#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA2	20	genome.wustl.edu	37	9	139907165	139907165	+	Splice_Site	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr9:139907165G>A	ENST00000371605.3	-	30	5224	c.5077C>T	c.(5077-5079)Cgg>Tgg	p.R1693W	ABCA2_ENST00000341511.6_Splice_Site_p.R1694W|ABCA2_ENST00000265662.5_Splice_Site_p.R1694W			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1693					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCAGCTCACCGGTGCAGTCGG	0.652																																																	0													31.0	39.0	36.0					9																	139907165		2067	4185	6252	SO:0001630	splice_region_variant	20			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.5078+1C>T	9.37:g.139907165G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1694W	ENST00000371605.3	37	c.5080		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.90|19.90	3.913107|3.913107	0.72983|0.72983	.|.	.|.	ENSG00000107331|ENSG00000107331	ENST00000477420|ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	.|D;D;D	.|0.91792	.|-2.91;-2.9;-2.91	4.06|4.06	2.0|2.0	0.26442|0.26442	.|.	.|0.374892	.|0.14362	.|U	.|0.324386	D|D	0.94958|0.94958	0.8369|0.8369	M|M	0.74881|0.74881	2.28|2.28	0.54753|0.54753	D|D	0.999989|0.999989	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.79784	.|0.993;0.993	D|D	0.93963|0.93963	0.7242|0.7242	5|10	.|0.87932	.|D	.|0	.|.	10.6561|10.6561	0.45675|0.45675	0.0:0.0:0.4092:0.5908|0.0:0.0:0.4092:0.5908	.|.	.|1693;1724	.|Q9BZC7;E7ETC3	.|ABCA2_HUMAN;.	L|W	105|1694;1693;1724;1694	.|ENSP00000265662:R1694W;ENSP00000360666:R1693W;ENSP00000344155:R1694W	.|ENSP00000265662:R1694W	P|R	-|-	2|1	0|2	ABCA2|ABCA2	139026986|139026986	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	2.565000|2.565000	0.45939|0.45939	1.036000|1.036000	0.39998|0.39998	0.491000|0.491000	0.48974|0.48974	CCG|CGG	ABCA2	-	NULL		0.652	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		G	NM_001606	Missense_Mutation	139907165	-1	no_errors	ENST00000265662	ensembl	human	known	70_37	missense	SNP	1.000	A
ABCA2	20	genome.wustl.edu	37	9	139916825	139916825	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr9:139916825G>A	ENST00000371605.3	-	5	689	c.542C>T	c.(541-543)gCc>gTc	p.A181V	ABCA2_ENST00000492260.1_5'UTR|ABCA2_ENST00000341511.6_Missense_Mutation_p.A182V|ABCA2_ENST00000265662.5_Missense_Mutation_p.A182V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	181					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CACACGGGCGGCCAAGAGTGC	0.652																																																	0													24.0	30.0	28.0					9																	139916825		2012	4143	6155	SO:0001583	missense	20			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.542C>T	9.37:g.139916825G>A	ENSP00000360666:p.Ala181Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A182V	ENST00000371605.3	37	c.545		9	.	.	.	.	.	.	.	.	.	.	g	5.218	0.225705	0.09916	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.86956	-2.19;-2.19;-2.19	4.39	2.45	0.29901	.	2.036410	0.04512	U	0.383087	T	0.76933	0.4057	N	0.08118	0	0.09310	N	1	B;B;B	0.23937	0.094;0.047;0.002	B;B;B	0.16722	0.014;0.016;0.007	T	0.64407	-0.6415	10	0.41790	T	0.15	.	10.6791	0.45804	0.0908:0.1672:0.742:0.0	.	181;211;212	Q9BZC7;E7EU84;E7ETC3	ABCA2_HUMAN;.;.	V	182;181;212;182	ENSP00000265662:A182V;ENSP00000360666:A181V;ENSP00000344155:A182V	ENSP00000265662:A182V	A	-	2	0	ABCA2	139036646	0.412000	0.25392	0.127000	0.21898	0.004000	0.04260	1.082000	0.30803	0.829000	0.34733	-0.436000	0.05848	GCC	ABCA2	-	NULL		0.652	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		G	NM_001606		139916825	-1	no_errors	ENST00000265662	ensembl	human	known	70_37	missense	SNP	0.027	A
ACRBP	84519	genome.wustl.edu	37	12	6754443	6754443	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:6754443C>G	ENST00000229243.2	-	4	511	c.418G>C	c.(418-420)Gct>Cct	p.A140P	ACRBP_ENST00000536350.1_Missense_Mutation_p.A140P|ACRBP_ENST00000414226.2_Missense_Mutation_p.A140P|ACRBP_ENST00000542357.1_5'Flank	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						TCAGCTGAAGCTTCTATCTCC	0.537																																																	0													157.0	153.0	154.0					12																	6754443		2203	4300	6503	SO:0001583	missense	84519			AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.418G>C	12.37:g.6754443C>G	ENSP00000229243:p.Ala140Pro	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Proacrosin-bd	p.A140P	ENST00000229243.2	37	c.418	CCDS8554.1	12	.	.	.	.	.	.	.	.	.	.	C	10.61	1.397548	0.25205	.	.	ENSG00000111644	ENST00000229243;ENST00000414226;ENST00000536350;ENST00000546114	T;T	0.47869	0.89;0.83	4.14	-8.28	0.01013	.	1.096420	0.07004	N	0.823883	T	0.27419	0.0673	N	0.14661	0.345	0.09310	N	1	B;B	0.30236	0.144;0.274	B;B	0.35931	0.114;0.214	T	0.47837	-0.9086	10	0.72032	D	0.01	-0.0223	6.1419	0.20265	0.1878:0.367:0.0:0.4452	.	140;140	E7EP66;Q8NEB7	.;ACRBP_HUMAN	P	140	ENSP00000229243:A140P;ENSP00000402725:A140P	ENSP00000229243:A140P	A	-	1	0	ACRBP	6624704	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.790000	0.01759	-2.061000	0.00892	-0.254000	0.11334	GCT	ACRBP	-	pfam_Proacrosin-bd		0.537	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACRBP	HGNC	protein_coding	OTTHUMT00000400703.1	C	NM_032489		6754443	-1	no_errors	ENST00000229243	ensembl	human	known	70_37	missense	SNP	0.000	G
ACTR6	64431	genome.wustl.edu	37	12	100598771	100598771	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:100598771C>A	ENST00000188312.2	+	2	887	c.122C>A	c.(121-123)aCt>aAt	p.T41N	ACTR6_ENST00000551617.1_5'UTR|ACTR6_ENST00000546902.1_5'UTR|ACTR6_ENST00000552376.1_Missense_Mutation_p.T41N|ACTR6_ENST00000550813.1_3'UTR	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	41						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						AAAACTTTTACTGCCAACCAG	0.333																																																	0													87.0	90.0	89.0					12																	100598771		2203	4300	6503	SO:0001583	missense	64431			AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.122C>A	12.37:g.100598771C>A	ENSP00000188312:p.Thr41Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like	p.T41N	ENST00000188312.2	37	c.122	CCDS9074.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.104319	0.94245	.	.	ENSG00000075089	ENST00000551652;ENST00000188312;ENST00000552376	D;D;D	0.94457	-3.43;-3.43;-3.43	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.95500	0.8538	L	0.42245	1.32	0.80722	D	1	D;D;D	0.58620	0.983;0.97;0.976	P;P;P	0.59115	0.852;0.559;0.686	D	0.95734	0.8777	10	0.87932	D	0	.	19.3813	0.94536	0.0:1.0:0.0:0.0	.	41;41;41	B4DLG9;F8W057;Q9GZN1	.;.;ARP6_HUMAN	N	53;41;41	ENSP00000448508:T53N;ENSP00000188312:T41N;ENSP00000447237:T41N	ENSP00000188312:T41N	T	+	2	0	ACTR6	99122902	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.565000	0.82337	2.798000	0.96311	0.655000	0.94253	ACT	ACTR6	-	pfam_Actin-like,smart_Actin-like		0.333	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR6	HGNC	protein_coding	OTTHUMT00000408159.1	C	NM_022496		100598771	+1	no_errors	ENST00000188312	ensembl	human	known	70_37	missense	SNP	1.000	A
ADAMTS12	81792	genome.wustl.edu	37	5	33576359	33576359	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr5:33576359C>G	ENST00000504830.1	-	19	4107	c.3772G>C	c.(3772-3774)Gaa>Caa	p.E1258Q	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.E1173Q	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1258	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CCTGAGGGTTCTGGCTGGTGG	0.517										HNSCC(64;0.19)																																							0													170.0	171.0	171.0					5																	33576359		2203	4300	6503	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3772G>C	5.37:g.33576359C>G	ENSP00000422554:p.Glu1258Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E1258Q	ENST00000504830.1	37	c.3772	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	0.215	-1.033500	0.02029	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58797	0.31;0.31	5.33	-1.81	0.07882	.	1.796830	0.02387	N	0.079301	T	0.36771	0.0979	N	0.14661	0.345	0.09310	N	1	B;B	0.27068	0.167;0.104	B;B	0.23716	0.048;0.013	T	0.14254	-1.0479	10	0.16420	T	0.52	.	6.848	0.23998	0.1139:0.4315:0.0:0.4545	.	1173;1258	P58397-3;P58397	.;ATS12_HUMAN	Q	1258;1173	ENSP00000422554:E1258Q;ENSP00000344847:E1173Q	ENSP00000344847:E1173Q	E	-	1	0	ADAMTS12	33612116	0.000000	0.05858	0.006000	0.13384	0.074000	0.17049	-1.421000	0.02455	-0.031000	0.13781	0.591000	0.81541	GAA	ADAMTS12	-	NULL		0.517	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	C	NM_030955		33576359	-1	no_errors	ENST00000504830	ensembl	human	known	70_37	missense	SNP	0.000	G
ADH1B	125	genome.wustl.edu	37	4	100239094	100239094	+	5'UTR	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:100239094C>T	ENST00000504498.1	-	0	421				ADH1B_ENST00000394887.3_Intron|ADH1B_ENST00000305046.8_Intron			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	CCTGGCTGCGCGGTGACCTTG	0.507																																																	0																																										SO:0001623	5_prime_UTR_variant	125			AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000504498.1:c.-273G>A	4.37:g.100239094C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	RNA	SNP	-	NULL	ENST00000504498.1	37	NULL		4																																																																																			ADH1B	-	-		0.507	ADH1B-006	PUTATIVE	basic	processed_transcript	ADH1B	HGNC	protein_coding	OTTHUMT00000364858.1	C	NM_000668		100239094	-1	no_errors	ENST00000504498	ensembl	human	putative	70_37	rna	SNP	0.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105408592	105408592	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr14:105408592G>A	ENST00000333244.5	-	7	13315	c.13196C>T	c.(13195-13197)cCc>cTc	p.P4399L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4399						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCTATCTGGGGACCCTTGAG	0.612																																																	0													85.0	91.0	89.0					14																	105408592		1922	4121	6043	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13196C>T	14.37:g.105408592G>A	ENSP00000353114:p.Pro4399Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P4399L	ENST00000333244.5	37	c.13196	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190633	0.38707	.	.	ENSG00000185567	ENST00000333244	T	0.03212	4.01	3.09	3.09	0.35607	.	0.522324	0.12970	U	0.424205	T	0.23572	0.0570	M	0.89601	3.045	0.41548	D	0.988559	D	0.89917	1.0	D	0.87578	0.998	T	0.14364	-1.0475	10	0.66056	D	0.02	.	14.6623	0.68882	0.0:0.0:1.0:0.0	.	4399	Q8IVF2	AHNK2_HUMAN	L	4399	ENSP00000353114:P4399L	ENSP00000353114:P4399L	P	-	2	0	AHNAK2	104479637	0.988000	0.35896	0.033000	0.17914	0.021000	0.10359	3.836000	0.55813	1.474000	0.48178	0.290000	0.19541	CCC	AHNAK2	-	NULL		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	G	NM_138420		105408592	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	missense	SNP	0.756	A
AK9	221264	genome.wustl.edu	37	6	109835543	109835543	+	Missense_Mutation	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:109835543T>C	ENST00000424296.2	-	32	4239	c.4163A>G	c.(4162-4164)gAa>gGa	p.E1388G		NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1388					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TTCTTTTGTTTCTTTACTAGA	0.358																																																	0													151.0	132.0	138.0					6																	109835543		692	1591	2283	SO:0001583	missense	221264			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.4163A>G	6.37:g.109835543T>C	ENSP00000410186:p.Glu1388Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.E1388G	ENST00000424296.2	37	c.4163	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.75|14.75	2.628733|2.628733	0.46944|0.46944	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000424296|ENST00000470564	T|.	0.68765|.	-0.35|.	5.28|5.28	-0.893|-0.893	0.10567|0.10567	.|.	.|.	.|.	.|.	.|.	T|T	0.34250|0.34250	0.0891|0.0891	L|L	0.52011|0.52011	1.625|1.625	0.80722|0.80722	D|D	1|1	B|.	0.12630|.	0.006|.	B|.	0.10450|.	0.005|.	T|T	0.34304|0.34304	-0.9834|-0.9834	8|5	.|.	.|.	.|.	.|.	3.1514|3.1514	0.06489|0.06489	0.12:0.1395:0.1102:0.6302|0.12:0.1395:0.1102:0.6302	.|.	1388|.	Q5TCS8|.	AKD1_HUMAN|.	G|E	1388|226	ENSP00000410186:E1388G|.	.|.	E|K	-|-	2|1	0|0	AKD1|AKD1	109942236|109942236	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.703000|0.703000	0.40648|0.40648	2.254000|2.254000	0.43214|0.43214	0.021000|0.021000	0.15133|0.15133	0.528000|0.528000	0.53228|0.53228	GAA|AAA	AKD1	-	NULL		0.358	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		T	NM_001145128		109835543	-1	no_errors	ENST00000424296	ensembl	human	known	70_37	missense	SNP	0.983	C
NDUFS8	4728	genome.wustl.edu	37	11	67795656	67795656	+	5'Flank	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:67795656C>G	ENST00000313468.5	+	0	0				ALDH3B1_ENST00000539229.1_3'UTR|RP5-901A4.1_ENST00000532296.1_RNA|ALDH3B1_ENST00000342456.6_3'UTR|NDUFS8_ENST00000528492.1_5'Flank|ALDH3B1_ENST00000007633.8_3'UTR|ALDH3B1_ENST00000434449.1_3'UTR	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|lung(5)|skin(1)	8						CACCCCCTGCCCCCGCACCAA	0.647																																					Colon(116;1205 2770 20054)												0													5.0	6.0	6.0					11																	67795656		858	1960	2818	SO:0001631	upstream_gene_variant	221			U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331		11.37:g.67795656C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB86|Q0VDA8	RNA	SNP	-	NULL	ENST00000313468.5	37	NULL	CCDS8176.1	11																																																																																			ALDH3B1	-	-		0.647	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH3B1	HGNC	protein_coding	OTTHUMT00000394193.1	C	NM_002496		67795656	+1	no_errors	ENST00000007633	ensembl	human	known	70_37	rna	SNP	0.000	G
ALS2	57679	genome.wustl.edu	37	2	202625678	202625678	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:202625678C>T	ENST00000264276.6	-	4	1411	c.1039G>A	c.(1039-1041)Gaa>Aaa	p.E347K	ALS2_ENST00000467448.1_Missense_Mutation_p.E347K|ALS2_ENST00000496244.1_5'Flank	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	347					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CGTAGGTATTCATTGACTGCT	0.428																																																	0													157.0	147.0	150.0					2																	202625678		2018	4179	6197	SO:0001583	missense	57679			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1039G>A	2.37:g.202625678C>T	ENSP00000264276:p.Glu347Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_DH-domain,smart_MORN,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain,prints_Reg_chr_condens	p.E347K	ENST00000264276.6	37	c.1039	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294902	0.60086	.	.	ENSG00000003393	ENST00000264276;ENST00000467448	T;T	0.58210	0.46;0.35	6.06	6.06	0.98353	.	0.380726	0.29715	N	0.011397	T	0.47002	0.1422	L	0.50333	1.59	0.80722	D	1	P;B;B;B	0.42296	0.775;0.167;0.025;0.025	B;B;B;B	0.38428	0.273;0.124;0.024;0.015	T	0.36065	-0.9763	10	0.24483	T	0.36	.	15.1762	0.72913	0.0:0.8599:0.1401:0.0	.	347;347;347;347	Q96Q42-2;Q96Q42-3;Q6IQ41;Q96Q42	.;.;.;ALS2_HUMAN	K	347	ENSP00000264276:E347K;ENSP00000429223:E347K	ENSP00000264276:E347K	E	-	1	0	ALS2	202333923	1.000000	0.71417	0.091000	0.20842	0.122000	0.20287	4.524000	0.60552	2.876000	0.98609	0.655000	0.94253	GAA	ALS2	-	NULL		0.428	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	C	NM_020919		202625678	-1	no_errors	ENST00000264276	ensembl	human	known	70_37	missense	SNP	0.788	T
ANAPC16	119504	genome.wustl.edu	37	10	73989994	73989994	+	Intron	SNP	C	C	T	rs374464766		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:73989994C>T	ENST00000299381.4	+	3	260				ANAPC16_ENST00000470481.2_Intron	NM_001242546.1|NM_001242547.1|NM_001242548.1|NM_173473.3	NP_001229475.1|NP_001229476.1|NP_001229477.1|NP_775744.1	Q96DE5	APC16_HUMAN	anaphase promoting complex subunit 16						mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	anaphase-promoting complex (GO:0005680)|cytoplasm (GO:0005737)				large_intestine(1)|ovary(1)	2						AAGCAGAACCCGTCTTTGTAA	0.328																																																	0																																										SO:0001627	intron_variant	119504			BC009530	CCDS7314.1, CCDS73147.1	10q22.2	2011-08-12	2010-04-06	2010-04-06	ENSG00000166295	ENSG00000166295		"""Anaphase promoting complex subunits"""	26976	protein-coding gene	gene with protein product	"""centromere protein 27"""	613427	"""chromosome 10 open reading frame 104"""	C10orf104		14702039, 20360068	Standard	NM_001242546		Approved	bA570G20.3, FLJ33728, APC16, CENP-27	uc021psp.1	Q96DE5	OTTHUMG00000018433	ENST00000299381.4:c.143-130C>T	10.37:g.73989994C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000299381.4	37	NULL	CCDS7314.1	10																																																																																			ANAPC16	-	-		0.328	ANAPC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC16	HGNC	protein_coding	OTTHUMT00000048565.2	C	NM_173473		73989994	+1	no_errors	ENST00000496924	ensembl	human	known	70_37	rna	SNP	0.002	T
ANGPT2	285	genome.wustl.edu	37	8	6360664	6360664	+	Silent	SNP	C	C	T	rs556882297		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr8:6360664C>T	ENST00000325203.5	-	9	1923	c.1449G>A	c.(1447-1449)tcG>tcA	p.S483S	MCPH1_ENST00000344683.5_Intron|ANGPT2_ENST00000415216.1_Silent_p.S482S|ANGPT2_ENST00000338312.6_Silent_p.S431S			O15123	ANGP2_HUMAN	angiopoietin 2	483	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		TGGCCTTGAGCGAATAGCCTG	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		23538	0.001		0.0	False		,,,				2504	0.0																0													259.0	210.0	227.0					8																	6360664		2203	4300	6503	SO:0001819	synonymous_variant	285			AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.1449G>A	8.37:g.6360664C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.S483	ENST00000325203.5	37	c.1449	CCDS5958.1	8																																																																																			ANGPT2	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C		0.458	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANGPT2	HGNC	protein_coding	OTTHUMT00000206737.1	C	NM_001147		6360664	-1	no_errors	ENST00000325203	ensembl	human	known	70_37	silent	SNP	0.987	T
ARL16	339231	genome.wustl.edu	37	17	79650079	79650079	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr17:79650079G>C	ENST00000397498.4	-	3	368	c.270C>G	c.(268-270)atC>atG	p.I90M	ARL16_ENST00000570561.1_Missense_Mutation_p.I4M|ARL16_ENST00000573392.1_Intron|HGS_ENST00000329138.4_5'Flank|ARL16_ENST00000574938.1_Intron|ARL16_ENST00000576135.1_Missense_Mutation_p.I4M	NM_001040025.1	NP_001035114.1	Q0P5N6	ARL16_HUMAN	ADP-ribosylation factor-like 16	90					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|lung(4)|skin(1)	7	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AACTGGACCAGATGGGGCCCA	0.507																																																	0													143.0	154.0	151.0					17																	79650079		1919	4118	6037	SO:0001583	missense	339231				CCDS45813.1	17q25.3	2014-05-09				ENSG00000214087		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	27902	protein-coding gene	gene with protein product						12477932	Standard	NM_001040025		Approved		uc002kbf.3	Q0P5N6		ENST00000397498.4:c.270C>G	17.37:g.79650079G>C	ENSP00000380635:p.Ile90Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	p.I90M	ENST00000397498.4	37	c.270	CCDS45813.1	17	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340607	0.60963	.	.	ENSG00000214087	ENST00000397498	T	0.63744	-0.06	4.91	2.92	0.33932	.	0.000000	0.85682	U	0.000000	T	0.67813	0.2933	L	0.40543	1.245	0.42947	D	0.994362	D	0.89917	1.0	D	0.83275	0.996	T	0.67201	-0.5730	10	0.87932	D	0	-13.5632	8.186	0.31339	0.188:0.0:0.812:0.0	.	90	Q0P5N6	ARL16_HUMAN	M	90	ENSP00000380635:I90M	ENSP00000380635:I90M	I	-	3	3	ARL16	77260484	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.759000	0.55227	0.477000	0.27464	0.563000	0.77884	ATC	ARL16	-	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1		0.507	ARL16-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ARL16	HGNC	protein_coding	OTTHUMT00000440514.1	G	XM_290777		79650079	-1	no_errors	ENST00000397498	ensembl	human	known	70_37	missense	SNP	1.000	C
ART4	420	genome.wustl.edu	37	12	14993782	14993782	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:14993782A>T	ENST00000228936.4	-	2	831	c.450T>A	c.(448-450)taT>taA	p.Y150*	RP11-233G1.4_ENST00000444324.2_RNA|C12orf60_ENST00000527783.1_Intron	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	150					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						ATGAACGTTCATACTGCTGTG	0.448																																																	0													137.0	134.0	135.0					12																	14993782		2203	4300	6503	SO:0001587	stop_gained	420			X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.450T>A	12.37:g.14993782A>T	ENSP00000228936:p.Tyr150*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BZ50|Q9BZ51|Q9HB06	Nonsense_Mutation	SNP	pfam_ART,prints_ART	p.Y150*	ENST00000228936.4	37	c.450	CCDS8668.1	12	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071530	0.36566	.	.	ENSG00000111339	ENST00000228936;ENST00000420600	.	.	.	4.35	-0.833	0.10782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6094	8.6506	0.34033	0.5546:0.0:0.4454:0.0	.	.	.	.	X	150;133	.	ENSP00000228936:Y150X	Y	-	3	2	ART4	14885049	0.339000	0.24784	0.068000	0.19968	0.412000	0.31113	0.658000	0.24979	-0.125000	0.11703	-0.400000	0.06385	TAT	ART4	-	pfam_ART		0.448	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART4	HGNC	protein_coding	OTTHUMT00000400859.1	A	NM_021071		14993782	-1	no_errors	ENST00000228936	ensembl	human	known	70_37	nonsense	SNP	0.095	T
BAALC	79870	genome.wustl.edu	37	8	104195600	104195600	+	Intron	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr8:104195600T>C	ENST00000297574.6	+	2	299				BAALC_ENST00000306391.6_Missense_Mutation_p.Y56H|BAALC_ENST00000330955.5_Intron|RP11-318M2.2_ENST00000499522.2_RNA|BAALC_ENST00000309982.5_Intron|BAALC_ENST00000438105.2_Intron			Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic							cytoplasm (GO:0005737)|membrane (GO:0016020)				kidney(1)|large_intestine(3)|lung(3)	7			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			ATTAGCCCATTACCCTCTTGC	0.473																																																	0																																										SO:0001627	intron_variant	79870			AF363578	CCDS6297.1, CCDS47906.1	8q22.3	2008-07-29			ENSG00000164929	ENSG00000164929			14333	protein-coding gene	gene with protein product		606602				11707601	Standard	NM_024812		Approved		uc003yld.3	Q8WXS3	OTTHUMG00000164782	ENST00000297574.6:c.161-17286T>C	8.37:g.104195600T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WTP6|Q8WXS0|Q8WXS1|Q8WXS2|Q9HA93	Missense_Mutation	SNP	pfam_BAALC	p.Y56H	ENST00000297574.6	37	c.166		8	.	.	.	.	.	.	.	.	.	.	T	5.346	0.249077	0.10130	.	.	ENSG00000164929	ENST00000306391	.	.	.	0.8	0.8	0.18672	.	.	.	.	.	T	0.36552	0.0971	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	T	0.37126	-0.9719	5	0.87932	D	0	.	3.8629	0.09004	0.0:0.0:0.0:1.0	.	.	.	.	H	56	.	ENSP00000302559:Y56H	Y	+	1	0	BAALC	104264776	0.034000	0.19679	0.153000	0.22517	0.368000	0.29767	0.806000	0.27126	0.585000	0.29608	0.379000	0.24179	TAC	BAALC	-	NULL		0.473	BAALC-003	KNOWN	basic	protein_coding	BAALC	HGNC	protein_coding	OTTHUMT00000380257.1	T			104195600	+1	no_errors	ENST00000306391	ensembl	human	putative	70_37	missense	SNP	0.240	C
BAI3	577	genome.wustl.edu	37	6	69349167	69349167	+	Missense_Mutation	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:69349167G>T	ENST00000370598.1	+	3	1421	c.600G>T	c.(598-600)caG>caT	p.Q200H		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	200					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCTGCCCTCAGCATTTGGGAG	0.478																																																	0													66.0	65.0	65.0					6																	69349167		2203	4300	6503	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.600G>T	6.37:g.69349167G>T	ENSP00000359630:p.Gln200His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.Q200H	ENST00000370598.1	37	c.600	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690898	0.68271	.	.	ENSG00000135298	ENST00000370598	T	0.21734	1.99	5.12	4.25	0.50352	.	0.000000	0.64402	D	0.000004	T	0.21186	0.0510	L	0.40543	1.245	0.80722	D	1	D	0.57571	0.98	D	0.66979	0.948	T	0.02326	-1.1176	10	0.66056	D	0.02	.	8.5241	0.33293	0.2346:0.0:0.7654:0.0	.	200	O60242	BAI3_HUMAN	H	200	ENSP00000359630:Q200H	ENSP00000359630:Q200H	Q	+	3	2	BAI3	69405888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.619000	0.61218	1.284000	0.44531	0.655000	0.94253	CAG	BAI3	-	NULL		0.478	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	G			69349167	+1	no_errors	ENST00000370598	ensembl	human	known	70_37	missense	SNP	1.000	T
N4BP2L1	90634	genome.wustl.edu	37	13	32972342	32972342	+	IGR	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr13:32972342C>A	ENST00000380130.2	-	0	3046				BRCA2_ENST00000544455.1_Nonsense_Mutation_p.S3231*|BRCA2_ENST00000380152.3_Nonsense_Mutation_p.S3231*	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		AGTCCTTTATCACTTTGTATG	0.343																																																	0													108.0	117.0	114.0					13																	32972342		2203	4300	6503	SO:0001628	intergenic_variant	675			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972342C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4QN21|Q5TBK0	Nonsense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_BRCA2,pfscan_BRCA2_repeat	p.S3231*	ENST00000380130.2	37	c.9692	CCDS9345.2	13	.	.	.	.	.	.	.	.	.	.	C	49	15.119792	0.99823	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	4.21	3.36	0.38483	.	1.027250	0.07723	N	0.943961	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0414	0.47833	0.0:0.9116:0.0:0.0884	.	.	.	.	X	3231	.	ENSP00000369497:S3231X	S	+	2	0	BRCA2	31870342	0.356000	0.24930	0.212000	0.23672	0.014000	0.08584	2.110000	0.41873	1.346000	0.45694	0.591000	0.81541	TCA	BRCA2	-	pirsf_BRCA2		0.343	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding		C	NM_052818		32972342	+1	no_errors	ENST00000380152	ensembl	human	known	70_37	nonsense	SNP	0.338	A
C10orf54	64115	genome.wustl.edu	37	10	73520432	73520432	+	Intron	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:73520432T>C	ENST00000394957.3	-	3	627				C10orf54_ENST00000481568.2_5'UTR|CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54						BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CCAGAGCAGATGGAAGGAGAG	0.597																																																	0																																										SO:0001627	intron_variant	64115			AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.568+192A>G	10.37:g.73520432T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	RNA	SNP	-	NULL	ENST00000394957.3	37	NULL	CCDS31218.1	10																																																																																			C10orf54	-	-		0.597	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf54	HGNC	protein_coding	OTTHUMT00000048548.1	T	NM_022153		73520432	-1	no_errors	ENST00000481568	ensembl	human	known	70_37	rna	SNP	0.001	C
DDIAS	220042	genome.wustl.edu	37	11	82644096	82644096	+	Silent	SNP	A	A	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:82644096A>C	ENST00000533655.1	+	6	1928	c.1716A>C	c.(1714-1716)ctA>ctC	p.L572L	C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000329143.3_Silent_p.L271L|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Silent_p.L572L	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		572					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						ATTCTAGTCTAAATAACAAAT	0.338																																																	0													45.0	47.0	46.0					11																	82644096		2203	4299	6502	SO:0001819	synonymous_variant	220042																														ENST00000533655.1:c.1716A>C	11.37:g.82644096A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LK6|Q9H856	Silent	SNP	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold-like	p.L572	ENST00000533655.1	37	c.1716	CCDS8263.1	11																																																																																			C11orf82	-	NULL		0.338	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf82	HGNC	protein_coding	OTTHUMT00000391936.1	A			82644096	+1	no_errors	ENST00000430323	ensembl	human	known	70_37	silent	SNP	0.001	C
MISP	126353	genome.wustl.edu	37	19	759915	759915	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:759915C>A	ENST00000215582.6	+	3	1890	c.1787C>A	c.(1786-1788)aCg>aAg	p.T596K		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	596					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											ACAGGCATCACGGGCAGTTAC	0.557																																																	0													102.0	87.0	92.0					19																	759915		2203	4300	6503	SO:0001583	missense	126353			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1787C>A	19.37:g.759915C>A	ENSP00000215582:p.Thr596Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.T596K	ENST00000215582.6	37	c.1787	CCDS12042.1	19	.	.	.	.	.	.	.	.	.	.	C	11.15	1.554177	0.27739	.	.	ENSG00000099812	ENST00000215582	T	0.33865	1.39	4.68	0.858	0.19030	.	0.427648	0.22438	N	0.060044	T	0.45397	0.1340	L	0.60455	1.87	0.28395	N	0.918888	D	0.69078	0.997	D	0.64595	0.927	T	0.29941	-0.9995	10	0.72032	D	0.01	-15.9993	4.2234	0.10568	0.0:0.5816:0.1862:0.2322	.	596	Q8IVT2	CS021_HUMAN	K	596	ENSP00000215582:T596K	ENSP00000215582:T596K	T	+	2	0	C19orf21	710915	0.000000	0.05858	0.540000	0.28089	0.076000	0.17211	-0.412000	0.07132	0.440000	0.26502	-0.367000	0.07326	ACG	C19orf21	-	NULL		0.557	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf21	HGNC	protein_coding	OTTHUMT00000457600.2	C	NM_173481		759915	+1	no_errors	ENST00000215582	ensembl	human	known	70_37	missense	SNP	0.397	A
CACNA1C	775	genome.wustl.edu	37	12	2690795	2690795	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:2690795G>A	ENST00000347598.4	+	14	1935	c.1935G>A	c.(1933-1935)ctG>ctA	p.L645L	CACNA1C_ENST00000399634.1_Silent_p.L645L|CACNA1C_ENST00000399601.1_Silent_p.L645L|CACNA1C_ENST00000399621.1_Silent_p.L645L|CACNA1C_ENST00000399638.1_Silent_p.L645L|CACNA1C_ENST00000344100.3_Silent_p.L645L|CACNA1C_ENST00000399644.1_Silent_p.L645L|CACNA1C_ENST00000399629.1_Silent_p.L645L|CACNA1C_ENST00000399617.1_Silent_p.L645L|CACNA1C_ENST00000406454.3_Silent_p.L645L|CACNA1C_ENST00000399655.1_Silent_p.L645L|CACNA1C_ENST00000399641.1_Silent_p.L645L|CACNA1C_ENST00000399637.1_Silent_p.L645L|CACNA1C_ENST00000399591.1_Silent_p.L645L|CACNA1C_ENST00000402845.3_Silent_p.L645L|CACNA1C_ENST00000399595.1_Silent_p.L645L|CACNA1C_ENST00000399649.1_Silent_p.L645L|CACNA1C_ENST00000399603.1_Silent_p.L645L|CACNA1C_ENST00000399597.1_Silent_p.L645L|CACNA1C_ENST00000335762.5_Silent_p.L670L|CACNA1C_ENST00000480911.1_Silent_p.L645L|CACNA1C_ENST00000327702.7_Silent_p.L645L|CACNA1C_ENST00000399606.1_Silent_p.L645L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	645					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CATCCTTGCTGAACTCTGTGC	0.567																																																	0													108.0	112.0	111.0					12																	2690795		2202	4296	6498	SO:0001819	synonymous_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1935G>A	12.37:g.2690795G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L645	ENST00000347598.4	37	c.1935	CCDS44788.1	12																																																																																			CACNA1C	-	pfam_Ion_trans_dom		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	G	NM_000719		2690795	+1	no_errors	ENST00000399634	ensembl	human	known	70_37	silent	SNP	1.000	A
CASD1	64921	genome.wustl.edu	37	7	94167172	94167172	+	Missense_Mutation	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:94167172T>C	ENST00000297273.4	+	9	1519	c.1232T>C	c.(1231-1233)gTt>gCt	p.V411A		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	411						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TACATTTTGGTTTTGGGAGTA	0.294																																																	0													42.0	48.0	46.0					7																	94167172		2199	4295	6494	SO:0001583	missense	64921			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1232T>C	7.37:g.94167172T>C	ENSP00000297273:p.Val411Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.V411A	ENST00000297273.4	37	c.1232	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	T	8.353	0.831428	0.16820	.	.	ENSG00000127995	ENST00000297273	T	0.47528	0.84	5.51	3.04	0.35103	.	0.060781	0.64402	D	0.000005	T	0.37019	0.0988	L	0.31804	0.96	0.52099	D	0.999945	P;P	0.41710	0.76;0.76	P;P	0.45538	0.484;0.484	T	0.07693	-1.0759	10	0.07030	T	0.85	.	12.7134	0.57102	0.0:0.0:0.2317:0.7683	.	411;411	Q8WZ77;Q96PB1	.;CASD1_HUMAN	A	411	ENSP00000297273:V411A	ENSP00000297273:V411A	V	+	2	0	CASD1	94005108	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.838000	0.86804	0.431000	0.26258	0.477000	0.44152	GTT	CASD1	-	pfam_Cas1_AcylTrans_dom		0.294	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1	T	NM_022900		94167172	+1	no_errors	ENST00000297273	ensembl	human	known	70_37	missense	SNP	1.000	C
CEL	1056	genome.wustl.edu	37	9	135942276	135942276	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr9:135942276G>A	ENST00000372080.4	+	6	746	c.730G>A	c.(730-732)Ggc>Agc	p.G244S	CEL_ENST00000351304.7_Missense_Mutation_p.G241S	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	241					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CAGCCAGAGCGGCGTGGCCCT	0.647																																																	0													25.0	29.0	28.0					9																	135942276		1956	4141	6097	SO:0001583	missense	1056			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.730G>A	9.37:g.135942276G>A	ENSP00000361151:p.Gly244Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.G244S	ENST00000372080.4	37	c.730	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.295682	0.95574	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	D;D	0.82255	-1.59;-1.59	5.16	5.16	0.70880	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.91707	0.7378	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92911	0.6347	10	0.87932	D	0	.	17.2362	0.86999	0.0:0.0:1.0:0.0	.	241	P19835	CEL_HUMAN	S	244;241;244	ENSP00000361151:G244S;ENSP00000342217:G241S	ENSP00000304021:G244S	G	+	1	0	CEL	134932097	1.000000	0.71417	0.646000	0.29493	0.990000	0.78478	8.953000	0.93041	2.413000	0.81919	0.549000	0.68633	GGC	CEL	-	pfam_CarbesteraseB		0.647	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	G			135942276	+1	no_errors	ENST00000372080	ensembl	human	known	70_37	missense	SNP	0.998	A
CELF4	56853	genome.wustl.edu	37	18	34839128	34839128	+	Intron	SNP	G	G	C	rs199661532		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr18:34839128G>C	ENST00000591282.1	-	11	1333				CELF4_ENST00000601019.1_Intron|CELF4_ENST00000603232.1_Intron|CELF4_ENST00000591287.1_Intron|CELF4_ENST00000412753.1_Intron|CELF4_ENST00000361795.5_Intron|CELF4_ENST00000334919.5_Intron|CELF4_ENST00000588597.1_Missense_Mutation_p.S438W|CELF4_ENST00000420428.2_Intron			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4						alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						AAACACTTTCGAGGAGATGAC	0.522																																																	0													68.0	57.0	61.0					18																	34839128		2203	4300	6503	SO:0001627	intron_variant	56853			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.1333+15C>G	18.37:g.34839128G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S438W	ENST00000591282.1	37	c.1313	CCDS32818.1	18																																																																																			CELF4	-	pfam_RRM_dom		0.522	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF4	HGNC	protein_coding	OTTHUMT00000440892.1	G	NM_020180		34839128	-1	no_errors	ENST00000588597	ensembl	human	novel	70_37	missense	SNP	1.000	C
CFDP1	10428	genome.wustl.edu	37	16	75327731	75327732	+	3'UTR	INS	-	-	A	rs149574560		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr16:75327731_75327732insA	ENST00000283882.3	-	0	1150_1151					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CTTCAATGTAGAAAAAAAAAAG	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	10428			AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*119->T	16.37:g.75327741_75327741dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	RNA	INS	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																			CFDP1	-	-		0.307	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	HGNC	protein_coding	OTTHUMT00000269031.2	-	NM_006324		75327732	-1	no_errors	ENST00000570103	ensembl	human	known	70_37	rna	INS	0.904:0.940	A
CHN2	1124	genome.wustl.edu	37	7	29438060	29438060	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:29438060G>C	ENST00000222792.6	+	5	778	c.248G>C	c.(247-249)aGa>aCa	p.R83T	CHN2_ENST00000435288.2_Missense_Mutation_p.R83T|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000546235.1_Missense_Mutation_p.R68T|CHN2_ENST00000539406.1_Missense_Mutation_p.R158T|CHN2_ENST00000495789.2_Missense_Mutation_p.R96T	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	83	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						TACATCCTTAGAGAAAGCCAG	0.517																																					Ovarian(1;44 48 13232 18918 31480)												0													143.0	119.0	127.0					7																	29438060		2203	4300	6503	SO:0001583	missense	1124			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.248G>C	7.37:g.29438060G>C	ENSP00000222792:p.Arg83Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.R158T	ENST00000222792.6	37	c.473	CCDS5420.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.188398	0.94923	.	.	ENSG00000106069	ENST00000439384;ENST00000539406;ENST00000222792;ENST00000435288;ENST00000409350;ENST00000495789;ENST00000546235	D;D;D;D;D;D;D	0.99287	-5.69;-5.69;-5.69;-5.69;-5.69;-5.69;-5.69	5.44	5.44	0.79542	SH2 motif (4);	0.100359	0.64402	D	0.000003	D	0.99729	0.9894	H	0.99011	4.4	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.985;0.996;0.991;0.985	D;D;D;D;D	0.97110	1.0;0.977;0.99;0.987;0.977	D	0.97078	0.9782	10	0.87932	D	0	.	18.8374	0.92168	0.0:0.0:1.0:0.0	.	68;96;158;83;83	B7Z1W9;B7Z1V0;F5H003;A4D1A2;P52757	.;.;.;.;CHIO_HUMAN	T	158;158;83;83;96;96;68	ENSP00000409843:R158T;ENSP00000444063:R158T;ENSP00000222792:R83T;ENSP00000400282:R83T;ENSP00000386968:R96T;ENSP00000438587:R96T;ENSP00000442812:R68T	ENSP00000222792:R83T	R	+	2	0	CHN2	29404585	1.000000	0.71417	0.966000	0.40874	0.983000	0.72400	9.169000	0.94788	2.553000	0.86117	0.467000	0.42956	AGA	CHN2	-	pfam_SH2,smart_SH2,pfscan_SH2		0.517	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHN2	HGNC	protein_coding	OTTHUMT00000214228.2	G	NM_004067		29438060	+1	no_errors	ENST00000539406	ensembl	human	known	70_37	missense	SNP	1.000	C
COMTD1	118881	genome.wustl.edu	37	10	76994715	76994715	+	Silent	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:76994715C>T	ENST00000372538.3	-	5	565	c.483G>A	c.(481-483)aaG>aaA	p.K161K	COMTD1_ENST00000460899.1_5'UTR	NM_144589.2	NP_653190.2	Q86VU5	CMTD1_HUMAN	catechol-O-methyltransferase domain containing 1	161						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	O-methyltransferase activity (GO:0008171)			central_nervous_system(1)|large_intestine(1)|lung(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)					CCAAGGCGGGCTTCAGCCGGA	0.687																																					Colon(106;1192 2596 47278)												0													15.0	11.0	12.0					10																	76994715		1982	3834	5816	SO:0001819	synonymous_variant	118881				CCDS7349.1	10q22.2	2013-09-20			ENSG00000165644	ENSG00000165644			26309	protein-coding gene	gene with protein product						12975309	Standard	NM_144589		Approved	FLJ23841	uc001jxb.3	Q86VU5	OTTHUMG00000018518	ENST00000372538.3:c.483G>A	10.37:g.76994715C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TE79	Silent	SNP	pfam_O-MeTrfase_3	p.K161	ENST00000372538.3	37	c.483	CCDS7349.1	10	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518789	0.27211	.	.	ENSG00000165644	ENST00000536650	.	.	.	4.62	2.75	0.32379	.	.	.	.	.	T	0.62490	0.2432	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61004	-0.7150	5	0.56958	D	0.05	-21.0696	8.5924	0.33695	0.0:0.8163:0.0:0.1837	.	.	.	.	T	150	.	ENSP00000444168:A150T	A	-	1	0	COMTD1	76664721	0.989000	0.36119	0.997000	0.53966	0.924000	0.55760	1.050000	0.30404	0.553000	0.29044	-0.300000	0.09419	GCC	COMTD1	-	pfam_O-MeTrfase_3		0.687	COMTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMTD1	HGNC	protein_coding	OTTHUMT00000048802.1	C	NM_144589		76994715	-1	no_errors	ENST00000372538	ensembl	human	known	70_37	silent	SNP	0.995	T
CPT1A	1374	genome.wustl.edu	37	11	68529068	68529068	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:68529068G>A	ENST00000265641.5	-	16	2117	c.1963C>T	c.(1963-1965)Cgt>Tgt	p.R655C	CPT1A_ENST00000376618.2_Missense_Mutation_p.R655C|CPT1A_ENST00000540367.1_Missense_Mutation_p.R655C|CPT1A_ENST00000537756.2_5'Flank|CPT1A_ENST00000539743.1_Missense_Mutation_p.R655C	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	655					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	AAGAGGTGACGATCGATCCCA	0.488																																																	0													252.0	236.0	241.0					11																	68529068		2200	4294	6494	SO:0001583	missense	1374			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1963C>T	11.37:g.68529068G>A	ENSP00000265641:p.Arg655Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.R655C	ENST00000265641.5	37	c.1963	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158091	0.78114	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	5.65	5.65	0.86999	.	0.057824	0.64402	D	0.000001	D	0.97729	0.9255	H	0.96805	3.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98196	1.0465	10	0.66056	D	0.02	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	655;655	P50416;P50416-2	CPT1A_HUMAN;.	C	655	ENSP00000439084:R655C;ENSP00000365803:R655C;ENSP00000265641:R655C;ENSP00000446108:R655C	ENSP00000265641:R655C	R	-	1	0	CPT1A	68285644	1.000000	0.71417	0.996000	0.52242	0.233000	0.25261	9.463000	0.97652	2.824000	0.97209	0.655000	0.94253	CGT	CPT1A	-	pfam_Carn_acyl_trans		0.488	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	G	NM_001876		68529068	-1	no_errors	ENST00000265641	ensembl	human	known	70_37	missense	SNP	1.000	A
CREB1	1385	genome.wustl.edu	37	2	208434952	208434952	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:208434952G>C	ENST00000432329.2	+	6	705	c.454G>C	c.(454-456)Gaa>Caa	p.E152Q	CREB1_ENST00000374397.4_Missense_Mutation_p.E152Q|CREB1_ENST00000430624.1_Missense_Mutation_p.E138Q|CREB1_ENST00000353267.3_Missense_Mutation_p.E138Q|CREB1_ENST00000536726.1_Missense_Mutation_p.E138Q|CREB1_ENST00000539789.1_Missense_Mutation_p.E112Q	NM_134442.3	NP_604391.1	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1	152	KID. {ECO:0000255|PROSITE- ProRule:PRU00312}.				activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|cellular response to zinc ion (GO:0071294)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|lactation (GO:0007595)|lung saccule development (GO:0060430)|memory (GO:0007613)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription by competitive promoter binding (GO:0010944)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of cell size (GO:0008361)|response to drug (GO:0042493)|response to glucagon (GO:0033762)|response to organic substance (GO:0010033)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|Type I pneumocyte differentiation (GO:0060509)|viral process (GO:0016032)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding (GO:0035497)|enzyme binding (GO:0019899)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		EWSR1/CREB1(44)	NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|upper_aerodigestive_tract(1)	5				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Naloxone(DB01183)	GCCAAGGATTGAAGAAGAGAA	0.378			T	EWSR1	"""clear cell sarcoma, angiomatoid fibrous histiocytoma"""																																			Dom	yes		2	2q34	1385	cAMP responsive element binding protein 1		M	0													102.0	103.0	102.0					2																	208434952		2203	4300	6503	SO:0001583	missense	1385			M27691	CCDS2374.1, CCDS2375.1	2q34	2013-01-10			ENSG00000118260	ENSG00000118260		"""basic leucine zipper proteins"""	2345	protein-coding gene	gene with protein product		123810					Standard	NM_134442		Approved		uc002vcc.3	P16220	OTTHUMG00000132936	ENST00000432329.2:c.454G>C	2.37:g.208434952G>C	ENSP00000387699:p.Glu152Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	P21934|Q6V963|Q9UMA7	Missense_Mutation	SNP	pfam_Coactivator_CBP_pKID,pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_Coactivator_CBP_pKID,pfscan_bZIP,prints_Leuzip_CREB	p.E152Q	ENST00000432329.2	37	c.454	CCDS2375.1	2	.	.	.	.	.	.	.	.	.	.	G	30	5.052125	0.93793	.	.	ENSG00000118260	ENST00000430624;ENST00000432329;ENST00000353267;ENST00000445803;ENST00000421139;ENST00000536726;ENST00000374397;ENST00000539789;ENST00000448277;ENST00000457101	T;T;T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.86	5.86	0.93980	Coactivator CBP, pKID (2);	0.000000	0.85682	D	0.000000	D	0.88265	0.6390	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.87578	0.988;0.939;0.998	D	0.87671	0.2541	10	0.56958	D	0.05	-19.5613	20.1823	0.98208	0.0:0.0:1.0:0.0	.	138;138;152	F5H0V3;Q53X93;P16220	.;.;CREB1_HUMAN	Q	138;152;138;152;98;138;152;112;98;112	ENSP00000405539:E138Q;ENSP00000387699:E152Q;ENSP00000236995:E138Q;ENSP00000407227:E152Q;ENSP00000403678:E98Q;ENSP00000445892:E138Q;ENSP00000363518:E152Q;ENSP00000440809:E112Q;ENSP00000405711:E98Q;ENSP00000391125:E112Q	ENSP00000236995:E138Q	E	+	1	0	CREB1	208143197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.771000	0.95319	0.650000	0.86243	GAA	CREB1	-	pfam_Coactivator_CBP_pKID,pfscan_Coactivator_CBP_pKID		0.378	CREB1-001	KNOWN	basic|CCDS	protein_coding	CREB1	HGNC	protein_coding	OTTHUMT00000256467.3	G	NM_134442		208434952	+1	no_errors	ENST00000432329	ensembl	human	known	70_37	missense	SNP	1.000	C
DDX26B	203522	genome.wustl.edu	37	X	134706650	134706650	+	Intron	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:134706650G>T	ENST00000370752.4	+	11	1621				DDX26B_ENST00000481908.1_Intron	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B											large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					ATTGTTCTGTGGGGTTCTGAA	0.318																																																	0																																										SO:0001627	intron_variant	203522			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1288-90G>T	X.37:g.134706650G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	RNA	SNP	-	NULL	ENST00000370752.4	37	NULL	CCDS35401.1	X																																																																																			DDX26B	-	-		0.318	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	G	NM_182540		134706650	+1	no_errors	ENST00000493637	ensembl	human	known	70_37	rna	SNP	0.001	T
DGKD	8527	genome.wustl.edu	37	2	234294806	234294806	+	Intron	DEL	T	T	-			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:234294806delT	ENST00000264057.2	+	2	168				DGKD_ENST00000489613.1_3'UTR|DGKD_ENST00000409813.3_5'Flank|AC019221.4_ENST00000442524.1_RNA	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa						blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TGGTTTTGTCTTTTTTTTTTT	0.408																																																	0																																										SO:0001627	intron_variant	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.157-2097T>-	2.37:g.234294806delT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14158|Q6PK55|Q8NG53	RNA	DEL	-	NULL	ENST00000264057.2	37	NULL	CCDS2504.1	2																																																																																			DGKD	-	-		0.408	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	T	NM_003648		234294806	+1	no_errors	ENST00000489613	ensembl	human	putative	70_37	rna	DEL	0.000	-
DHRSX	207063	genome.wustl.edu	37	X	2184919	2184919	+	Missense_Mutation	SNP	A	A	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:2184919A>T	ENST00000334651.5	-	5	510	c.458T>A	c.(457-459)cTa>cAa	p.L153Q	DHRSX_ENST00000464935.1_5'UTR	NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	153							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GAAGTGCCCTAGGTAGTTCAG	0.532																																																	0													424.0	372.0	390.0					X																	2184919		2203	4296	6499	SO:0001583	missense	207063			AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.458T>A	X.37:g.2184919A>T	ENSP00000334113:p.Leu153Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.L153Q	ENST00000334651.5	37	c.458	CCDS35195.1	X	.	.	.	.	.	.	.	.	.	.	A	15.25	2.776551	0.49786	.	.	ENSG00000169084	ENST00000334651;ENST00000412516;ENST00000444280	T;T;T	0.25749	1.78;1.78;1.78	2.11	2.11	0.27256	NAD(P)-binding domain (1);	0.000000	0.64402	U	0.000014	T	0.58264	0.2110	H	0.95224	3.64	0.31703	N	0.640473	D	0.89917	1.0	D	0.80764	0.994	T	0.68788	-0.5316	10	0.87932	D	0	.	9.6251	0.39746	1.0:0.0:0.0:0.0	.	153	Q8N5I4	DHRSX_HUMAN	Q	153;130;86	ENSP00000334113:L153Q;ENSP00000391778:L130Q;ENSP00000402741:L86Q	ENSP00000334113:L153Q	L	-	2	0	DHRSX	2194919	1.000000	0.71417	0.993000	0.49108	0.580000	0.36256	4.821000	0.62679	0.703000	0.31848	0.225000	0.17782	CTA	DHRSX	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase		0.532	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRSX	HGNC	protein_coding	OTTHUMT00000055617.3	A	NM_145177		2184919	-1	no_errors	ENST00000334651	ensembl	human	known	70_37	missense	SNP	1.000	T
LINC01011	401232	genome.wustl.edu	37	6	2990535	2990535	+	lincRNA	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:2990535C>T	ENST00000445000.1	+	0	1939				RP1-90J20.8_ENST00000456189.1_RNA|RP1-90J20.8_ENST00000429319.1_RNA	NR_026855.1				long intergenic non-protein coding RNA 1011																		AATTATCTACCgtgacccctt	0.373																																																	0																																												401232					6p25.2	2013-07-24			ENSG00000244041	ENSG00000244041		"""Long non-coding RNAs"""	33812	non-coding RNA	RNA, long non-coding							Standard	NR_026855		Approved	DKFZp686I15217			OTTHUMG00000014128		6.37:g.2990535C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445000.1	37	NULL		6																																																																																			RP1-90J20.7	-	-		0.373	LINC01011-004	KNOWN	basic|exp_conf	lincRNA	DKFZP686I15217	Clone_based_vega_gene	lincRNA	OTTHUMT00000255317.1	C			2990535	+1	no_errors	ENST00000597787	ensembl	human	known	70_37	rna	SNP	0.029	T
DLAT	1737	genome.wustl.edu	37	11	111896985	111896985	+	Missense_Mutation	SNP	G	G	C	rs200147835		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:111896985G>C	ENST00000280346.6	+	2	1002	c.343G>C	c.(343-345)Gag>Cag	p.E115Q	DLAT_ENST00000393051.1_Missense_Mutation_p.E115Q|DLAT_ENST00000537636.1_Missense_Mutation_p.E13Q	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase	115	Lipoyl-binding 1. {ECO:0000255|PROSITE- ProRule:PRU01066}.				cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		GGAAAAAAAAGAGGGGGACAA	0.338																																																	0													48.0	49.0	48.0					11																	111896985		2201	4297	6498	SO:0001583	missense	1737			Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.343G>C	11.37:g.111896985G>C	ENSP00000280346:p.Glu115Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16783|Q53EP3	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl,tigrfam_AcTrfase_Pyrv_DH_cplx_L	p.E115Q	ENST00000280346.6	37	c.343	CCDS8354.1	11	.	.	.	.	.	.	.	.	.	.	G	26.3	4.729308	0.89390	.	.	ENSG00000150768	ENST00000280346;ENST00000534998;ENST00000393051;ENST00000531306;ENST00000537636	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.57	4.65	0.58169	Single hybrid motif (1);Biotin/lipoyl attachment (2);	0.046163	0.85682	D	0.000000	T	0.80138	0.4568	M	0.92169	3.28	0.25994	N	0.982209	D;D	0.76494	0.998;0.999	D;D	0.72338	0.974;0.977	T	0.74867	-0.3518	10	0.66056	D	0.02	-21.1753	13.8387	0.63426	0.0733:0.0:0.9267:0.0	.	115;115	E9PEJ4;P10515	.;ODP2_HUMAN	Q	115;115;115;74;13	ENSP00000280346:E115Q;ENSP00000376771:E115Q;ENSP00000433432:E74Q;ENSP00000442427:E13Q	ENSP00000280346:E115Q	E	+	1	0	DLAT	111402195	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.091000	0.76923	2.614000	0.88457	0.591000	0.81541	GAG	DLAT	-	pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl		0.338	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLAT	HGNC	protein_coding	OTTHUMT00000258167.1	G	NM_001931		111896985	+1	no_errors	ENST00000280346	ensembl	human	known	70_37	missense	SNP	1.000	C
DNAH5	1767	genome.wustl.edu	37	5	13920589	13920589	+	Splice_Site	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr5:13920589C>G	ENST00000265104.4	-	6	902	c.798G>C	c.(796-798)caG>caC	p.Q266H		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	266	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCAAAATTACCTGTTCTGTCT	0.398									Kartagener syndrome																																								0													237.0	206.0	217.0					5																	13920589		2203	4300	6503	SO:0001630	splice_region_variant	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.798+1G>C	5.37:g.13920589C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q266H	ENST00000265104.4	37	c.798	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	.	25.9	4.682239	0.88542	.	.	ENSG00000039139	ENST00000265104	T	0.56444	0.46	6.17	6.17	0.99709	Dynein heavy chain, domain-1 (1);	0.130029	0.53938	D	0.000045	T	0.65386	0.2686	M	0.78916	2.43	0.80722	D	1	B	0.28760	0.221	B	0.39771	0.309	T	0.59236	-0.7492	9	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	266	Q8TE73	DYH5_HUMAN	H	266	ENSP00000265104:Q266H	.	Q	-	3	2	DNAH5	13973589	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.642000	0.67888	2.941000	0.99782	0.655000	0.94253	CAG	DNAH5	-	pfam_Dynein_heavy_dom-1		0.398	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	C	NM_001369	Missense_Mutation	13920589	-1	no_errors	ENST00000265104	ensembl	human	known	70_37	missense	SNP	1.000	G
DPP6	1804	genome.wustl.edu	37	7	154379552	154379552	+	Intron	SNP	T	T	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:154379552T>G	ENST00000377770.3	+	6	768				DPP6_ENST00000332007.3_Intron|DPP6_ENST00000404039.1_Intron|DPP6_ENST00000427557.1_Intron|DPP6_ENST00000406326.1_Missense_Mutation_p.C274G			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6						cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ATTGCCAGCTTGCCATGTACA	0.537																																					NSCLC(125;1384 1783 2490 7422 34254)												0													61.0	57.0	59.0					7																	154379552		876	1991	2867	SO:0001627	intron_variant	1804			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.628-49979T>G	7.37:g.154379552T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.C274G	ENST00000377770.3	37	c.820		7	.	.	.	.	.	.	.	.	.	.	T	4.054	0.007810	0.07866	.	.	ENSG00000130226	ENST00000406326	.	.	.	2.63	-3.64	0.04515	.	.	.	.	.	T	0.24661	0.0598	.	.	.	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.28522	-1.0041	7	0.87932	D	0	.	1.396	0.02261	0.1727:0.128:0.4088:0.2905	.	274	Q8IYG9	.	G	274	.	ENSP00000384393:C274G	C	+	1	0	DPP6	154010485	0.000000	0.05858	0.004000	0.12327	0.045000	0.14185	-1.028000	0.03589	-0.802000	0.04421	0.260000	0.18958	TGC	DPP6	-	NULL		0.537	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	T	NM_130797		154379552	+1	no_errors	ENST00000406326	ensembl	human	putative	70_37	missense	SNP	0.006	G
DTX1	1840	genome.wustl.edu	37	12	113533237	113533237	+	Intron	SNP	A	A	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:113533237A>G	ENST00000257600.3	+	8	2141				DTX1_ENST00000547974.1_Intron	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase						cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CCCAGCCGTGAGGGCATGGGA	0.607																																																	0													33.0	36.0	35.0					12																	113533237		2203	4300	6503	SO:0001627	intron_variant	1840			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1638+18A>G	12.37:g.113533237A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O60630|Q9BS04	RNA	SNP	-	NULL	ENST00000257600.3	37	NULL	CCDS9164.1	12																																																																																			DTX1	-	-		0.607	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	HGNC	protein_coding	OTTHUMT00000405045.2	A			113533237	+1	no_errors	ENST00000547730	ensembl	human	known	70_37	rna	SNP	0.001	G
EML3	256364	genome.wustl.edu	37	11	62369823	62369823	+	3'UTR	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:62369823G>A	ENST00000394773.2	-	0	3122				EML3_ENST00000529309.1_Missense_Mutation_p.S902L|EML3_ENST00000531557.1_3'UTR|EML3_ENST00000278845.4_3'UTR|EML3_ENST00000494176.2_Missense_Mutation_p.S874L|MTA2_ENST00000527204.1_5'Flank|MTA2_ENST00000278823.2_5'Flank	NM_153265.2	NP_694997.2	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like 3							cytoplasm (GO:0005737)|microtubule (GO:0005874)				biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GAAAATGCGCGATCGGGAATG	0.697																																																	0													17.0	18.0	18.0					11																	62369823		692	1591	2283	SO:0001624	3_prime_UTR_variant	256364			AK093146	CCDS8023.2	11q12.3	2013-01-10			ENSG00000149499	ENSG00000149499		"""WD repeat domain containing"""	26666	protein-coding gene	gene with protein product						15225882, 14744259	Standard	NM_153265		Approved	FLJ35827, ELP95	uc001ntu.1	Q32P44	OTTHUMG00000149817	ENST00000394773.2:c.*124C>T	11.37:g.62369823G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW7|Q8NA55	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S902L	ENST00000394773.2	37	c.2705	CCDS8023.2	11	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.567582	0.00895	.	.	ENSG00000149499	ENST00000494176;ENST00000529309	T;T	0.32272	1.48;1.46	4.46	-3.14	0.05250	.	.	.	.	.	T	0.17831	0.0428	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.25813	-1.0121	8	0.87932	D	0	.	1.8354	0.03138	0.2768:0.207:0.393:0.1232	.	902;874	Q32P44-2;G3V1D0	.;.	L	874;902	ENSP00000435064:S874L;ENSP00000434513:S902L	ENSP00000435064:S874L	S	-	2	0	EML3	62126399	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.874000	0.04210	-1.139000	0.02881	-2.654000	0.00148	TCG	EML3	-	NULL		0.697	EML3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	EML3	HGNC	protein_coding	OTTHUMT00000313432.1	G	NM_153265		62369823	-1	no_errors	ENST00000529309	ensembl	human	known	70_37	missense	SNP	0.000	A
RP11-782C8.1	0	genome.wustl.edu	37	1	143223399	143223399	+	lincRNA	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:143223399C>T	ENST00000438000.1	+	0	147																											CACTTCAGTGCTAGGCTGAAT	0.318																																																	0																																												0																															1.37:g.143223399C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			BX571672.5	-	-		0.318	RP11-782C8.1-002	KNOWN	basic	lincRNA	ENSG00000225278	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	C			143223399	-1	no_errors	ENST00000422716	ensembl	human	known	70_37	rna	SNP	0.008	T
SYNPR	132204	genome.wustl.edu	37	3	63320491	63320491	+	Intron	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr3:63320491G>A	ENST00000478300.1	+	2	495				AC099545.1_ENST00000516853.1_RNA	NM_001130003.1	NP_001123475.1	Q8TBG9	SYNPR_HUMAN	synaptoporin							cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		ggtaattgccgtttttgccat	0.378																																					NSCLC(29;1052 1116 20025 32519)												0																																										SO:0001627	intron_variant	0			AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000478300.1:c.84+56073G>A	3.37:g.63320491G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R675|G5E9W4	RNA	SNP	-	NULL	ENST00000478300.1	37	NULL	CCDS46859.1	3																																																																																			AC099545.1	-	-		0.378	SYNPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000252662	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000351784.1	G			63320491	+1	no_errors	ENST00000516853	ensembl	human	novel	70_37	rna	SNP	0.013	A
ST5	6764	genome.wustl.edu	37	11	8715262	8715263	+	3'UTR	INS	-	-	CAGG	rs55680964|rs397775044|rs3833781	byFrequency	TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:8715262_8715263insCAGG	ENST00000534127.1	-	0	4179_4180				ST5_ENST00000526757.1_3'UTR|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000313726.6_3'UTR|RP11-152H18.3_ENST00000529883.1_RNA|ST5_ENST00000357665.1_3'UTR|ST5_ENST00000530991.1_3'UTR	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5						positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		AGCGGGGACCTCAGGCAGGCAG	0.535														1715	0.342452	0.3147	0.3429	5008	,	,		18392	0.3006		0.4066	False		,,,				2504	0.3569																0																																										SO:0001624	3_prime_UTR_variant	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.*381->CCTG	11.37:g.8715267_8715270dupCAGG		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	RNA	INS	-	NULL	ENST00000534127.1	37	NULL	CCDS7791.1	11																																																																																			RP11-152H18.3	-	-		0.535	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000254665	Clone_based_vega_gene	protein_coding	OTTHUMT00000386518.1	-	NM_005418		8715263	+1	no_errors	ENST00000529883	ensembl	human	known	70_37	rna	INS	0.007:0.136	CAGG
CMTM2	146225	genome.wustl.edu	37	16	66614150	66614150	+	Intron	SNP	T	T	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr16:66614150T>G	ENST00000268595.2	+	2	595				CMTM2_ENST00000379486.2_Intron|RP11-403P17.2_ENST00000568430.1_RNA	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2						chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		TCTTGGCACCTGGAAAGTCAC	0.542																																																	0																																										SO:0001627	intron_variant	0			BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.444+63T>G	16.37:g.66614150T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5I2A4|Q8N7E5	Splice_Site	SNP	-	NULL	ENST00000268595.2	37	c.NULL	CCDS10814.1	16																																																																																			RP11-403P17.2	-	-		0.542	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000260650	Clone_based_vega_gene	protein_coding	OTTHUMT00000268808.1	T			66614150	-1	no_errors	ENST00000568430	ensembl	human	known	70_37	splice_site	SNP	0.000	G
FAM149B1	317662	genome.wustl.edu	37	10	74999103	74999103	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:74999103G>C	ENST00000242505.6	+	13	1810	c.1636G>C	c.(1636-1638)Gag>Cag	p.E546Q	DNAJC9_ENST00000453189.2_5'UTR	NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	546										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						ATGTGCAGTTGAGTATCCTCA	0.473																																																	0													132.0	110.0	117.0					10																	74999103		692	1591	2283	SO:0001583	missense	317662			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.1636G>C	10.37:g.74999103G>C	ENSP00000242505:p.Glu546Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.E546Q	ENST00000242505.6	37	c.1636	CCDS44435.1	10	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666923	0.47677	.	.	ENSG00000138286	ENST00000242505;ENST00000429173;ENST00000445951	T;T	0.53206	0.63;0.63	4.98	4.98	0.66077	.	0.051078	0.85682	D	0.000000	T	0.54143	0.1840	L	0.55481	1.735	0.58432	D	0.999996	D;P;D	0.57899	0.958;0.933;0.981	P;P;P	0.52109	0.558;0.623;0.69	T	0.57940	-0.7724	10	0.72032	D	0.01	-8.8647	13.6228	0.62146	0.0:0.0:1.0:0.0	.	524;294;546	B4E0M2;B3KN32;Q96BN6	.;.;F149B_HUMAN	Q	546;294;299	ENSP00000242505:E546Q;ENSP00000402293:E299Q	ENSP00000242505:E546Q	E	+	1	0	FAM149B1	74669109	1.000000	0.71417	0.921000	0.36526	0.282000	0.26991	3.251000	0.51453	2.591000	0.87537	0.591000	0.81541	GAG	FAM149B1	-	NULL		0.473	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	G	NM_173348		74999103	+1	no_errors	ENST00000242505	ensembl	human	known	70_37	missense	SNP	0.696	C
FAM181A	90050	genome.wustl.edu	37	14	94394853	94394853	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr14:94394853C>A	ENST00000267594.5	+	3	715	c.408C>A	c.(406-408)gaC>gaA	p.D136E	FAM181A_ENST00000557000.2_Missense_Mutation_p.D74E|FAM181A_ENST00000557719.1_Missense_Mutation_p.D74E|FAM181A_ENST00000556222.1_Missense_Mutation_p.D74E|FAM181A-AS1_ENST00000554742.1_RNA	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	136										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GGTCTGAGGACCGGCCCAGGA	0.647																																																	0													20.0	23.0	22.0					14																	94394853		2200	4298	6498	SO:0001583	missense	90050			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.408C>A	14.37:g.94394853C>A	ENSP00000267594:p.Asp136Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD39|Q96GY1	Missense_Mutation	SNP	NULL	p.D136E	ENST00000267594.5	37	c.408	CCDS9914.1	14	.	.	.	.	.	.	.	.	.	.	C	9.246	1.039574	0.19669	.	.	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000554404;ENST00000557000	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	4.21	0.999	0.19862	.	0.000000	0.37530	N	0.002049	T	0.12860	0.0312	N	0.21448	0.665	0.26105	N	0.980761	B	0.13594	0.008	B	0.16289	0.015	T	0.24977	-1.0145	10	0.06365	T	0.9	-12.2162	2.913	0.05743	0.1407:0.5287:0.1468:0.1838	.	136	Q8N9Y4	F181A_HUMAN	E	74;136;74;74;125	ENSP00000451802:D74E;ENSP00000267594:D136E;ENSP00000451678:D74E;ENSP00000452393:D74E	ENSP00000267594:D136E	D	+	3	2	FAM181A	93464606	0.428000	0.25522	0.878000	0.34440	0.765000	0.43378	0.743000	0.26231	0.404000	0.25506	0.561000	0.74099	GAC	FAM181A	-	NULL		0.647	FAM181A-001	KNOWN	basic|CCDS	protein_coding	FAM181A	HGNC	protein_coding	OTTHUMT00000412840.1	C	NM_138344		94394853	+1	no_errors	ENST00000267594	ensembl	human	known	70_37	missense	SNP	0.647	A
FAM182B	728882	genome.wustl.edu	37	20	25840531	25840531	+	Intron	SNP	A	A	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr20:25840531A>G	ENST00000376403.1	-	1	142				FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						ccggagcctcagagccccgac	0.612																																																	0																																										SO:0001627	intron_variant	728882					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.236+3164T>C	20.37:g.25840531A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0Q1	RNA	SNP	-	NULL	ENST00000376403.1	37	NULL		20																																																																																			FAM182B	-	-		0.612	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	HGNC	protein_coding	OTTHUMT00000078463.2	A	NR_026714		25840531	-1	no_errors	ENST00000584356	ensembl	human	known	70_37	rna	SNP	0.018	G
FAM86C1	55199	genome.wustl.edu	37	11	71504429	71504429	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:71504429G>A	ENST00000359244.4	+	3	186	c.163G>A	c.(163-165)Gag>Aag	p.E55K	FAM86C1_ENST00000346333.6_Intron|FAM86C1_ENST00000426628.2_Intron	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	55										lung(1)	1						CCCCCAGCACGAGGCTGTCCA	0.532																																																	0																																										SO:0001583	missense	55199			AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.163G>A	11.37:g.71504429G>A	ENSP00000352182:p.Glu55Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5D3	Missense_Mutation	SNP	NULL	p.E55K	ENST00000359244.4	37	c.163	CCDS41686.1	11	.	.	.	.	.	.	.	.	.	.	.	13.98	2.398918	0.42512	.	.	ENSG00000158483	ENST00000359244	T	0.25414	1.8	2.05	2.05	0.26809	.	.	.	.	.	T	0.45135	0.1327	M	0.79926	2.475	0.80722	D	1	D	0.71674	0.998	D	0.65443	0.935	T	0.39663	-0.9603	9	0.46703	T	0.11	.	7.5504	0.27793	0.0:0.0:1.0:0.0	.	55	Q9NVL1	FA86C_HUMAN	K	55	ENSP00000352182:E55K	ENSP00000352182:E55K	E	+	1	0	FAM86C1	71182077	1.000000	0.71417	0.998000	0.56505	0.230000	0.25150	3.193000	0.50997	1.136000	0.42199	0.184000	0.17185	GAG	FAM86C1	-	NULL		0.532	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM86C1	HGNC	protein_coding	OTTHUMT00000361120.1	G	NM_152563		71504429	+1	no_errors	ENST00000359244	ensembl	human	known	70_37	missense	SNP	1.000	A
FAT1	2195	genome.wustl.edu	37	4	187542656	187542656	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:187542656G>C	ENST00000441802.2	-	10	5293	c.5084C>G	c.(5083-5085)tCa>tGa	p.S1695*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1695	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CACCACTGATGATTGACTATG	0.388										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													116.0	113.0	114.0					4																	187542656		1868	4116	5984	SO:0001587	stop_gained	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.5084C>G	4.37:g.187542656G>C	ENSP00000406229:p.Ser1695*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S1695*	ENST00000441802.2	37	c.5084	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	45	11.950173	0.99620	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.8314	0.92141	0.0:0.0:1.0:0.0	.	.	.	.	X	1695;1697	.	ENSP00000260147:S1697X	S	-	2	0	FAT1	187779650	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.601000	0.98297	2.751000	0.94390	0.650000	0.86243	TCA	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.388	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	G	NM_005245		187542656	-1	no_errors	ENST00000441802	ensembl	human	known	70_37	nonsense	SNP	1.000	C
FBN2	2201	genome.wustl.edu	37	5	127641259	127641259	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr5:127641259C>G	ENST00000508053.1	-	50	6592	c.5618G>C	c.(5617-5619)aGt>aCt	p.S1873T	FBN2_ENST00000262464.4_Missense_Mutation_p.S1873T			P35556	FBN2_HUMAN	fibrillin 2	1873	EGF-like 30; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAGCGGTAACTACCAGGACT	0.453																																																	0													99.0	96.0	97.0					5																	127641259		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5618G>C	5.37:g.127641259C>G	ENSP00000424571:p.Ser1873Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.S1873T	ENST00000508053.1	37	c.5618	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631499	0.46944	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.94793	-3.52;-3.52	5.35	5.35	0.76521	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93288	0.7861	M	0.67569	2.06	0.47123	D	0.99932	B	0.15719	0.014	B	0.17722	0.019	D	0.89963	0.4088	10	0.59425	D	0.04	.	15.1368	0.72572	0.0:0.8593:0.1407:0.0	.	1873	P35556	FBN2_HUMAN	T	1873	ENSP00000262464:S1873T;ENSP00000424571:S1873T	ENSP00000262464:S1873T	S	-	2	0	FBN2	127669158	1.000000	0.71417	0.995000	0.50966	0.427000	0.31564	5.497000	0.66924	2.941000	0.99782	0.655000	0.94253	AGT	FBN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	C	NM_001999		127641259	-1	no_errors	ENST00000262464	ensembl	human	known	70_37	missense	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152287917	152287917	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:152287917C>T	ENST00000368799.1	-	2	51	c.16G>A	c.(16-18)Gaa>Aaa	p.E6K	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	6	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGATGTTTTCCAGGAGAGTA	0.284									Ichthyosis																																								0													75.0	74.0	74.0					1																	152287917		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.16G>A	1.37:g.152287917C>T	ENSP00000357789:p.Glu6Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E6K	ENST00000368799.1	37	c.16	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268278	0.40095	.	.	ENSG00000143631	ENST00000368799	T	0.07567	3.18	5.2	2.17	0.27698	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.03739	0.0106	N	0.17723	0.515	0.21416	N	0.999694	P	0.52316	0.952	P	0.60286	0.872	T	0.34054	-0.9844	9	0.31617	T	0.26	-24.8286	3.3011	0.06983	0.1694:0.5504:0.1855:0.0947	.	6	P20930	FILA_HUMAN	K	6	ENSP00000357789:E6K	ENSP00000357789:E6K	E	-	1	0	FLG	150554541	0.751000	0.28327	0.953000	0.39169	0.002000	0.02628	0.374000	0.20501	0.767000	0.33267	-0.259000	0.10710	GAA	FLG	-	pfam_S100_Ca-bd_sub		0.284	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	C	NM_002016		152287917	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.881	T
FCRL5	83416	genome.wustl.edu	37	1	157514053	157514053	+	Splice_Site	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:157514053C>G	ENST00000361835.3	-	5	1000	c.843G>C	c.(841-843)caG>caC	p.Q281H	FCRL5_ENST00000368190.3_Splice_Site_p.Q281H|FCRL5_ENST00000368191.3_Splice_Site_p.Q196H|FCRL5_ENST00000368189.3_Splice_Site_p.Q281H|FCRL5_ENST00000356953.4_Splice_Site_p.Q281H	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	281					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AACACTTACTCTGCACCTGTA	0.502																																																	0													127.0	124.0	125.0					1																	157514053		2203	4300	6503	SO:0001630	splice_region_variant	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.844+1G>C	1.37:g.157514053C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q281H	ENST00000361835.3	37	c.843	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190842	0.38707	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.49720	0.77;0.79;0.77;1.05;1.09	4.06	-8.12	0.01078	.	.	.	.	.	T	0.31575	0.0801	M	0.69358	2.11	0.09310	N	1	P;P;P;P;P;D	0.61080	0.907;0.88;0.88;0.788;0.858;0.989	B;P;P;B;P;D	0.65140	0.396;0.66;0.71;0.286;0.465;0.932	T	0.43702	-0.9375	9	0.08179	T	0.78	.	8.09	0.30795	0.0:0.242:0.1329:0.6251	.	312;196;281;281;281;281	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	H	281;281;281;196;281	ENSP00000354691:Q281H;ENSP00000349434:Q281H;ENSP00000357173:Q281H;ENSP00000357174:Q196H;ENSP00000357172:Q281H	ENSP00000349434:Q281H	Q	-	3	2	FCRL5	155780677	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.491000	0.02302	-1.944000	0.01038	-0.253000	0.11424	CAG	FCRL5	-	smart_Ig_sub		0.502	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	C	NM_031281	Missense_Mutation	157514053	-1	no_errors	ENST00000356953	ensembl	human	known	70_37	missense	SNP	0.000	G
FRZB	2487	genome.wustl.edu	37	2	183702723	183702723	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:183702723C>A	ENST00000295113.4	-	5	1423	c.814G>T	c.(814-816)Ggc>Tgc	p.G272C		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	272	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			GCTATAGAGCCTTCCACCAAG	0.323																																																	0													77.0	73.0	74.0					2																	183702723		2203	4300	6503	SO:0001583	missense	2487			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.814G>T	2.37:g.183702723C>A	ENSP00000295113:p.Gly272Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O00181|Q99686	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.G272C	ENST00000295113.4	37	c.814	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030824	0.75504	.	.	ENSG00000162998	ENST00000295113	T	0.31769	1.48	5.81	5.81	0.92471	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.100472	0.64402	D	0.000002	T	0.50257	0.1605	L	0.40543	1.245	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.46091	-0.9216	10	0.72032	D	0.01	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	272	Q92765	SFRP3_HUMAN	C	272	ENSP00000295113:G272C	ENSP00000295113:G272C	G	-	1	0	FRZB	183410968	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.327000	0.52045	2.736000	0.93811	0.655000	0.94253	GGC	FRZB	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain		0.323	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	HGNC	protein_coding	OTTHUMT00000255808.1	C	NM_001463		183702723	-1	no_errors	ENST00000295113	ensembl	human	known	70_37	missense	SNP	1.000	A
FZD5	7855	genome.wustl.edu	37	2	208631837	208631837	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:208631837G>A	ENST00000295417.3	-	2	2180	c.1627C>T	c.(1627-1629)Cgc>Tgc	p.R543C		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	543					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TTGTGGCCGCGCCGCGGGCGG	0.756																																																	0													4.0	4.0	4.0					2																	208631837		1942	3835	5777	SO:0001583	missense	7855			U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.1627C>T	2.37:g.208631837G>A	ENSP00000354607:p.Arg543Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R543C	ENST00000295417.3	37	c.1627	CCDS33366.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141663	0.77775	.	.	ENSG00000163251	ENST00000295417	T	0.80738	-1.41	4.73	4.73	0.59995	.	0.489229	0.19325	N	0.117035	T	0.61615	0.2361	N	0.08118	0	0.58432	D	0.999999	D	0.56287	0.975	B	0.37387	0.248	T	0.71006	-0.4717	10	0.72032	D	0.01	.	13.077	0.59093	0.0:0.0:1.0:0.0	.	543	Q13467	FZD5_HUMAN	C	543	ENSP00000354607:R543C	ENSP00000354607:R543C	R	-	1	0	FZD5	208340082	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.145000	0.58065	2.448000	0.82819	0.561000	0.74099	CGC	FZD5	-	NULL		0.756	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD5	HGNC	protein_coding	OTTHUMT00000337060.1	G	NM_003468		208631837	-1	no_errors	ENST00000295417	ensembl	human	known	70_37	missense	SNP	1.000	A
GARS	2617	genome.wustl.edu	37	7	30671904	30671904	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:30671904G>A	ENST00000389266.3	+	16	2186	c.1945G>A	c.(1945-1947)Gat>Aat	p.D649N		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	649					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CAAAGTAGACGATTCCTCTGG	0.448																																																	0													91.0	87.0	89.0					7																	30671904		1948	4140	6088	SO:0001583	missense	2617			AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.1945G>A	7.37:g.30671904G>A	ENSP00000373918:p.Asp649Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,prints_tRNA-synt_gly,tigrfam_tRNA-synt_gly	p.D649N	ENST00000389266.3	37	c.1945	CCDS43564.1	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943551	0.92593	.	.	ENSG00000106105	ENST00000389266	D	0.84298	-1.83	5.33	5.33	0.75918	Anticodon-binding (3);	0.000000	0.85682	D	0.000000	D	0.86924	0.6050	M	0.89840	3.065	0.80722	D	1	P	0.37352	0.591	B	0.29598	0.104	D	0.89018	0.3433	10	0.62326	D	0.03	-23.0128	16.9662	0.86286	0.0:0.0:1.0:0.0	.	649	P41250	SYG_HUMAN	N	649	ENSP00000373918:D649N	ENSP00000373918:D649N	D	+	1	0	GARS	30638429	1.000000	0.71417	0.904000	0.35570	0.729000	0.41735	9.827000	0.99397	2.688000	0.91661	0.460000	0.39030	GAT	GARS	-	pfam_Anticodon-bd,superfamily_Anticodon-bd,tigrfam_tRNA-synt_gly		0.448	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GARS	HGNC	protein_coding	OTTHUMT00000327735.1	G	NM_002047		30671904	+1	no_errors	ENST00000389266	ensembl	human	known	70_37	missense	SNP	1.000	A
GAS6	2621	genome.wustl.edu	37	13	114550997	114550997	+	Splice_Site	SNP	A	A	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr13:114550997A>T	ENST00000327773.6	-	3	427		c.e3+1		GAS6_ENST00000355761.4_5'Flank|GAS6_ENST00000357389.3_Splice_Site|GAS6_ENST00000476291.1_Splice_Site	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6						activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				ATTGAGACTTACCTAAGTATC	0.438																																																	0													120.0	125.0	124.0					13																	114550997		2203	4300	6503	SO:0001630	splice_region_variant	2621				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.280+1T>A	13.37:g.114550997A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Splice_Site	SNP	-	e3+2	ENST00000327773.6	37	c.280+2	CCDS45072.1	13	.	.	.	.	.	.	.	.	.	.	A	8.826	0.938771	0.18206	.	.	ENSG00000183087	ENST00000357389;ENST00000327773	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8959	0.41318	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GAS6	113562946	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	3.395000	0.52558	1.758000	0.51981	0.459000	0.35465	.	GAS6	-	-		0.438	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	A	NM_000820	Intron	114550997	-1	no_errors	ENST00000357389	ensembl	human	known	70_37	splice_site	SNP	1.000	T
GDF5OS	554250	genome.wustl.edu	37	20	34022198	34022199	+	Nonsense_Mutation	DNP	TC	TC	GA			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T|C	T|C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr20:34022198_34022199TC>GA	ENST00000374375.1	+	2	684_685	c.242_243TC>GA	c.(241-243)tTC>tGA	p.F81*	GDF5_ENST00000374369.3_Missense_Mutation_p.338_339EK>DQ|GDF5_ENST00000374372.1_Missense_Mutation_p.338_339EK>DQ			Q5U4N7	GDF5O_HUMAN	growth differentiation factor 5 opposite strand	81	Arg-rich.					mitochondrion (GO:0005739)				cervix(1)|endometrium(4)|lung(4)	9						AACAGGGCCTTCTCGTGGACCT	0.639																																																	0																																										SO:0001587	stop_gained	8200			BC085019		20q11.2	2013-03-18			ENSG00000204183	ENSG00000204183			33435	other	unknown							Standard			Approved		uc002xcj.3	Q5U4N7	OTTHUMG00000055985	Exception_encountered	20.37:g.34022198_34022199delinsGA	ENSP00000363495:p.Phe81*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6PVI8	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.K339Q|p.E338D	ENST00000374375.1	37	c.1015|c.1014		20																																																																																			GDF5	-	pfam_TGF-b_N		0.639	GDF5OS-001	KNOWN	basic|appris_principal	protein_coding	GDF5	HGNC	protein_coding	OTTHUMT00000125987.3	T|C			34022198|34022199	-1	no_errors	ENST00000374369	ensembl	human	known	70_37	missense	SNP	1.000	G|A
GLUD2	2747	genome.wustl.edu	37	X	120182357	120182357	+	Silent	SNP	C	C	T	rs145381711	byFrequency	TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:120182357C>T	ENST00000328078.1	+	1	896	c.819C>T	c.(817-819)ggC>ggT	p.G273G		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	273					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CTGCTACTGGCCGTGGTGTCT	0.448																																																	0								C		2,3833		0,2,1630,571	124.0	96.0	106.0		819	0.3	0.0	X	dbSNP_134	106	0,6728		0,0,2428,1872	no	coding-synonymous	GLUD2	NM_012084.3		0,2,4058,2443	TT,TC,CC,C		0.0,0.0522,0.0189		273/559	120182357	2,10561	2203	4300	6503	SO:0001819	synonymous_variant	2747			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.819C>T	X.37:g.120182357C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8G0|Q9UDQ4	Silent	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.G273	ENST00000328078.1	37	c.819	CCDS14603.1	X																																																																																			GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH		0.448	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	C	NM_012084		120182357	+1	no_errors	ENST00000328078	ensembl	human	known	70_37	silent	SNP	0.990	T
HIF3A	64344	genome.wustl.edu	37	19	46838184	46838184	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:46838184C>A	ENST00000377670.4	+	14	1884	c.1853C>A	c.(1852-1854)cCa>cAa	p.P618Q	HIF3A_ENST00000420102.2_Missense_Mutation_p.P567Q|HIF3A_ENST00000300862.3_Missense_Mutation_p.P616Q|HIF3A_ENST00000244303.6_Missense_Mutation_p.P549Q|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Missense_Mutation_p.P562Q|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000600383.1_Missense_Mutation_p.P549Q	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	618					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		ACAGGAGGACCAGCCCCAGGG	0.567																																																	0													66.0	65.0	65.0					19																	46838184		2203	4300	6503	SO:0001583	missense	64344			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1853C>A	19.37:g.46838184C>A	ENSP00000366898:p.Pro618Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.P618Q	ENST00000377670.4	37	c.1853	CCDS12681.2	19	.	.	.	.	.	.	.	.	.	.	C	2.654	-0.281301	0.05642	.	.	ENSG00000124440	ENST00000377670;ENST00000244303;ENST00000339613;ENST00000300862;ENST00000420102	T;T;T;T;T	0.63744	0.7;-0.04;0.58;0.7;-0.06	4.61	0.906	0.19314	.	1.641460	0.04258	N	0.339808	T	0.44201	0.1282	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.17268	0.021;0.012;0.005;0.003	B;B;B;B	0.12837	0.008;0.004;0.003;0.001	T	0.22591	-1.0212	10	0.25751	T	0.34	.	6.9434	0.24506	0.3562:0.4792:0.1647:0.0	.	567;549;616;618	F5H884;B4DNA2;Q9Y2N7-2;Q9Y2N7	.;.;.;HIF3A_HUMAN	Q	618;549;562;616;567	ENSP00000366898:P618Q;ENSP00000244303:P549Q;ENSP00000341877:P562Q;ENSP00000300862:P616Q;ENSP00000407771:P567Q	ENSP00000244303:P549Q	P	+	2	0	HIF3A	51530024	0.001000	0.12720	0.001000	0.08648	0.454000	0.32378	0.818000	0.27295	0.055000	0.16094	0.555000	0.69702	CCA	HIF3A	-	NULL		0.567	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	C			46838184	+1	no_errors	ENST00000377670	ensembl	human	known	70_37	missense	SNP	0.000	A
IGSF9	57549	genome.wustl.edu	37	1	159901458	159901458	+	Intron	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:159901458C>T	ENST00000368094.1	-	12	1560				IGSF9_ENST00000361509.3_Intron|IGSF9_ENST00000493195.1_Intron	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9						dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CGCCCCTCATCTCTCCAGGCA	0.662																																																	0																																										SO:0001627	intron_variant	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1363-65G>A	1.37:g.159901458C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000368094.1	37	NULL	CCDS44254.1	1																																																																																			IGSF9	-	-		0.662	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1	C	NM_020789		159901458	-1	no_errors	ENST00000496645	ensembl	human	known	70_37	rna	SNP	0.897	T
ITGB4	3691	genome.wustl.edu	37	17	73745051	73745051	+	Missense_Mutation	SNP	G	G	A	rs201802102		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr17:73745051G>A	ENST00000200181.3	+	27	3428	c.3241G>A	c.(3241-3243)Gtc>Atc	p.V1081I	ITGB4_ENST00000339591.3_Missense_Mutation_p.V1081I|ITGB4_ENST00000579662.1_Missense_Mutation_p.V1081I|ITGB4_ENST00000450894.3_Missense_Mutation_p.V1081I|ITGB4_ENST00000449880.2_Missense_Mutation_p.V1081I	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1081	Calx-beta.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCGTTTCCACGTCCAGCTCAG	0.647																																																	0								G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	32.0	36.0	35.0		3241,3241,3241	-2.6	0.4	17		35	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ITGB4	NM_000213.3,NM_001005619.1,NM_001005731.1	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	1081/1823,1081/1806,1081/1753	73745051	1,13005	2203	4300	6503	SO:0001583	missense	3691				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.3241G>A	17.37:g.73745051G>A	ENSP00000200181:p.Val1081Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pirsf_Integrin_bsu-4,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.V1081I	ENST00000200181.3	37	c.3241	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	6.712	0.500154	0.12762	0.0	1.16E-4	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.34275	1.37;1.37;1.37	5.45	-2.62	0.06152	Na-Ca exchanger/integrin-beta4 (2);	0.323139	0.31909	N	0.006874	T	0.10594	0.0259	N	0.03071	-0.42	0.22811	N	0.99871	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.003;0.004;0.004	T	0.33214	-0.9877	10	0.08599	T	0.76	.	7.4105	0.27016	0.3558:0.2242:0.42:0.0	.	1081;1081;1081	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	I	1081	ENSP00000200181:V1081I;ENSP00000344079:V1081I;ENSP00000400217:V1081I	ENSP00000200181:V1081I	V	+	1	0	ITGB4	71256646	0.000000	0.05858	0.355000	0.25773	0.070000	0.16714	-0.670000	0.05256	-0.453000	0.07076	-0.781000	0.03364	GTC	ITGB4	-	pfam_Calx_beta,smart_Calx_beta,pirsf_Integrin_bsu-4		0.647	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	G			73745051	+1	no_errors	ENST00000200181	ensembl	human	known	70_37	missense	SNP	0.449	A
KCNIP1	30820	genome.wustl.edu	37	5	170148834	170148834	+	Intron	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr5:170148834T>C	ENST00000411494.1	+	5	289				KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000390656.4_Intron|KCNIP1_ENST00000520740.1_Intron|KCNIP1_ENST00000434108.1_Missense_Mutation_p.V110A|KCNIP1_ENST00000328939.4_Intron			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1						detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCTGCCTTGTAGATGCCAGC	0.542																																																	0													220.0	200.0	207.0					5																	170148834		2203	4300	6503	SO:0001627	intron_variant	30820			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.290-3T>C	5.37:g.170148834T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	pfam_EF-hand,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.V110A	ENST00000411494.1	37	c.329	CCDS34286.1	5	.	.	.	.	.	.	.	.	.	.	T	6.076	0.382279	0.11524	.	.	ENSG00000182132	ENST00000434108	T	0.42131	0.98	5.5	3.71	0.42584	.	.	.	.	.	T	0.28134	0.0694	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04961	-1.0915	7	.	.	.	.	9.387	0.38349	0.0:0.8224:0.0:0.1776	.	110	Q3YAD0	.	A	110	ENSP00000414886:V110A	.	V	+	2	0	KCNIP1	170081412	1.000000	0.71417	0.810000	0.32431	0.842000	0.47809	4.584000	0.60971	0.660000	0.30964	-0.242000	0.12053	GTA	KCNIP1	-	NULL		0.542	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	KCNIP1	HGNC	protein_coding	OTTHUMT00000371760.1	T			170148834	+1	no_errors	ENST00000434108	ensembl	human	novel	70_37	missense	SNP	0.993	C
KLK9	284366	genome.wustl.edu	37	19	51506516	51506516	+	Splice_Site	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:51506516C>G	ENST00000594211.1	-	5	604	c.604G>C	c.(604-606)Ggt>Cgt	p.G202R	KLK9_ENST00000376832.4_Splice_Site_p.G202R|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000391806.2_5'Flank|KLK8_ENST00000291726.7_5'Flank|KLK8_ENST00000320838.5_5'Flank|KLK9_ENST00000250366.6_Splice_Site_p.G202R|KLK8_ENST00000600767.1_5'Flank|KLK8_ENST00000593490.1_5'Flank|KLK8_ENST00000347619.4_5'Flank			Q9UKQ9	KLK9_HUMAN	kallikrein-related peptidase 9	202	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7		all_neural(266;0.0652)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		CCAGAGTCACCCTGTACGCGA	0.632																																																	0													36.0	40.0	38.0					19																	51506516		2203	4300	6503	SO:0001630	splice_region_variant	284366			AF135026	CCDS12816.1	19q13.33	2008-02-05	2006-10-27					"""Kallikreins"""	6370	protein-coding gene	gene with protein product		605504	"""kallikrein 9"""			16800724, 16800723	Standard	NM_012315		Approved	KLK-L3	uc002pux.1	Q9UKQ9		ENST00000594211.1:c.604-1G>C	19.37:g.51506516C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6QA55	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G202R	ENST00000594211.1	37	c.604	CCDS12816.1	19	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451111	0.84209	.	.	ENSG00000213022	ENST00000376832;ENST00000250366	D;D	0.98044	-4.68;-4.68	4.71	4.71	0.59529	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.99023	0.9666	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98997	1.0810	9	0.54805	T	0.06	.	15.5252	0.75898	0.0:1.0:0.0:0.0	.	202;202	Q2XQG6;Q9UKQ9	.;KLK9_HUMAN	R	202	ENSP00000366028:G202R;ENSP00000250366:G202R	ENSP00000250366:G202R	G	-	1	0	KLK9	56198328	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.904000	0.69886	2.598000	0.87819	0.561000	0.74099	GGT	KLK9	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A		0.632	KLK9-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KLK9	Uniprot_genename	protein_coding	OTTHUMT00000465226.1	C	NM_012315	Missense_Mutation	51506516	-1	no_errors	ENST00000250366	ensembl	human	known	70_37	missense	SNP	1.000	G
LEO1	123169	genome.wustl.edu	37	15	52251016	52251016	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:52251016C>G	ENST00000299601.5	-	6	1228	c.1168G>C	c.(1168-1170)Gat>Cat	p.D390H	LEO1_ENST00000315141.5_Intron	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	390					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)		p.D390N(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TACTGAGGATCAAAAGGTCTA	0.269																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												1	Substitution - Missense(1)	endometrium(1)											73.0	72.0	72.0					15																	52251016		2194	4288	6482	SO:0001583	missense	123169			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1168G>C	15.37:g.52251016C>G	ENSP00000299601:p.Asp390His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96N99	Missense_Mutation	SNP	pfam_Leo1	p.D390H	ENST00000299601.5	37	c.1168	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502551	0.85176	.	.	ENSG00000166477	ENST00000299601;ENST00000538386	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.75539	0.3863	L	0.60067	1.865	0.80722	D	1	D	0.71674	0.998	D	0.63283	0.913	T	0.75637	-0.3249	9	0.52906	T	0.07	.	19.1407	0.93445	0.0:1.0:0.0:0.0	.	390	Q8WVC0	LEO1_HUMAN	H	390;368	.	ENSP00000299601:D390H	D	-	1	0	LEO1	50038308	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.613000	0.82986	2.619000	0.88677	0.557000	0.71058	GAT	LEO1	-	pfam_Leo1		0.269	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	C	NM_138792		52251016	-1	no_errors	ENST00000299601	ensembl	human	known	70_37	missense	SNP	1.000	G
KIAA2012	100652824	genome.wustl.edu	37	2	202965171	202965171	+	Splice_Site	SNP	A	A	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:202965171A>T	ENST00000541917.1	+	7	1527	c.1154A>T	c.(1153-1155)aAg>aTg	p.K385M	AC079354.1_ENST00000409515.3_3'UTR|AC079354.1_ENST00000295844.3_Splice_Site_p.K441M																							AAGAAGAAAAAGGTTGTGTGT	0.448																																																	0																																										SO:0001630	splice_region_variant	100652824																														ENST00000541917.1:c.1155+1A>T	2.37:g.202965171A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.K385M	ENST00000541917.1	37	c.1154		2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199175	0.38806	.	.	ENSG00000182329	ENST00000541917;ENST00000295844;ENST00000498697	.	.	.	5.52	4.36	0.52297	.	0.000000	0.52532	D	0.000073	T	0.61874	0.2382	M	0.61703	1.905	0.31947	N	0.610186	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.68985	-0.5265	9	0.87932	D	0	-21.3344	8.4085	0.32629	0.911:0.0:0.089:0.0	.	385;441	B4DIH8;E7EP55	.;.	M	385;441;5	.	ENSP00000295844:K441M	K	+	2	0	AC079354.1	202673416	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	2.920000	0.48844	1.037000	0.40024	0.459000	0.35465	AAG	FLJ39061	-	NULL		0.448	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	Uniprot_genename	protein_coding		A		Missense_Mutation	202965171	+1	no_errors	ENST00000541917	ensembl	human	known	70_37	missense	SNP	1.000	T
LOC644145	644145	genome.wustl.edu	37	4	56686283	56686283	+	lincRNA	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:56686283G>A	ENST00000504250.1	+	0	115					NR_003935.2																						AGAGTTCTCCGTCCAGGACAG	0.413																																																	0																																												644145																															4.37:g.56686283G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000504250.1	37	NULL		4																																																																																			RP11-345F18.1	-	-		0.413	RP11-345F18.1-001	KNOWN	basic	lincRNA	LOC644145	Clone_based_vega_gene	lincRNA	OTTHUMT00000361808.1	G			56686283	+1	no_errors	ENST00000504250	ensembl	human	known	70_37	rna	SNP	0.706	A
LOXHD1	125336	genome.wustl.edu	37	18	44101084	44101084	+	Silent	SNP	G	G	T	rs367815392		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr18:44101084G>T	ENST00000398722.4	-	26	4412	c.4413C>A	c.(4411-4413)gcC>gcA	p.A1471A	LOXHD1_ENST00000441893.2_Intron|LOXHD1_ENST00000300591.6_Silent_p.A638A|LOXHD1_ENST00000398705.2_5'Flank|LOXHD1_ENST00000536736.1_Intron|LOXHD1_ENST00000441551.2_Silent_p.A1543A|LOXHD1_ENST00000582408.1_Intron|LOXHD1_ENST00000579038.1_Silent_p.A542A|LOXHD1_ENST00000398686.4_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1471					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCACCACCATGGCATCCAAGA	0.607																																																	0													51.0	47.0	49.0					18																	44101084		692	1591	2283	SO:0001819	synonymous_variant	125336			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4413C>A	18.37:g.44101084G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.A1543	ENST00000398722.4	37	c.4629		18																																																																																			LOXHD1	-	NULL		0.607	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		G	NM_144612		44101084	-1	no_errors	ENST00000441551	ensembl	human	known	70_37	silent	SNP	0.002	T
MC1R	4157	genome.wustl.edu	37	16	89980899	89980899	+	5'UTR	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr16:89980899C>T	ENST00000555427.1	+	0	1074				RP11-566K11.7_ENST00000570217.1_RNA			Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)						G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		TTtgtgtgtgcgcctgtgtgt	0.572									Melanoma, Familial Clustering of																																								0																																										SO:0001623	5_prime_UTR_variant	4157	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555427.1:c.-1230C>T	16.37:g.89980899C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	RNA	SNP	-	NULL	ENST00000555427.1	37	NULL		16																																																																																			MC1R	-	-		0.572	MC1R-002	PUTATIVE	basic	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412001.2	C	NM_002386		89980899	+1	no_errors	ENST00000539976	ensembl	human	known	70_37	rna	SNP	0.407	T
MDC1	9656	genome.wustl.edu	37	6	30672609	30672609	+	Missense_Mutation	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:30672609T>C	ENST00000376406.3	-	10	4998	c.4351A>G	c.(4351-4353)Aca>Gca	p.T1451A	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.T1187A	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1451	Interaction with the PRKDC complex.|Pro-rich.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TCAGGGGCTGTGGGGACAACT	0.567								Other conserved DNA damage response genes																																									0													116.0	126.0	122.0					6																	30672609		2203	4300	6503	SO:0001583	missense	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4351A>G	6.37:g.30672609T>C	ENSP00000365588:p.Thr1451Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.T1451A	ENST00000376406.3	37	c.4351	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	T	11.29	1.594648	0.28445	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.13089	2.62;2.62	4.0	-3.89	0.04193	.	.	.	.	.	T	0.10423	0.0255	M	0.71036	2.16	0.09310	N	1	D;B	0.53619	0.961;0.131	P;B	0.58454	0.839;0.074	T	0.09250	-1.0683	9	0.38643	T	0.18	-0.3402	3.113	0.06365	0.4951:0.2111:0.0:0.2938	.	1187;1451	Q14676-2;Q14676	.;MDC1_HUMAN	A	1451;1187;1164;1017	ENSP00000365588:T1451A;ENSP00000365587:T1187A	ENSP00000365587:T1187A	T	-	1	0	MDC1	30780588	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.371000	0.07513	-0.392000	0.07751	0.369000	0.22263	ACA	MDC1	-	NULL		0.567	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	T	NM_014641		30672609	-1	no_errors	ENST00000376406	ensembl	human	known	70_37	missense	SNP	0.000	C
MDC1	9656	genome.wustl.edu	37	6	30673161	30673161	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:30673161G>C	ENST00000376406.3	-	10	4446	c.3799C>G	c.(3799-3801)Cag>Gag	p.Q1267E	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.Q1003E	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1267	Interaction with the PRKDC complex.|Pro-rich.			Missing (in Ref. 2; CAH18685). {ECO:0000305}.	DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CTAGTAGCCTGATATGTGGGC	0.572								Other conserved DNA damage response genes																																									0													131.0	148.0	142.0					6																	30673161		2202	4299	6501	SO:0001583	missense	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.3799C>G	6.37:g.30673161G>C	ENSP00000365588:p.Gln1267Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.Q1267E	ENST00000376406.3	37	c.3799	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	0.069	-1.206192	0.01568	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000422104	T;T	0.08807	3.05;3.05	3.15	2.25	0.28309	.	1.570440	0.04431	N	0.369160	T	0.01523	0.0049	L	0.31926	0.97	0.09310	N	1	B;B	0.31817	0.341;0.231	B;B	0.25140	0.058;0.026	T	0.34030	-0.9845	10	0.05721	T	0.95	.	7.6422	0.28300	0.0:0.0:0.7474:0.2526	.	1003;1267	Q14676-2;Q14676	.;MDC1_HUMAN	E	1267;1003;874	ENSP00000365588:Q1267E;ENSP00000365587:Q1003E	ENSP00000365587:Q1003E	Q	-	1	0	MDC1	30781140	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	0.038000	0.13862	0.886000	0.36113	0.478000	0.44815	CAG	MDC1	-	NULL		0.572	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	G	NM_014641		30673161	-1	no_errors	ENST00000376406	ensembl	human	known	70_37	missense	SNP	0.001	C
MTPAP	55149	genome.wustl.edu	37	10	30604919	30604919	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:30604919G>A	ENST00000263063.4	-	8	1402	c.1359C>T	c.(1357-1359)ttC>ttT	p.F453F	MTPAP_ENST00000358107.4_Silent_p.F583F|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	453	PAP-associated.				cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						AATTTTTATCGAAAGCAAAAT	0.279																																																	0													30.0	30.0	30.0					10																	30604919		2197	4296	6493	SO:0001819	synonymous_variant	55149			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1359C>T	10.37:g.30604919G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	pfam_PAP_assoc	p.F583	ENST00000263063.4	37	c.1749	CCDS7165.1	10																																																																																			MTPAP	-	pfam_PAP_assoc		0.279	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	G	NM_018109		30604919	-1	no_errors	ENST00000358107	ensembl	human	known	70_37	silent	SNP	1.000	A
MYRIP	25924	genome.wustl.edu	37	3	40299719	40299719	+	3'UTR	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr3:40299719C>A	ENST00000302541.6	+	0	2984				MYRIP_ENST00000396217.3_3'UTR|MYRIP_ENST00000425621.1_3'UTR|MYRIP_ENST00000539167.1_3'UTR|MYRIP_ENST00000459828.1_3'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein						intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GTGCCTTGACCCAACAGCCAT	0.567																																																	0													117.0	93.0	101.0					3																	40299719		692	1591	2283	SO:0001624	3_prime_UTR_variant	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.*62C>A	3.37:g.40299719C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	RNA	SNP	-	NULL	ENST00000302541.6	37	NULL	CCDS2689.1	3																																																																																			MYRIP	-	-		0.567	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	C	NM_015460		40299719	+1	no_errors	ENST00000459828	ensembl	human	known	70_37	rna	SNP	1.000	A
NAF1	92345	genome.wustl.edu	37	4	164048226	164048226	+	IGR	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:164048226G>T	ENST00000274054.2	-	0	1907				NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Missense_Mutation_p.P359T	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein						pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				gactgcaatggtctggatccg	0.393																																																	0													95.0	87.0	90.0					4																	164048226		692	1591	2283	SO:0001628	intergenic_variant	92345				CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8			4.37:g.164048226G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DP28|E9PAZ2	Missense_Mutation	SNP	pfam_H/ACA_rnp_Gar1/Naf1,superfamily_Transl_elong_init/rib_B-barrel	p.P359T	ENST00000274054.2	37	c.1075	CCDS3803.1	4	.	.	.	.	.	.	.	.	.	.	G	0.077	-1.191440	0.01607	.	.	ENSG00000145414	ENST00000422287	T	0.35421	1.31	0.55	-0.365	0.12549	.	.	.	.	.	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.31586	-0.9938	8	0.13853	T	0.58	.	.	.	.	.	359	E9PAZ2	.	T	359	ENSP00000408963:P359T	ENSP00000408963:P359T	P	-	1	0	NAF1	164267676	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.371000	0.07513	-0.267000	0.09325	-0.263000	0.10527	CCA	NAF1	-	NULL		0.393	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAF1	HGNC	protein_coding	OTTHUMT00000364684.2	G	NM_138386		164048226	-1	no_errors	ENST00000422287	ensembl	human	known	70_37	missense	SNP	0.001	T
NCAPD3	23310	genome.wustl.edu	37	11	134063985	134063985	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:134063985G>A	ENST00000534548.2	-	15	1814	c.1750C>T	c.(1750-1752)Ctg>Ttg	p.L584L		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	584					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGGTCCTGCAGAATCCACAGG	0.473																																																	0													100.0	88.0	92.0					11																	134063985		2201	4297	6498	SO:0001819	synonymous_variant	23310			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1750C>T	11.37:g.134063985G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFS2|Q4KMQ9	Silent	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.L584	ENST00000534548.2	37	c.1750	CCDS31723.1	11																																																																																			NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3		0.473	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	G	NM_015261		134063985	-1	no_errors	ENST00000534548	ensembl	human	known	70_37	silent	SNP	0.998	A
NEB	4703	genome.wustl.edu	37	2	152394431	152394431	+	Silent	SNP	A	A	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:152394431A>G	ENST00000172853.10	-	112	16101	c.15954T>C	c.(15952-15954)cgT>cgC	p.R5318R	NEB_ENST00000409198.1_Silent_p.R5318R|NEB_ENST00000397345.3_Silent_p.R7019R|NEB_ENST00000603639.1_Silent_p.R7019R|NEB_ENST00000604864.1_Silent_p.R7019R|NEB_ENST00000427231.2_Silent_p.R7019R			P20929	NEBU_HUMAN	nebulin	5318					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AATGCTCTGGACGATCAGGAA	0.403																																																	0													92.0	95.0	94.0					2																	152394431		1867	4111	5978	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15954T>C	2.37:g.152394431A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.R7019	ENST00000172853.10	37	c.21057		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.403	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		A	NM_004543		152394431	-1	no_errors	ENST00000397345	ensembl	human	known	70_37	silent	SNP	0.984	G
NFX1	4799	genome.wustl.edu	37	9	33366700	33366700	+	Missense_Mutation	SNP	C	C	T	rs569829262		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr9:33366700C>T	ENST00000379540.3	+	22	3175	c.3113C>T	c.(3112-3114)gCc>gTc	p.A1038V	NFX1_ENST00000463421.1_3'UTR	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	1038	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.				inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CATGACTTGGCCCAAGTTTAT	0.512																																																	0													109.0	93.0	98.0					9																	33366700		2203	4300	6503	SO:0001583	missense	4799			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.3113C>T	9.37:g.33366700C>T	ENSP00000368856:p.Ala1038Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.A1038V	ENST00000379540.3	37	c.3113	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.671259	0.96754	.	.	ENSG00000086102	ENST00000379540	T	0.68181	-0.31	6.07	6.07	0.98685	Single-stranded nucleic acid binding R3H (3);	0.000000	0.85682	D	0.000000	T	0.76492	0.3995	L	0.41632	1.29	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.76881	-0.2795	10	0.72032	D	0.01	-3.5694	18.1378	0.89627	0.0:1.0:0.0:0.0	.	1038	Q12986	NFX1_HUMAN	V	1038	ENSP00000368856:A1038V	ENSP00000368856:A1038V	A	+	2	0	NFX1	33356700	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.636000	0.83301	2.884000	0.98904	0.655000	0.94253	GCC	NFX1	-	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd		0.512	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	C			33366700	+1	no_errors	ENST00000379540	ensembl	human	known	70_37	missense	SNP	1.000	T
NHLH2	4808	genome.wustl.edu	37	1	116380753	116380753	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:116380753C>T	ENST00000369506.1	-	1	5785	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	NHLH2_ENST00000320238.3_Missense_Mutation_p.A81T			Q02577	HEN2_HUMAN	nescient helix loop helix 2	81	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|mating behavior (GO:0007617)|ovulation cycle (GO:0042698)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)			prostate(1)	1	Lung SC(450;0.184)	all_cancers(81;1.75e-06)|all_epithelial(167;1.16e-06)|all_lung(203;9.55e-06)|Lung NSC(69;5.83e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GTGGCGTGGGCCGAGCGGTAC	0.726																																																	0													14.0	16.0	15.0					1																	116380753		2195	4290	6485	SO:0001583	missense	4808				CCDS885.1	1p12-p11	2013-05-21			ENSG00000177551	ENSG00000177551		"""Basic helix-loop-helix proteins"""	7818	protein-coding gene	gene with protein product		162361		HEN2		1528853	Standard	NM_005599		Approved	NSCL2, bHLHa34	uc001efy.3	Q02577	OTTHUMG00000011969	ENST00000369506.1:c.241G>A	1.37:g.116380753C>T	ENSP00000358519:p.Ala81Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T1P6	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.A81T	ENST00000369506.1	37	c.241	CCDS885.1	1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879369	0.91740	.	.	ENSG00000177551	ENST00000320238;ENST00000369506;ENST00000429731	D;D;D	0.98044	-4.68;-4.68;-4.68	4.49	4.49	0.54785	Helix-loop-helix DNA-binding (4);	0.000000	0.64402	D	0.000001	D	0.96996	0.9019	L	0.39566	1.225	0.80722	D	1	D	0.61697	0.99	P	0.61722	0.893	D	0.96809	0.9595	10	0.41790	T	0.15	-12.9783	16.8027	0.85618	0.0:1.0:0.0:0.0	.	81	Q02577	HEN2_HUMAN	T	81	ENSP00000322087:A81T;ENSP00000358519:A81T;ENSP00000405062:A81T	ENSP00000322087:A81T	A	-	1	0	NHLH2	116182276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.721000	0.61951	2.053000	0.61076	0.561000	0.74099	GCC	NHLH2	-	pfam_HLH_dom,superfamily_HLH_dom,pfscan_HLH_dom		0.726	NHLH2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NHLH2	HGNC	protein_coding	OTTHUMT00000033090.1	C	NM_005599		116380753	-1	no_errors	ENST00000320238	ensembl	human	known	70_37	missense	SNP	1.000	T
NOP58	51602	genome.wustl.edu	37	2	203155898	203155898	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:203155898G>T	ENST00000264279.5	+	8	911	c.685G>T	c.(685-687)Gaa>Taa	p.E229*	SNORD11B_ENST00000607707.1_RNA|SNORD11_ENST00000459124.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	229					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						GCTGCCAGAAGAAGTTGAAGC	0.423																																																	0													102.0	104.0	104.0					2																	203155898		2203	4300	6503	SO:0001587	stop_gained	51602				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.685G>T	2.37:g.203155898G>T	ENSP00000264279:p.Glu229*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Nonsense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.E229*	ENST00000264279.5	37	c.685	CCDS2353.1	2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320815	0.81469	.	.	ENSG00000055044	ENST00000264279	.	.	.	5.78	5.78	0.91487	.	0.044264	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-1.9828	20.3754	0.98918	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000264279:E229X	E	+	1	0	NOP58	202864143	1.000000	0.71417	0.944000	0.38274	0.688000	0.40055	9.694000	0.98686	2.894000	0.99253	0.591000	0.81541	GAA	NOP58	-	NULL		0.423	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP58	HGNC	protein_coding	OTTHUMT00000256313.2	G	NM_015934		203155898	+1	no_errors	ENST00000264279	ensembl	human	known	70_37	nonsense	SNP	1.000	T
NPAP1	23742	genome.wustl.edu	37	15	24922666	24922666	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:24922666C>T	ENST00000329468.2	+	1	2126	c.1652C>T	c.(1651-1653)aCg>aTg	p.T551M		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	551					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ATGAATTCCACGTCAGTCATT	0.498																																																	0													175.0	164.0	168.0					15																	24922666		2203	4300	6503	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1652C>T	15.37:g.24922666C>T	ENSP00000333735:p.Thr551Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.T551M	ENST00000329468.2	37	c.1652	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	11.57	1.678665	0.29783	.	.	ENSG00000185823	ENST00000329468	T	0.05139	3.49	1.82	-2.61	0.06171	.	2.223100	0.02278	N	0.069132	T	0.06096	0.0158	N	0.22421	0.69	0.09310	N	1	D	0.69078	0.997	P	0.47251	0.542	T	0.15263	-1.0443	10	0.72032	D	0.01	.	2.3149	0.04196	0.4651:0.2949:0.0:0.24	.	551	Q9NZP6	CO002_HUMAN	M	551	ENSP00000333735:T551M	ENSP00000333735:T551M	T	+	2	0	C15orf2	22473759	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	-1.144000	0.03197	-0.741000	0.04797	0.205000	0.17691	ACG	NPAP1	-	NULL		0.498	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	C	NM_018958		24922666	+1	no_errors	ENST00000329468	ensembl	human	known	70_37	missense	SNP	0.000	T
NPHS1	4868	genome.wustl.edu	37	19	36330418	36330418	+	Silent	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:36330418C>A	ENST00000378910.5	-	21	2906	c.2907G>T	c.(2905-2907)ctG>ctT	p.L969L	NPHS1_ENST00000353632.6_Silent_p.L969L	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	969	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACCTCTGTGGCAGGCCCCCAT	0.592																																																	0													70.0	72.0	71.0					19																	36330418		2203	4300	6503	SO:0001819	synonymous_variant	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2907G>T	19.37:g.36330418C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDH2|C3RX61	Silent	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L969	ENST00000378910.5	37	c.2907	CCDS32996.1	19																																																																																			NPHS1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.592	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	C			36330418	-1	no_errors	ENST00000378910	ensembl	human	known	70_37	silent	SNP	0.971	A
NR2E3	10002	genome.wustl.edu	37	15	72106369	72106369	+	RNA	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:72106369G>A	ENST00000398840.2	+	0	1201							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GGGGCCTGAAGGATCCTGAGC	0.617																																																	0													35.0	42.0	39.0					15																	72106369		2106	4228	6334			10002				CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72106369G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B6ZGU0|Q9UHM4	RNA	SNP	-	NULL	ENST00000398840.2	37	NULL		15																																																																																			NR2E3	-	-		0.617	NR2E3-202	KNOWN	basic	processed_transcript	NR2E3	HGNC	processed_transcript		G	NM_014249		72106369	+1	no_errors	ENST00000326995	ensembl	human	known	70_37	rna	SNP	1.000	A
NR4A1	3164	genome.wustl.edu	37	12	52449047	52449047	+	Intron	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:52449047C>T	ENST00000243050.1	+	3	1190				NR4A1_ENST00000360284.3_Intron|NR4A1_ENST00000550082.1_Intron|NR4A1_ENST00000394825.1_Intron|NR4A1_ENST00000545748.1_Intron|NR4A1_ENST00000394824.2_Intron|NR4A1_ENST00000548232.1_Missense_Mutation_p.P312L	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1						cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TGGCCTCATCCCATTGGGACC	0.622																																																	0													11.0	12.0	11.0					12																	52449047		692	1591	2283	SO:0001627	intron_variant	3164			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.876+59C>T	12.37:g.52449047C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,prints_Nuc_orp_HMR_rcpt,prints_Nuc_orph_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.P312L	ENST00000243050.1	37	c.935	CCDS8818.1	12	.	.	.	.	.	.	.	.	.	.	C	7.410	0.634610	0.14322	.	.	ENSG00000123358	ENST00000548232	D	0.92299	-3.01	2.98	2.98	0.34508	.	.	.	.	.	D	0.88629	0.6488	.	.	.	0.31735	N	0.636524	B	0.25904	0.137	B	0.31290	0.127	D	0.88694	0.3211	8	0.87932	D	0	.	9.6629	0.39965	0.0:1.0:0.0:0.0	.	312	Q15627	.	L	312	ENSP00000449587:P312L	ENSP00000449587:P312L	P	+	2	0	NR4A1	50735314	0.000000	0.05858	0.007000	0.13788	0.008000	0.06430	-0.214000	0.09292	1.992000	0.58205	0.561000	0.74099	CCC	NR4A1	-	NULL		0.622	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NR4A1	HGNC	protein_coding	OTTHUMT00000317922.2	C			52449047	+1	no_errors	ENST00000548232	ensembl	human	novel	70_37	missense	SNP	0.007	T
NSUN6	221078	genome.wustl.edu	37	10	18837049	18837049	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:18837049G>A	ENST00000377304.4	-	10	1607	c.1189C>T	c.(1189-1191)Cag>Tag	p.Q397*	NSUN6_ENST00000493816.1_5'UTR|RP11-499P20.2_ENST00000425669.1_RNA	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	397							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						ACCTGGGGCTGAAGCTGAAGG	0.438																																																	0													68.0	60.0	63.0					10																	18837049		2203	4300	6503	SO:0001587	stop_gained	221078			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.1189C>T	10.37:g.18837049G>A	ENSP00000366519:p.Gln397*	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ54	Nonsense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_PUA,superfamily_PUA-like_domain,pfscan_PUA,prints_RCMT	p.Q397*	ENST00000377304.4	37	c.1189	CCDS7130.1	10	.	.	.	.	.	.	.	.	.	.	G	41	8.847742	0.98976	.	.	ENSG00000241058	ENST00000377304	.	.	.	5.87	5.87	0.94306	.	0.108833	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	.	.	.	X	397	.	ENSP00000366519:Q397X	Q	-	1	0	NSUN6	18877055	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	4.133000	0.57983	2.780000	0.95670	0.655000	0.94253	CAG	NSUN6	-	pfam_Fmu/NOL1/Nop2p		0.438	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN6	HGNC	protein_coding	OTTHUMT00000047083.1	G	NM_182543		18837049	-1	no_errors	ENST00000377304	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ORAOV1	220064	genome.wustl.edu	37	11	69486572	69486572	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:69486572C>A	ENST00000535657.1	-	3	253	c.172G>T	c.(172-174)Ggt>Tgt	p.G58C	ORAOV1_ENST00000539414.1_Missense_Mutation_p.G58C|ORAOV1_ENST00000542341.1_Missense_Mutation_p.G58C|ORAOV1_ENST00000279147.4_Missense_Mutation_p.G58C|ORAOV1_ENST00000536870.1_Intron			Q8WV07	ORAV1_HUMAN	oral cancer overexpressed 1	58										NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;5.64e-57)|all cancers(3;5.98e-51)|BRCA - Breast invasive adenocarcinoma(2;5.49e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			AAAGCAAAACCTTGGTAGCAC	0.408																																																	0													144.0	128.0	134.0					11																	69486572		2200	4294	6494	SO:0001583	missense	220064				CCDS8192.1	11q13.2	2010-11-23			ENSG00000149716	ENSG00000149716			17589	protein-coding gene	gene with protein product	"""oral cancer overexpressed protein 1-A"""	607224				12172009	Standard	NM_153451		Approved	TAOS1	uc001opc.3	Q8WV07		ENST00000535657.1:c.172G>T	11.37:g.69486572C>A	ENSP00000446129:p.Gly58Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4R2|Q8NFK0	Missense_Mutation	SNP	pfam_Essential_protein_Yae1_N	p.G58C	ENST00000535657.1	37	c.172	CCDS8192.1	11	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925851	0.52759	.	.	ENSG00000149716	ENST00000538554;ENST00000376587;ENST00000279147;ENST00000535657;ENST00000539414;ENST00000542341	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	5.41	5.41	0.78517	Essential protein Yae1, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.91573	0.7338	M	0.89968	3.075	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93106	0.6512	10	0.87932	D	0	-24.8672	16.9615	0.86273	0.0:1.0:0.0:0.0	.	58;58;58	B4DFA5;F5H6T8;Q8WV07	.;.;ORAV1_HUMAN	C	58	ENSP00000446428:G58C;ENSP00000279147:G58C;ENSP00000446129:G58C;ENSP00000444112:G58C;ENSP00000437367:G58C	ENSP00000279147:G58C	G	-	1	0	ORAOV1	69195753	0.998000	0.40836	0.287000	0.24848	0.215000	0.24574	4.964000	0.63701	2.525000	0.85131	0.448000	0.29417	GGT	ORAOV1	-	pfam_Essential_protein_Yae1_N		0.408	ORAOV1-009	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ORAOV1	HGNC	protein_coding	OTTHUMT00000396821.1	C	NM_153451		69486572	-1	no_errors	ENST00000279147	ensembl	human	known	70_37	missense	SNP	0.972	A
OPCML	4978	genome.wustl.edu	37	11	132812831	132812831	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:132812831C>T	ENST00000331898.7	-	1	735	c.157G>A	c.(157-159)Gcc>Acc	p.A53T	OPCML_ENST00000524381.1_Missense_Mutation_p.A46T|OPCML_ENST00000374778.4_Missense_Mutation_p.A12T|OPCML_ENST00000529038.1_Intron|OPCML_ENST00000541867.1_Missense_Mutation_p.A53T	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	53	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		CTGAGGGTGGCGCTCTCCCCC	0.677																																																	0													66.0	66.0	66.0					11																	132812831		2201	4297	6498	SO:0001583	missense	4978			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.157G>A	11.37:g.132812831C>T	ENSP00000330862:p.Ala53Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A53T	ENST00000331898.7	37	c.157	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.358707	0.95854	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162483	0.41396	D	0.000888	T	0.44705	0.1306	M	0.73962	2.25	0.58432	D	0.999998	P;P;P;P	0.46784	0.782;0.884;0.884;0.884	B;P;P;P	0.45195	0.393;0.473;0.473;0.473	T	0.47289	-0.9129	10	0.62326	D	0.03	-16.5216	19.8557	0.96758	0.0:1.0:0.0:0.0	.	53;46;53;53	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	T	53;46;12;46;53	ENSP00000330862:A53T;ENSP00000434750:A46T;ENSP00000363910:A12T;ENSP00000445496:A53T	ENSP00000330862:A53T	A	-	1	0	OPCML	132318041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.707000	0.92482	0.655000	0.94253	GCC	OPCML	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.677	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	C	NM_001012393		132812831	-1	no_errors	ENST00000541867	ensembl	human	known	70_37	missense	SNP	1.000	T
OXA1L	5018	genome.wustl.edu	37	14	23235786	23235786	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr14:23235786G>C	ENST00000285848.5	+	1	56	c.56G>C	c.(55-57)cGt>cCt	p.R19P	CTD-2555K7.2_ENST00000553792.1_RNA|CTD-2555K7.2_ENST00000554730.1_RNA|CTD-2555K7.2_ENST00000554857.1_RNA|OXA1L_ENST00000412791.1_5'Flank|OXA1L_ENST00000604262.1_5'Flank|OXA1L_ENST00000358043.5_5'Flank	NM_005015.3	NP_005006.3	Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	0					aerobic respiration (GO:0009060)|mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex I biogenesis (GO:0097031)|negative regulation of ATPase activity (GO:0032780)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|protein complex assembly (GO:0006461)|protein insertion into membrane (GO:0051205)|protein tetramerization (GO:0051262)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	mitochondrial ribosome binding (GO:0097177)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|skin(2)	19	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		GCCAAGCTCCGTTCTCTTTTA	0.502																																																	0													117.0	122.0	120.0					14																	23235786		2203	4300	6503	SO:0001583	missense	5018				CCDS9573.1	14q11.2	2009-05-26			ENSG00000155463	ENSG00000155463			8526	protein-coding gene	gene with protein product		601066				8586451, 19349278	Standard	NM_005015		Approved	MGC133129, OXA1	uc001wgn.2	Q15070	OTTHUMG00000028691	ENST00000285848.5:c.56G>C	14.37:g.23235786G>C	ENSP00000285848:p.Arg19Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DPA2	Missense_Mutation	SNP	pfam_Membrane_insert_OXA1/ALB3/YidC,tigrfam_Membrane_insert_OXA1/ALB3/YidC	p.R19P	ENST00000285848.5	37	c.56	CCDS9573.1	14	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779834	0.31502	.	.	ENSG00000155463	ENST00000285848	T	0.34275	1.37	4.93	-2.05	0.07321	.	.	.	.	.	T	0.16214	0.0390	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.21655	-1.0239	9	0.87932	D	0	1.1713	4.6691	0.12680	0.3796:0.3109:0.3095:0.0	.	19	Q2M1J6	.	P	19	ENSP00000285848:R19P	ENSP00000285848:R19P	R	+	2	0	OXA1L	22305626	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	0.163000	0.16520	-0.224000	0.09928	-0.302000	0.09304	CGT	OXA1L	-	NULL		0.502	OXA1L-001	KNOWN	basic|CCDS	protein_coding	OXA1L	HGNC	protein_coding	OTTHUMT00000071630.2	G	NM_005015		23235786	+1	no_errors	ENST00000285848	ensembl	human	known	70_37	missense	SNP	0.000	C
OXSR1	9943	genome.wustl.edu	37	3	38271862	38271862	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr3:38271862G>C	ENST00000446845.1	+	10	1264	c.892G>C	c.(892-894)Gaa>Caa	p.E298Q	OXSR1_ENST00000311806.3_Missense_Mutation_p.E298Q					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCAGAATAAAGAATTTCTTCA	0.299																																																	0													53.0	65.0	61.0					3																	38271862		2203	4288	6491	SO:0001583	missense	9943			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.892G>C	3.37:g.38271862G>C	ENSP00000415851:p.Glu298Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E298Q	ENST00000446845.1	37	c.892		3	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694997	0.88830	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.22336	1.96;1.96	5.1	5.1	0.69264	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	M	0.78637	2.42	0.80722	D	1	D;P	0.53462	0.96;0.928	P;P	0.53224	0.721;0.637	T	0.43343	-0.9397	10	0.72032	D	0.01	-22.2596	17.882	0.88843	0.0:0.0:1.0:0.0	.	298;298	C9JIG9;O95747	.;OXSR1_HUMAN	Q	298	ENSP00000415851:E298Q;ENSP00000311713:E298Q	ENSP00000311713:E298Q	E	+	1	0	OXSR1	38246866	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.390000	0.90175	2.551000	0.86045	0.585000	0.79938	GAA	OXSR1	-	superfamily_Kinase-like_dom		0.299	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	HGNC	protein_coding	OTTHUMT00000342708.1	G	NM_005109		38271862	+1	no_errors	ENST00000311806	ensembl	human	known	70_37	missense	SNP	1.000	C
PAX6	5080	genome.wustl.edu	37	11	31816307	31816307	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:31816307C>G	ENST00000379132.3	-	7	833	c.553G>C	c.(553-555)Gag>Cag	p.E185Q	PAX6_ENST00000379111.2_Missense_Mutation_p.E185Q|PAX6_ENST00000241001.8_Missense_Mutation_p.E185Q|PAX6_ENST00000419022.1_Missense_Mutation_p.E199Q|PAX6_ENST00000379129.2_Missense_Mutation_p.E199Q|PAX6_ENST00000379115.4_Missense_Mutation_p.E199Q|PAX6_ENST00000379107.2_Missense_Mutation_p.E199Q|PAX6_ENST00000379123.5_Missense_Mutation_p.E185Q			P26367	PAX6_HUMAN	paired box 6	185	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TTGGTATTCTCTCCCCCTCCT	0.463									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								0													106.0	96.0	100.0					11																	31816307		2202	4299	6501	SO:0001583	missense	5080	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.553G>C	11.37:g.31816307C>G	ENSP00000368427:p.Glu185Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6N006|Q99413	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Paired_dom,prints_Paired_dom	p.E199Q	ENST00000379132.3	37	c.595	CCDS31451.1	11	.	.	.	.	.	.	.	.	.	.	C	13.89	2.372181	0.42003	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000531633;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333;ENST00000531910;ENST00000471303	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.95035	-3.35;-3.34;-3.35;-2.99;-3.35;-3.34;-3.35;-3.34;-3.34;-2.78;-2.78;-3.34;-3.08;-2.79;-3.59	5.76	5.76	0.90799	Homeodomain-like (1);	0.744600	0.13653	N	0.372111	D	0.91811	0.7409	L	0.41492	1.28	0.80722	D	1	P;B	0.45348	0.856;0.411	B;B	0.38562	0.276;0.111	D	0.89742	0.3934	10	0.24483	T	0.36	.	19.9583	0.97232	0.0:1.0:0.0:0.0	.	199;185	F1T0F8;P26367	.;PAX6_HUMAN	Q	199;185;199;14;199;185;199;185;185;49;49;185;140;49;49	ENSP00000404100:E199Q;ENSP00000368427:E185Q;ENSP00000368424:E199Q;ENSP00000451885:E14Q;ENSP00000368401:E199Q;ENSP00000241001:E185Q;ENSP00000368410:E199Q;ENSP00000368406:E185Q;ENSP00000368418:E185Q;ENSP00000451901:E49Q;ENSP00000450775:E49Q;ENSP00000368403:E185Q;ENSP00000451372:E140Q;ENSP00000452558:E49Q;ENSP00000435884:E49Q	ENSP00000241001:E185Q	E	-	1	0	PAX6	31772883	1.000000	0.71417	0.987000	0.45799	0.944000	0.59088	7.453000	0.80700	2.716000	0.92895	0.655000	0.94253	GAG	PAX6	-	superfamily_Homeodomain-like		0.463	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	HGNC	protein_coding	OTTHUMT00000099293.4	C	NM_001604		31816307	-1	no_errors	ENST00000379107	ensembl	human	known	70_37	missense	SNP	0.999	G
PCOLCE2	26577	genome.wustl.edu	37	3	142542411	142542411	+	Silent	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr3:142542411C>T	ENST00000295992.3	-	7	1218	c.912G>A	c.(910-912)acG>acA	p.T304T	PCOLCE2_ENST00000485766.1_Intron	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	304	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.T304T(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						CCAGAGTCCCCGTCCGTCTAC	0.388																																																	1	Substitution - coding silent(1)	lung(1)											82.0	87.0	86.0					3																	142542411		2203	4300	6503	SO:0001819	synonymous_variant	26577			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.912G>A	3.37:g.142542411C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCH9|D3DNG4|Q9BRH3	Silent	SNP	pfam_CUB,pfam_Netrin_module_non-TIMP,superfamily_CUB,superfamily_TIMP-like_OB-fold,smart_CUB,smart_Netrin_module_non-TIMP,pfscan_CUB,pfscan_Netrin_domain	p.T304	ENST00000295992.3	37	c.912	CCDS3127.1	3																																																																																			PCOLCE2	-	superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain		0.388	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1	C	NM_013363		142542411	-1	no_errors	ENST00000295992	ensembl	human	known	70_37	silent	SNP	0.030	T
PDCD4	27250	genome.wustl.edu	37	10	112650326	112650326	+	Missense_Mutation	SNP	T	T	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:112650326T>A	ENST00000280154.7	+	8	1162	c.888T>A	c.(886-888)gaT>gaA	p.D296E	PDCD4_ENST00000481353.1_3'UTR|PDCD4_ENST00000393104.2_Missense_Mutation_p.D285E	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	296					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTGCTCTGGATAAGGCTACCG	0.403																																					Ovarian(115;1498 1603 9363 40056 40885)												0													143.0	145.0	144.0					10																	112650326		2203	4300	6503	SO:0001583	missense	27250			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.888T>A	10.37:g.112650326T>A	ENSP00000280154:p.Asp296Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	p.D296E	ENST00000280154.7	37	c.888	CCDS7567.1	10	.	.	.	.	.	.	.	.	.	.	T	12.75	2.032333	0.35893	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.41758	0.99;0.99	5.34	0.981	0.19756	Armadillo-type fold (1);	0.044847	0.85682	D	0.000000	T	0.32102	0.0818	L	0.50333	1.59	0.51012	D	0.999905	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.08659	-1.0711	10	0.25106	T	0.35	-9.8168	9.0641	0.36453	0.0:0.4392:0.0:0.5608	.	282;296;285	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	E	296;285	ENSP00000280154:D296E;ENSP00000376816:D285E	ENSP00000280154:D296E	D	+	3	2	PDCD4	112640316	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	0.884000	0.28214	-0.107000	0.12088	0.528000	0.53228	GAT	PDCD4	-	superfamily_ARM-type_fold		0.403	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD4	HGNC	protein_coding	OTTHUMT00000050361.1	T	NM_014456		112650326	+1	no_errors	ENST00000280154	ensembl	human	known	70_37	missense	SNP	0.999	A
PIK3R1	5295	genome.wustl.edu	37	5	67591146	67591147	+	In_Frame_Ins	INS	-	-	CTT			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr5:67591146_67591147insCTT	ENST00000521381.1	+	13	2355_2356	c.1739_1740insCTT	c.(1738-1743)tacttg>taCTTcttg	p.580_581YL>YFL	PIK3R1_ENST00000521657.1_In_Frame_Ins_p.580_581YL>YFL|PIK3R1_ENST00000396611.1_In_Frame_Ins_p.580_581YL>YFL|PIK3R1_ENST00000274335.5_In_Frame_Ins_p.580_581YL>YFL|PIK3R1_ENST00000523872.1_In_Frame_Ins_p.217_218YL>YFL|PIK3R1_ENST00000320694.8_In_Frame_Ins_p.280_281YL>YFL|PIK3R1_ENST00000336483.5_In_Frame_Ins_p.310_311YL>YFL	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	580					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.R577_M582>K(1)|p.Y580fs*1(1)|p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AGAGACCAATACTTGATGTAAG	0.371			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																														Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	4	Whole gene deletion(1)|Complex - deletion inframe(1)|Deletion - Frameshift(1)|Unknown(1)	large_intestine(1)|lung(1)|central_nervous_system(1)|endometrium(1)																																								SO:0001652	inframe_insertion	5295			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1740_1742dupCTT	5.37:g.67591147_67591149dupCTT	ENSP00000428056:p.Tyr580_Leu581insPhe	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Ins	INS	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.581in_frame_insF	ENST00000521381.1	37	c.1739_1740	CCDS3993.1	5																																																																																			PIK3R1	-	prints_PI3kinase_P85		0.371	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	-	NM_181504		67591147	+1	no_errors	ENST00000396611	ensembl	human	known	70_37	in_frame_ins	INS	1.000:1.000	CTT
POTEF	728378	genome.wustl.edu	37	2	130877734	130877734	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:130877734C>T	ENST00000409914.2	-	3	754	c.355G>A	c.(355-357)Gct>Act	p.A119T	POTEF_ENST00000360967.5_Missense_Mutation_p.A119T|POTEF_ENST00000357462.5_Missense_Mutation_p.A119T|POTEF_ENST00000361163.4_Missense_Mutation_p.A119T	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	119					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A119T(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TCTCCCCAAGCGCCCACCTTG	0.587																																																	2	Substitution - Missense(2)	upper_aerodigestive_tract(2)											62.0	82.0	75.0					2																	130877734		2202	4298	6500	SO:0001583	missense	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.355G>A	2.37:g.130877734C>T	ENSP00000386786:p.Ala119Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC34	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.A119T	ENST00000409914.2	37	c.355	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	0.437	-0.900707	0.02472	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.76839	-1.05;-1.05;1.78;1.71	0.409	-0.818	0.10833	.	.	.	.	.	T	0.48484	0.1502	N	0.13235	0.315	0.09310	N	1	P	0.52463	0.953	B	0.32149	0.141	T	0.47114	-0.9142	8	0.30078	T	0.28	.	.	.	.	.	119	A5A3E0	POTEF_HUMAN	T	119	ENSP00000350052:A119T;ENSP00000386786:A119T;ENSP00000354232:A119T;ENSP00000355012:A119T	ENSP00000350052:A119T	A	-	1	0	POTEF	130594204	0.012000	0.17670	0.001000	0.08648	0.002000	0.02628	-0.054000	0.11826	-0.572000	0.06006	-1.279000	0.01387	GCT	POTEF	-	NULL		0.587	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	C	NM_001099771		130877734	-1	no_errors	ENST00000357462	ensembl	human	known	70_37	missense	SNP	0.001	T
PRSS53	339105	genome.wustl.edu	37	16	31100087	31100087	+	Missense_Mutation	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr16:31100087G>T	ENST00000280606.6	-	1	197	c.44C>A	c.(43-45)aCa>aAa	p.T15K	RP11-196G11.1_ENST00000529564.1_Intron	NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	15						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						CATGAGGACTGTGGCACCCGC	0.662																																																	0													44.0	54.0	51.0					16																	31100087		2075	4202	6277	SO:0001583	missense	339105				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.44C>A	16.37:g.31100087G>T	ENSP00000280606:p.Thr15Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T15K	ENST00000280606.6	37	c.44	CCDS42153.1	16	.	.	.	.	.	.	.	.	.	.	G	7.138	0.581194	0.13686	.	.	ENSG00000151006	ENST00000280606	D	0.81659	-1.52	5.55	4.4	0.53042	Peptidase S1/S6, chymotrypsin/Hap (1);	1.101070	0.07346	U	0.881638	T	0.60843	0.2300	N	0.08118	0	0.22601	N	0.998948	B	0.02656	0.0	B	0.01281	0.0	T	0.47249	-0.9132	10	0.06099	T	0.92	.	8.1901	0.31363	0.9078:0.0:0.0922:0.0	.	15	Q2L4Q9	PRS53_HUMAN	K	15	ENSP00000280606:T15K	ENSP00000280606:T15K	T	-	2	0	PRSS53	31007588	0.138000	0.22547	0.817000	0.32601	0.003000	0.03518	0.608000	0.24223	0.937000	0.37394	-0.459000	0.05422	ACA	PRSS53	-	pfscan_Peptidase_S1_S6		0.662	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	G	NM_001081268		31100087	-1	no_errors	ENST00000280606	ensembl	human	known	70_37	missense	SNP	0.840	T
PTPRZ1	5803	genome.wustl.edu	37	7	121513476	121513476	+	5'UTR	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:121513476C>T	ENST00000393386.2	+	0	334				PTPRZ1_ENST00000449182.1_5'UTR	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACAAAAAAAACATTTCCTTCG	0.502																																																	0																																										SO:0001623	5_prime_UTR_variant	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.-78C>T	7.37:g.121513476C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	RNA	SNP	-	NULL	ENST00000393386.2	37	NULL	CCDS34740.1	7																																																																																			PTPRZ1	-	-		0.502	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	C	NM_002851		121513476	+1	no_errors	ENST00000471837	ensembl	human	known	70_37	rna	SNP	0.004	T
RALY	22913	genome.wustl.edu	37	20	32659947	32659947	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr20:32659947G>C	ENST00000246194.3	+	3	569	c.67G>C	c.(67-69)Gtc>Ctc	p.V23L	RALY_ENST00000493399.1_3'UTR|RALY_ENST00000375114.3_Missense_Mutation_p.V23L	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	23	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CAACTCTCGAGTCTTCATTGG	0.498																																																	0													123.0	115.0	117.0					20																	32659947		2203	4300	6503	SO:0001583	missense	22913			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.67G>C	20.37:g.32659947G>C	ENSP00000246194:p.Val23Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.V23L	ENST00000246194.3	37	c.67	CCDS13230.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.320699	0.95682	.	.	ENSG00000125970	ENST00000375114;ENST00000448364;ENST00000246194;ENST00000413297;ENST00000333552;ENST00000442805	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.82;1.46	5.55	5.55	0.83447	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	N	0.11870	0.19	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.85130	0.997;0.997	T	0.38972	-0.9636	10	0.45353	T	0.12	-31.0741	19.6873	0.95984	0.0:0.0:1.0:0.0	.	23;23	Q9UKM9-2;Q9UKM9	.;RALY_HUMAN	L	23	ENSP00000364255:V23L;ENSP00000413638:V23L;ENSP00000246194:V23L;ENSP00000403744:V23L;ENSP00000327522:V23L;ENSP00000415973:V23L	ENSP00000246194:V23L	V	+	1	0	RALY	32123608	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.537000	0.98070	2.890000	0.99128	0.585000	0.79938	GTC	RALY	-	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom		0.498	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	G			32659947	+1	no_errors	ENST00000246194	ensembl	human	known	70_37	missense	SNP	1.000	C
RASSF4	83937	genome.wustl.edu	37	10	45480397	45480397	+	Silent	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:45480397C>T	ENST00000340258.5	+	6	623	c.510C>T	c.(508-510)aaC>aaT	p.N170N	RASSF4_ENST00000334940.6_Silent_p.N179N|RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						TCTCTATCAACGGCCACTTCT	0.652																																																	0													63.0	74.0	70.0					10																	45480397		2203	4300	6503	SO:0001819	synonymous_variant	83937			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.510C>T	10.37:g.45480397C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH	p.N179	ENST00000340258.5	37	c.537	CCDS7208.1	10																																																																																			RASSF4	-	NULL		0.652	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF4	HGNC	protein_coding	OTTHUMT00000047745.2	C	NM_032023		45480397	+1	no_errors	ENST00000334940	ensembl	human	known	70_37	silent	SNP	0.586	T
RFX5	5993	genome.wustl.edu	37	1	151316236	151316236	+	Silent	SNP	G	G	A	rs559709373		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:151316236G>A	ENST00000290524.4	-	9	856	c.678C>T	c.(676-678)gtC>gtT	p.V226V	RFX5_ENST00000452513.2_Silent_p.V186V|RFX5_ENST00000452671.2_Silent_p.V226V|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000368870.2_Silent_p.V226V	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	226					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGAAGCGGGCGACCTCAACGA	0.592																																																	0													106.0	94.0	98.0					1																	151316236		2203	4300	6503	SO:0001819	synonymous_variant	5993				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.678C>T	1.37:g.151316236G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z848|D3DV19|E9PFU4|Q5VWC3	Silent	SNP	pfam_DNA-bd_RFX	p.V226	ENST00000290524.4	37	c.678	CCDS994.1	1																																																																																			RFX5	-	NULL		0.592	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	HGNC	protein_coding	OTTHUMT00000034892.6	G	NM_000449		151316236	-1	no_errors	ENST00000290524	ensembl	human	known	70_37	silent	SNP	0.255	A
RGL2	5863	genome.wustl.edu	37	6	33263343	33263343	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:33263343C>T	ENST00000497454.1	-	7	1457	c.962G>A	c.(961-963)cGg>cAg	p.R321Q	RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000444031.2_Missense_Mutation_p.R239Q	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	321	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						ACGGAGTGGCCGTATGGTCAC	0.602																																																	0													44.0	46.0	45.0					6																	33263343		2203	4300	6503	SO:0001583	missense	5863				CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.962G>A	6.37:g.33263343C>T	ENSP00000420211:p.Arg321Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R321Q	ENST00000497454.1	37	c.962	CCDS4774.1	6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125779	0.77436	.	.	ENSG00000237441	ENST00000497454;ENST00000421215;ENST00000444031	T;T	0.11930	2.77;2.73	4.91	4.91	0.64330	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.294250	0.31010	N	0.008436	T	0.06735	0.0172	N	0.11131	0.1	0.32534	N	0.534581	D;P	0.69078	0.997;0.641	P;B	0.51487	0.671;0.223	T	0.07195	-1.0785	10	0.72032	D	0.01	.	13.4774	0.61316	0.0:1.0:0.0:0.0	.	239;321	B4DG72;O15211	.;RGL2_HUMAN	Q	321;185;239	ENSP00000420211:R321Q;ENSP00000403070:R239Q	ENSP00000400083:R185Q	R	-	2	0	RGL2	33371321	0.313000	0.24554	0.991000	0.47740	0.989000	0.77384	3.339000	0.52135	2.542000	0.85734	0.643000	0.83706	CGG	RGL2	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.602	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL2	HGNC	protein_coding	OTTHUMT00000076098.2	C			33263343	-1	no_errors	ENST00000497454	ensembl	human	known	70_37	missense	SNP	1.000	T
RIN2	54453	genome.wustl.edu	37	20	19870110	19870110	+	Intron	SNP	G	G	C	rs527832680		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr20:19870110G>C	ENST00000255006.6	+	2	260				RIN2_ENST00000440354.2_5'Flank	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						TGTTGTTGACGGAAAAAGATC	0.483																																																	0																																										SO:0001627	intron_variant	54453			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.112-100G>C	20.37:g.19870110G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	RNA	SNP	-	NULL	ENST00000255006.6	37	NULL	CCDS56182.1	20																																																																																			RIN2	-	-		0.483	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	G			19870110	+1	no_errors	ENST00000488077	ensembl	human	known	70_37	rna	SNP	1.000	C
ZWILCH	55055	genome.wustl.edu	37	15	66797732	66797732	+	Intron	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:66797732G>A	ENST00000307897.5	+	1	433				SNORD16_ENST00000362803.1_RNA|ZWILCH_ENST00000565960.1_Intron|RPL4_ENST00000564517.1_5'UTR|RPL4_ENST00000307961.6_5'Flank|ZWILCH_ENST00000565627.1_Intron|ZWILCH_ENST00000535141.2_Intron|SNORD18A_ENST00000363753.1_RNA|RPL4_ENST00000568588.1_5'UTR|ZWILCH_ENST00000446801.2_Intron	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						CTCCTTCAGTGAGTCTAGTCT	0.582																																																	0													106.0	108.0	107.0					15																	66797732		2201	4299	6500	SO:0001627	intron_variant	6124			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.53+3G>A	15.37:g.66797732G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	RNA	SNP	-	NULL	ENST00000307897.5	37	NULL	CCDS10219.1	15																																																																																			RPL4	-	-		0.582	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL4	HGNC	protein_coding	OTTHUMT00000256904.4	G	NM_017975		66797732	-1	no_errors	ENST00000564517	ensembl	human	putative	70_37	rna	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	165946749	165946749	+	Missense_Mutation	SNP	T	T	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr2:165946749T>A	ENST00000360093.3	-	28	6405	c.5914A>T	c.(5914-5916)Agt>Tgt	p.S1972C	SCN3A_ENST00000409101.3_Missense_Mutation_p.S1923C|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000540861.1_Missense_Mutation_p.S455C|SCN3A_ENST00000283254.7_Missense_Mutation_p.S1972C|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1972					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTGTTACACTATCATAGGAA	0.358																																																	0													94.0	90.0	91.0					2																	165946749		2203	4300	6503	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5914A>T	2.37:g.165946749T>A	ENSP00000353206:p.Ser1972Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.S1972C	ENST00000360093.3	37	c.5914		2	.	.	.	.	.	.	.	.	.	.	T	18.15	3.561014	0.65538	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97598	-4.21;-4.2;-4.15;-4.45	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	D	0.96981	0.9014	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.987	D	0.98461	1.0596	10	0.87932	D	0	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	1923;1923;1972	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	C	1972;1972;1923;455	ENSP00000353206:S1972C;ENSP00000283254:S1972C;ENSP00000386726:S1923C;ENSP00000439920:S455C	ENSP00000283254:S1972C	S	-	1	0	SCN3A	165654995	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.285000	0.72658	2.308000	0.77769	0.533000	0.62120	AGT	SCN3A	-	NULL		0.358	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		T	NM_006922		165946749	-1	no_errors	ENST00000283254	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC13A4	26266	genome.wustl.edu	37	7	135390911	135390911	+	Missense_Mutation	SNP	G	G	A	rs543900359		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr7:135390911G>A	ENST00000354042.4	-	4	1192	c.503C>T	c.(502-504)gCg>gTg	p.A168V	RP11-644N4.1_ENST00000609370.1_RNA	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	168					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						GGAGTTGCCCGCCACGAGCTG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18689	0.0		0.0	False		,,,				2504	0.0																0													102.0	88.0	92.0					7																	135390911		2203	4300	6503	SO:0001583	missense	26266			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.503C>T	7.37:g.135390911G>A	ENSP00000297282:p.Ala168Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.A168V	ENST00000354042.4	37	c.503	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354237	0.24512	.	.	ENSG00000164707	ENST00000354042	T	0.03330	3.97	4.76	3.86	0.44501	.	0.635877	0.15635	N	0.252182	T	0.03608	0.0103	L	0.45352	1.415	0.09310	N	1	P	0.36959	0.575	B	0.34301	0.179	T	0.42137	-0.9469	10	0.30078	T	0.28	.	6.0955	0.20019	0.0968:0.0:0.7006:0.2026	.	168	Q9UKG4	S13A4_HUMAN	V	168	ENSP00000297282:A168V	ENSP00000297282:A168V	A	-	2	0	SLC13A4	135041451	0.221000	0.23642	0.022000	0.16811	0.564000	0.35744	2.333000	0.43912	1.099000	0.41499	0.462000	0.41574	GCG	SLC13A4	-	pfam_Na/sul_symport		0.617	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	G	NM_012450		135390911	-1	no_errors	ENST00000354042	ensembl	human	known	70_37	missense	SNP	0.003	A
SLC18A3	6572	genome.wustl.edu	37	10	50819083	50819083	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:50819083G>A	ENST00000374115.3	+	1	737	c.297G>A	c.(295-297)gcG>gcA	p.A99A	CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000351556.3_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	99					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						ACACCTCGGCGTCCCCGACAG	0.706																																																	0													41.0	42.0	42.0					10																	50819083		2203	4299	6502	SO:0001819	synonymous_variant	6572			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.297G>A	10.37:g.50819083G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7S1	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A99	ENST00000374115.3	37	c.297	CCDS7231.1	10																																																																																			SLC18A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.706	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	G	NM_003055		50819083	+1	no_errors	ENST00000374115	ensembl	human	known	70_37	silent	SNP	0.690	A
SMC1A	8243	genome.wustl.edu	37	X	53430536	53430536	+	Missense_Mutation	SNP	T	T	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:53430536T>G	ENST00000322213.4	-	15	2509	c.2382A>C	c.(2380-2382)gaA>gaC	p.E794D		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	794					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TCACCTTTTCTTCCTCAAACT	0.522																																																	0													188.0	151.0	163.0					X																	53430536		2203	4300	6503	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2382A>C	X.37:g.53430536T>G	ENSP00000323421:p.Glu794Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	O14995|Q16351|Q2M228	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.E794D	ENST00000322213.4	37	c.2382	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	T	15.33	2.801662	0.50315	.	.	ENSG00000072501	ENST00000322213	T	0.78707	-1.2	4.58	4.58	0.56647	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.68787	0.3039	L	0.42686	1.345	0.80722	D	1	B;B	0.30973	0.211;0.302	B;B	0.33568	0.082;0.166	T	0.67643	-0.5618	10	0.44086	T	0.13	.	7.3313	0.26584	0.0:0.1028:0.0:0.8972	.	772;794	Q6MZR8;Q14683	.;SMC1A_HUMAN	D	794	ENSP00000323421:E794D	ENSP00000323421:E794D	E	-	3	2	SMC1A	53447261	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.360000	0.44151	1.831000	0.53308	0.425000	0.28330	GAA	SMC1A	-	pfam_RecF/RecN/SMC		0.522	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	T	NM_006306		53430536	-1	no_errors	ENST00000322213	ensembl	human	known	70_37	missense	SNP	1.000	G
SPAG17	200162	genome.wustl.edu	37	1	118512716	118512716	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr1:118512716G>A	ENST00000336338.5	-	46	6415	c.6350C>T	c.(6349-6351)cCc>cTc	p.P2117L	SPAG17_ENST00000492438.1_5'Flank	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	2117						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCCTGTGCTGGGTGGGGGCTG	0.393																																																	0													143.0	142.0	142.0					1																	118512716		2203	4300	6503	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.6350C>T	1.37:g.118512716G>A	ENSP00000337804:p.Pro2117Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.P2117L	ENST00000336338.5	37	c.6350	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189997	0.78789	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.20200	2.09	5.3	5.3	0.74995	.	0.296744	0.32935	N	0.005468	T	0.37571	0.1008	M	0.78801	2.425	0.39480	D	0.967865	D	0.57257	0.979	P	0.61658	0.892	T	0.20571	-1.0271	10	0.87932	D	0	.	15.9899	0.80197	0.0:0.0:1.0:0.0	.	2117	Q6Q759	SPG17_HUMAN	L	2117;597	ENSP00000337804:P2117L	ENSP00000337804:P2117L	P	-	2	0	SPAG17	118314239	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.168000	0.50801	2.775000	0.95449	0.650000	0.86243	CCC	SPAG17	-	NULL		0.393	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	G	NM_206996		118512716	-1	no_errors	ENST00000336338	ensembl	human	known	70_37	missense	SNP	1.000	A
SPTB	6710	genome.wustl.edu	37	14	65253258	65253258	+	Missense_Mutation	SNP	C	C	T	rs141173028		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr14:65253258C>T	ENST00000389721.5	-	15	3457	c.3425G>A	c.(3424-3426)cGg>cAg	p.R1142Q	SPTB_ENST00000556626.1_Missense_Mutation_p.R1142Q|SPTB_ENST00000542895.1_Missense_Mutation_p.R1142Q|SPTB_ENST00000389720.3_Missense_Mutation_p.R1142Q|SPTB_ENST00000389722.3_Missense_Mutation_p.R1142Q	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1142					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCCTCCAGCCGCTGGCCCAG	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		18967	0.0		0.001	False		,,,				2504	0.0																0								C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	57.0	55.0	56.0		3425,3425	4.9	1.0	14	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SPTB	NM_000347.5,NM_001024858.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1142/2138,1142/2329	65253258	1,13005	2203	4300	6503	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3425G>A	14.37:g.65253258C>T	ENSP00000374371:p.Arg1142Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1142Q	ENST00000389721.5	37	c.3425	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618557	0.87460	0.0	1.16E-4	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.71904	0.3395	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.986	T	0.74194	-0.3744	10	0.54805	T	0.06	.	17.1796	0.86851	0.0:1.0:0.0:0.0	.	1142;1146	P11277;Q59FP5	SPTB1_HUMAN;.	Q	1146;1142;1142;1142;1142;1142	ENSP00000374372:R1142Q;ENSP00000451752:R1142Q;ENSP00000374371:R1142Q;ENSP00000443882:R1142Q;ENSP00000374370:R1142Q	ENSP00000374370:R1142Q	R	-	2	0	SPTB	64323011	1.000000	0.71417	0.997000	0.53966	0.654000	0.38779	7.811000	0.86092	2.430000	0.82344	0.549000	0.68633	CGG	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.602	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	C			65253258	-1	no_errors	ENST00000389722	ensembl	human	known	70_37	missense	SNP	1.000	T
STARD9	57519	genome.wustl.edu	37	15	42987423	42987423	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:42987423G>A	ENST00000290607.7	+	25	13105	c.13048G>A	c.(13048-13050)Gcc>Acc	p.A4350T		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	4350					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CCATGAGGAGGCCAAGGTGGA	0.552																																																	0													104.0	91.0	95.0					15																	42987423		692	1590	2282	SO:0001583	missense	57519			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.13048G>A	15.37:g.42987423G>A	ENSP00000290607:p.Ala4350Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A4350T	ENST00000290607.7	37	c.13048	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571312	0.65765	.	.	ENSG00000159433	ENST00000290607	T	0.49139	0.79	5.77	3.67	0.42095	.	.	.	.	.	T	0.31857	0.0810	L	0.49640	1.575	0.39071	D	0.960715	P	0.38597	0.639	B	0.30179	0.112	T	0.14254	-1.0479	9	0.23302	T	0.38	.	5.146	0.14985	0.1381:0.0:0.6467:0.2152	.	4264	Q9P2P6	STAR9_HUMAN	T	4350	ENSP00000290607:A4350T	ENSP00000290607:A4350T	A	+	1	0	STARD9	40774715	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	4.050000	0.57404	1.429000	0.47314	0.561000	0.74099	GCC	STARD9	-	NULL		0.552	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	G			42987423	+1	no_errors	ENST00000290607	ensembl	human	known	70_37	missense	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152603026	152603026	+	Silent	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:152603026G>T	ENST00000367255.5	-	97	18898	c.18297C>A	c.(18295-18297)ctC>ctA	p.L6099L	SYNE1_ENST00000356820.4_Silent_p.L623L|SYNE1_ENST00000341594.5_Silent_p.L5711L|SYNE1_ENST00000265368.4_Silent_p.L6099L|SYNE1_ENST00000448038.1_Silent_p.L6028L|SYNE1_ENST00000423061.1_Silent_p.L6028L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6099					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGTACTCAAGAGCCAGCTGT	0.552										HNSCC(10;0.0054)																																							0													103.0	85.0	91.0					6																	152603026		2203	4300	6503	SO:0001819	synonymous_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18297C>A	6.37:g.152603026G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L6099	ENST00000367255.5	37	c.18297	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.552	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	G	NM_182961		152603026	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	silent	SNP	0.979	T
SYNE1	23345	genome.wustl.edu	37	6	152746609	152746610	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr6:152746609_152746610delGA	ENST00000367255.5	-	39	5774_5775	c.5173_5174delTC	c.(5173-5175)tcafs	p.S1725fs	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Frame_Shift_Del_p.S1725fs|SYNE1_ENST00000448038.1_Frame_Shift_Del_p.S1732fs|SYNE1_ENST00000423061.1_Frame_Shift_Del_p.S1732fs	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1725					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGAGGCTACTGAGAACAATGAT	0.381										HNSCC(10;0.0054)																																							0																																										SO:0001589	frameshift_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5173_5174delTC	6.37:g.152746611_152746612delGA	ENSP00000356224:p.Ser1725fs	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V1726fs	ENST00000367255.5	37	c.5174_5173	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.381	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	GA	NM_182961		152746610	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	frame_shift_del	DEL	0.929:0.933	-
TBC1D1	23216	genome.wustl.edu	37	4	38051422	38051422	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:38051422C>T	ENST00000261439.4	+	11	2168	c.1813C>T	c.(1813-1815)Cag>Tag	p.Q605*	TBC1D1_ENST00000508802.1_Nonsense_Mutation_p.Q605*	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	605					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CATCGAATGCCAGGAACCTCC	0.582																																																	0													58.0	62.0	61.0					4																	38051422		2203	4300	6503	SO:0001587	stop_gained	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1813C>T	4.37:g.38051422C>T	ENSP00000261439:p.Gln605*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.Q605*	ENST00000261439.4	37	c.1813	CCDS33972.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.131620|6.131620	0.97310|0.97310	.|.	.|.	ENSG00000065882|ENSG00000065882	ENST00000510573|ENST00000508802;ENST00000261439;ENST00000446803;ENST00000421339	.|.	.|.	.|.	5.06|5.06	3.29|3.29	0.37713|0.37713	.|.	.|0.470497	.|0.19702	.|N	.|0.108016	T|.	0.19366|.	0.0465|.	.|.	.|.	.|.	0.24599|0.24599	N|N	0.99379|0.99379	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.19745|.	-1.0296|.	4|.	.|0.08599	.|T	.|0.76	-8.8143|-8.8143	10.3568|10.3568	0.43969|0.43969	0.0:0.7898:0.1364:0.0737|0.0:0.7898:0.1364:0.0737	.|.	.|.	.|.	.|.	L|X	252|605;605;476;73	.|.	.|ENSP00000261439:Q605X	P|Q	+|+	2|1	0|0	TBC1D1|TBC1D1	37727817|37727817	0.865000|0.865000	0.29922|0.29922	0.043000|0.043000	0.18650|0.18650	0.153000|0.153000	0.21895|0.21895	3.071000|3.071000	0.50041|0.50041	1.240000|1.240000	0.43803|0.43803	0.655000|0.655000	0.94253|0.94253	CCA|CAG	TBC1D1	-	NULL		0.582	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	C	NM_015173		38051422	+1	no_errors	ENST00000261439	ensembl	human	known	70_37	nonsense	SNP	0.042	T
TFE3	7030	genome.wustl.edu	37	X	48886990	48886990	+	3'UTR	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:48886990G>C	ENST00000315869.7	-	0	2666				TFE3_ENST00000487451.1_5'Flank	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3						humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						CGGTGGCCTGGTCCTACTGAT	0.552			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																			Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0																																										SO:0001624	3_prime_UTR_variant	7030			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.*679C>G	X.37:g.48886990G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	RNA	SNP	-	NULL	ENST00000315869.7	37	NULL	CCDS14315.3	X																																																																																			TFE3	-	-		0.552	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	G	NM_006521		48886990	-1	no_errors	ENST00000478476	ensembl	human	known	70_37	rna	SNP	0.000	C
TMEM132D	121256	genome.wustl.edu	37	12	129558618	129558618	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr12:129558618G>A	ENST00000422113.2	-	9	3428	c.3102C>T	c.(3100-3102)ccC>ccT	p.P1034P	TMEM132D_ENST00000389441.4_Silent_p.P572P	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1034					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGGATGTTGGGGGCTCACTTT	0.478																																																	0													104.0	108.0	107.0					12																	129558618		2203	4300	6503	SO:0001819	synonymous_variant	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3102C>T	12.37:g.129558618G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.P1034	ENST00000422113.2	37	c.3102	CCDS9266.1	12																																																																																			TMEM132D	-	NULL		0.478	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	G	NM_133448		129558618	-1	no_errors	ENST00000422113	ensembl	human	known	70_37	silent	SNP	0.925	A
TMPRSS6	164656	genome.wustl.edu	37	22	37482381	37482381	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr22:37482381C>G	ENST00000346753.3	-	8	1058	c.942G>C	c.(940-942)aaG>aaC	p.K314N	TMPRSS6_ENST00000442782.2_Missense_Mutation_p.K314N|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.K305N|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.K305N|TMPRSS6_ENST00000381792.2_Missense_Mutation_p.K305N	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	314	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						TGTGCAGGCCCTTCTTCCAGA	0.667																																																	0													33.0	31.0	32.0					22																	37482381		2203	4299	6502	SO:0001583	missense	164656			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.942G>C	22.37:g.37482381C>G	ENSP00000334962:p.Lys314Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	pirsf_Pept_S1A_matriptase-2,pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.K305N	ENST00000346753.3	37	c.915	CCDS13941.1	22	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804614	0.70682	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856;ENST00000442782	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	4.83	-1.67	0.08238	CUB (1);	0.067824	0.64402	D	0.000015	T	0.57315	0.2045	L	0.32530	0.975	0.41767	D	0.989748	D;D;D	0.71674	0.996;0.998;0.979	D;D;P	0.66351	0.918;0.943;0.63	T	0.55667	-0.8105	10	0.49607	T	0.09	.	9.4588	0.38772	0.0:0.3755:0.0:0.6245	.	314;305;314	Q8IU80-2;Q8IU80-5;Q8IU80	.;.;TMPS6_HUMAN	N	305;314;305;305;314	ENSP00000371211:K305N;ENSP00000334962:K314N;ENSP00000385453:K305N;ENSP00000384964:K305N;ENSP00000397691:K314N	ENSP00000334962:K314N	K	-	3	2	TMPRSS6	35812327	0.992000	0.36948	0.980000	0.43619	0.981000	0.71138	0.277000	0.18734	-0.111000	0.12001	0.655000	0.94253	AAG	TMPRSS6	-	pirsf_Pept_S1A_matriptase-2,superfamily_CUB		0.667	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	HGNC	protein_coding	OTTHUMT00000318822.1	C	NM_153609		37482381	-1	no_errors	ENST00000381792	ensembl	human	known	70_37	missense	SNP	0.996	G
TNIP3	79931	genome.wustl.edu	37	4	122082291	122082291	+	Splice_Site	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:122082291C>A	ENST00000509841.1	-	5	456	c.378G>T	c.(376-378)gaG>gaT	p.E126D	TNIP3_ENST00000057513.3_Splice_Site_p.E49D|TNIP3_ENST00000454328.1_Splice_Site_p.E49D|TNIP3_ENST00000507879.1_Splice_Site_p.E119D	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						TCTAAGTTACCTCTTTTCTTT	0.323																																																	0													153.0	145.0	148.0					4																	122082291		2185	4290	6475	SO:0001630	splice_region_variant	79931			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.378+1G>T	4.37:g.122082291C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E49D	ENST00000509841.1	37	c.147	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540287	0.65085	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.60299	0.35;0.35;0.2;0.2	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000001	T	0.71837	0.3387	M	0.64260	1.97	0.58432	D	0.999997	P;D;D	0.89917	0.77;0.998;1.0	P;D;D	0.83275	0.647;0.99;0.996	T	0.71279	-0.4640	9	.	.	.	-23.4062	14.0116	0.64500	0.0:1.0:0.0:0.0	.	119;49;49	B4DVF5;A5HU65;Q96KP6	.;.;TNIP3_HUMAN	D	49;49;119;126	ENSP00000057513:E49D;ENSP00000411817:E49D;ENSP00000427106:E119D;ENSP00000426613:E126D	.	E	-	3	2	TNIP3	122301741	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	3.879000	0.56138	2.576000	0.86940	0.491000	0.48974	GAG	TNIP3	-	NULL		0.323	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	C	NM_024873	Missense_Mutation	122082291	-1	no_errors	ENST00000057513	ensembl	human	known	70_37	missense	SNP	1.000	A
TNMD	64102	genome.wustl.edu	37	X	99849347	99849347	+	Missense_Mutation	SNP	G	G	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:99849347G>T	ENST00000373031.4	+	4	628	c.411G>T	c.(409-411)gaG>gaT	p.E137D	TNMD_ENST00000485971.1_3'UTR	NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	137	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						AACCAGAAGAGGAAATAGATG	0.343																																																	0													71.0	63.0	66.0					X																	99849347		2203	4300	6503	SO:0001583	missense	64102			AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.411G>T	X.37:g.99849347G>T	ENSP00000362122:p.Glu137Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBX0|Q9UJG0	Missense_Mutation	SNP	pfam_BRICHOS_dom,superfamily_Chitin-bd_1,pfscan_BRICHOS_dom	p.E137D	ENST00000373031.4	37	c.411	CCDS14469.1	X	.	.	.	.	.	.	.	.	.	.	G	9.358	1.067307	0.20067	.	.	ENSG00000000005	ENST00000373031	T	0.79653	-1.29	5.87	-0.0677	0.13759	BRICHOS (2);	0.704471	0.13624	N	0.374238	T	0.55513	0.1925	N	0.08118	0	0.24881	N	0.992226	B	0.23937	0.094	B	0.24541	0.054	T	0.39981	-0.9587	10	0.25751	T	0.34	-37.4341	2.5832	0.04824	0.4172:0.1101:0.3595:0.1132	.	137	Q9H2S6	TNMD_HUMAN	D	137	ENSP00000362122:E137D	ENSP00000362122:E137D	E	+	3	2	TNMD	99736003	0.728000	0.28080	0.900000	0.35374	0.927000	0.56198	-0.461000	0.06712	-0.369000	0.08028	0.594000	0.82650	GAG	TNMD	-	pfam_BRICHOS_dom,pfscan_BRICHOS_dom		0.343	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNMD	HGNC	protein_coding	OTTHUMT00000057481.1	G	NM_022144		99849347	+1	no_errors	ENST00000373031	ensembl	human	known	70_37	missense	SNP	0.784	T
TPGS2	25941	genome.wustl.edu	37	18	34387880	34387880	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr18:34387880C>T	ENST00000334295.4	-	3	610	c.183G>A	c.(181-183)atG>atA	p.M61I	TPGS2_ENST00000383056.3_Missense_Mutation_p.M61I|TPGS2_ENST00000593035.1_Missense_Mutation_p.M61I|TPGS2_ENST00000589049.1_Missense_Mutation_p.M61I|TPGS2_ENST00000587129.1_Missense_Mutation_p.M61I|TPGS2_ENST00000590842.1_Missense_Mutation_p.M61I	NM_015476.2	NP_056291.2	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	61						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATCTTCAGGCATCACACAGT	0.468																																																	0													194.0	159.0	171.0					18																	34387880		2203	4300	6503	SO:0001583	missense	25941			BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000334295.4:c.183G>A	18.37:g.34387880C>T	ENSP00000335144:p.Met61Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Missense_Mutation	SNP	smart_Cell_wall_assmbl_KNR4-like	p.M61I	ENST00000334295.4	37	c.183	CCDS32817.1	18	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814237	0.50527	.	.	ENSG00000134779	ENST00000334295;ENST00000383056	T;T	0.42513	1.63;0.97	5.91	1.86	0.25419	Cell wall assembly/cell proliferation coordinating protein, KNR4-like (1);	0.123243	0.56097	D	0.000036	T	0.31263	0.0791	L	0.43152	1.355	0.30446	N	0.775745	B;B;B;B	0.26876	0.098;0.023;0.162;0.162	B;B;B;B	0.23419	0.031;0.028;0.031;0.046	T	0.28522	-1.0041	10	0.72032	D	0.01	-6.9134	7.459	0.27283	0.0:0.5949:0.2213:0.1838	.	61;61;61;61	B4DIX2;Q68CL5-3;Q68CL5-1;Q68CL5	.;.;.;TPGS2_HUMAN	I	61	ENSP00000335144:M61I;ENSP00000372530:M61I	ENSP00000335144:M61I	M	-	3	0	C18orf10	32641878	0.936000	0.31750	0.913000	0.36048	0.991000	0.79684	0.022000	0.13511	0.370000	0.24538	0.655000	0.94253	ATG	TPGS2	-	smart_Cell_wall_assmbl_KNR4-like		0.468	TPGS2-001	KNOWN	basic|CCDS	protein_coding	TPGS2	HGNC	protein_coding	OTTHUMT00000440410.2	C	NM_015476		34387880	-1	no_errors	ENST00000334295	ensembl	human	known	70_37	missense	SNP	0.997	T
TRPM1	4308	genome.wustl.edu	37	15	31341662	31341662	+	Silent	SNP	G	G	A	rs373134893		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr15:31341662G>A	ENST00000256552.6	-	13	1635	c.1488C>T	c.(1486-1488)gtC>gtT	p.V496V	TRPM1_ENST00000542188.1_Silent_p.V513V|TRPM1_ENST00000397795.2_Silent_p.V474V	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1									p.V474V(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TCACAAAGTCGACACGATCTA	0.502																																																	1	Substitution - coding silent(1)	large_intestine(1)						G		2,3920		0,2,1959	124.0	118.0	120.0		1422	-10.3	0.2	15		120	0,8326		0,0,4163	no	coding-synonymous	TRPM1	NM_002420.4		0,2,6122	AA,AG,GG		0.0,0.051,0.0163		474/1604	31341662	2,12246	1961	4163	6124	SO:0001819	synonymous_variant	4308			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1488C>T	15.37:g.31341662G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ion_trans_dom	p.V513	ENST00000256552.6	37	c.1539	CCDS58346.1	15																																																																																			TRPM1	-	NULL		0.502	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	G	NM_002420		31341662	-1	no_errors	ENST00000542188	ensembl	human	known	70_37	silent	SNP	0.930	A
TSHZ3	57616	genome.wustl.edu	37	19	31770571	31770571	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:31770571G>C	ENST00000240587.4	-	2	455	c.128C>G	c.(127-129)gCc>gGc	p.A43G		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	43					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CATGTACTTGGCCGAGGGCTC	0.587																																																	0													48.0	50.0	50.0					19																	31770571		1960	4152	6112	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.128C>G	19.37:g.31770571G>C	ENSP00000240587:p.Ala43Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.A43G	ENST00000240587.4	37	c.128	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942333	0.34283	.	.	ENSG00000121297	ENST00000240587	T	0.12879	2.64	5.92	5.92	0.95590	.	0.369087	0.23879	U	0.043678	T	0.14657	0.0354	L	0.38175	1.15	0.40502	D	0.980656	B	0.30068	0.267	B	0.25140	0.058	T	0.03717	-1.1010	10	0.41790	T	0.15	-25.3141	20.3116	0.98642	0.0:0.0:1.0:0.0	.	43	Q63HK5	TSH3_HUMAN	G	43	ENSP00000240587:A43G	ENSP00000240587:A43G	A	-	2	0	TSHZ3	36462411	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.135000	0.57997	2.793000	0.96121	0.650000	0.86243	GCC	TSHZ3	-	NULL		0.587	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	G	NM_020856		31770571	-1	no_errors	ENST00000240587	ensembl	human	known	70_37	missense	SNP	1.000	C
TSPAN5	10098	genome.wustl.edu	37	4	99397456	99397456	+	Splice_Site	SNP	C	C	G			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr4:99397456C>G	ENST00000305798.3	-	7	1027	c.625G>C	c.(625-627)Gaa>Caa	p.E209Q	TSPAN5_ENST00000509168.1_5'Flank|TSPAN5_ENST00000505184.1_Splice_Site_p.E138Q	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	209					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)			kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TGGTCAACTTCCTTCACAAGA	0.473																																																	0													129.0	118.0	122.0					4																	99397456		2203	4300	6503	SO:0001630	splice_region_variant	10098				CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.625-1G>C	4.37:g.99397456C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.E209Q	ENST00000305798.3	37	c.625	CCDS3646.1	4	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998243	0.74818	.	.	ENSG00000168785	ENST00000305798;ENST00000505184	T;T	0.79247	-1.25;-1.25	5.66	5.66	0.87406	Tetraspanin, EC2 domain (1);	0.045348	0.85682	D	0.000000	T	0.70343	0.3213	L	0.35542	1.07	0.58432	D	0.999999	B	0.18741	0.03	B	0.19666	0.026	T	0.63800	-0.6555	10	0.17832	T	0.49	.	19.7302	0.96179	0.0:1.0:0.0:0.0	.	209	P62079	TSN5_HUMAN	Q	209;138	ENSP00000307701:E209Q;ENSP00000423916:E138Q	ENSP00000307701:E209Q	E	-	1	0	TSPAN5	99616479	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.822000	0.69265	2.669000	0.90835	0.585000	0.79938	GAA	TSPAN5	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.473	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN5	HGNC	protein_coding	OTTHUMT00000253641.2	C	NM_005723	Missense_Mutation	99397456	-1	no_errors	ENST00000305798	ensembl	human	known	70_37	missense	SNP	1.000	G
TXLNG	55787	genome.wustl.edu	37	X	16804696	16804697	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G|C	G|C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:16804696_16804697GC>AA	ENST00000380122.5	+	1	147_148	c.86_87GC>AA	c.(85-87)cGC>cAA	p.R29Q	TXLNG_ENST00000398155.4_Missense_Mutation_p.R29Q	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	29					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)			breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						GGACGGCGACGCAGCCCGCGGC	0.698																																																	0																																										SO:0001583	missense	55787			AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	Exception_encountered	X.37:g.16804696_16804697delinsAA	ENSP00000369465:p.Arg29Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KQ75|Q5JNZ7|Q9P0X1	Missense_Mutation|Silent	SNP	pfam_Taxilin_fam	p.R29H|p.R29	ENST00000380122.5	37	c.86|c.87	CCDS14178.1	X																																																																																			TXLNG	-	NULL		0.698	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNG	HGNC	protein_coding	OTTHUMT00000055912.1	G|C	NM_018360		16804696|16804697	+1	no_errors	ENST00000380122	ensembl	human	known	70_37	missense|silent	SNP	1.000|0.998	A
TYK2	7297	genome.wustl.edu	37	19	10463746	10463746	+	Missense_Mutation	SNP	T	T	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr19:10463746T>C	ENST00000525621.1	-	22	3537	c.3056A>G	c.(3055-3057)tAc>tGc	p.Y1019C	TYK2_ENST00000264818.6_Missense_Mutation_p.Y1019C|TYK2_ENST00000529422.1_5'UTR|TYK2_ENST00000524462.1_Missense_Mutation_p.Y834C	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1019	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TCGGTGGATGTAGTGCTGCGC	0.682																																																	0													57.0	51.0	53.0					19																	10463746		2203	4300	6503	SO:0001583	missense	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3056A>G	19.37:g.10463746T>C	ENSP00000431885:p.Tyr1019Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.Y1019C	ENST00000525621.1	37	c.3056	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375540	0.82682	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529739	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	5.43	5.43	0.79202	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.287206	0.24206	N	0.040572	D	0.88919	0.6568	N	0.16098	0.37	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.89583	0.3822	10	0.46703	T	0.11	-33.7184	13.4282	0.61039	0.0:0.0:0.0:1.0	.	1019	P29597	TYK2_HUMAN	C	834;1019;1019;766;42	ENSP00000433203:Y834C;ENSP00000431885:Y1019C;ENSP00000264818:Y1019C;ENSP00000436155:Y42C	ENSP00000264818:Y1019C	Y	-	2	0	TYK2	10324746	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.054000	0.57434	2.078000	0.62432	0.459000	0.35465	TAC	TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.682	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	T			10463746	-1	no_errors	ENST00000264818	ensembl	human	known	70_37	missense	SNP	1.000	C
UBQLNL	143630	genome.wustl.edu	37	11	5536549	5536549	+	Missense_Mutation	SNP	G	G	A	rs372374185		TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr11:5536549G>A	ENST00000380184.1	-	1	1386	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	375										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GCTGGCTGCCGAGTGGCACAG	0.493																																																	0								G	TRP/ARG	0,4402		0,0,2201	184.0	182.0	183.0		1123	4.2	0.1	11		183	1,8593	1.2+/-3.3	0,1,4296	no	missense	UBQLNL	NM_145053.4	101	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	375/476	5536549	1,12995	2201	4297	6498	SO:0001583	missense	143630			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.1123C>T	11.37:g.5536549G>A	ENSP00000369531:p.Arg375Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.R375W	ENST00000380184.1	37	c.1123	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	G	6.324	0.427795	0.11987	0.0	1.16E-4	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.49720	0.77	5.15	4.23	0.50019	.	0.184386	0.26349	U	0.024894	T	0.24812	0.0602	N	0.08118	0	0.09310	N	1	D	0.57257	0.979	B	0.37508	0.252	T	0.12041	-1.0563	10	0.72032	D	0.01	-10.2782	11.3664	0.49675	0.0:0.2058:0.7942:0.0	.	375	Q8IYU4	UBQLN_HUMAN	W	375;160	ENSP00000369531:R375W	ENSP00000369531:R375W	R	-	1	2	UBQLNL	5493125	0.722000	0.28017	0.118000	0.21660	0.014000	0.08584	1.178000	0.31981	1.349000	0.45751	0.655000	0.94253	CGG	UBQLNL	-	NULL		0.493	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	HGNC	protein_coding	OTTHUMT00000143386.1	G	NM_145053		5536549	-1	no_errors	ENST00000380184	ensembl	human	putative	70_37	missense	SNP	0.014	A
USP54	159195	genome.wustl.edu	37	10	75277079	75277079	+	Silent	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr10:75277079G>A	ENST00000339859.4	-	19	3205	c.3105C>T	c.(3103-3105)ccC>ccT	p.P1035P	USP54_ENST00000394811.2_Silent_p.P123P|USP54_ENST00000422491.2_Silent_p.P217P|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000428547.1_Silent_p.P885P|USP54_ENST00000408019.1_Silent_p.P1035P|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000593790.1_RNA|RP11-137L10.6_ENST00000595069.1_RNA			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1035					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TCACCGGGGAGGGGTTAGCAG	0.532																																					Colon(195;880 2046 8854 25025 38456)												0													107.0	112.0	110.0					10																	75277079		2203	4300	6503	SO:0001819	synonymous_variant	159195			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3105C>T	10.37:g.75277079G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.P1035	ENST00000339859.4	37	c.3105	CCDS7329.2	10																																																																																			USP54	-	NULL		0.532	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2	G	NM_152586		75277079	-1	no_errors	ENST00000339859	ensembl	human	known	70_37	silent	SNP	0.000	A
VCPIP1	80124	genome.wustl.edu	37	8	67576721	67576721	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr8:67576721C>A	ENST00000310421.4	-	1	2731	c.2473G>T	c.(2473-2475)Gag>Tag	p.E825*		NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	825					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)	p.E825Q(1)		breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GGCATTAACTCTTTAGGAGGA	0.388																																					NSCLC(179;265 2915 6144 43644)												1	Substitution - Missense(1)	breast(1)											128.0	131.0	130.0					8																	67576721		2203	4300	6503	SO:0001587	stop_gained	80124			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.2473G>T	8.37:g.67576721C>A	ENSP00000309031:p.Glu825*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Nonsense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.E825*	ENST00000310421.4	37	c.2473	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	C	43	10.103702	0.99337	.	.	ENSG00000175073	ENST00000310421	.	.	.	5.59	5.59	0.84812	.	0.051565	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.0117	19.5838	0.95484	0.0:1.0:0.0:0.0	.	.	.	.	X	825	.	ENSP00000309031:E825X	E	-	1	0	VCPIP1	67739275	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.613000	0.88420	0.655000	0.94253	GAG	VCPIP1	-	NULL		0.388	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	C			67576721	-1	no_errors	ENST00000310421	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ZCCHC5	203430	genome.wustl.edu	37	X	77912937	77912937	+	Silent	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:77912937C>T	ENST00000321110.1	-	2	1276	c.981G>A	c.(979-981)caG>caA	p.Q327Q		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	327							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GATGGATGCACTGGTTGGCAT	0.463																																																	0													68.0	57.0	61.0					X																	77912937		2203	4300	6503	SO:0001819	synonymous_variant	203430			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.981G>A	X.37:g.77912937C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMZ0|Q5JQE9	Silent	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q327	ENST00000321110.1	37	c.981	CCDS14440.1	X																																																																																			ZCCHC5	-	NULL		0.463	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC5	HGNC	protein_coding	OTTHUMT00000057319.1	C	NM_152694		77912937	-1	no_errors	ENST00000321110	ensembl	human	known	70_37	silent	SNP	0.000	T
ZFHX3	463	genome.wustl.edu	37	16	72832329	72832329	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr16:72832329G>A	ENST00000268489.5	-	9	4924	c.4252C>T	c.(4252-4254)Ctc>Ttc	p.L1418F	ZFHX3_ENST00000397992.5_Missense_Mutation_p.L504F	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1418					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGAGAATGGAGCTGCAACTTT	0.517																																																	0													169.0	152.0	158.0					16																	72832329		2198	4300	6498	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.4252C>T	16.37:g.72832329G>A	ENSP00000268489:p.Leu1418Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.L1418F	ENST00000268489.5	37	c.4252	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667264	0.47677	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.29655	1.56;1.56	5.94	5.94	0.96194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.45126	D	0.000390	T	0.55986	0.1955	M	0.70903	2.155	0.58432	D	0.999999	D	0.61080	0.989	D	0.63957	0.92	T	0.50734	-0.8793	10	0.48119	T	0.1	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	1418	Q15911	ZFHX3_HUMAN	F	1418;504	ENSP00000268489:L1418F;ENSP00000438926:L504F	ENSP00000268489:L1418F	L	-	1	0	ZFHX3	71389830	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.581000	0.67471	2.826000	0.97356	0.561000	0.74099	CTC	ZFHX3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.517	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	G	NM_006885		72832329	-1	no_errors	ENST00000268489	ensembl	human	known	70_37	missense	SNP	1.000	A
ZFPM2	23414	genome.wustl.edu	37	8	106431433	106431433	+	Silent	SNP	C	C	A			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr8:106431433C>A	ENST00000407775.2	+	2	352	c.102C>A	c.(100-102)atC>atA	p.I34I	ZFPM2_ENST00000520492.1_5'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	34					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAACAGACATCATCTCCAAAG	0.413																																																	0													96.0	92.0	93.0					8																	106431433		1849	4107	5956	SO:0001819	synonymous_variant	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.102C>A	8.37:g.106431433C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I34	ENST00000407775.2	37	c.102	CCDS47908.1	8																																																																																			ZFPM2	-	NULL		0.413	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	C			106431433	+1	no_errors	ENST00000407775	ensembl	human	known	70_37	silent	SNP	0.993	A
ZNF185	7739	genome.wustl.edu	37	X	152089261	152089261	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chrX:152089261C>T	ENST00000370268.4	+	9	659	c.622C>T	c.(622-624)Cag>Tag	p.Q208*	ZNF185_ENST00000449285.2_Nonsense_Mutation_p.Q209*|ZNF185_ENST00000318504.7_Nonsense_Mutation_p.Q208*|ZNF185_ENST00000324823.6_Nonsense_Mutation_p.Q74*|ZNF185_ENST00000318529.8_Nonsense_Mutation_p.Q46*|ZNF185_ENST00000370270.2_Nonsense_Mutation_p.Q208*|ZNF185_ENST00000539731.1_Nonsense_Mutation_p.Q208*|ZNF185_ENST00000535861.1_Nonsense_Mutation_p.Q208*			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	208						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCCTACCCAGGAGACACA	0.587																																																	0													107.0	100.0	102.0					X																	152089261		2047	4169	6216	SO:0001587	stop_gained	7739			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.622C>T	X.37:g.152089261C>T	ENSP00000359291:p.Gln208*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Nonsense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.Q208*	ENST00000370268.4	37	c.622	CCDS48184.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.111697|5.111697	0.94339|0.94339	.|.	.|.	ENSG00000147394|ENSG00000147394	ENST00000426821;ENST00000447088;ENST00000447792|ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000324823;ENST00000433245;ENST00000370268;ENST00000318529;ENST00000370270	.|.	.|.	.|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.270947	.|0.25981	.|N	.|0.027068	T|.	0.63367|.	0.2505|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.68247|.	-0.5459|.	3|.	.|0.33141	.|T	.|0.24	-6.2889|-6.2889	13.7791|13.7791	0.63073|0.63073	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	52;25;4|208;208;209;208;73;74;74;208;46;69	.|.	.|ENSP00000312782:Q208X	P|Q	+|+	2|1	0|0	ZNF185|ZNF185	151839917|151839917	0.971000|0.971000	0.33674|0.33674	0.291000|0.291000	0.24904|0.24904	0.172000|0.172000	0.22775|0.22775	3.785000|3.785000	0.55424|0.55424	2.412000|2.412000	0.81896|0.81896	0.523000|0.523000	0.50628|0.50628	CCA|CAG	ZNF185	-	NULL		0.587	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	C	NM_007150		152089261	+1	no_errors	ENST00000535861	ensembl	human	known	70_37	nonsense	SNP	0.362	T
ZNF484	83744	genome.wustl.edu	37	9	95609815	95609815	+	Silent	SNP	C	C	T			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr9:95609815C>T	ENST00000375495.3	-	5	1402	c.1254G>A	c.(1252-1254)ggG>ggA	p.G418G	ANKRD19P_ENST00000473204.1_RNA|ZNF484_ENST00000332591.6_Silent_p.G382G|ZNF484_ENST00000395506.3_Silent_p.G420G|ZNF484_ENST00000395505.2_Silent_p.G382G	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						TAAAGGCCTTCCCACATTCAG	0.358																																																	0													74.0	78.0	76.0					9																	95609815		2203	4300	6503	SO:0001819	synonymous_variant	83744			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.1254G>A	9.37:g.95609815C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL89|B4DRI2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G420	ENST00000375495.3	37	c.1260	CCDS35066.1	9																																																																																			ZNF484	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	C	XM_046861		95609815	-1	no_errors	ENST00000395506	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNFX1	57169	genome.wustl.edu	37	20	47895230	47895230	+	5'Flank	SNP	G	G	C			TCGA-LP-A4AW-01A-11D-A243-09	TCGA-LP-A4AW-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	42a70aaa-1ae4-4a80-bb04-d0bf0ed8cf2d	dc7ed67b-fb7d-4b7f-b4ba-21db7bfe7a48	g.chr20:47895230G>C	ENST00000396105.1	-	0	0				SNORD12C_ENST00000386307.1_RNA|ZFAS1_ENST00000417721.1_RNA|SNORD12B_ENST00000410433.1_RNA|ZFAS1_ENST00000326677.5_RNA|ZFAS1_ENST00000450535.1_RNA|ZFAS1_ENST00000428008.1_RNA|ZNFX1_ENST00000371754.4_5'Flank|ZFAS1_ENST00000371743.3_RNA|SNORD12_ENST00000391002.1_RNA|ZFAS1_ENST00000458653.1_RNA|ZNFX1_ENST00000371752.1_5'Flank|ZFAS1_ENST00000441722.1_RNA	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TTGCAGTCAGGCTTCATACGC	0.517																																																	0																																										SO:0001631	upstream_gene_variant	441951			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696		20.37:g.47895230G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	RNA	SNP	-	NULL	ENST00000396105.1	37	NULL	CCDS13417.1	20																																																																																			ZNFX1-AS1	-	-		0.517	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1-AS1	HGNC	protein_coding	OTTHUMT00000079647.2	G	NM_021035		47895230	+1	no_errors	ENST00000326677	ensembl	human	known	70_37	rna	SNP	0.000	C
