	.	.	.	.	.	.	T	19.40	3.821048	0.71028	.	.	ENSG00000106069	ENST00000539406;ENST00000222792;ENST00000435288;ENST00000495789;ENST00000539389;ENST00000546235;ENST00000409041;ENST00000424025;ENST00000439711;ENST00000421775	T;T;T;T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36	5.41	5.41	0.78517	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.108340	0.64402	D	0.000007	T	0.75503	0.3858	H	0.99042	4.41	0.80722	D	1	D;D;P;D;D;D;D;D;D;D;D;P;D;P	0.76494	0.991;0.984;0.906;0.962;0.995;0.958;0.975;0.979;0.996;0.999;0.999;0.79;0.995;0.79	D;D;B;B;P;P;P;D;D;D;D;B;D;B	0.75020	0.957;0.93;0.333;0.412;0.889;0.71;0.794;0.962;0.958;0.985;0.982;0.26;0.922;0.26	D	0.86146	0.1584	10	0.87932	D	0	.	15.4009	0.74841	0.0:0.0:0.0:1.0	.	206;398;426;488;232;186;205;173;231;219;269;413;277;413	B7Z215;B7Z1W9;B7Z1V0;F5H003;B3VCF1;B3VCF2;B3VCF5;B3VCF4;B3VCF7;B3VCF3;B3VCG1;A4D1A2;E9PGE0;P52757	.;.;.;.;.;.;.;.;.;.;.;.;.;CHIO_HUMAN	G	488;413;137;426;269;398;277;232;231;219	ENSP00000444063:V488G;ENSP00000222792:V413G;ENSP00000400282:V137G;ENSP00000438587:V426G;ENSP00000440526:V269G;ENSP00000442812:V398G;ENSP00000386849:V277G;ENSP00000406337:V232G;ENSP00000387425:V231G;ENSP00000394284:V219G	ENSP00000222792:V413G	V	+	2	0	CHN2	29518707	1.000000	0.71417	0.983000	0.44433	0.926000	0.56050	7.997000	0.88414	2.179000	0.69175	0.528000	0.53228	GTT	CHN2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.418	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHN2	HGNC	protein_coding	OTTHUMT00000214228.2	T	NM_004067		29552182	+1	no_errors	ENST00000539406	ensembl	human	known	70_37	missense	SNP	1.000	G
CNBD1	168975	genome.wustl.edu	37	8	88249229	88249229	+	Silent	SNP	A	A	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr8:88249229A>G	ENST00000518476.1	+	6	711	c.660A>G	c.(658-660)ggA>ggG	p.G220G	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	220										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TGATTGAAGGAAGTGATTCAC	0.378																																																	0													142.0	128.0	133.0					8																	88249229		1856	4093	5949	SO:0001819	synonymous_variant	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.660A>G	8.37:g.88249229A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.G220	ENST00000518476.1	37	c.660	CCDS55259.1	8																																																																																			CNBD1	-	superfamily_cNMP-bd-like		0.378	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	HGNC	protein_coding	OTTHUMT00000375113.2	A	NM_173538		88249229	+1	no_errors	ENST00000518476	ensembl	human	known	70_37	silent	SNP	0.000	G
DFFA	1676	genome.wustl.edu	37	1	10532464	10532464	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:10532464G>T	ENST00000377038.3	-	1	119	c.52C>A	c.(52-54)Cta>Ata	p.L18I	PEX14_ENST00000538836.1_5'Flank|DFFA_ENST00000377036.2_Missense_Mutation_p.L18I|PEX14_ENST00000356607.4_5'Flank	NM_004401.2	NP_004392.1	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha polypeptide	18	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|negative regulation of apoptotic DNA fragmentation (GO:1902511)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of apoptotic process (GO:0043065)|thymocyte apoptotic process (GO:0070242)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				large_intestine(3)|lung(2)	5	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		CACGGCTTTAGAGTCCGGATC	0.672																																																	0													43.0	48.0	46.0					1																	10532464		2203	4300	6503	SO:0001583	missense	1676			AF087573	CCDS118.1, CCDS119.1	1p36.3-p36.2	2008-07-18	2002-08-29		ENSG00000160049	ENSG00000160049			2772	protein-coding gene	gene with protein product	"""DNA fragmentation factor, 45 kD, alpha subunit"""	601882	"""DNA fragmentation factor, 45 kD, alpha polypeptide"""			9605855, 9108473	Standard	NM_004401		Approved	DFF-45, DFF45, ICAD, DFF1	uc001arj.3	O00273	OTTHUMG00000001909	ENST00000377038.3:c.52C>A	1.37:g.10532464G>T	ENSP00000366237:p.Leu18Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T6G5|Q5T6G6|Q96I97|Q9Y6C6	Missense_Mutation	SNP	pfam_DNA_fragmentation_C,pfam_CAD,smart_CAD,pirsf_DNA_fragmentation_factor_asu,pfscan_CAD	p.L18I	ENST00000377038.3	37	c.52	CCDS118.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877975	0.91664	.	.	ENSG00000160049	ENST00000377038;ENST00000377036	.	.	.	5.18	3.27	0.37495	Caspase-activated nuclease CIDE-N (2);	0.572368	0.17837	N	0.160321	T	0.57021	0.2025	L	0.55834	1.745	0.28771	N	0.900343	B;P	0.37158	0.228;0.585	B;P	0.53912	0.385;0.737	T	0.54057	-0.8350	9	0.52906	T	0.07	-1.1065	9.3513	0.38140	0.2304:0.0:0.7696:0.0	.	18;18	O00273-2;O00273	.;DFFA_HUMAN	I	18	.	ENSP00000366235:L18I	L	-	1	2	DFFA	10455051	0.025000	0.19082	0.178000	0.23040	0.883000	0.51084	0.887000	0.28254	1.307000	0.44944	0.655000	0.94253	CTA	DFFA	-	pfam_CAD,pirsf_DNA_fragmentation_factor_asu,pfscan_CAD		0.672	DFFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFFA	HGNC	protein_coding	OTTHUMT00000005418.1	G	NM_004401		10532464	-1	no_errors	ENST00000377038	ensembl	human	known	70_37	missense	SNP	0.339	T
DEDD	9191	genome.wustl.edu	37	1	161091834	161091834	+	3'UTR	DEL	C	C	-			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:161091834delC	ENST00000368006.3	-	0	1274				DEDD_ENST00000490843.2_3'UTR|NIT1_ENST00000368008.1_Intron|DEDD_ENST00000368005.1_3'UTR|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000458050.2_3'UTR|DEDD_ENST00000545495.1_3'UTR|DEDD_ENST00000392188.1_3'UTR	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing						decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AAAAAAAAGGCAGGGGTGTGA	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	9191			AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.*103G>-	1.37:g.161091834delC		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVF5|O60737	RNA	DEL	-	NULL	ENST00000368006.3	37	NULL	CCDS1219.1	1																																																																																			DEDD	-	-		0.468	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEDD	HGNC	protein_coding	OTTHUMT00000080582.1	C	NM_004216		161091834	-1	no_errors	ENST00000486041	ensembl	human	known	70_37	rna	DEL	0.032	-
CNTN2	6900	genome.wustl.edu	37	1	205039053	205039053	+	Silent	SNP	C	C	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:205039053C>A	ENST00000331830.4	+	18	2579	c.2295C>A	c.(2293-2295)ggC>ggA	p.G765G		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	765	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGGTGCCTGGCGCCGATGCCC	0.657																																					Melanoma(183;2548 2817 37099 41192)												0													86.0	89.0	88.0					1																	205039053		2203	4300	6503	SO:0001819	synonymous_variant	6900			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2295C>A	1.37:g.205039053C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P78432|Q5T054	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G765	ENST00000331830.4	37	c.2295	CCDS1449.1	1																																																																																			CNTN2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	C	NM_005076		205039053	+1	no_errors	ENST00000331830	ensembl	human	known	70_37	silent	SNP	0.847	A
FBN1	2200	genome.wustl.edu	37	15	48888524	48888524	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr15:48888524C>T	ENST00000316623.5	-	6	949	c.494G>A	c.(493-495)cGa>cAa	p.R165Q		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	165	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R165Q(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCATGCACATCGATTTGGGGC	0.418																																																	1	Substitution - Missense(1)	large_intestine(1)											131.0	117.0	122.0					15																	48888524		2197	4296	6493	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.494G>A	15.37:g.48888524C>T	ENSP00000325527:p.Arg165Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.R165Q	ENST00000316623.5	37	c.494	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879179	0.91740	.	.	ENSG00000166147	ENST00000316623;ENST00000544030;ENST00000537463	D;T	0.91631	-2.88;0.14	5.87	5.87	0.94306	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93930	0.8057	L	0.35487	1.065	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.93644	0.6967	10	0.51188	T	0.08	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	165	P35555	FBN1_HUMAN	Q	165	ENSP00000325527:R165Q;ENSP00000440294:R165Q	ENSP00000325527:R165Q	R	-	2	0	FBN1	46675816	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.246000	0.78247	2.785000	0.95823	0.655000	0.94253	CGA	FBN1	-	smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.418	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	C			48888524	-1	no_errors	ENST00000316623	ensembl	human	known	70_37	missense	SNP	1.000	T
FOXR2	139628	genome.wustl.edu	37	X	55650327	55650327	+	Silent	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chrX:55650327G>A	ENST00000339140.3	+	1	495	c.183G>A	c.(181-183)caG>caA	p.Q61Q		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	61					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						AAATGCCTCAGAAGAGGAGAC	0.527																																																	0													88.0	81.0	83.0					X																	55650327		2203	4300	6503	SO:0001819	synonymous_variant	139628			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.183G>A	X.37:g.55650327G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.Q61	ENST00000339140.3	37	c.183	CCDS35308.1	X																																																																																			FOXR2	-	NULL		0.527	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR2	HGNC	protein_coding	OTTHUMT00000056877.2	G	NM_198451		55650327	+1	no_errors	ENST00000339140	ensembl	human	known	70_37	silent	SNP	0.015	A
GOLGA6C	653641	genome.wustl.edu	37	15	75557739	75557739	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr15:75557739G>A	ENST00000300576.5	+	9	733	c.733G>A	c.(733-735)Gag>Aag	p.E245K		NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	245						Golgi apparatus (GO:0005794)				ovary(1)	1						CCGGTGGCAGGAGAGGATGTG	0.502																																																	0																																										SO:0001583	missense	653641				CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.733G>A	15.37:g.75557739G>A	ENSP00000300576:p.Glu245Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E245K	ENST00000300576.5	37	c.733	CCDS58388.1	15	.	.	.	.	.	.	.	.	.	.	G	11.75	1.730468	0.30684	.	.	ENSG00000167195	ENST00000300576	T	0.23147	1.92	0.167	-0.334	0.12666	.	.	.	.	.	T	0.39306	0.1073	M	0.73962	2.25	0.21184	N	0.999763	P	0.49696	0.927	P	0.56563	0.801	T	0.29274	-1.0017	9	0.72032	D	0.01	.	5.5572	0.17123	0.0:0.3457:0.6542:0.0	.	245	A6NDK9	GOG6C_HUMAN	K	245	ENSP00000300576:E245K	ENSP00000300576:E245K	E	+	1	0	GOLGA6C	73344792	0.941000	0.31946	0.007000	0.13788	0.007000	0.05969	0.175000	0.16762	-0.972000	0.03559	-0.971000	0.02607	GAG	GOLGA6C	-	NULL		0.502	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6C	HGNC	protein_coding	OTTHUMT00000419797.1	G	NM_001164404		75557739	+1	no_errors	ENST00000300576	ensembl	human	known	70_37	missense	SNP	0.902	A
HEATR1	55127	genome.wustl.edu	37	1	236734921	236734921	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:236734921C>T	ENST00000366582.3	-	27	3887	c.3773G>A	c.(3772-3774)tGt>tAt	p.C1258Y	HEATR1_ENST00000366581.2_Missense_Mutation_p.C1177Y	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1258					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GTTGAGCAGACAACTAAGAAT	0.383																																																	0													162.0	159.0	160.0					1																	236734921		2203	4300	6503	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3773G>A	1.37:g.236734921C>T	ENSP00000355541:p.Cys1258Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.C1258Y	ENST00000366582.3	37	c.3773	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406008	0.83230	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.21;-0.18	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.99;1.0	P;D	0.66847	0.76;0.947	D	0.84314	0.0512	10	0.72032	D	0.01	.	19.0871	0.93209	0.0:1.0:0.0:0.0	.	1177;1258	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	Y	1258;1177	ENSP00000355541:C1258Y;ENSP00000355540:C1177Y	ENSP00000355540:C1177Y	C	-	2	0	HEATR1	234801544	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.465000	0.60141	2.504000	0.84457	0.585000	0.79938	TGT	HEATR1	-	superfamily_ARM-type_fold		0.383	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	C	XM_375853		236734921	-1	no_errors	ENST00000366582	ensembl	human	known	70_37	missense	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62196447	62196447	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:62196447C>T	ENST00000467148.1	-	8	3797	c.3728G>A	c.(3727-3729)cGg>cAg	p.R1243Q	HELZ2_ENST00000427522.2_Missense_Mutation_p.R674Q	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1243					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CCGGCCCTTCCGGAGGCTGTA	0.652																																																	0													14.0	14.0	14.0					20																	62196447		2151	4264	6415	SO:0001583	missense	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3728G>A	20.37:g.62196447C>T	ENSP00000417401:p.Arg1243Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.R1243Q	ENST00000467148.1	37	c.3728	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	C	2.036	-0.421107	0.04734	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.79141	-1.24;-1.14	4.78	-8.29	0.01009	.	2.929330	0.01109	N	0.005534	T	0.43634	0.1256	N	0.01352	-0.895	0.09310	N	1	B;B	0.22414	0.041;0.069	B;B	0.09377	0.004;0.004	T	0.46345	-0.9198	10	0.13108	T	0.6	-1.0859	7.6981	0.28606	0.267:0.41:0.0:0.3231	.	1243;674	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	Q	674;1243	ENSP00000393257:R674Q;ENSP00000417401:R1243Q	ENSP00000393257:R674Q	R	-	2	0	RP4-697K14.7	61666891	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.351000	0.07711	-0.937000	0.03719	-0.448000	0.05591	CGG	HELZ2	-	NULL		0.652	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	C	NM_001037335		62196447	-1	no_errors	ENST00000467148	ensembl	human	known	70_37	missense	SNP	0.000	T
HSPG2	3339	genome.wustl.edu	37	1	22170683	22170683	+	Silent	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:22170683G>A	ENST00000374695.3	-	65	8653	c.8574C>T	c.(8572-8574)gtC>gtT	p.V2858V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2858	Ig-like C2-type 14.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGTGCCACGTGACCTGGGCGT	0.652																																																	0													66.0	62.0	63.0					1																	22170683		2203	4300	6503	SO:0001819	synonymous_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8574C>T	1.37:g.22170683G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.V2858	ENST00000374695.3	37	c.8574	CCDS30625.1	1																																																																																			HSPG2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.652	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	G	NM_005529		22170683	-1	no_errors	ENST00000374695	ensembl	human	known	70_37	silent	SNP	1.000	A
ITGA11	22801	genome.wustl.edu	37	15	68624760	68624760	+	Silent	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr15:68624760C>G	ENST00000315757.7	-	13	1568	c.1482G>C	c.(1480-1482)gtG>gtC	p.V494V	ITGA11_ENST00000423218.2_Silent_p.V494V	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	494					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.V494V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						GGACATCAGTCACGCCGTCGC	0.607																																																	1	Substitution - coding silent(1)	lung(1)											46.0	49.0	48.0					15																	68624760		2124	4233	6357	SO:0001819	synonymous_variant	22801			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1482G>C	15.37:g.68624760C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V494	ENST00000315757.7	37	c.1482	CCDS45291.1	15																																																																																			ITGA11	-	pfam_FG-GAP,smart_Int_alpha_beta-p		0.607	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		C	NM_012211		68624760	-1	no_errors	ENST00000315757	ensembl	human	known	70_37	silent	SNP	0.030	G
KCNQ1	3784	genome.wustl.edu	37	11	2609969	2609969	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr11:2609969C>G	ENST00000155840.5	+	10	1386	c.1278C>G	c.(1276-1278)gaC>gaG	p.D426E	KCNQ1_ENST00000335475.5_Missense_Mutation_p.D299E	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	426					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	TCAAGCTGGACAAAGACAATG	0.542																																																	0													59.0	60.0	59.0					11																	2609969		2202	4299	6501	SO:0001583	missense	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1278C>G	11.37:g.2609969C>G	ENSP00000155840:p.Asp426Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCQN1,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.D426E	ENST00000155840.5	37	c.1278	CCDS7736.1	11	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573326	0.28092	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99207	-5.56;-5.47	5.02	-2.99	0.05497	.	0.469806	0.23416	N	0.048418	D	0.94739	0.8302	N	0.19112	0.55	0.38309	D	0.943199	B;B;B	0.11235	0.003;0.002;0.004	B;B;B	0.13407	0.009;0.004;0.005	D	0.87158	0.2213	10	0.08179	T	0.78	-29.3041	5.1273	0.14892	0.0:0.2716:0.3412:0.3872	.	299;299;426	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	E	426;299	ENSP00000155840:D426E;ENSP00000334497:D299E	ENSP00000155840:D426E	D	+	3	2	KCNQ1	2566545	0.882000	0.30256	0.904000	0.35570	0.866000	0.49608	-0.448000	0.06820	-0.247000	0.09597	0.484000	0.47621	GAC	KCNQ1	-	prints_K_chnl_volt-dep_KCQN1		0.542	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1	HGNC	protein_coding	OTTHUMT00000027382.2	C	NM_000218		2609969	+1	no_errors	ENST00000155840	ensembl	human	known	70_37	missense	SNP	0.982	G
KIAA1875	340390	genome.wustl.edu	37	8	145166328	145166328	+	Splice_Site	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr8:145166328G>T	ENST00000323662.8	+	11	2451		c.e11-1					A6NE52	K1875_HUMAN	KIAA1875											large_intestine(1)	1						CCTGTTTGCAGCGAGGCCTTG	0.657																																																	0																																										SO:0001630	splice_region_variant	340390			AB058778		8q24.3	2013-01-10			ENSG00000179698	ENSG00000179698		"""WD repeat domain containing"""	26959	protein-coding gene	gene with protein product						11347906	Standard	NR_024207		Approved		uc011lky.1	A6NE52	OTTHUMG00000165245	ENST00000323662.8:c.2427-1G>T	8.37:g.145166328G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96JF2	Splice_Site	SNP	-	e11-1	ENST00000323662.8	37	c.2427-1		8	.	.	.	.	.	.	.	.	.	.	g	14.65	2.598420	0.46318	.	.	ENSG00000179698	ENST00000323662	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8845	0.58036	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1875	145238316	0.734000	0.28142	0.940000	0.37924	0.008000	0.06430	1.363000	0.34159	2.748000	0.94277	0.651000	0.88453	.	KIAA1875	-	-		0.657	KIAA1875-007	PUTATIVE	basic|appris_principal	protein_coding	KIAA1875	HGNC	protein_coding	OTTHUMT00000382917.1	G	NM_032529	Intron	145166328	+1	no_errors	ENST00000323662	ensembl	human	putative	70_37	splice_site	SNP	0.980	T
KLK14	43847	genome.wustl.edu	37	19	51584836	51584836	+	Silent	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr19:51584836G>A	ENST00000156499.2	-	4	431	c.213C>T	c.(211-213)gcC>gcT	p.A71A	KLK14_ENST00000391802.1_Silent_p.A71A			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	71	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		CTGAAAGCAGGGCGCCTCCGC	0.642																																					GBM(117;2161 2172 2448 22911)												0													14.0	14.0	14.0					19																	51584836		1821	3933	5754	SO:0001819	synonymous_variant	43847			AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.213C>T	19.37:g.51584836G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7UNK5|Q1RMZ2|Q6B089	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A71	ENST00000156499.2	37	c.213	CCDS12823.2	19																																																																																			KLK14	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A		0.642	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK14	HGNC	protein_coding	OTTHUMT00000289774.2	G	NM_022046		51584836	-1	no_errors	ENST00000156499	ensembl	human	known	70_37	silent	SNP	0.927	A
KTN1	3895	genome.wustl.edu	37	14	56103991	56103991	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr14:56103991C>G	ENST00000395314.3	+	11	1693	c.1625C>G	c.(1624-1626)tCa>tGa	p.S542*	KTN1_ENST00000438792.2_Nonsense_Mutation_p.S542*|KTN1_ENST00000395309.3_Nonsense_Mutation_p.S542*|KTN1_ENST00000395308.1_Nonsense_Mutation_p.S542*|KTN1_ENST00000416613.1_Nonsense_Mutation_p.S542*|KTN1_ENST00000413890.2_Nonsense_Mutation_p.S542*|KTN1_ENST00000395311.1_Nonsense_Mutation_p.S542*	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	542					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						ACCTTGGTATCAAAACAACAG	0.343			T	RET	papillary thryoid																																			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													104.0	106.0	105.0					14																	56103991		2202	4300	6502	SO:0001587	stop_gained	3895				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.1625C>G	14.37:g.56103991C>G	ENSP00000378725:p.Ser542*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Nonsense_Mutation	SNP	NULL	p.S542*	ENST00000395314.3	37	c.1625	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.389882	0.97529	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	.	.	.	5.22	5.22	0.72569	.	0.186510	0.26193	N	0.025785	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-0.0216	19.1377	0.93435	0.0:1.0:0.0:0.0	.	.	.	.	X	542	.	ENSP00000378719:S542X	S	+	2	0	KTN1	55173744	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	6.188000	0.72045	2.586000	0.87340	0.514000	0.50259	TCA	KTN1	-	NULL		0.343	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	C			56103991	+1	no_errors	ENST00000395309	ensembl	human	known	70_37	nonsense	SNP	1.000	G
LRRK2	120892	genome.wustl.edu	37	12	40645343	40645343	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:40645343G>T	ENST00000298910.7	+	10	1236	c.1178G>T	c.(1177-1179)gGc>gTc	p.G393V	LRRK2_ENST00000343742.2_Missense_Mutation_p.G393V	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	393					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GATGAAGATGGCCAGTTAGTA	0.313											OREG0003829	type=REGULATORY REGION|Gene=LRRK2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													45.0	44.0	44.0					12																	40645343		2203	4300	6503	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1178G>T	12.37:g.40645343G>T	ENSP00000298910:p.Gly393Val	Somatic	895	WXS	Illumina HiSeq	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.G393V	ENST00000298910.7	37	c.1178	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205442	0.39003	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.44482	0.92;0.92	5.65	2.41	0.29592	Armadillo-like helical (1);Armadillo-type fold (1);	0.356343	0.29480	N	0.012038	T	0.30541	0.0768	L	0.34521	1.04	0.49130	D	0.999755	P;P	0.48162	0.906;0.498	B;B	0.44224	0.444;0.155	T	0.07046	-1.0793	10	0.72032	D	0.01	.	5.2259	0.15393	0.3187:0.1514:0.5299:0.0	.	393;393	E9PC85;Q5S007	.;LRRK2_HUMAN	V	393	ENSP00000341930:G393V;ENSP00000298910:G393V	ENSP00000298910:G393V	G	+	2	0	LRRK2	38931610	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.209000	0.42806	0.755000	0.32990	-0.142000	0.14014	GGC	LRRK2	-	superfamily_ARM-type_fold		0.313	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	G	XM_058513		40645343	+1	no_errors	ENST00000298910	ensembl	human	known	70_37	missense	SNP	0.989	T
MAP1LC3A	84557	genome.wustl.edu	37	20	33147555	33147555	+	Silent	SNP	G	G	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:33147555G>C	ENST00000360668.3	+	4	980	c.219G>C	c.(217-219)ctG>ctC	p.L73L	MAP1LC3A_ENST00000397709.1_Silent_p.L73L|MAP1LC3A_ENST00000374837.3_Silent_p.L77L|MAP1LC3A_ENST00000476428.1_3'UTR			Q9H492	MLP3A_HUMAN	microtubule-associated protein 1 light chain 3 alpha	73					autophagic vacuole assembly (GO:0000045)|mitochondrion degradation (GO:0000422)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|late endosome (GO:0005770)|microtubule (GO:0005874)|organelle membrane (GO:0031090)	phosphatidylethanolamine binding (GO:0008429)|phospholipid binding (GO:0005543)			cervix(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(2)	5						GCCTGCAGCTGAACCCCACGC	0.637																																																	0													37.0	45.0	43.0					20																	33147555		2201	4295	6496	SO:0001819	synonymous_variant	84557				CCDS13237.1, CCDS13238.1	20q11.22	2014-02-12			ENSG00000101460	ENSG00000101460			6838	protein-coding gene	gene with protein product		601242				8833088, 17580304	Standard	NM_032514		Approved	MAP1BLC3, MAP1ALC3, LC3, LC3A, ATG8E	uc002xaq.2	Q9H492	OTTHUMG00000032306	ENST00000360668.3:c.219G>C	20.37:g.33147555G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5P4|E1P5P5|Q9BXW5	Silent	SNP	pfam_Atg8_ubiquitin-like,pfam_Autophagy-rel_prot_12	p.L73	ENST00000360668.3	37	c.219	CCDS13238.1	20																																																																																			MAP1LC3A	-	pfam_Atg8_ubiquitin-like,pfam_Autophagy-rel_prot_12		0.637	MAP1LC3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1LC3A	HGNC	protein_coding	OTTHUMT00000078801.2	G	NM_181509		33147555	+1	no_errors	ENST00000360668	ensembl	human	known	70_37	silent	SNP	1.000	C
MDC1	9656	genome.wustl.edu	37	6	30671436	30671436	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr6:30671436C>T	ENST00000376406.3	-	10	6171	c.5524G>A	c.(5524-5526)Gag>Aag	p.E1842K	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.E1578K	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1842	Required for nuclear localization (NLS2).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TCTTCTTCCTCTTCCTTGATA	0.498								Other conserved DNA damage response genes																																									0													159.0	164.0	162.0					6																	30671436		2203	4300	6503	SO:0001583	missense	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5524G>A	6.37:g.30671436C>T	ENSP00000365588:p.Glu1842Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.E1842K	ENST00000376406.3	37	c.5524	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749620	0.69533	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.05319	3.46;3.46	4.81	2.97	0.34412	.	0.192578	0.25490	N	0.030304	T	0.08268	0.0206	M	0.75777	2.31	0.24006	N	0.996193	D;D;B	0.71674	0.998;0.997;0.019	D;D;B	0.78314	0.991;0.98;0.031	T	0.18116	-1.0347	10	0.20046	T	0.44	-8.67	6.6655	0.23039	0.0:0.7229:0.1801:0.0971	.	1578;1842;819	Q14676-2;Q14676;Q14676-4	.;MDC1_HUMAN;.	K	1842;1578;1555;1408	ENSP00000365588:E1842K;ENSP00000365587:E1578K	ENSP00000365587:E1578K	E	-	1	0	MDC1	30779415	0.391000	0.25221	0.149000	0.22428	0.149000	0.21700	1.044000	0.30329	0.713000	0.32060	0.555000	0.69702	GAG	MDC1	-	NULL		0.498	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	C	NM_014641		30671436	-1	no_errors	ENST00000376406	ensembl	human	known	70_37	missense	SNP	0.649	T
MT-ATP6	4508	genome.wustl.edu	37	M	8701	8701	+	Missense_Mutation	SNP	A	A	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chrM:8701A>G	ENST00000361899.2	+	1	175	c.175A>G	c.(175-177)Acc>Gcc	p.T59A	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-CO3_ENST00000362079.2_5'Flank			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	59			T -> A (in dbSNP:rs2000975). {ECO:0000269|PubMed:1757091, ECO:0000269|PubMed:3201231}.		ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						AACAAATGATAGCCATACACA	0.403																																																	0																																										SO:0001583	missense	4508					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.175A>G	M.37:g.8701A>G	ENSP00000354632:p.Thr59Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.T59A	ENST00000361899.2	37	c.175		MT																																																																																			MT-ATP6	-	pfam_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu		0.403	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		A	YP_003024031		8701	+1	no_errors	ENST00000361899	ensembl	human	known	70_37	missense	SNP	NULL	G
MUC5B	727897	genome.wustl.edu	37	11	1265856	1265856	+	Silent	SNP	C	C	T	rs533882258	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr11:1265856C>T	ENST00000529681.1	+	31	7804	c.7746C>T	c.(7744-7746)acC>acT	p.T2582T	MUC5B_ENST00000447027.1_Silent_p.T2585T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2582	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|T -> A (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCTTACCACCACGGCCACCA	0.637													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19614	0.0		0.0	False		,,,				2504	0.0																0													143.0	169.0	160.0					11																	1265856		2092	4200	6292	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7746C>T	11.37:g.1265856C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T2585	ENST00000529681.1	37	c.7755	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	2.262	-0.369115	0.05069	.	.	ENSG00000117983	ENST00000537836	.	.	.	2.56	-4.54	0.03452	.	.	.	.	.	T	0.19087	0.0458	.	.	.	0.27423	N	0.954248	.	.	.	.	.	.	T	0.28170	-1.0052	5	0.33141	T	0.24	.	0.6167	0.00771	0.423:0.2122:0.1325:0.2323	.	.	.	.	L	126	.	ENSP00000440615:P126L	P	+	2	0	MUC5B	1222432	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.969000	0.00088	-0.789000	0.04498	-1.043000	0.02367	CCA	MUC5B	-	NULL		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	C	XM_001126093		1265856	+1	no_errors	ENST00000447027	ensembl	human	known	70_37	silent	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1265936	1265936	+	Missense_Mutation	SNP	T	T	C	rs2943496	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr11:1265936T>C	ENST00000529681.1	+	31	7884	c.7826T>C	c.(7825-7827)cTg>cCg	p.L2609P	MUC5B_ENST00000447027.1_Missense_Mutation_p.L2612P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2609	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			L -> P (in Ref. 4; CAA96577). {ECO:0000305}.|Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCAAAGTGCTGACTACCACA	0.642													T|||	67	0.0133786	0.0151	0.0101	5008	,	,		19126	0.001		0.0318	False		,,,				2504	0.0072																0								T	PRO/LEU	17,4159		0,17,2071	155.0	184.0	174.0		7826	-1.6	0.0	11	dbSNP_101	174	87,8309		6,75,4117	no	missense	MUC5B	NM_002458.2	98	6,92,6188	CC,CT,TT		1.0362,0.4071,0.8272	benign	2609/5763	1265936	104,12468	2088	4198	6286	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.7826T>C	11.37:g.1265936T>C	ENSP00000436812:p.Leu2609Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.L2612P	ENST00000529681.1	37	c.7835	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	T	0.373	-0.932845	0.02359	0.004071	0.010362	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.24350	1.86;2.05	0.801	-1.6	0.08426	.	.	.	.	.	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23048	-1.0199	9	0.87932	D	0	.	2.808	0.05433	0.3291:0.2918:0.0:0.3791	rs2943496	3247;2612	A7Y9J9;E9PBJ0	.;.	P	2609;2612;2581;2624	ENSP00000436812:L2609P;ENSP00000415793:L2612P	ENSP00000343037:L2581P	L	+	2	0	MUC5B	1222512	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-12.573000	0.00001	-0.800000	0.04433	0.155000	0.16302	CTG	MUC5B	-	NULL		0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	T	XM_001126093		1265936	+1	no_errors	ENST00000447027	ensembl	human	known	70_37	missense	SNP	0.000	C
MYL9	10398	genome.wustl.edu	37	20	35173466	35173466	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:35173466C>T	ENST00000279022.2	+	2	283	c.179C>T	c.(178-180)tCg>tTg	p.S60L	MYL9_ENST00000346786.2_Missense_Mutation_p.S60L|RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA	NM_006097.4	NP_006088.2	P24844	MYL9_HUMAN	myosin, light chain 9, regulatory	60	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|platelet aggregation (GO:0070527)|regulation of muscle contraction (GO:0006937)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)	8	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ATGCTGGCCTCGCTGGGTGAG	0.567																																																	0													74.0	68.0	70.0					20																	35173466		2203	4300	6503	SO:0001583	missense	10398			J02854	CCDS13276.1, CCDS13277.1	20q11.23	2013-01-10	2006-09-29		ENSG00000101335	ENSG00000101335		"""Myosins / Light chain"", ""EF-hand domain containing"""	15754	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2, smooth muscle isoform"", ""myosin regulatory light chain 1"""	609905	"""myosin, light polypeptide 9, regulatory"""			2526655	Standard	NM_006097		Approved	MYRL2, MLC2, LC20, MRLC1	uc002xfl.2	P24844	OTTHUMG00000032387	ENST00000279022.2:c.179C>T	20.37:g.35173466C>T	ENSP00000279022:p.Ser60Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5T6|Q9BQL9|Q9BUF9|Q9H136	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S60L	ENST00000279022.2	37	c.179	CCDS13276.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.091342	0.94149	.	.	ENSG00000101335	ENST00000279022;ENST00000346786	T;T	0.70869	-0.52;-0.08	4.67	4.67	0.58626	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.85852	0.5793	M	0.87038	2.855	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.983	D	0.88813	0.3293	10	0.87932	D	0	.	16.5061	0.84272	0.0:1.0:0.0:0.0	.	60;60	Q9BUF9;P24844	.;MYL9_HUMAN	L	60	ENSP00000279022:S60L;ENSP00000217313:S60L	ENSP00000279022:S60L	S	+	2	0	MYL9	34606880	1.000000	0.71417	0.937000	0.37676	0.967000	0.64934	7.818000	0.86416	2.299000	0.77371	0.655000	0.94253	TCG	MYL9	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.567	MYL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL9	HGNC	protein_coding	OTTHUMT00000079015.2	C	NM_006097		35173466	+1	no_errors	ENST00000279022	ensembl	human	known	70_37	missense	SNP	1.000	T
NLRP8	126205	genome.wustl.edu	37	19	56463942	56463942	+	Nonsense_Mutation	SNP	G	G	T	rs534631410	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr19:56463942G>T	ENST00000291971.3	+	2	477	c.406G>T	c.(406-408)Gga>Tga	p.G136*	NLRP8_ENST00000590542.1_Nonsense_Mutation_p.G136*	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	136					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CTTGAATGTGGGAGAAACACA	0.488																																																	0													175.0	160.0	165.0					19																	56463942		2203	4300	6503	SO:0001587	stop_gained	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.406G>T	19.37:g.56463942G>T	ENSP00000291971:p.Gly136*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTR4	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.G136*	ENST00000291971.3	37	c.406	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613873	0.46631	.	.	ENSG00000179709	ENST00000291971	.	.	.	1.54	-0.742	0.11108	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	4.2801	0.10829	0.5522:0.0:0.4478:0.0	.	.	.	.	X	136	.	ENSP00000291971:G136X	G	+	1	0	NLRP8	61155754	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.617000	0.05584	-0.281000	0.09141	-0.507000	0.04495	GGA	NLRP8	-	NULL		0.488	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	G	NM_176811		56463942	+1	no_errors	ENST00000291971	ensembl	human	known	70_37	nonsense	SNP	0.000	T
NOP56	10528	genome.wustl.edu	37	20	2635525	2635525	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:2635525G>A	ENST00000329276.5	+	5	1017	c.501G>A	c.(499-501)atG>atA	p.M167I	SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORA51_ENST00000606420.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD86_ENST00000391196.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	167					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TGGACAATATGATCATCCAGT	0.502																																																	0													167.0	163.0	164.0					20																	2635525		2203	4300	6503	SO:0001583	missense	10528			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.501G>A	20.37:g.2635525G>A	ENSP00000370589:p.Met167Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.M167I	ENST00000329276.5	37	c.501	CCDS13030.1	20	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360143	0.82353	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	D;D	0.84442	-1.85;-1.85	5.89	4.94	0.65067	NOSIC (2);	0.000000	0.85682	D	0.000000	D	0.92338	0.7569	M	0.93197	3.39	0.80722	D	1	P	0.49696	0.927	P	0.54706	0.759	D	0.93662	0.6982	10	0.72032	D	0.01	-34.2421	12.8657	0.57937	0.0786:0.0:0.9214:0.0	.	167	O00567	NOP56_HUMAN	I	167	ENSP00000370589:M167I;ENSP00000388497:M167I	ENSP00000370589:M167I	M	+	3	0	NOP56	2583525	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.603000	0.98315	1.494000	0.48533	-0.266000	0.10368	ATG	NOP56	-	pfam_NOSIC,smart_NOSIC		0.502	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	HGNC	protein_coding	OTTHUMT00000077631.2	G	NM_006392		2635525	+1	no_errors	ENST00000329276	ensembl	human	known	70_37	missense	SNP	1.000	A
NSD1	64324	genome.wustl.edu	37	5	176562700	176562700	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr5:176562700C>T	ENST00000439151.2	+	2	641	c.596C>T	c.(595-597)tCa>tTa	p.S199L	NSD1_ENST00000361032.4_Missense_Mutation_p.S199L|NSD1_ENST00000347982.4_Intron|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000511258.1_Intron	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	199					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAGACTAAATCAGAGAATGGT	0.468			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													129.0	125.0	127.0					5																	176562700		2203	4300	6503	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.596C>T	5.37:g.176562700C>T	ENSP00000395929:p.Ser199Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.S199L	ENST00000439151.2	37	c.596	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253908	0.59212	.	.	ENSG00000165671	ENST00000439151;ENST00000361032	D;D	0.94457	-3.29;-3.43	4.66	4.66	0.58398	.	0.000000	0.38381	N	0.001715	D	0.90386	0.6991	N	0.08118	0	0.80722	D	1	D;P;D	0.61697	0.99;0.948;0.99	P;P;P	0.58721	0.844;0.614;0.842	D	0.86950	0.2085	10	0.02654	T	1	.	14.5812	0.68292	0.0:1.0:0.0:0.0	.	199;199;199	Q96L73-3;Q96L73;Q6PJ64	.;NSD1_HUMAN;.	L	199	ENSP00000395929:S199L;ENSP00000354310:S199L	ENSP00000354310:S199L	S	+	2	0	NSD1	176495306	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.332000	0.43903	2.423000	0.82170	0.462000	0.41574	TCA	NSD1	-	NULL		0.468	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	C	NM_172349		176562700	+1	no_errors	ENST00000439151	ensembl	human	known	70_37	missense	SNP	1.000	T
OR10Z1	128368	genome.wustl.edu	37	1	158576486	158576487	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:158576486_158576487insG	ENST00000361284.1	+	1	258_259	c.258_259insG	c.(259-261)gggfs	p.G87fs		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					CTGGCCTGGCTGGGGGGGACCA	0.554																																																	0																																										SO:0001589	frameshift_variant	128368			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.265dupG	1.37:g.158576493_158576493dupG	ENSP00000354707:p.Gly87fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYL0|Q6IFR7	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D88fs	ENST00000361284.1	37	c.258_259	CCDS30901.1	1																																																																																			OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.554	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	NM_001004478		158576487	+1	no_errors	ENST00000361284	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.000	G
PAK7	57144	genome.wustl.edu	37	20	9561269	9561269	+	Silent	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:9561269G>A	ENST00000378429.3	-	5	1059	c.513C>T	c.(511-513)caC>caT	p.H171H	RP5-986I17.2_ENST00000428769.1_RNA|PAK7_ENST00000378423.1_Silent_p.H171H|PAK7_ENST00000353224.5_Silent_p.H171H	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	171	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TTTTCATTACGTGCCCATTTT	0.468																																																	0													157.0	151.0	153.0					20																	9561269		2203	4300	6503	SO:0001819	synonymous_variant	57144			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.513C>T	20.37:g.9561269G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.H171	ENST00000378429.3	37	c.513	CCDS13107.1	20																																																																																			PAK7	-	NULL		0.468	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1	G			9561269	-1	no_errors	ENST00000353224	ensembl	human	known	70_37	silent	SNP	0.021	A
RAD9B	144715	genome.wustl.edu	37	12	110957694	110957694	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:110957694C>T	ENST00000409778.3	+	7	680	c.656C>T	c.(655-657)tCa>tTa	p.S219L	RAD9B_ENST00000409425.1_Missense_Mutation_p.S216L|RAD9B_ENST00000409300.1_Missense_Mutation_p.S288L|RAD9B_ENST00000409246.1_Missense_Mutation_p.S216L|RAD9B_ENST00000392672.4_Missense_Mutation_p.S288L			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	285					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						TCACCACAGTCACTGTGTCTT	0.353																																																	0													155.0	134.0	141.0					12																	110957694		2202	4300	6502	SO:0001583	missense	144715				CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.656C>T	12.37:g.110957694C>T	ENSP00000386697:p.Ser219Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Missense_Mutation	SNP	pfam_Rad9/Ddc1,pirsf_Rad9	p.S288L	ENST00000409778.3	37	c.863		12	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463262	0.26248	.	.	ENSG00000151164	ENST00000409246;ENST00000392672;ENST00000409300;ENST00000409425;ENST00000409778	T;T;T;T;T	0.26223	1.75;2.07;2.08;1.75;2.0	5.41	3.56	0.40772	.	0.322426	0.26373	N	0.024755	T	0.24122	0.0584	L	0.51422	1.61	0.09310	N	1	B;B;B	0.17465	0.022;0.001;0.003	B;B;B	0.17433	0.018;0.0;0.004	T	0.16867	-1.0388	10	0.48119	T	0.1	-2.6925	11.0655	0.47972	0.0:0.8496:0.0:0.1504	.	219;288;285	B4DYM6;B4DX60;Q6WBX8	.;.;RAD9B_HUMAN	L	216;288;288;216;219	ENSP00000387329:S216L;ENSP00000376440:S288L;ENSP00000386434:S288L;ENSP00000386629:S216L;ENSP00000386697:S219L	ENSP00000376440:S288L	S	+	2	0	RAD9B	109442077	0.022000	0.18835	0.197000	0.23402	0.650000	0.38633	2.102000	0.41796	0.635000	0.30488	0.655000	0.94253	TCA	RAD9B	-	pirsf_Rad9		0.353	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	RAD9B	HGNC	protein_coding	OTTHUMT00000404634.1	C	NM_152442		110957694	+1	no_errors	ENST00000392672	ensembl	human	known	70_37	missense	SNP	0.101	T
RASAL2	9462	genome.wustl.edu	37	1	178411962	178411962	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:178411962G>T	ENST00000462775.1	+	6	761	c.636G>T	c.(634-636)tgG>tgT	p.W212C	RASAL2_ENST00000367649.3_Missense_Mutation_p.W360C|RASAL2_ENST00000448150.3_Missense_Mutation_p.W342C	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	212	C2.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						ATATTTTCTGGGGCGAACATT	0.388																																																	0													87.0	90.0	89.0					1																	178411962		2203	4300	6503	SO:0001583	missense	9462			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.636G>T	1.37:g.178411962G>T	ENSP00000420558:p.Trp212Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.W360C	ENST00000462775.1	37	c.1080	CCDS1322.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213233	0.79352	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	D;D;D	0.85773	-2.03;-2.03;-2.03	5.75	5.75	0.90469	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.94417	0.8204	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.94935	0.8086	10	0.87932	D	0	.	19.9405	0.97159	0.0:0.0:1.0:0.0	.	212;360	Q9UJF2;F8W755	NGAP_HUMAN;.	C	342;360;212	ENSP00000407768:W342C;ENSP00000356621:W360C;ENSP00000420558:W212C	ENSP00000356621:W360C	W	+	3	0	RASAL2	176678585	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.731000	0.98807	2.716000	0.92895	0.650000	0.86243	TGG	RASAL2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep		0.388	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	G	NM_170692		178411962	+1	no_errors	ENST00000367649	ensembl	human	known	70_37	missense	SNP	1.000	T
RBM12	10137	genome.wustl.edu	37	20	34242510	34242510	+	Silent	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:34242510C>T	ENST00000374114.3	-	3	998	c.735G>A	c.(733-735)ccG>ccA	p.P245P	RBM12_ENST00000359646.1_Silent_p.P245P|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000374104.3_Silent_p.P245P|CPNE1_ENST00000397442.1_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000317677.5_5'Flank|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	245	Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GATTCAAGGGCGGCATGCCCG	0.552																																																	0													73.0	72.0	72.0					20																	34242510		2203	4300	6503	SO:0001819	synonymous_variant	10137			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.735G>A	20.37:g.34242510C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P245	ENST00000374114.3	37	c.735	CCDS13261.1	20																																																																																			RBM12	-	NULL		0.552	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12	HGNC	protein_coding	OTTHUMT00000078894.1	C	NM_006047		34242510	-1	no_errors	ENST00000359646	ensembl	human	known	70_37	silent	SNP	0.836	T
RERGL	79785	genome.wustl.edu	37	12	18238556	18238556	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:18238556G>A	ENST00000229002.2	-	4	390	c.184C>T	c.(184-186)Caa>Taa	p.Q62*	RERGL_ENST00000536890.1_Nonsense_Mutation_p.Q61*|RERGL_ENST00000538724.1_Nonsense_Mutation_p.Q61*|RERGL_ENST00000541632.1_5'UTR	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	62	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TTACTTACTTGAGAACAAGGG	0.284																																																	0													106.0	107.0	106.0					12																	18238556		2202	4296	6498	SO:0001587	stop_gained	79785			AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.184C>T	12.37:g.18238556G>A	ENSP00000229002:p.Gln62*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type	p.Q62*	ENST00000229002.2	37	c.184	CCDS8679.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.247266	0.95305	.	.	ENSG00000111404	ENST00000229002;ENST00000538724;ENST00000536890	.	.	.	4.1	4.1	0.47936	.	0.125962	0.56097	D	0.000033	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	15.7719	0.78176	0.0:0.0:1.0:0.0	.	.	.	.	X	62;61;61	.	ENSP00000229002:Q62X	Q	-	1	0	RERGL	18129823	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	5.659000	0.68010	2.561000	0.86390	0.557000	0.71058	CAA	RERGL	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type		0.284	RERGL-001	KNOWN	basic|CCDS	protein_coding	RERGL	HGNC	protein_coding	OTTHUMT00000401198.1	G	NM_024730		18238556	-1	no_errors	ENST00000229002	ensembl	human	known	70_37	nonsense	SNP	1.000	A
RGPD3	653489	genome.wustl.edu	37	2	107049624	107049624	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr2:107049624C>G	ENST00000409886.3	-	16	2410	c.2323G>C	c.(2323-2325)Gaa>Caa	p.E775Q	RGPD3_ENST00000304514.7_Missense_Mutation_p.E775Q	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	775					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TGTTTTATTTCTGAATCCGCA	0.353																																																	0													45.0	42.0	43.0					2																	107049624		692	1590	2282	SO:0001583	missense	653489				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2323G>C	2.37:g.107049624C>G	ENSP00000386588:p.Glu775Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E775Q	ENST00000409886.3	37	c.2323	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	4.568	0.105581	0.08780	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.20332	2.08;2.08	2.34	2.34	0.29019	.	.	.	.	.	T	0.17534	0.0421	L	0.60455	1.87	0.23972	N	0.996307	P	0.37233	0.588	B	0.21708	0.036	T	0.11494	-1.0585	9	0.49607	T	0.09	-20.4736	10.3857	0.44138	0.0:1.0:0.0:0.0	.	775	A6NKT7	RGPD3_HUMAN	Q	775;533;775	ENSP00000386588:E775Q;ENSP00000303659:E775Q	ENSP00000303659:E775Q	E	-	1	0	RGPD3	106416056	1.000000	0.71417	0.995000	0.50966	0.037000	0.13140	4.229000	0.58625	1.308000	0.44962	0.173000	0.16961	GAA	RGPD3	-	NULL		0.353	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	C	XM_929931		107049624	-1	no_errors	ENST00000304514	ensembl	human	known	70_37	missense	SNP	1.000	G
RGPD4	285190	genome.wustl.edu	37	2	108479255	108479255	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr2:108479255G>C	ENST00000408999.3	+	16	2400	c.2323G>C	c.(2323-2325)Gaa>Caa	p.E775Q	RGPD4_ENST00000354986.4_Missense_Mutation_p.E775Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	775					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGCGGATTCAGAAATAAAACA	0.348																																																	0													19.0	19.0	19.0					2																	108479255		376	922	1298	SO:0001583	missense	285190			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2323G>C	2.37:g.108479255G>C	ENSP00000386810:p.Glu775Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E775Q	ENST00000408999.3	37	c.2323	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	5.599	0.295237	0.10622	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.20332	2.08;2.08	2.3	2.3	0.28687	.	.	.	.	.	T	0.19927	0.0479	L	0.60455	1.87	0.24575	N	0.99391	P	0.37233	0.588	B	0.33295	0.161	T	0.08868	-1.0701	9	0.32370	T	0.25	-20.4736	11.5619	0.50782	0.0:0.0:1.0:0.0	.	775	Q7Z3J3	RGPD4_HUMAN	Q	775;775;533	ENSP00000347081:E775Q;ENSP00000386810:E775Q	ENSP00000347081:E775Q	E	+	1	0	RGPD4	107845687	1.000000	0.71417	0.998000	0.56505	0.152000	0.21847	5.390000	0.66261	1.299000	0.44798	0.152000	0.16155	GAA	RGPD4	-	NULL		0.348	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	G	XM_496581		108479255	+1	no_errors	ENST00000354986	ensembl	human	known	70_37	missense	SNP	0.997	C
SERPINB3	6317	genome.wustl.edu	37	18	61322841	61322841	+	3'UTR	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr18:61322841G>T	ENST00000283752.5	-	0	1366				SERPINB3_ENST00000332821.8_3'UTR|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3						negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						CAGTTTACCAGAACATCTGCA	0.378																																																	0													91.0	95.0	94.0					18																	61322841		2201	4300	6501	SO:0001624	3_prime_UTR_variant	89778			U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.*50C>A	18.37:g.61322841G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	RNA	SNP	-	NULL	ENST00000283752.5	37	NULL	CCDS11987.1	18																																																																																			SERPINB11	-	-		0.378	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB11	HGNC	protein_coding	OTTHUMT00000133791.1	G	NM_006919		61322841	+1	no_errors	ENST00000489748	ensembl	human	known	70_37	rna	SNP	0.000	T
SFRP2	6423	genome.wustl.edu	37	4	154709955	154709956	+	In_Frame_Ins	INS	-	-	AGC	rs559360607	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr4:154709955_154709956insAGC	ENST00000274063.4	-	1	316_317	c.32_33insGCT	c.(31-33)ctc>ctGCTc	p.11_11L>LL		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	11					bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				AGGCGAGGAAGAGCAGCAGCAG	0.708														3	0.000599042	0.0	0.0	5008	,	,		13542	0.0		0.003	False		,,,				2504	0.0																0										6,3904		0,6,1949						-7.4	0.3			11	34,7600		5,24,3788	no	coding	SFRP2	NM_003013.2		5,30,5737	A1A1,A1R,RR		0.4454,0.1535,0.3465				40,11504				SO:0001652	inframe_insertion	6423			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.30_32dupGCT	4.37:g.154709962_154709964dupAGC	ENSP00000274063:p.Leu11dup	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQR2|O14778|Q9HAP5	In_Frame_Ins	INS	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.12in_frame_insL	ENST00000274063.4	37	c.33_32	CCDS34082.1	4																																																																																			SFRP2	-	NULL		0.708	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP2	HGNC	protein_coding	OTTHUMT00000365296.1	-			154709956	-1	no_errors	ENST00000274063	ensembl	human	known	70_37	in_frame_ins	INS	0.009:0.677	AGC
SGK223	157285	genome.wustl.edu	37	8	8185835	8185835	+	Silent	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr8:8185835C>T	ENST00000520004.1	-	5	2721	c.2457G>A	c.(2455-2457)gtG>gtA	p.V819V	SGK223_ENST00000330777.4_Silent_p.V819V			Q86YV5	SG223_HUMAN		821							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTGCCCGGCTCACTATCTTTT	0.612																																					GBM(34;731 755 10259 33573 33867)												0													57.0	64.0	62.0					8																	8185835		1867	4089	5956	SO:0001819	synonymous_variant	157285																														ENST00000520004.1:c.2457G>A	8.37:g.8185835C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3N5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.V819	ENST00000520004.1	37	c.2457	CCDS43706.1	8																																																																																			SGK223	-	NULL		0.612	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_genename	protein_coding	OTTHUMT00000374864.1	C			8185835	-1	no_errors	ENST00000330777	ensembl	human	known	70_37	silent	SNP	1.000	T
SH3BP1	23616	genome.wustl.edu	37	22	38041472	38041472	+	Silent	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr22:38041472C>T	ENST00000357436.4	+	10	1192	c.879C>T	c.(877-879)atC>atT	p.I293I	SH3BP1_ENST00000336738.5_Silent_p.I293I|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000495174.1_3'UTR|SH3BP1_ENST00000442465.2_Silent_p.I293I|SH3BP1_ENST00000599616.1_Silent_p.I229I	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	293	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CCCTGCCCATCGAGGCCTGCG	0.637																																																	0													85.0	82.0	83.0					22																	38041472		2203	4300	6503	SO:0001819	synonymous_variant	23616				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.879C>T	22.37:g.38041472C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.I293	ENST00000357436.4	37	c.879	CCDS13952.2	22																																																																																			SH3BP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.637	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4	C	NM_018957		38041472	+1	no_errors	ENST00000357436	ensembl	human	known	70_37	silent	SNP	0.494	T
SLC34A2	10568	genome.wustl.edu	37	4	25665907	25665907	+	Missense_Mutation	SNP	G	G	A	rs78448446		TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr4:25665907G>A	ENST00000382051.3	+	4	384	c.334G>A	c.(334-336)Gtg>Atg	p.V112M	SLC34A2_ENST00000504570.1_Missense_Mutation_p.V111M|SLC34A2_ENST00000503434.1_Missense_Mutation_p.V111M	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	112					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CTACTTTTTCGTGTGCTCCCT	0.483			T	ROS1	NSCLC																																			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													140.0	138.0	139.0					4																	25665907		2203	4300	6503	SO:0001583	missense	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.334G>A	4.37:g.25665907G>A	ENSP00000371483:p.Val112Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.V112M	ENST00000382051.3	37	c.334	CCDS3435.1	4	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800296	0.70567	.	.	ENSG00000157765	ENST00000513204;ENST00000504570;ENST00000382051;ENST00000503434;ENST00000507530	D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13	5.35	5.35	0.76521	.	0.056527	0.64402	D	0.000001	D	0.91841	0.7418	L	0.52126	1.63	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.981	D	0.91893	0.5525	10	0.59425	D	0.04	-27.9342	19.4396	0.94813	0.0:0.0:1.0:0.0	.	111;112	O95436-2;O95436	.;NPT2B_HUMAN	M	111;111;112;111;112	ENSP00000423038:V111M;ENSP00000425501:V111M;ENSP00000371483:V112M;ENSP00000423021:V111M;ENSP00000424266:V112M	ENSP00000371483:V112M	V	+	1	0	SLC34A2	25275005	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	3.764000	0.55264	2.678000	0.91216	0.655000	0.94253	GTG	SLC34A2	-	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt		0.483	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	G	NM_006424		25665907	+1	no_errors	ENST00000382051	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC41A1	254428	genome.wustl.edu	37	1	205779628	205779628	+	5'UTR	SNP	C	C	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:205779628C>G	ENST00000367137.3	-	0	956					NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			TTTCTCTCTTCTTCTCTAACT	0.542											OREG0014163	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001623	5_prime_UTR_variant	254428			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.-59G>C	1.37:g.205779628C>G		Somatic	2154	WXS	Illumina HiSeq	Phase_IV	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	RNA	SNP	-	NULL	ENST00000367137.3	37	NULL	CCDS30988.1	1																																																																																			SLC41A1	-	-		0.542	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	C			205779628	-1	no_errors	ENST00000484000	ensembl	human	known	70_37	rna	SNP	0.361	G
SLITRK1	114798	genome.wustl.edu	37	13	84454243	84454243	+	Missense_Mutation	SNP	A	A	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr13:84454243A>G	ENST00000377084.2	-	1	2285	c.1400T>C	c.(1399-1401)tTc>tCc	p.F467S		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	467					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CATGGCATTGAAAGTGCCCGG	0.557																																																	0													78.0	71.0	73.0					13																	84454243		2203	4300	6503	SO:0001583	missense	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1400T>C	13.37:g.84454243A>G	ENSP00000366288:p.Phe467Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.F467S	ENST00000377084.2	37	c.1400	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	A	17.13	3.312023	0.60414	.	.	ENSG00000178235	ENST00000377084	T	0.70749	-0.51	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.89111	0.6622	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92533	0.6035	10	0.87932	D	0	-16.6297	14.208	0.65746	1.0:0.0:0.0:0.0	.	467	Q96PX8	SLIK1_HUMAN	S	467	ENSP00000366288:F467S	ENSP00000366288:F467S	F	-	2	0	SLITRK1	83352244	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.287000	0.95975	2.104000	0.64026	0.533000	0.62120	TTC	SLITRK1	-	smart_Leu-rich_rpt_typical-subtyp		0.557	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	A	NM_052910		84454243	-1	no_errors	ENST00000377084	ensembl	human	known	70_37	missense	SNP	1.000	G
SMG6	23293	genome.wustl.edu	37	17	1964523	1964523	+	3'UTR	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr17:1964523C>T	ENST00000263073.6	-	0	4573				SMG6_ENST00000573166.1_5'UTR|SMG6_ENST00000544865.1_3'UTR|SMG6_ENST00000354901.4_3'UTR	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCTGGCTTGCCCAGCTGCTGT	0.647																																					Melanoma(59;28 1088 11621 25887 46638 50814)												0																																										SO:0001624	3_prime_UTR_variant	23293			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.*263G>A	17.37:g.1964523C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	RNA	SNP	-	NULL	ENST00000263073.6	37	NULL	CCDS11016.1	17																																																																																			SMG6	-	-		0.647	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	C			1964523	-1	no_errors	ENST00000570756	ensembl	human	known	70_37	rna	SNP	1.000	T
SNRPD3	6634	genome.wustl.edu	37	22	24964112	24964112	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr22:24964112G>T	ENST00000215829.3	+	3	874	c.287G>T	c.(286-288)gGc>gTc	p.G96V	SNRPD3_ENST00000402849.1_Missense_Mutation_p.G96V	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	96	Arg/Lys-rich (basic).				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						TCAGGGGCTGGCCGAGGAAAA	0.453																																																	0													56.0	52.0	54.0					22																	24964112		2203	4300	6503	SO:0001583	missense	6634			U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.287G>T	22.37:g.24964112G>T	ENSP00000215829:p.Gly96Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJP7|B5BU13|P43331	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.G96V	ENST00000215829.3	37	c.287	CCDS13828.1	22	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443719	0.83993	.	.	ENSG00000100028	ENST00000215829;ENST00000402849	T;T	0.49139	0.79;0.79	6.08	6.08	0.98989	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.66616	0.2807	M	0.80422	2.495	0.80722	D	1	P;B	0.52316	0.952;0.065	P;B	0.55667	0.781;0.094	T	0.67102	-0.5755	10	0.51188	T	0.08	.	17.8207	0.88649	0.0:0.0:1.0:0.0	.	96;96	B4DJP7;P62318	.;SMD3_HUMAN	V	96	ENSP00000215829:G96V;ENSP00000385266:G96V	ENSP00000385994:G96V	G	+	2	0	SNRPD3	23294112	1.000000	0.71417	0.964000	0.40570	0.990000	0.78478	7.386000	0.79775	2.890000	0.99128	0.655000	0.94253	GGC	SNRPD3	-	superfamily_LSM_dom		0.453	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD3	HGNC	protein_coding	OTTHUMT00000319813.1	G	NM_004175		24964112	+1	no_errors	ENST00000215829	ensembl	human	known	70_37	missense	SNP	1.000	T
STRADB	55437	genome.wustl.edu	37	2	202344886	202344886	+	Silent	SNP	C	C	T	rs146098224		TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr2:202344886C>T	ENST00000194530.3	+	12	1610	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	415					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						AAGACTCATACTGGGAATTCT	0.393																																																	0													134.0	136.0	135.0					2																	202344886		2203	4300	6503	SO:0001819	synonymous_variant	55437			AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1245C>T	2.37:g.202344886C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BKY7|Q9P1L0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y415	ENST00000194530.3	37	c.1245	CCDS2348.1	2																																																																																			STRADB	-	NULL		0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADB	HGNC	protein_coding	OTTHUMT00000256297.1	C	NM_018571		202344886	+1	no_errors	ENST00000194530	ensembl	human	known	70_37	silent	SNP	0.437	T
TMC7	79905	genome.wustl.edu	37	16	19051725	19051725	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr16:19051725G>A	ENST00000304381.5	+	9	1424	c.1294G>A	c.(1294-1296)Gag>Aag	p.E432K	TMC7_ENST00000421369.3_Missense_Mutation_p.E322K|TMC7_ENST00000569532.1_Missense_Mutation_p.E432K	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	432					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CATCCGCTATGAGGATTATTC	0.453																																																	0													128.0	113.0	118.0					16																	19051725		2197	4300	6497	SO:0001583	missense	79905			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1294G>A	16.37:g.19051725G>A	ENSP00000304710:p.Glu432Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	pfam_TMC	p.E432K	ENST00000304381.5	37	c.1294	CCDS10573.1	16	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928740	0.92389	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.64085	-0.08;-0.08	4.46	4.46	0.54185	.	0.125119	0.52532	D	0.000073	T	0.80539	0.4642	M	0.87547	2.89	0.58432	D	0.999997	P;D	0.56287	0.939;0.975	P;P	0.62382	0.847;0.901	D	0.85370	0.1113	10	0.87932	D	0	.	17.1093	0.86671	0.0:0.0:1.0:0.0	.	432;432	Q7Z402;B3KSZ3	TMC7_HUMAN;.	K	432;322	ENSP00000304710:E432K;ENSP00000397081:E322K	ENSP00000304710:E432K	E	+	1	0	TMC7	18959226	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.765000	0.98953	2.024000	0.59613	0.416000	0.27883	GAG	TMC7	-	NULL		0.453	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC7	HGNC	protein_coding	OTTHUMT00000254276.3	G	NM_024847		19051725	+1	no_errors	ENST00000304381	ensembl	human	known	70_37	missense	SNP	1.000	A
TMEM117	84216	genome.wustl.edu	37	12	44693454	44693454	+	Missense_Mutation	SNP	A	A	G			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:44693454A>G	ENST00000266534.3	+	6	827	c.700A>G	c.(700-702)Agt>Ggt	p.S234G	TMEM117_ENST00000536799.1_Missense_Mutation_p.S130G|TMEM117_ENST00000551577.1_Missense_Mutation_p.S234G	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	234						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		ATTTTTGCCCAGTGATGAAGT	0.448																																																	0													299.0	275.0	283.0					12																	44693454		2203	4300	6503	SO:0001583	missense	84216			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.700A>G	12.37:g.44693454A>G	ENSP00000266534:p.Ser234Gly	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S234G	ENST00000266534.3	37	c.700	CCDS8745.1	12	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850677	0.71719	.	.	ENSG00000139173	ENST00000551577;ENST00000266534;ENST00000536799	T;T;T	0.48836	0.8;0.8;0.8	5.21	5.21	0.72293	.	0.109289	0.85682	D	0.000000	T	0.64011	0.2560	L	0.53249	1.67	0.51482	D	0.999926	D;D;D	0.67145	0.974;0.996;0.974	D;D;D	0.73380	0.953;0.98;0.953	T	0.67122	-0.5750	10	0.72032	D	0.01	-14.3756	15.3725	0.74577	1.0:0.0:0.0:0.0	.	234;130;234	F8VS00;F5H3Q2;Q9H0C3	.;.;TM117_HUMAN	G	234;234;130	ENSP00000448595:S234G;ENSP00000266534:S234G;ENSP00000445243:S130G	ENSP00000266534:S234G	S	+	1	0	TMEM117	42979721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.027000	0.93706	2.092000	0.63282	0.482000	0.46254	AGT	TMEM117	-	NULL		0.448	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM117	HGNC	protein_coding	OTTHUMT00000403969.1	A	NM_032256		44693454	+1	no_errors	ENST00000266534	ensembl	human	known	70_37	missense	SNP	1.000	G
TMEM184C	55751	genome.wustl.edu	37	4	148555364	148555364	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr4:148555364G>T	ENST00000296582.3	+	10	1670	c.1096G>T	c.(1096-1098)Gat>Tat	p.D366Y	TMEM184C_ENST00000508208.1_Intron	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	366						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						GTTTCCCGAGGATCAAGATCA	0.363																																																	0													66.0	63.0	64.0					4																	148555364		2203	4300	6503	SO:0001583	missense	55751			AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.1096G>T	4.37:g.148555364G>T	ENSP00000296582:p.Asp366Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	pfam_Ost-alpha	p.D366Y	ENST00000296582.3	37	c.1096	CCDS3770.1	4	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401523	0.83120	.	.	ENSG00000164168	ENST00000296582	.	.	.	5.74	5.74	0.90152	.	0.266511	0.42294	D	0.000729	T	0.71400	0.3335	M	0.63428	1.95	0.80722	D	1	D	0.61080	0.989	P	0.55667	0.781	T	0.63800	-0.6555	9	0.12103	T	0.63	-21.3928	20.2825	0.98528	0.0:0.0:1.0:0.0	.	366	Q9NVA4	T184C_HUMAN	Y	366	.	ENSP00000296582:D366Y	D	+	1	0	TMEM184C	148774814	1.000000	0.71417	0.980000	0.43619	0.870000	0.49936	6.766000	0.74970	2.873000	0.98535	0.561000	0.74099	GAT	TMEM184C	-	NULL		0.363	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184C	HGNC	protein_coding	OTTHUMT00000364644.1	G	NM_018241		148555364	+1	no_errors	ENST00000296582	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM52B	120939	genome.wustl.edu	37	12	10342532	10342532	+	Silent	SNP	C	C	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr12:10342532C>A	ENST00000381923.2	+	6	749	c.345C>A	c.(343-345)atC>atA	p.I115I	TMEM52B_ENST00000536952.1_Silent_p.I115I|TMEM52B_ENST00000298530.3_Silent_p.I95I			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	115						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTCGGAGGATCCTGGCTGTGG	0.562																																																	0													93.0	81.0	85.0					12																	10342532		2203	4300	6503	SO:0001819	synonymous_variant	120939			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.345C>A	12.37:g.10342532C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96NA7	Silent	SNP	NULL	p.I115	ENST00000381923.2	37	c.345		12																																																																																			TMEM52B	-	NULL		0.562	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	TMEM52B	HGNC	protein_coding	OTTHUMT00000399645.1	C	NM_153022		10342532	+1	no_errors	ENST00000381923	ensembl	human	known	70_37	silent	SNP	1.000	A
TMEM63B	55362	genome.wustl.edu	37	6	44102397	44102397	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr6:44102397G>T	ENST00000259746.9	+	2	259	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	TMEM63B_ENST00000323267.6_Missense_Mutation_p.A26S			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	26					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CTGCTACAGCGCCCGCATCCG	0.632																																																	0													107.0	77.0	87.0					6																	44102397		2203	4300	6503	SO:0001583	missense	55362			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.76G>T	6.37:g.44102397G>T	ENSP00000259746:p.Ala26Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.A26S	ENST00000259746.9	37	c.76	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417271	0.25552	.	.	ENSG00000137216	ENST00000259746;ENST00000532634;ENST00000323267	T;T;T	0.34472	1.36;1.36;1.36	4.11	4.11	0.48088	.	0.061042	0.64402	D	0.000004	T	0.18759	0.0450	L	0.28608	0.87	0.49130	D	0.999758	B;D	0.54964	0.029;0.969	B;P	0.51974	0.02;0.686	T	0.03933	-1.0991	10	0.02654	T	1	.	15.0514	0.71872	0.0:0.0:1.0:0.0	.	26;26	Q5T3F8;Q5T3F8-2	TM63B_HUMAN;.	S	26	ENSP00000259746:A26S;ENSP00000437163:A26S;ENSP00000327154:A26S	ENSP00000259746:A26S	A	+	1	0	TMEM63B	44210375	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	9.223000	0.95203	2.124000	0.65301	0.313000	0.20887	GCC	TMEM63B	-	NULL		0.632	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	G	XM_166410		44102397	+1	no_errors	ENST00000259746	ensembl	human	known	70_37	missense	SNP	1.000	T
USP1	7398	genome.wustl.edu	37	1	62907935	62907935	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr1:62907935G>A	ENST00000339950.4	+	4	1176	c.361G>A	c.(361-363)Gaa>Aaa	p.E121K	USP1_ENST00000371146.1_Missense_Mutation_p.E121K	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	121	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		AAGGAAGAAAGAAGCTCTAAA	0.269																																					Ovarian(122;1846 2315 3982 19504)												0													39.0	40.0	40.0					1																	62907935		2197	4289	6486	SO:0001583	missense	7398				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.361G>A	1.37:g.62907935G>A	ENSP00000343526:p.Glu121Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E121K	ENST00000339950.4	37	c.361	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939488	0.73557	.	.	ENSG00000162607	ENST00000452143;ENST00000371146;ENST00000339950	T;T;T	0.61040	0.14;0.14;0.14	6.17	6.17	0.99709	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.321081	0.36703	N	0.002452	T	0.68100	0.2964	L	0.40543	1.245	0.50813	D	0.999895	D	0.64830	0.994	D	0.66716	0.946	T	0.56932	-0.7897	10	0.15499	T	0.54	-8.8687	20.8794	0.99867	0.0:0.0:1.0:0.0	.	121	O94782	UBP1_HUMAN	K	121	ENSP00000403662:E121K;ENSP00000360188:E121K;ENSP00000343526:E121K	ENSP00000343526:E121K	E	+	1	0	USP1	62680523	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.232000	0.78116	2.941000	0.99782	0.655000	0.94253	GAA	USP1	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.269	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	G	NM_001017415		62907935	+1	no_errors	ENST00000339950	ensembl	human	known	70_37	missense	SNP	1.000	A
VPS16	64601	genome.wustl.edu	37	20	2845875	2845875	+	Silent	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr20:2845875C>T	ENST00000380445.3	+	21	2158	c.2086C>T	c.(2086-2088)Cta>Tta	p.L696L	VPS16_ENST00000380469.3_Silent_p.L552L|VPS16_ENST00000380443.3_Silent_p.L382L|PTPRA_ENST00000380393.3_5'UTR	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	696					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						AGACCTGTCTCTACATGACAC	0.587																																																	0													83.0	76.0	78.0					20																	2845875		2203	4300	6503	SO:0001819	synonymous_variant	64601			AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.2086C>T	20.37:g.2845875C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Silent	SNP	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.L696	ENST00000380445.3	37	c.2086	CCDS13036.1	20																																																																																			VPS16	-	pfam_Vps16_C,pirsf_VPS16		0.587	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	HGNC	protein_coding	OTTHUMT00000077658.2	C	NM_022575		2845875	+1	no_errors	ENST00000380445	ensembl	human	known	70_37	silent	SNP	1.000	T
WRNIP1	56897	genome.wustl.edu	37	6	2779557	2779557	+	Silent	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr6:2779557C>T	ENST00000380773.4	+	4	1526	c.1317C>T	c.(1315-1317)gaC>gaT	p.D439D	WRNIP1_ENST00000380771.4_Silent_p.D414D|WRNIP1_ENST00000380769.4_Silent_p.D219D|WRNIP1_ENST00000380764.1_Silent_p.D55D	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				GTGACGGTGACGCCCGAGCTG	0.532																																																	0													114.0	97.0	103.0					6																	2779557		2203	4300	6503	SO:0001819	synonymous_variant	56897			AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1317C>T	6.37:g.2779557C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_MgsA_C,pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_dyneun-rel_AAA,pfam_DUF815,pfam_IstB_ATP-bd,pfam_ATPase_AAA-2,smart_Znf_Rad18_put,smart_AAA+_ATPase	p.D439	ENST00000380773.4	37	c.1317	CCDS4475.1	6																																																																																			WRNIP1	-	NULL		0.532	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRNIP1	HGNC	protein_coding	OTTHUMT00000039641.1	C	NM_130395		2779557	+1	no_errors	ENST00000380773	ensembl	human	known	70_37	silent	SNP	0.997	T
ZAN	7455	genome.wustl.edu	37	7	100371474	100371474	+	RNA	SNP	G	G	A	rs78193191	byFrequency	TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr7:100371474G>A	ENST00000348028.3	+	0	5930				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGCTGCTCCGTTTCGGGCCT	0.622													G|||	2231	0.445487	0.2141	0.5418	5008	,	,		18070	0.7867		0.3419	False		,,,				2504	0.4448																0													32.0	34.0	33.0					7																	100371474		2009	4154	6163			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100371474G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.R1922H	ENST00000348028.3	37	c.5765		7	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459247	0.63401	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.80994	2.44;2.44;2.41;-1.44	4.56	2.73	0.32206	von Willebrand factor, type C (1);von Willebrand factor, type D domain (1);	0.756330	0.11382	N	0.569707	T	0.73845	0.3639	M	0.76574	2.34	0.21064	N	0.999795	P;P	0.42908	0.754;0.793	B;B	0.33750	0.105;0.169	T	0.64106	-0.6485	10	0.34782	T	0.22	.	6.1384	0.20247	0.226:0.0:0.774:0.0	.	1922;1922	F5H0T8;Q9Y493	.;ZAN_HUMAN	H	1922;1922;1922;433	ENSP00000445943:R1922H;ENSP00000445091:R1922H;ENSP00000444427:R1922H;ENSP00000441117:R433H	ENSP00000423579:R1922H	R	+	2	0	ZAN	100209410	0.922000	0.31269	0.754000	0.31244	0.137000	0.21094	1.873000	0.39558	1.222000	0.43521	0.448000	0.29417	CGT	ZAN	-	smart_VWF_type-D		0.622	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	G	NM_003386		100371474	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	missense	SNP	0.705	A
ZNF174	7727	genome.wustl.edu	37	16	3452170	3452170	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr16:3452170G>C	ENST00000268655.4	+	1	751	c.166G>C	c.(166-168)Gag>Cag	p.E56Q	ZSCAN32_ENST00000573830.1_5'Flank|ZSCAN32_ENST00000396852.4_5'Flank|ZNF174_ENST00000572544.1_Missense_Mutation_p.E56Q|ZNF174_ENST00000575752.1_Missense_Mutation_p.E56Q|ZSCAN32_ENST00000422427.2_5'Flank|ZNF174_ENST00000571936.1_Missense_Mutation_p.E56Q|ZSCAN32_ENST00000439568.2_5'Flank|ZNF174_ENST00000344823.5_Missense_Mutation_p.E56Q|ZSCAN32_ENST00000304926.3_5'Flank	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	56					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						TTGTTATCAAGAGGTGTCTGG	0.542																																																	0													111.0	125.0	120.0					16																	3452170		2197	4300	6497	SO:0001583	missense	7727			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.166G>C	16.37:g.3452170G>C	ENSP00000268655:p.Glu56Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53Y68|Q9BQ34	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E56Q	ENST00000268655.4	37	c.166	CCDS10504.1	16	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040375	0.75732	.	.	ENSG00000103343	ENST00000344823;ENST00000268655	T;T	0.08008	3.14;3.14	4.5	4.5	0.54988	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.49305	D	0.000160	T	0.29355	0.0731	M	0.85777	2.775	0.28530	N	0.912649	D;D;P	0.89917	1.0;0.999;0.728	D;D;P	0.76575	0.986;0.988;0.558	T	0.07046	-1.0793	10	0.72032	D	0.01	.	10.2594	0.43416	0.0:0.0:0.803:0.197	.	56;56;56	Q15697;Q15697-2;Q8IZN5	ZN174_HUMAN;.;.	Q	56	ENSP00000339781:E56Q;ENSP00000268655:E56Q	ENSP00000268655:E56Q	E	+	1	0	ZNF174	3392171	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	5.751000	0.68720	2.790000	0.95986	0.655000	0.94253	GAG	ZNF174	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.542	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	HGNC	protein_coding	OTTHUMT00000251510.1	G	NM_003450		3452170	+1	no_errors	ENST00000268655	ensembl	human	known	70_37	missense	SNP	0.996	C
ZNF492	57615	genome.wustl.edu	37	19	22847093	22847093	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3PZ-01A-11D-A21Q-09	TCGA-JX-A3PZ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	780c38c5-f1fa-4885-a0f9-ced48cf123c9	a37dd07d-ef81-4183-904e-1cdb09139d9b	g.chr19:22847093C>T	ENST00000456783.2	+	4	866	c.622C>T	c.(622-624)Cgg>Tgg	p.R208W	CTC-457E21.9_ENST00000601860.1_RNA	NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AGCCTTTAACCGGCTCTCACA	0.393																																																	0													10.0	13.0	12.0					19																	22847093		1785	4063	5848	SO:0001583	missense	57615			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.622C>T	19.37:g.22847093C>T	ENSP00000413660:p.Arg208Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08EI7|Q08EI8	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R208W	ENST00000456783.2	37	c.622	CCDS46032.1	19	.	.	.	.	.	.	.	.	.	.	.	2.429	-0.331310	0.05314	.	.	ENSG00000229676	ENST00000456783	T	0.07444	3.19	1.3	-2.61	0.06171	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04770	0.0129	N	0.25485	0.75	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.41680	-0.9495	9	0.31617	T	0.26	.	3.6498	0.08199	0.4255:0.3608:0.2137:0.0	.	208	Q9P255	ZN492_HUMAN	W	208	ENSP00000413660:R208W	ENSP00000413660:R208W	R	+	1	2	ZNF492	22638933	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-5.618000	0.00109	-0.540000	0.06265	0.274000	0.19336	CGG	ZNF492	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF492	HGNC	protein_coding	OTTHUMT00000464581.1	C	NM_020855		22847093	+1	no_errors	ENST00000456783	ensembl	human	known	70_37	missense	SNP	0.000	T
