#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACSS2	55902	genome.wustl.edu	37	20	33513535	33513535	+	Silent	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr20:33513535C>T	ENST00000360596.2	+	15	1903	c.1692C>T	c.(1690-1692)atC>atT	p.I564I	ACSS2_ENST00000253382.5_Silent_p.I577I|ACSS2_ENST00000476922.1_3'UTR|ACSS2_ENST00000336325.4_Silent_p.I514I	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	564					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ATTACTGGATCACTGGCAGGA	0.498																																																	0													90.0	87.0	88.0					20																	33513535		2203	4300	6503	SO:0001819	synonymous_variant	55902			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1692C>T	20.37:g.33513535C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_Acyl-CoA_synth_DUF3448	p.S173L	ENST00000360596.2	37	c.518	CCDS13243.1	20																																																																																			ACSS2	-	NULL		0.498	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	C	NM_018677		33513535	+1	no_errors	ENST00000480978	ensembl	human	known	70_37	missense	SNP	1.000	T
ADRA1B	147	genome.wustl.edu	37	5	159344627	159344627	+	Missense_Mutation	SNP	G	G	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr5:159344627G>T	ENST00000306675.3	+	1	838	c.715G>T	c.(715-717)Gca>Tca	p.A239S		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	239					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	GAACCTAGAGGCAGGAGTCAT	0.522																																																	0													126.0	123.0	124.0					5																	159344627		2203	4300	6503	SO:0001583	missense	147			L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.715G>T	5.37:g.159344627G>T	ENSP00000306662:p.Ala239Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0LPE1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Adrene_rcpt_A1B,prints_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.A239S	ENST00000306675.3	37	c.715	CCDS4347.1	5	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240115	0.58995	.	.	ENSG00000170214	ENST00000306675	T	0.71579	-0.58	5.93	5.93	0.95920	GPCR, rhodopsin-like superfamily (1);	0.094754	0.64402	D	0.000001	T	0.60470	0.2271	N	0.11870	0.19	0.51233	D	0.99991	B	0.33379	0.41	B	0.41174	0.349	T	0.55903	-0.8067	10	0.15066	T	0.55	.	18.9177	0.92512	0.0:0.0:1.0:0.0	.	239	P35368	ADA1B_HUMAN	S	239	ENSP00000306662:A239S	ENSP00000306662:A239S	A	+	1	0	ADRA1B	159277205	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	GCA	ADRA1B	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.522	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA1B	HGNC	protein_coding	OTTHUMT00000252676.1	G			159344627	+1	no_errors	ENST00000306675	ensembl	human	known	70_37	missense	SNP	1.000	T
AMZ1	155185	genome.wustl.edu	37	7	2740305	2740305	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr7:2740305C>T	ENST00000312371.4	+	2	588	c.220C>T	c.(220-222)Ccc>Tcc	p.P74S	AMZ1_ENST00000407112.1_Missense_Mutation_p.P74S	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	74							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		ACCCGAGGCTCCCGAGGACTT	0.667																																																	0													57.0	65.0	62.0					7																	2740305		2203	4300	6503	SO:0001583	missense	155185			AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.220C>T	7.37:g.2740305C>T	ENSP00000308149:p.Pro74Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRS0|Q8TF51	Missense_Mutation	SNP	pfam_Pept_M54_archaemetzincn	p.P74S	ENST00000312371.4	37	c.220	CCDS34589.1	7	.	.	.	.	.	.	.	.	.	.	C	21.7	4.180821	0.78677	.	.	ENSG00000174945	ENST00000312371;ENST00000407112	T;T	0.18174	2.23;2.23	4.34	4.34	0.51931	.	0.000000	0.64402	D	0.000007	T	0.43033	0.1229	M	0.78049	2.395	0.46279	D	0.998966	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.44236	-0.9341	10	0.54805	T	0.06	-19.0328	15.04	0.71781	0.0:1.0:0.0:0.0	.	74;74	B3KRS0;Q400G9	.;AMZ1_HUMAN	S	74	ENSP00000308149:P74S;ENSP00000386020:P74S	ENSP00000308149:P74S	P	+	1	0	AMZ1	2706831	0.998000	0.40836	0.895000	0.35142	0.847000	0.48162	5.435000	0.66532	1.969000	0.57287	0.561000	0.74099	CCC	AMZ1	-	NULL		0.667	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	C	NM_133463		2740305	+1	no_errors	ENST00000312371	ensembl	human	known	70_37	missense	SNP	0.998	T
ARNT2	9915	genome.wustl.edu	37	15	80762742	80762742	+	Silent	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr15:80762742C>T	ENST00000303329.4	+	4	543	c.378C>T	c.(376-378)ggC>ggT	p.G126G	ARNT2_ENST00000533983.1_Silent_p.G115G|ARNT2_ENST00000531595.3_3'UTR|ARNT2_ENST00000527771.1_Silent_p.G115G	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	126					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			CCACCGATGGCGCGTACAAGC	0.572																																																	0													101.0	72.0	82.0					15																	80762742		2203	4300	6503	SO:0001819	synonymous_variant	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.378C>T	15.37:g.80762742C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIS7|O15024|Q8IYC2	Silent	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.G126	ENST00000303329.4	37	c.378	CCDS32307.1	15																																																																																			ARNT2	-	superfamily_HLH_dom		0.572	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	HGNC	protein_coding	OTTHUMT00000384389.2	C			80762742	+1	no_errors	ENST00000303329	ensembl	human	known	70_37	silent	SNP	0.998	T
ATG2B	55102	genome.wustl.edu	37	14	96811053	96811053	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr14:96811053C>G	ENST00000359933.4	-	4	1412	c.519G>C	c.(517-519)ttG>ttC	p.L173F		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	173					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GTTCAATTCTCAAAACAGTAT	0.313																																																	0													55.0	51.0	52.0					14																	96811053		1801	4056	5857	SO:0001583	missense	55102			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.519G>C	14.37:g.96811053C>G	ENSP00000353010:p.Leu173Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.L173F	ENST00000359933.4	37	c.519	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148788	0.37923	.	.	ENSG00000066739	ENST00000359933	T	0.57752	0.38	5.66	4.76	0.60689	.	0.204275	0.32533	U	0.005962	T	0.28632	0.0709	N	0.04636	-0.2	0.38580	D	0.950166	B	0.15141	0.012	B	0.11329	0.006	T	0.12708	-1.0537	10	0.33940	T	0.23	.	9.3375	0.38060	0.2476:0.6848:0.0:0.0676	.	173	Q96BY7	ATG2B_HUMAN	F	173	ENSP00000353010:L173F	ENSP00000353010:L173F	L	-	3	2	ATG2B	95880806	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.248000	0.32827	1.498000	0.48600	0.655000	0.94253	TTG	ATG2B	-	NULL		0.313	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	C	NM_018036		96811053	-1	no_errors	ENST00000359933	ensembl	human	known	70_37	missense	SNP	1.000	G
BACH1	571	genome.wustl.edu	37	21	30698588	30698588	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr21:30698588C>T	ENST00000399921.1	+	3	686	c.443C>T	c.(442-444)tCa>tTa	p.S148L	BACH1_ENST00000286800.3_Missense_Mutation_p.S148L	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						TGCTTTTCATCACACTGTCAG	0.368																																																	0													75.0	78.0	77.0					21																	30698588		2203	4300	6503	SO:0001583	missense	571			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.443C>T	21.37:g.30698588C>T	ENSP00000382805:p.Ser148Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.S148L	ENST00000399921.1	37	c.443	CCDS13585.1	21	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029431	0.35797	.	.	ENSG00000156273	ENST00000286800;ENST00000399921;ENST00000451655;ENST00000447177;ENST00000435072	T;T;T;T;T	0.77358	-0.65;-0.65;-0.98;-0.98;-1.09	5.45	5.45	0.79879	.	0.626601	0.15550	N	0.256462	T	0.67031	0.2850	N	0.24115	0.695	0.09310	N	1	B	0.28713	0.22	B	0.29267	0.1	T	0.57894	-0.7732	10	0.33940	T	0.23	-4.9645	14.4233	0.67198	0.1826:0.8174:0.0:0.0	.	148	O14867	BACH1_HUMAN	L	148	ENSP00000286800:S148L;ENSP00000382805:S148L;ENSP00000400576:S148L;ENSP00000408605:S148L;ENSP00000392202:S148L	ENSP00000286800:S148L	S	+	2	0	BACH1	29620459	0.000000	0.05858	0.318000	0.25279	0.704000	0.40688	0.903000	0.28475	2.731000	0.93534	0.591000	0.81541	TCA	BACH1	-	NULL		0.368	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	C	NM_206866		30698588	+1	no_errors	ENST00000286800	ensembl	human	known	70_37	missense	SNP	0.042	T
C1orf85	112770	genome.wustl.edu	37	1	156263856	156263856	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:156263856G>A	ENST00000362007.1	-	4	777	c.751C>T	c.(751-753)Cag>Tag	p.Q251*	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	251					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					TGCTGCTCCTGCATTGAGGGG	0.607																																																	0													113.0	110.0	111.0					1																	156263856		2203	4300	6503	SO:0001587	stop_gained	112770			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.751C>T	1.37:g.156263856G>A	ENSP00000354553:p.Gln251*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Nonsense_Mutation	SNP	NULL	p.Q251*	ENST00000362007.1	37	c.751	CCDS1139.1	1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047127	0.36085	.	.	ENSG00000198715	ENST00000362007;ENST00000368264	.	.	.	5.53	1.04	0.20106	.	0.786615	0.12075	N	0.501838	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-13.8142	8.9618	0.35851	0.0:0.1192:0.4641:0.4166	.	.	.	.	X	251;165	.	ENSP00000354553:Q251X	Q	-	1	0	C1orf85	154530480	0.988000	0.35896	0.093000	0.20910	0.145000	0.21501	1.081000	0.30791	0.625000	0.30304	0.462000	0.41574	CAG	C1orf85	-	NULL		0.607	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf85	HGNC	protein_coding	OTTHUMT00000052108.1	G	NM_144580		156263856	-1	no_errors	ENST00000362007	ensembl	human	known	70_37	nonsense	SNP	0.475	A
C1orf21	81563	genome.wustl.edu	37	1	184446657	184446657	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:184446657C>T	ENST00000235307.6	+	2	449	c.14C>T	c.(13-15)tCc>tTc	p.S5F		NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21	5										breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		GGCTGTGCCTCCGCCAAGCAT	0.458																																																	0													76.0	69.0	71.0					1																	184446657		2203	4300	6503	SO:0001583	missense	81563			AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.14C>T	1.37:g.184446657C>T	ENSP00000235307:p.Ser5Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R551	Missense_Mutation	SNP	NULL	p.S5F	ENST00000235307.6	37	c.14	CCDS1362.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751645	0.89753	.	.	ENSG00000116667	ENST00000235307	.	.	.	5.4	5.4	0.78164	.	0.113014	0.64402	D	0.000005	T	0.67524	0.2902	L	0.29908	0.895	0.80722	D	1	D	0.58970	0.984	D	0.74348	0.983	T	0.70436	-0.4872	9	0.87932	D	0	.	18.5099	0.90913	0.0:1.0:0.0:0.0	.	5	Q9H246	CA021_HUMAN	F	5	.	ENSP00000235307:S5F	S	+	2	0	C1orf21	182713280	1.000000	0.71417	0.999000	0.59377	1.000000	0.99986	5.458000	0.66679	2.687000	0.91594	0.655000	0.94253	TCC	C1orf21	-	NULL		0.458	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf21	HGNC	protein_coding	OTTHUMT00000085784.2	C	NM_030806		184446657	+1	no_errors	ENST00000235307	ensembl	human	known	70_37	missense	SNP	1.000	T
SMIM14	201895	genome.wustl.edu	37	4	39606751	39606751	+	Silent	SNP	T	T	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr4:39606751T>C	ENST00000295958.5	-	2	401	c.15A>G	c.(13-15)ggA>ggG	p.G5G	SMIM14_ENST00000511809.1_Silent_p.G5G|SMIM14_ENST00000510628.1_Intron	NM_174921.1	NP_777581.1	Q96QK8	SIM14_HUMAN	small integral membrane protein 14	5						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											AGGGATCAAATCCACCTTCTG	0.378																																																	0													196.0	158.0	171.0					4																	39606751		2203	4300	6503	SO:0001819	synonymous_variant	201895			BC008502	CCDS3456.1	4p14	2014-02-10	2012-12-03	2012-12-03	ENSG00000163683	ENSG00000163683			27321	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 34"""	C4orf34		15231747, 24499674, 23759569	Standard	NM_174921		Approved	FLJ13289	uc003guo.3	Q96QK8	OTTHUMG00000128581	ENST00000295958.5:c.15A>G	4.37:g.39606751T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Uncharacterised_CD034/YQF4	p.G5	ENST00000295958.5	37	c.15	CCDS3456.1	4																																																																																			C4orf34	-	pfam_Uncharacterised_CD034/YQF4		0.378	SMIM14-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C4orf34	HGNC	protein_coding	OTTHUMT00000250434.4	T	NM_174921		39606751	-1	no_errors	ENST00000295958	ensembl	human	known	70_37	silent	SNP	1.000	C
CDC27	996	genome.wustl.edu	37	17	45234397	45234397	+	Missense_Mutation	SNP	G	G	A	rs7350908		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:45234397G>A	ENST00000066544.3	-	7	817	c.724C>T	c.(724-726)Cct>Tct	p.P242S	CDC27_ENST00000531206.1_Missense_Mutation_p.P242S|CDC27_ENST00000446365.2_Missense_Mutation_p.P181S|CDC27_ENST00000527547.1_Missense_Mutation_p.P242S|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	242					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						ACAGTATCAGGTGAAATTACA	0.363																																																	0													44.0	48.0	47.0					17																	45234397		2191	4293	6484	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.724C>T	17.37:g.45234397G>A	ENSP00000066544:p.Pro242Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P242S	ENST00000066544.3	37	c.724	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407694	0.42715	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67523	-0.26;-0.27;0.01;-0.27;0.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.51517	0.1679	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.26195	0.0;0.014;0.0;0.144	B;B;B;B	0.20955	0.001;0.008;0.001;0.032	T	0.50004	-0.8878	10	0.06099	T	0.92	-16.7932	16.7505	0.85484	0.0:0.0:1.0:0.0	rs7350908;rs52796638;rs7350908	181;242;242;242	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	242;242;181;242;242	ENSP00000066544:P242S;ENSP00000434614:P242S;ENSP00000392802:P181S;ENSP00000437339:P242S;ENSP00000432105:P242S	ENSP00000066544:P242S	P	-	1	0	CDC27	42589396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.436000	0.80404	2.555000	0.86185	0.460000	0.39030	CCT	CDC27	-	NULL		0.363	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2	G			45234397	-1	no_errors	ENST00000531206	ensembl	human	known	70_37	missense	SNP	1.000	A
CDH4	1002	genome.wustl.edu	37	20	60498574	60498574	+	Silent	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr20:60498574G>C	ENST00000360469.5	+	10	1528	c.1440G>C	c.(1438-1440)ctG>ctC	p.L480L	CDH4_ENST00000543233.1_Silent_p.L406L	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	480	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGGCGCCCCTGGCCAGCGGAA	0.577																																																	0													86.0	78.0	80.0					20																	60498574		2203	4300	6503	SO:0001819	synonymous_variant	1002			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1440G>C	20.37:g.60498574G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin	p.L480	ENST00000360469.5	37	c.1440	CCDS13488.1	20																																																																																			CDH4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.577	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	G	NM_001794		60498574	+1	no_errors	ENST00000360469	ensembl	human	known	70_37	silent	SNP	1.000	C
CELP	1057	genome.wustl.edu	37	9	135962599	135962600	+	RNA	INS	-	-	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr9:135962599_135962600insG	ENST00000411440.2	+	0	1106_1107					NR_001275.2				carboxyl ester lipase pseudogene																		CCTGTGTCCCCCACAGATGACT	0.624																																																	0																																												1057			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962599_135962600insG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	-	NM_001808		135962600	+1	no_errors	ENST00000411440	ensembl	human	known	70_37	rna	INS	0.184:0.043	G
CELP	1057	genome.wustl.edu	37	9	135962600	135962601	+	RNA	INS	-	-	T	rs143741686		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr9:135962600_135962601insT	ENST00000411440.2	+	0	1107_1108					NR_001275.2				carboxyl ester lipase pseudogene																		CTGTGTCCCCCACAGATGACTC	0.624																																																	0																																												1057			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962600_135962601insT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	-	NM_001808		135962601	+1	no_errors	ENST00000411440	ensembl	human	known	70_37	rna	INS	0.043:0.023	T
CHD7	55636	genome.wustl.edu	37	8	61778087	61778087	+	Silent	SNP	T	T	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:61778087T>C	ENST00000423902.2	+	38	9068	c.8589T>C	c.(8587-8589)gcT>gcC	p.A2863A	CHD7_ENST00000524602.1_Silent_p.A814A	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2863					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCACAGATGCTGTTTCGGCTG	0.507																																																	0													94.0	103.0	100.0					8																	61778087		2136	4244	6380	SO:0001819	synonymous_variant	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.8589T>C	8.37:g.61778087T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A2863	ENST00000423902.2	37	c.8589	CCDS47865.1	8																																																																																			CHD7	-	NULL		0.507	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	T	XM_098762		61778087	+1	no_errors	ENST00000307121	ensembl	human	known	70_37	silent	SNP	1.000	C
CSE1L	1434	genome.wustl.edu	37	20	47691934	47691934	+	Silent	SNP	C	C	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr20:47691934C>A	ENST00000262982.2	+	12	1335	c.1212C>A	c.(1210-1212)atC>atA	p.I404I	CSE1L_ENST00000396192.3_Silent_p.I348I|CSE1L_ENST00000542325.1_Silent_p.I187I	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	404					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TGACAGGAATCTTCTCTGGTT	0.403																																																	0													138.0	132.0	134.0					20																	47691934		2203	4300	6503	SO:0001819	synonymous_variant	1434			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1212C>A	20.37:g.47691934C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	pfam_CAS_CSE1_C,pfam_Exportin/Importin_Cse1-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.I404	ENST00000262982.2	37	c.1212	CCDS13412.1	20																																																																																			CSE1L	-	pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold		0.403	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2	C	NM_001316		47691934	+1	no_errors	ENST00000262982	ensembl	human	known	70_37	silent	SNP	1.000	A
DNAI2	64446	genome.wustl.edu	37	17	72285876	72285876	+	Splice_Site	SNP	G	G	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:72285876G>T	ENST00000311014.6	+	5	677		c.e5+1		DNAI2_ENST00000307504.5_Splice_Site|DNAI2_ENST00000579490.1_Splice_Site|DNAI2_ENST00000582036.1_Splice_Site|DNAI2_ENST00000446837.2_Splice_Site			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2						cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TGGGACCTGGGTGAGAAGCAG	0.627									Kartagener syndrome																																								0													54.0	52.0	53.0					17																	72285876		2203	4300	6503	SO:0001630	splice_region_variant	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.610+1G>T	17.37:g.72285876G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Splice_Site	SNP	-	e4+1	ENST00000311014.6	37	c.610+1	CCDS11697.1	17	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232568	0.79688	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6058	0.88037	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAI2	69797471	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	8.944000	0.92980	2.157000	0.67596	0.491000	0.48974	.	DNAI2	-	-		0.627	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	G	NM_023036	Intron	72285876	+1	no_errors	ENST00000311014	ensembl	human	known	70_37	splice_site	SNP	1.000	T
DOT1L	84444	genome.wustl.edu	37	19	2210818	2210818	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr19:2210818C>T	ENST00000398665.3	+	14	1351	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	439					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCACGCTCAGACCGTGTC	0.692																																																	0													33.0	42.0	39.0					19																	2210818		2010	4153	6163	SO:0001587	stop_gained	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1315C>T	19.37:g.2210818C>T	ENSP00000381657:p.Gln439*	Somatic		WXS	Illumina HiSeq	Phase_IV	O60379|Q96JL1	Nonsense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.Q439*	ENST00000398665.3	37	c.1315	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551658	0.86127	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	.	.	.	4.84	4.84	0.62591	.	0.173300	0.50627	D	0.000104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.6181	16.9353	0.86202	0.0:1.0:0.0:0.0	.	.	.	.	X	439	.	ENSP00000221482:Q439X	Q	+	1	0	DOT1L	2161818	1.000000	0.71417	0.094000	0.20943	0.356000	0.29392	4.592000	0.61027	2.222000	0.72286	0.561000	0.74099	CAG	DOT1L	-	pirsf_Histone_H3-K79_MeTrfase_met		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	C	NM_032482		2210818	+1	no_errors	ENST00000398665	ensembl	human	known	70_37	nonsense	SNP	0.999	T
DZIP1L	199221	genome.wustl.edu	37	3	137816688	137816688	+	Splice_Site	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr3:137816688C>T	ENST00000327532.2	-	3	865	c.503G>A	c.(502-504)tGc>tAc	p.C168Y	DZIP1L_ENST00000469243.1_Splice_Site_p.C168Y	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	168					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						ACACAGGTGGCACTATACAGA	0.557											OREG0015831	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													53.0	41.0	45.0					3																	137816688		2203	4300	6503	SO:0001630	splice_region_variant	199221			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.502-1G>A	3.37:g.137816688C>T		Somatic	1636	WXS	Illumina HiSeq	Phase_IV	C9JUG5|Q96M38	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.C168Y	ENST00000327532.2	37	c.503	CCDS3096.1	3	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165318	0.78339	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.55052	0.54;0.54	5.14	5.14	0.70334	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.75347	0.3837	M	0.82323	2.585	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.986	T	0.79538	-0.1762	10	0.87932	D	0	-16.0786	17.7193	0.88345	0.0:1.0:0.0:0.0	.	168;168	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	Y	168	ENSP00000332148:C168Y;ENSP00000419486:C168Y	ENSP00000332148:C168Y	C	-	2	0	DZIP1L	139299378	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.021000	0.64072	2.531000	0.85337	0.655000	0.94253	TGC	DZIP1L	-	pfscan_Znf_C2H2		0.557	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	C	NM_173543	Missense_Mutation	137816688	-1	no_errors	ENST00000327532	ensembl	human	known	70_37	missense	SNP	1.000	T
EGFL8	80864	genome.wustl.edu	37	6	32134696	32134696	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr6:32134696C>T	ENST00000395512.1	+	5	449	c.344C>T	c.(343-345)gCc>gTc	p.A115V	PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000490711.1_5'Flank|EGFL8_ENST00000333845.6_Missense_Mutation_p.A115V			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	115	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						GCCATCTGCGCCAAGCCTTGC	0.662																																																	0													58.0	58.0	58.0					6																	32134696		1511	2709	4220	SO:0001583	missense	80864			U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.344C>T	6.37:g.32134696C>T	ENSP00000378888:p.Ala115Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	pfam_EMI_domain,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_EMI_domain	p.A115V	ENST00000395512.1	37	c.344	CCDS4743.1	6	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075165	0.36566	.	.	ENSG00000241404	ENST00000333845;ENST00000395512;ENST00000432129	D;D;T	0.92647	-3.08;-3.08;1.89	6.08	5.21	0.72293	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.74921	0.3780	N	0.17278	0.47	0.22851	N	0.998658	B	0.27910	0.193	B	0.27608	0.081	T	0.65146	-0.6239	9	0.27785	T	0.31	-1.8942	11.2047	0.48762	0.0:0.9164:0.0:0.0836	.	115	Q99944	EGFL8_HUMAN	V	115	ENSP00000333380:A115V;ENSP00000378888:A115V;ENSP00000401694:A115V	ENSP00000333380:A115V	A	+	2	0	EGFL8	32242674	0.004000	0.15560	0.997000	0.53966	0.859000	0.49053	0.266000	0.18534	1.586000	0.49944	0.655000	0.94253	GCC	EGFL8	-	pfam_EG-like_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.662	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL8	HGNC	protein_coding	OTTHUMT00000076463.3	C	NM_030652		32134696	+1	no_errors	ENST00000333845	ensembl	human	known	70_37	missense	SNP	0.977	T
SNX29P2	440352	genome.wustl.edu	37	16	29496834	29496834	+	Silent	SNP	C	C	T	rs199632829	byFrequency	TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr16:29496834C>T	ENST00000354563.5	-	3	851	c.441G>A	c.(439-441)aaG>aaA	p.K147K	SNX29P2_ENST00000398878.3_lincRNA																endometrium(1)|kidney(1)	2						CGGGAGGTGTCTTGAGATTAT	0.567																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000354563.5:c.441G>A	16.37:g.29496834C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_NPIP	p.K147	ENST00000354563.5	37	c.441		16																																																																																			61E3.4	-	pfam_NPIP		0.567	RP11-231C14.4-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000169203	Uniprot_genename	protein_coding		C			29496834	-1	no_errors	ENST00000354563	ensembl	human	known	70_37	silent	SNP	0.001	T
RP11-706O15.1	0	genome.wustl.edu	37	X	3761463	3761463	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chrX:3761463C>G	ENST00000425492.2	-	1	435	c.61G>C	c.(61-63)Gag>Cag	p.E21Q																								GGGCAGAGCTCGGGCGCCCAG	0.761																																																	0																																										SO:0001583	missense	0																														ENST00000425492.2:c.61G>C	X.37:g.3761463C>G	ENSP00000409862:p.Glu21Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E21Q	ENST00000425492.2	37	c.61		X	.	.	.	.	.	.	.	.	.	.	-	6.520	0.464175	0.12402	.	.	ENSG00000205664	ENST00000425492	T	0.49139	0.79	0.118	0.118	0.14667	.	.	.	.	.	T	0.42471	0.1204	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51204	-0.8735	4	0.36615	T	0.2	.	.	.	.	.	.	.	.	Q	21	ENSP00000409862:E21Q	ENSP00000409862:E21Q	E	-	1	0	RP11-706O15.1	3771463	0.006000	0.16342	0.007000	0.13788	0.007000	0.05969	1.467000	0.35321	0.179000	0.19938	0.181000	0.17075	GAG	RP11-706O15.1	-	NULL		0.761	RP11-706O15.1-009	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000205664	Clone_based_vega_gene	protein_coding	OTTHUMT00000144334.1	C			3761463	-1	no_errors	ENST00000425492	ensembl	human	known	70_37	missense	SNP	0.007	G
EYA1	2138	genome.wustl.edu	37	8	72129214	72129214	+	Silent	SNP	G	G	A	rs372488542		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:72129214G>A	ENST00000340726.3	-	13	1824	c.1185C>T	c.(1183-1185)aaC>aaT	p.N395N	EYA1_ENST00000419131.1_Silent_p.N360N|EYA1_ENST00000388742.4_Silent_p.N395N|EYA1_ENST00000303824.7_Silent_p.N389N|EYA1_ENST00000388741.2_Silent_p.N361N|EYA1_ENST00000388743.2_Silent_p.N394N|EYA1_ENST00000388740.3_Silent_p.N362N	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	395					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GGTCCTGTCCGTTATCATCTG	0.343																																																	0								G	,,,	0,4406		0,0,2203	136.0	128.0	131.0		1185,1185,1080,1086	-5.5	0.9	8		131	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	EYA1	NM_000503.4,NM_172058.2,NM_172059.2,NM_172060.2	,,,	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	,,,	395/593,395/593,360/558,362/560	72129214	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	2138			AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1185C>T	8.37:g.72129214G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.N395	ENST00000340726.3	37	c.1185	CCDS34906.1	8																																																																																			EYA1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA		0.343	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	HGNC	protein_coding	OTTHUMT00000313788.2	G	NM_000503, NM_172060		72129214	-1	no_errors	ENST00000340726	ensembl	human	known	70_37	silent	SNP	0.832	A
FERD3L	222894	genome.wustl.edu	37	7	19184752	19184752	+	Silent	SNP	C	C	T	rs73079402		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr7:19184752C>T	ENST00000275461.3	-	1	292	c.234G>A	c.(232-234)gaG>gaA	p.E78E	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	78	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						gctcctcttcctcctcctctt	0.627																																																	0													71.0	51.0	58.0					7																	19184752		2203	4300	6503	SO:0001819	synonymous_variant	222894			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.234G>A	7.37:g.19184752C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q495K0	Silent	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.E78	ENST00000275461.3	37	c.234	CCDS5368.1	7																																																																																			FERD3L	-	NULL		0.627	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	HGNC	protein_coding	OTTHUMT00000207627.1	C			19184752	-1	no_errors	ENST00000275461	ensembl	human	known	70_37	silent	SNP	0.998	T
FLG2	388698	genome.wustl.edu	37	1	152324211	152324211	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:152324211C>G	ENST00000388718.5	-	3	6123	c.6051G>C	c.(6049-6051)caG>caC	p.Q2017H	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2017					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGACCCTCTCTGTGTGGACT	0.532																																																	0													390.0	363.0	372.0					1																	152324211		2201	4300	6501	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6051G>C	1.37:g.152324211C>G	ENSP00000373370:p.Gln2017His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Q2017H	ENST00000388718.5	37	c.6051	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	8.696	0.908503	0.17833	.	.	ENSG00000143520	ENST00000388718	T	0.03889	3.77	3.9	-7.81	0.01210	.	.	.	.	.	T	0.00967	0.0032	L	0.44542	1.39	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.44952	-0.9294	9	0.44086	T	0.13	4.6727	1.8998	0.03265	0.228:0.1738:0.1125:0.4857	.	2017	Q5D862	FILA2_HUMAN	H	2017	ENSP00000373370:Q2017H	ENSP00000373370:Q2017H	Q	-	3	2	FLG2	150590835	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.925000	0.00333	-1.970000	0.01003	0.297000	0.19635	CAG	FLG2	-	NULL		0.532	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	C	NM_001014342		152324211	-1	no_errors	ENST00000388718	ensembl	human	known	70_37	missense	SNP	0.000	G
FOXN1	8456	genome.wustl.edu	37	17	26851603	26851603	+	Missense_Mutation	SNP	G	G	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:26851603G>T	ENST00000226247.2	+	2	235	c.206G>T	c.(205-207)cGc>cTc	p.R69L	FOXN1_ENST00000579795.1_Missense_Mutation_p.R69L	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	69			R -> C (in dbSNP:rs2071587).		defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R69H(2)		endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					CACAGCCCCCGCATTGCGTCA	0.647																																																	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)											44.0	48.0	47.0					17																	26851603		2203	4300	6503	SO:0001583	missense	8456			Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.206G>T	17.37:g.26851603G>T	ENSP00000226247:p.Arg69Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9Q7|O15352	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R69L	ENST00000226247.2	37	c.206	CCDS11232.1	17	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827014	0.50739	.	.	ENSG00000109101	ENST00000226247	D	0.92249	-3.0	5.54	5.54	0.83059	.	0.063200	0.64402	D	0.000002	D	0.84515	0.5489	N	0.08118	0	0.29529	N	0.85291	B	0.02656	0.0	B	0.01281	0.0	T	0.79157	-0.1919	10	0.72032	D	0.01	.	16.5484	0.84457	0.0:0.0:1.0:0.0	.	69	O15353	FOXN1_HUMAN	L	69	ENSP00000226247:R69L	ENSP00000226247:R69L	R	+	2	0	FOXN1	23875730	0.965000	0.33210	0.972000	0.41901	0.368000	0.29767	1.535000	0.36061	2.768000	0.95171	0.561000	0.74099	CGC	FOXN1	-	NULL		0.647	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN1	HGNC	protein_coding	OTTHUMT00000255832.1	G			26851603	+1	no_errors	ENST00000226247	ensembl	human	known	70_37	missense	SNP	0.998	T
FRY	10129	genome.wustl.edu	37	13	32691498	32691498	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr13:32691498G>A	ENST00000380250.3	+	4	848	c.352G>A	c.(352-354)Gag>Aag	p.E118K		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	118						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTCCCTTTCTGAGTACTGCCT	0.403																																																	0													92.0	88.0	89.0					13																	32691498		1910	4142	6052	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.352G>A	13.37:g.32691498G>A	ENSP00000369600:p.Glu118Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E118K	ENST00000380250.3	37	c.352	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.420335	0.96111	.	.	ENSG00000073910	ENST00000380250;ENST00000436046;ENST00000267067	T	0.24151	1.87	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.45696	0.1355	M	0.84082	2.675	0.80722	D	1	P	0.40875	0.731	P	0.46479	0.518	T	0.53429	-0.8440	10	0.87932	D	0	.	18.9435	0.92612	0.0:0.0:1.0:0.0	.	118	Q5TBA9	FRY_HUMAN	K	118;115;84	ENSP00000369600:E118K	ENSP00000267067:E84K	E	+	1	0	FRY	31589498	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.311000	0.96282	2.533000	0.85409	0.655000	0.94253	GAG	FRY	-	NULL		0.403	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	G	NM_023037		32691498	+1	no_errors	ENST00000380250	ensembl	human	known	70_37	missense	SNP	1.000	A
GATSL3	652968	genome.wustl.edu	37	22	30682031	30682031	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr22:30682031C>T	ENST00000407689.3	-	7	929	c.800G>A	c.(799-801)cGc>cAc	p.R267H	GATSL3_ENST00000459785.1_Intron|GATSL3_ENST00000404953.3_Missense_Mutation_p.R229H|RP1-130H16.18_ENST00000447976.1_3'UTR	NM_001037666.2	NP_001032755.1	Q8WTX7	GATL3_HUMAN	GATS protein-like 3	267										breast(1)|endometrium(1)|lung(1)	3						TCCACCGATGCGCACCATCCT	0.672																																																	0													34.0	43.0	40.0					22																	30682031		2026	4177	6203	SO:0001583	missense	652968				CCDS43001.1	22q12	2010-06-23			ENSG00000239282	ENSG00000239282			34423	protein-coding gene	gene with protein product							Standard	NM_001037666		Approved			Q8WTX7	OTTHUMG00000150929	ENST00000407689.3:c.800G>A	22.37:g.30682031C>T	ENSP00000384183:p.Arg267His	Somatic		WXS	Illumina HiSeq	Phase_IV	O76052|Q96ND9|Q9UIE8	Missense_Mutation	SNP	NULL	p.R267H	ENST00000407689.3	37	c.800	CCDS43001.1	22	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864049	0.91511	.	.	ENSG00000239282;ENSG00000239282;ENSG00000248751	ENST00000407689;ENST00000404953;ENST00000434291	T	0.09350	2.99	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.38772	0.1053	M	0.85630	2.765	0.51482	D	0.999927	D;P	0.89917	1.0;0.809	D;B	0.85130	0.997;0.159	T	0.42682	-0.9437	10	0.72032	D	0.01	-13.875	16.9605	0.86271	0.0:1.0:0.0:0.0	.	267;229	Q8WTX7;B7WPJ3	GATL3_HUMAN;.	H	267;229;418	ENSP00000401535:R418H	ENSP00000385868:R229H	R	-	2	0	RP1-130H16.18;GATSL3	29012031	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.055000	0.71103	2.252000	0.74401	0.462000	0.41574	CGC	GATSL3	-	NULL		0.672	GATSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATSL3	HGNC	protein_coding	OTTHUMT00000320581.2	C	NM_001037666		30682031	-1	no_errors	ENST00000407689	ensembl	human	known	70_37	missense	SNP	1.000	T
HIST1H4C	8364	genome.wustl.edu	37	6	26104310	26104310	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr6:26104310G>C	ENST00000377803.2	+	1	207	c.135G>C	c.(133-135)aaG>aaC	p.K45N		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	45					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GTGGCGTCAAGCGCATTTCCG	0.547																																																	0													69.0	67.0	68.0					6																	26104310		2203	4300	6503	SO:0001583	missense	8364			X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.135G>C	6.37:g.26104310G>C	ENSP00000367034:p.Lys45Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.K45N	ENST00000377803.2	37	c.135	CCDS4583.1	6	.	.	.	.	.	.	.	.	.	.	.	16.76	3.211369	0.58343	.	.	ENSG00000197061	ENST00000377803	T	0.69040	-0.37	4.57	2.79	0.32731	.	0.000000	0.85682	D	0.000000	T	0.64516	0.2605	.	.	.	0.50039	D	0.999845	.	.	.	.	.	.	T	0.68503	-0.5391	7	0.87932	D	0	.	9.9394	0.41572	0.1655:0.0:0.8345:0.0	.	.	.	.	N	45	ENSP00000367034:K45N	ENSP00000367034:K45N	K	+	3	2	HIST1H4C	26212289	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	4.759000	0.62227	0.669000	0.31146	0.561000	0.74099	AAG	HIST1H4C	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4		0.547	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	HGNC	protein_coding	OTTHUMT00000040092.2	G	NM_003542		26104310	+1	no_errors	ENST00000377803	ensembl	human	known	70_37	missense	SNP	1.000	C
HTR4	3360	genome.wustl.edu	37	5	147889077	147889077	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr5:147889077G>C	ENST00000377888.3	-	6	1156	c.1018C>G	c.(1018-1020)Ctg>Gtg	p.L340V	HTR4_ENST00000360693.3_Missense_Mutation_p.L340V|HTR4_ENST00000520514.1_Missense_Mutation_p.L340V|HTR4_ENST00000521735.1_Missense_Mutation_p.L340V|HTR4_ENST00000517929.1_Missense_Mutation_p.L340V|HTR4_ENST00000314512.6_Missense_Mutation_p.L340V|HTR4_ENST00000521530.1_Missense_Mutation_p.L340V|HTR4_ENST00000362016.2_Missense_Mutation_p.L354V|HTR4_ENST00000354217.2_Missense_Mutation_p.L340V	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	340					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	GTCTGGCCCAGAATGGAAGGT	0.438																																					GBM(120;370 1604 14007 17804 41573)												0													107.0	94.0	98.0					5																	147889077		2203	4300	6503	SO:0001583	missense	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.1018C>G	5.37:g.147889077G>C	ENSP00000367120:p.Leu340Val	Somatic		WXS	Illumina HiSeq	Phase_IV	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn	p.L340V	ENST00000377888.3	37	c.1018	CCDS4291.1	5	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248625	0.39797	.	.	ENSG00000164270	ENST00000521530;ENST00000354217;ENST00000314512;ENST00000521735;ENST00000517929;ENST00000520514;ENST00000377888;ENST00000360693;ENST00000362016	T;T;T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.57;-0.57;-0.55;-0.54;-0.59;-0.55;-0.51	5.79	4.93	0.64822	.	0.063315	0.64402	D	0.000004	T	0.62696	0.2449	M	0.62723	1.935	0.42644	D	0.99342	P;B;B;B;B;B;B	0.35745	0.518;0.113;0.091;0.063;0.18;0.239;0.245	B;B;B;B;B;B;B	0.33620	0.08;0.031;0.103;0.108;0.108;0.167;0.05	T	0.58792	-0.7574	10	0.14252	T	0.57	.	9.9718	0.41759	0.1555:0.0:0.8445:0.0	.	340;340;340;354;340;340;340	C4WYH4;Q13639;Q712M9;Q13639-6;Q13639-3;Q13639-2;Q684M0	.;5HT4R_HUMAN;.;.;.;.;.	V	340;340;340;340;340;340;340;340;354	ENSP00000428320:L340V;ENSP00000346156:L340V;ENSP00000314906:L340V;ENSP00000430979:L340V;ENSP00000435904:L340V;ENSP00000427913:L340V;ENSP00000367120:L340V;ENSP00000353915:L340V;ENSP00000355037:L354V	ENSP00000314906:L340V	L	-	1	2	HTR4	147869270	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.254000	0.18314	1.452000	0.47756	0.563000	0.77884	CTG	HTR4	-	prints_5HT4_rcpt		0.438	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR4	HGNC	protein_coding	OTTHUMT00000252187.2	G	NM_000870		147889077	-1	no_errors	ENST00000360693	ensembl	human	known	70_37	missense	SNP	1.000	C
HTR4	3360	genome.wustl.edu	37	5	147889204	147889204	+	Silent	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr5:147889204G>A	ENST00000377888.3	-	6	1029	c.891C>T	c.(889-891)ttC>ttT	p.F297F	HTR4_ENST00000360693.3_Silent_p.F297F|HTR4_ENST00000520514.1_Silent_p.F297F|HTR4_ENST00000521735.1_Silent_p.F297F|HTR4_ENST00000517929.1_Silent_p.F297F|HTR4_ENST00000314512.6_Silent_p.F297F|HTR4_ENST00000521530.1_Silent_p.F297F|HTR4_ENST00000362016.2_Silent_p.F311F|HTR4_ENST00000354217.2_Silent_p.F297F	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	297					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	CGAGCCAGAGGAAAGCAGTCC	0.488																																					GBM(120;370 1604 14007 17804 41573)												0													94.0	93.0	94.0					5																	147889204		2203	4300	6503	SO:0001819	synonymous_variant	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.891C>T	5.37:g.147889204G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn	p.F297	ENST00000377888.3	37	c.891	CCDS4291.1	5																																																																																			HTR4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn		0.488	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR4	HGNC	protein_coding	OTTHUMT00000252187.2	G	NM_000870		147889204	-1	no_errors	ENST00000360693	ensembl	human	known	70_37	silent	SNP	1.000	A
INPP5K	51763	genome.wustl.edu	37	17	1416809	1416809	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:1416809C>T	ENST00000421807.2	-	3	587	c.199G>A	c.(199-201)Gcc>Acc	p.A67T	INPP5K_ENST00000406424.4_5'UTR|INPP5K_ENST00000542125.1_Missense_Mutation_p.A67T|INPP5K_ENST00000397335.3_Intron|INPP5K_ENST00000320345.6_5'UTR	NM_016532.3	NP_057616.2	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K	67	Catalytic. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|cellular response to cAMP (GO:0071320)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hormone stimulus (GO:0032870)|cellular response to insulin stimulus (GO:0032869)|cellular response to tumor necrosis factor (GO:0071356)|dephosphorylation (GO:0016311)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inositol phosphate dephosphorylation (GO:0046855)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of dephosphorylation (GO:0035305)|negative regulation of glucose transport (GO:0010829)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of stress fiber assembly (GO:0051497)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of renal water transport (GO:2001153)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|protein targeting to plasma membrane (GO:0072661)|regulation of glycogen biosynthetic process (GO:0005979)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	inositol bisphosphate phosphatase activity (GO:0016312)|inositol trisphosphate phosphatase activity (GO:0046030)|inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|lipid phosphatase activity (GO:0042577)|phosphatidylinositol phosphate 5-phosphatase activity (GO:0034595)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:0034485)|vasopressin receptor activity (GO:0005000)			endometrium(1)|large_intestine(7)|lung(3)|skin(1)	12						TCATTAAAGGCAGCATCGGAA	0.517																																																	0													211.0	193.0	199.0					17																	1416809		2203	4300	6503	SO:0001583	missense	51763				CCDS11004.1, CCDS11005.1	17p13.3	2008-09-09			ENSG00000132376	ENSG00000132376			33882	protein-coding gene	gene with protein product	"""skeletal muscle and kidney enriched inositol phosphatase"""	607875				10753883, 12536145	Standard	NM_016532		Approved	SKIP	uc002fsr.3	Q9BT40	OTTHUMG00000150648	ENST00000421807.2:c.199G>A	17.37:g.1416809C>T	ENSP00000413937:p.Ala67Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6I2|B2R750|D3DTH8|Q15733|Q9NPJ5|Q9P2R5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.A67T	ENST00000421807.2	37	c.199	CCDS11004.1	17	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639940	0.67244	.	.	ENSG00000132376	ENST00000350761;ENST00000542125	D	0.97710	-4.5	5.72	4.73	0.59995	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.182306	0.47852	D	0.000218	D	0.97427	0.9158	L	0.49778	1.585	0.80722	D	1	P;P	0.51240	0.908;0.943	P;P	0.57009	0.575;0.811	D	0.96637	0.9471	10	0.33940	T	0.23	-20.457	14.5756	0.68243	0.1472:0.8528:0.0:0.0	.	67;67	F5GXZ0;Q9BT40	.;INP5K_HUMAN	T	67	ENSP00000440147:A67T	ENSP00000254712:A67T	A	-	1	0	INPP5K	1363559	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	0.852000	0.27764	1.358000	0.45922	0.462000	0.41574	GCC	INPP5K	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.517	INPP5K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5K	HGNC	protein_coding	OTTHUMT00000319381.4	C			1416809	-1	no_errors	ENST00000421807	ensembl	human	known	70_37	missense	SNP	1.000	T
ITIH1	3697	genome.wustl.edu	37	3	52816048	52816048	+	Silent	SNP	C	C	T	rs372878494		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr3:52816048C>T	ENST00000273283.2	+	7	804	c.780C>T	c.(778-780)taC>taT	p.Y260Y	ITIH1_ENST00000542827.1_Silent_p.Y260Y|ITIH1_ENST00000487686.1_3'UTR|ITIH1_ENST00000540715.1_Silent_p.Y118Y|ITIH1_ENST00000537050.1_5'UTR	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	260					hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AGGTGACCTACGATGTCAGTC	0.592																																																	0								C	,,,	0,4406		0,0,2203	156.0	127.0	137.0		354,,,780	-10.2	0.2	3		137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,utr-5,utr-5,coding-synonymous	ITIH1	NM_001166434.1,NM_001166435.1,NM_001166436.1,NM_002215.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	118/770,,,260/912	52816048	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.780C>T	3.37:g.52816048C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.Y260	ENST00000273283.2	37	c.780	CCDS2864.1	3																																																																																			ITIH1	-	NULL		0.592	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	C	NM_002215		52816048	+1	no_errors	ENST00000273283	ensembl	human	known	70_37	silent	SNP	0.141	T
KIAA2022	340533	genome.wustl.edu	37	X	73962042	73962042	+	Missense_Mutation	SNP	T	T	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chrX:73962042T>G	ENST00000055682.6	-	3	2961	c.2350A>C	c.(2350-2352)Agt>Cgt	p.S784R		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	784					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AAAGTGGAACTCTTAGCAGCC	0.413																																																	0													95.0	89.0	91.0					X																	73962042		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2350A>C	X.37:g.73962042T>G	ENSP00000055682:p.Ser784Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.S784R	ENST00000055682.6	37	c.2350	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	T	13.87	2.364797	0.41902	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.29397	1.57;1.57	5.73	5.73	0.89815	.	0.359879	0.26919	N	0.021839	T	0.18882	0.0453	N	0.08118	0	0.24823	N	0.992572	B	0.06786	0.001	B	0.04013	0.001	T	0.16012	-1.0417	10	0.45353	T	0.12	-13.3707	15.0241	0.71653	0.0:0.0:0.0:1.0	.	784	Q5QGS0	K2022_HUMAN	R	784	ENSP00000362567:S784R;ENSP00000055682:S784R	ENSP00000055682:S784R	S	-	1	0	KIAA2022	73878767	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.698000	0.84413	1.930000	0.55929	0.486000	0.48141	AGT	KIAA2022	-	NULL		0.413	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	T	NM_001008537		73962042	-1	no_errors	ENST00000055682	ensembl	human	known	70_37	missense	SNP	1.000	G
KRT10	3858	genome.wustl.edu	37	17	38975036	38975037	+	Intron	INS	-	-	ACCT			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:38975036_38975037insACCT	ENST00000269576.5	-	7	1758				TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10						cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				AGTTTCTGCTGACCTTGGTCCC	0.495																																																	0																																										SO:0001627	intron_variant	3858			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1748+1->AGGT	17.37:g.38975037_38975040dupACCT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14664|Q8N175	Splice_Site	INS	-	e7+2	ENST00000269576.5	37	c.1748+2_1748+1	CCDS11377.1	17																																																																																			KRT10	-	-		0.495	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	HGNC	protein_coding	OTTHUMT00000257875.1	-	NM_000421		38975037	-1	no_errors	ENST00000269576	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	ACCT
LRFN1	57622	genome.wustl.edu	37	19	39805372	39805372	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr19:39805372G>A	ENST00000248668.4	-	1	604	c.605C>T	c.(604-606)gCg>gTg	p.A202V	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	202						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GGTCCCCTCCGCGATGTGGTC	0.622																																																	0													44.0	54.0	51.0					19																	39805372		2161	4273	6434	SO:0001583	missense	57622			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.605C>T	19.37:g.39805372G>A	ENSP00000248668:p.Ala202Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TBS9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A202V	ENST00000248668.4	37	c.605	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606014	0.66445	.	.	ENSG00000128011	ENST00000248668	T	0.57107	0.42	4.62	4.62	0.57501	.	0.000000	0.42682	D	0.000672	T	0.50463	0.1617	N	0.17474	0.49	0.35781	D	0.821658	D	0.56968	0.978	P	0.55161	0.77	T	0.63470	-0.6630	10	0.56958	D	0.05	.	14.9961	0.71433	0.0:0.0:1.0:0.0	.	202	Q9P244	LRFN1_HUMAN	V	202	ENSP00000248668:A202V	ENSP00000248668:A202V	A	-	2	0	LRFN1	44497212	0.339000	0.24784	0.995000	0.50966	0.988000	0.76386	2.698000	0.47068	2.395000	0.81488	0.555000	0.69702	GCG	LRFN1	-	smart_Leu-rich_rpt_typical-subtyp		0.622	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	G	NM_020862		39805372	-1	no_errors	ENST00000248668	ensembl	human	known	70_37	missense	SNP	0.987	A
LRRC63	220416	genome.wustl.edu	37	13	46802139	46802139	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr13:46802139C>T	ENST00000595396.1	+	2	578	c.578C>T	c.(577-579)tCg>tTg	p.S193L	LRRC63_ENST00000446175.1_Missense_Mutation_p.S193L			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	193										lung(1)|ovary(1)	2						CAGCACATCTCGAGAGACTTA	0.433																																																	0																																										SO:0001583	missense	220416				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.578C>T	13.37:g.46802139C>T	ENSP00000469337:p.Ser193Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TBN0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S193L	ENST00000595396.1	37	c.578		13	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.316086	0.01331	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.00966	5.49;5.53	4.12	-3.83	0.04269	.	0.570837	0.12843	N	0.434614	T	0.00412	0.0013	N	0.03050	-0.425	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.42207	-0.9465	10	0.19147	T	0.46	0.5017	3.4209	0.07393	0.3359:0.1941:0.0:0.4699	.	193	Q05C16	LRC63_HUMAN	L	193	ENSP00000368082:S193L;ENSP00000408828:S193L	ENSP00000368082:S193L	S	+	2	0	LRRC63	45700140	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.090000	0.15025	-0.646000	0.05452	-1.292000	0.01352	TCG	LRRC63	-	NULL		0.433	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	HGNC	protein_coding	OTTHUMT00000463266.1	C	XM_001718341		46802139	+1	no_errors	ENST00000446175	ensembl	human	known	70_37	missense	SNP	0.000	T
MT-ND5	4540	genome.wustl.edu	37	M	13361	13361	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chrM:13361G>A	ENST00000361567.2	+	1	1025	c.1025G>A	c.(1024-1026)tGc>tAc	p.C342Y	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	342					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACTATTTATGTGCTCCGGGTC	0.433																																																	0																																										SO:0001583	missense	4540					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1025G>A	M.37:g.13361G>A	ENSP00000354813:p.Cys342Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.C342Y	ENST00000361567.2	37	c.1025		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.433	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		G	YP_003024036		13361	+1	no_errors	ENST00000361567	ensembl	human	known	70_37	missense	SNP	NULL	A
MYH10	4628	genome.wustl.edu	37	17	8381716	8381716	+	Silent	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:8381716C>T	ENST00000269243.4	-	39	5691	c.5553G>A	c.(5551-5553)ctG>ctA	p.L1851L	NDEL1_ENST00000299734.7_Intron|MYH10_ENST00000396239.1_Silent_p.L1872L|MYH10_ENST00000379980.4_Silent_p.L1867L|MYH10_ENST00000360416.3_Silent_p.L1882L	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1851					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						AGATTTCTTTCAGCTTCTTCT	0.493																																																	0													162.0	136.0	144.0					17																	8381716		2203	4300	6503	SO:0001819	synonymous_variant	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5553G>A	17.37:g.8381716C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1872	ENST00000269243.4	37	c.5616	CCDS11144.1	17																																																																																			MYH10	-	pfam_Myosin_tail,superfamily_HR1_rho-bd		0.493	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	C			8381716	-1	no_errors	ENST00000396239	ensembl	human	known	70_37	silent	SNP	1.000	T
MYO5C	55930	genome.wustl.edu	37	15	52513369	52513369	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr15:52513369C>G	ENST00000261839.7	-	30	3872	c.3711G>C	c.(3709-3711)gaG>gaC	p.E1237D		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1237						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		CTTTCATTTTCTCAGCTTGTT	0.383																																																	0													115.0	106.0	109.0					15																	52513369		1830	4074	5904	SO:0001583	missense	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3711G>C	15.37:g.52513369C>G	ENSP00000261839:p.Glu1237Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1237D	ENST00000261839.7	37	c.3711	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	C	8.374	0.835946	0.16820	.	.	ENSG00000128833	ENST00000261839	T	0.17054	2.3	5.19	3.11	0.35812	.	0.222920	0.41294	D	0.000909	T	0.07863	0.0197	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25187	-1.0139	10	0.13470	T	0.59	.	6.0445	0.19752	0.0:0.3406:0.0:0.6594	.	1237	Q9NQX4	MYO5C_HUMAN	D	1237	ENSP00000261839:E1237D	ENSP00000261839:E1237D	E	-	3	2	MYO5C	50300661	0.248000	0.23930	0.930000	0.37139	0.653000	0.38743	0.393000	0.20817	0.624000	0.30286	-0.142000	0.14014	GAG	MYO5C	-	NULL		0.383	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	C	NM_018728		52513369	-1	no_errors	ENST00000261839	ensembl	human	known	70_37	missense	SNP	0.930	G
MYT1L	23040	genome.wustl.edu	37	2	1921047	1921047	+	Silent	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr2:1921047G>A	ENST00000399161.2	-	11	2295	c.1548C>T	c.(1546-1548)caC>caT	p.H516H	MYT1L_ENST00000428368.2_Silent_p.H514H	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	516					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.H516H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCCCAGTTACGTGGCCGGTTC	0.537																																																	1	Substitution - coding silent(1)	lung(1)											193.0	201.0	198.0					2																	1921047		1986	4174	6160	SO:0001819	synonymous_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1548C>T	2.37:g.1921047G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.H516	ENST00000399161.2	37	c.1548		2																																																																																			MYT1L	-	pfam_Znf_C2HC		0.537	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	G	NM_015025		1921047	-1	no_errors	ENST00000399161	ensembl	human	known	70_37	silent	SNP	0.996	A
NET1	10276	genome.wustl.edu	37	10	5493809	5493809	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr10:5493809G>C	ENST00000355029.4	+	4	414	c.272G>C	c.(271-273)aGa>aCa	p.R91T	NET1_ENST00000380359.3_Missense_Mutation_p.R37T|NET1_ENST00000542715.1_5'UTR	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	91					apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						AGCAATAAAAGAGTTCGACCT	0.393																																																	0													160.0	167.0	165.0					10																	5493809		2203	4300	6503	SO:0001583	missense	10276			AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.272G>C	10.37:g.5493809G>C	ENSP00000347134:p.Arg91Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R91T	ENST00000355029.4	37	c.272	CCDS41483.1	10	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634008	0.87660	.	.	ENSG00000173848	ENST00000355029;ENST00000380359	T;T	0.18016	2.24;2.31	5.83	5.83	0.93111	.	0.000000	0.46145	D	0.000320	T	0.47488	0.1448	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.46005	-0.9222	10	0.87932	D	0	-23.0059	18.7012	0.91620	0.0:0.0:1.0:0.0	.	37;91	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	T	91;37	ENSP00000347134:R91T;ENSP00000369717:R37T	ENSP00000347134:R91T	R	+	2	0	NET1	5483809	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.415000	0.97375	2.763000	0.94921	0.563000	0.77884	AGA	NET1	-	NULL		0.393	NET1-005	KNOWN	basic|CCDS	protein_coding	NET1	HGNC	protein_coding	OTTHUMT00000046553.3	G	NM_005863		5493809	+1	no_errors	ENST00000355029	ensembl	human	known	70_37	missense	SNP	1.000	C
NLN	57486	genome.wustl.edu	37	5	65058893	65058893	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr5:65058893G>A	ENST00000380985.5	+	3	586	c.408G>A	c.(406-408)atG>atA	p.M136I	NLN_ENST00000502464.1_Missense_Mutation_p.M32I	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	136						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		ATATTGAGATGAGCATGAGAG	0.378																																																	0													126.0	122.0	123.0					5																	65058893		2203	4300	6503	SO:0001583	missense	57486			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.408G>A	5.37:g.65058893G>A	ENSP00000370372:p.Met136Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULJ4	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.M136I	ENST00000380985.5	37	c.408	CCDS3989.1	5	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720440	0.48728	.	.	ENSG00000123213	ENST00000380985;ENST00000502464;ENST00000340159	T;T	0.05786	3.39;3.39	5.65	5.65	0.86999	Neurolysin/Thimet oligopeptidase, N-terminal (1);	0.196589	0.53938	D	0.000041	T	0.19046	0.0457	L	0.41632	1.29	0.45035	D	0.998059	B;D	0.57571	0.075;0.98	B;D	0.68192	0.045;0.956	T	0.00136	-1.2006	10	0.42905	T	0.14	-20.1651	20.1057	0.97893	0.0:0.0:1.0:0.0	.	136;136	Q9BYT8;Q9BQD0	NEUL_HUMAN;.	I	136;32;136	ENSP00000370372:M136I;ENSP00000423214:M32I	ENSP00000339283:M136I	M	+	3	0	NLN	65094649	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.253000	0.58791	2.827000	0.97445	0.650000	0.86243	ATG	NLN	-	NULL		0.378	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLN	HGNC	protein_coding	OTTHUMT00000215060.1	G			65058893	+1	no_errors	ENST00000380985	ensembl	human	known	70_37	missense	SNP	1.000	A
OR2T35	403244	genome.wustl.edu	37	1	248801602	248801603	+	Frame_Shift_Ins	INS	-	-	CA	rs370874670|rs375058001		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:248801602_248801603insCA	ENST00000317450.3	-	1	956_957	c.957_958insTG	c.(955-960)gtgatcfs	p.I320fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	320						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I320fs*1(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTCCTGATCACAGTCGCCA	0.545																																																	1	Insertion - Frameshift(1)	prostate(1)																																								SO:0001589	frameshift_variant	403244			BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.956_957dupTG	1.37:g.248801605_248801606dupCA	ENSP00000324369:p.Ile320fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IEY7	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I319fs	ENST00000317450.3	37	c.958_957	CCDS31123.1	1																																																																																			OR2T35	-	NULL		0.545	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	HGNC	protein_coding	OTTHUMT00000097130.1	-	NM_001001827		248801603	-1	no_errors	ENST00000317450	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.000	CA
PCDHB6	56130	genome.wustl.edu	37	5	140531440	140531440	+	Silent	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr5:140531440C>T	ENST00000231136.1	+	1	1602	c.1602C>T	c.(1600-1602)cgC>cgT	p.R534R	PCDHB6_ENST00000543635.1_Silent_p.R398R	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	534	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCACAGACCGCGGCTCCCCGG	0.662																																																	0													56.0	62.0	60.0					5																	140531440		2202	4300	6502	SO:0001819	synonymous_variant	56130			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1602C>T	5.37:g.140531440C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R534	ENST00000231136.1	37	c.1602	CCDS4248.1	5																																																																																			PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.662	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	C	NM_018939		140531440	+1	no_errors	ENST00000231136	ensembl	human	known	70_37	silent	SNP	0.006	T
PDS5A	23244	genome.wustl.edu	37	4	39868556	39868556	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr4:39868556G>C	ENST00000303538.8	-	23	3106	c.2567C>G	c.(2566-2568)tCt>tGt	p.S856C		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TGAATTGGCAGATTTAGACTG	0.378																																																	0													73.0	68.0	69.0					4																	39868556		1864	4110	5974	SO:0001583	missense	23244			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.2567C>G	4.37:g.39868556G>C	ENSP00000303427:p.Ser856Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S856C	ENST00000303538.8	37	c.2567	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	G	31	5.084858	0.94100	.	.	ENSG00000121892	ENST00000303538	T	0.65364	-0.15	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80778	0.4688	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79971	-0.1578	9	.	.	.	-13.5492	19.8489	0.96731	0.0:0.0:1.0:0.0	.	856	Q29RF7	PDS5A_HUMAN	C	856	ENSP00000303427:S856C	.	S	-	2	0	PDS5A	39544951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.689000	0.91719	0.655000	0.94253	TCT	PDS5A	-	superfamily_ARM-type_fold		0.378	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	G	NM_015200		39868556	-1	no_errors	ENST00000303538	ensembl	human	known	70_37	missense	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110476533	110476533	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:110476533G>A	ENST00000378402.5	+	49	7576	c.7472G>A	c.(7471-7473)aGa>aAa	p.R2491K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2491					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R2493T(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTTATGTAAGAGGCTGTGCA	0.428										HNSCC(38;0.096)																																							1	Substitution - Missense(1)	lung(1)											57.0	55.0	56.0					8																	110476533		1868	4104	5972	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7472G>A	8.37:g.110476533G>A	ENSP00000367655:p.Arg2491Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.R2491K	ENST00000378402.5	37	c.7472	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446353	0.43429	.	.	ENSG00000205038	ENST00000378402	D	0.92752	-3.1	5.64	1.42	0.22433	Pectin lyase fold/virulence factor (1);	0.125321	0.49916	N	0.000122	D	0.83211	0.5205	N	0.21324	0.655	0.23282	N	0.997988	B	0.06786	0.001	B	0.12837	0.008	T	0.67768	-0.5585	10	0.25751	T	0.34	.	8.6834	0.34223	0.3619:0.0:0.6381:0.0	.	2491	Q86WI1	PKHL1_HUMAN	K	2491	ENSP00000367655:R2491K	ENSP00000367655:R2491K	R	+	2	0	PKHD1L1	110545709	1.000000	0.71417	0.990000	0.47175	0.989000	0.77384	2.387000	0.44389	-0.031000	0.13781	0.650000	0.86243	AGA	PKHD1L1	-	superfamily_Pectin_lyase_fold/virulence		0.428	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110476533	+1	no_errors	ENST00000378402	ensembl	human	known	70_37	missense	SNP	1.000	A
PRSS1	5644	genome.wustl.edu	37	7	142458938	142458938	+	Intron	SNP	T	T	A	rs374770738		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr7:142458938T>A	ENST00000311737.7	+	2	206				PRSS1_ENST00000486171.1_Missense_Mutation_p.F73L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	agtcaaaattttcaggAAGAG	0.388																																																	0																																										SO:0001627	intron_variant	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.200+373T>A	7.37:g.142458938T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.F73L	ENST00000311737.7	37	c.219	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	t	5.014	0.188341	0.09547	.	.	ENSG00000204983	ENST00000486171	D	0.92199	-2.99	1.97	0.784	0.18578	.	.	.	.	.	T	0.75019	0.3793	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.63817	-0.6551	6	0.02654	T	1	.	3.9587	0.09401	0.0:0.1879:0.0:0.8121	.	.	.	.	L	73	ENSP00000417854:F73L	ENSP00000417854:F73L	F	+	3	2	PRSS1	142138512	0.000000	0.05858	0.032000	0.17829	0.031000	0.12232	0.210000	0.17455	0.222000	0.20900	-0.849000	0.03036	TTT	PRSS1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.388	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	T			142458938	+1	no_errors	ENST00000486171	ensembl	human	novel	70_37	missense	SNP	0.043	A
PSMD12	5718	genome.wustl.edu	37	17	65337163	65337163	+	Silent	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:65337163G>A	ENST00000356126.3	-	11	1274	c.1167C>T	c.(1165-1167)tcC>tcT	p.S389S	PSMD12_ENST00000357146.4_Silent_p.S369S	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	389	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					GAAAGGCTTCGGACTCCTGCA	0.358																																																	0													53.0	54.0	54.0					17																	65337163		2203	4300	6503	SO:0001819	synonymous_variant	5718			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1167C>T	17.37:g.65337163G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NP15|Q53HA2|Q6P053	Silent	SNP	pfam_PCI_dom,smart_PCI_dom	p.S389	ENST00000356126.3	37	c.1167	CCDS11669.1	17																																																																																			PSMD12	-	pfam_PCI_dom,smart_PCI_dom		0.358	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	G	NM_002816, NM_174871		65337163	-1	no_errors	ENST00000356126	ensembl	human	known	70_37	silent	SNP	0.976	A
PTCHD1	139411	genome.wustl.edu	37	X	23397865	23397865	+	Missense_Mutation	SNP	A	A	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chrX:23397865A>G	ENST00000379361.4	+	2	1369	c.509A>G	c.(508-510)aAt>aGt	p.N170S		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	170					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						AATCGGACCAATTTTGCTATC	0.502																																																	0													101.0	87.0	92.0					X																	23397865		2203	4300	6503	SO:0001583	missense	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.509A>G	X.37:g.23397865A>G	ENSP00000368666:p.Asn170Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.N170S	ENST00000379361.4	37	c.509	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	A	11.10	1.539425	0.27475	.	.	ENSG00000165186	ENST00000379361	D	0.85013	-1.93	5.06	5.06	0.68205	.	0.191351	0.47093	D	0.000254	T	0.74207	0.3686	L	0.27053	0.805	0.32979	D	0.523382	B;B	0.26363	0.147;0.005	B;B	0.22386	0.039;0.01	T	0.71721	-0.4507	10	0.08599	T	0.76	0.0681	14.135	0.65281	1.0:0.0:0.0:0.0	.	65;170	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	S	170	ENSP00000368666:N170S	ENSP00000368666:N170S	N	+	2	0	PTCHD1	23307786	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.499000	0.45372	1.983000	0.57843	0.486000	0.48141	AAT	PTCHD1	-	pfam_Patched		0.502	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	A	NM_173495		23397865	+1	no_errors	ENST00000379361	ensembl	human	known	70_37	missense	SNP	1.000	G
PTK2B	2185	genome.wustl.edu	37	8	27294966	27294966	+	Missense_Mutation	SNP	G	G	A	rs267601879		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:27294966G>A	ENST00000397501.1	+	22	2288	c.1480G>A	c.(1480-1482)Gaa>Aaa	p.E494K	PTK2B_ENST00000397497.4_Missense_Mutation_p.E240K|PTK2B_ENST00000517339.1_Missense_Mutation_p.E494K|PTK2B_ENST00000420218.2_Missense_Mutation_p.E494K|PTK2B_ENST00000544172.1_Missense_Mutation_p.E494K|PTK2B_ENST00000338238.4_Missense_Mutation_p.E494K|PTK2B_ENST00000346049.5_Missense_Mutation_p.E494K	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	494	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)	p.E494K(1)|p.E240K(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CGGCATCATTGAAGAGGAGCC	0.572																																																	2	Substitution - Missense(2)	skin(2)											102.0	83.0	89.0					8																	27294966		2203	4300	6503	SO:0001583	missense	2185			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1480G>A	8.37:g.27294966G>A	ENSP00000380638:p.Glu494Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E494K	ENST00000397501.1	37	c.1480	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606663	0.87157	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	D;D;D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6	5.75	3.98	0.46160	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.043507	0.85682	N	0.000000	T	0.78110	0.4232	L	0.44542	1.39	0.58432	D	0.999995	B;B;B	0.34399	0.452;0.103;0.029	B;B;B	0.37943	0.261;0.048;0.01	T	0.75921	-0.3147	10	0.59425	D	0.04	.	10.4118	0.44299	0.1588:0.0:0.8412:0.0	.	240;494;494	E9PBI4;Q14289-2;Q14289	.;.;FAK2_HUMAN	K	494;499;494;494;494;494;494;240	ENSP00000380638:E494K;ENSP00000342242:E494K;ENSP00000440926:E494K;ENSP00000332816:E494K;ENSP00000391995:E494K;ENSP00000427931:E494K;ENSP00000380634:E240K	ENSP00000342242:E494K	E	+	1	0	PTK2B	27350883	0.999000	0.42202	0.912000	0.35992	0.958000	0.62258	3.374000	0.52402	0.799000	0.34018	0.561000	0.74099	GAA	PTK2B	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.572	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	G	NM_004103		27294966	+1	no_errors	ENST00000346049	ensembl	human	known	70_37	missense	SNP	0.983	A
PTPRC	5788	genome.wustl.edu	37	1	198721825	198721825	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:198721825A>T	ENST00000367376.2	+	31	3598	c.3427A>T	c.(3427-3429)Aaa>Taa	p.K1143*	PTPRC_ENST00000352140.3_Nonsense_Mutation_p.K1095*|PTPRC_ENST00000442510.2_Nonsense_Mutation_p.K1145*|PTPRC_ENST00000348564.6_Nonsense_Mutation_p.K984*|PTPRC_ENST00000594404.1_Nonsense_Mutation_p.K982*	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1143	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TCAGGTCGTCAAACAAAAACT	0.448																																																	0													75.0	76.0	76.0					1																	198721825		2203	4300	6503	SO:0001587	stop_gained	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3427A>T	1.37:g.198721825A>T	ENSP00000356346:p.Lys1143*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7W6|Q16614|Q9H0Y6	Nonsense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.K1145*	ENST00000367376.2	37	c.3433		1	.	.	.	.	.	.	.	.	.	.	A	37	6.313458	0.97467	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	.	.	.	6.02	6.02	0.97574	.	0.000000	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1131	0.72375	1.0:0.0:0.0:0.0	.	.	.	.	X	1145;1095;1143;982	.	ENSP00000306782:K982X	K	+	1	0	PTPRC	196988448	1.000000	0.71417	0.691000	0.30163	0.034000	0.12701	7.345000	0.79337	2.304000	0.77564	0.528000	0.53228	AAA	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt		0.448	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		A			198721825	+1	no_errors	ENST00000442510	ensembl	human	known	70_37	nonsense	SNP	0.879	T
RAD21	5885	genome.wustl.edu	37	8	117868503	117868503	+	Missense_Mutation	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:117868503G>A	ENST00000297338.2	-	8	1126	c.839C>T	c.(838-840)tCa>tTa	p.S280L	RAD21_ENST00000523547.1_5'Flank	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	280		Cleavage; by caspase-3 or caspase-7.			apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					GGGATCCACTGAATCAGGACT	0.383																																																	0													122.0	110.0	114.0					8																	117868503		2203	4300	6503	SO:0001583	missense	5885			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.839C>T	8.37:g.117868503G>A	ENSP00000297338:p.Ser280Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu,pfam_ScpA	p.S280L	ENST00000297338.2	37	c.839	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068577	0.76301	.	.	ENSG00000164754	ENST00000297338	T	0.55413	0.52	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.51601	0.1684	L	0.52905	1.665	0.80722	D	1	B	0.18310	0.027	B	0.18263	0.021	T	0.42916	-0.9423	10	0.27082	T	0.32	-1.075	19.6408	0.95757	0.0:0.0:1.0:0.0	.	280	O60216	RAD21_HUMAN	L	280	ENSP00000297338:S280L	ENSP00000297338:S280L	S	-	2	0	RAD21	117937684	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	9.780000	0.99024	2.643000	0.89663	0.650000	0.86243	TCA	RAD21	-	NULL		0.383	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	HGNC	protein_coding	OTTHUMT00000381184.1	G	NM_006265		117868503	-1	no_errors	ENST00000297338	ensembl	human	known	70_37	missense	SNP	1.000	A
RHD	6007	genome.wustl.edu	37	1	25634201	25634201	+	Intron	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:25634201G>C	ENST00000328664.4	+	7	1228				RHD_ENST00000357542.4_Intron|RHD_ENST00000454452.2_Intron|RHD_ENST00000417538.2_Intron|RHD_ENST00000423810.2_Missense_Mutation_p.L379F|RHD_ENST00000342055.5_Missense_Mutation_p.L379F|RHD_ENST00000423253.1_Intron|RHD_ENST00000568195.1_Intron	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen							integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TGATGCGTTTGGACGTGTCTC	0.478																																																	0																																										SO:0001627	intron_variant	6007			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.1073+981G>C	1.37:g.25634201G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.L379F	ENST00000328664.4	37	c.1137	CCDS262.1	1	.	.	.	.	.	.	.	.	.	.	G	7.899	0.734088	0.15574	.	.	ENSG00000187010	ENST00000342055;ENST00000423810	T;T	0.25085	1.82;1.93	0.987	0.987	0.19790	.	0.137835	0.47852	N	0.000208	T	0.11452	0.0279	.	.	.	0.09310	N	1	P;P	0.44690	0.588;0.841	B;B	0.26770	0.073;0.064	T	0.28202	-1.0051	9	0.59425	D	0.04	-0.8908	5.3579	0.16071	0.0:0.0:1.0:0.0	.	379;379	Q5XLS9;E7EVW1	.;.	F	379	ENSP00000339577:L379F;ENSP00000399640:L379F	ENSP00000339577:L379F	L	+	3	2	RHD	25506788	0.020000	0.18652	0.004000	0.12327	0.066000	0.16364	0.361000	0.20267	0.829000	0.34733	0.184000	0.17185	TTG	RHD	-	NULL		0.478	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHD	HGNC	protein_coding	OTTHUMT00000009660.5	G	NM_016124		25634201	+1	no_errors	ENST00000342055	ensembl	human	putative	70_37	missense	SNP	0.005	C
RUNX1T1	862	genome.wustl.edu	37	8	92982945	92982945	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:92982945T>A	ENST00000523629.1	-	11	1934	c.1480A>T	c.(1480-1482)Aaa>Taa	p.K494*	RUNX1T1_ENST00000422361.2_Nonsense_Mutation_p.K457*|RUNX1T1_ENST00000520724.1_Nonsense_Mutation_p.K457*|RUNX1T1_ENST00000360348.2_Nonsense_Mutation_p.K457*|RUNX1T1_ENST00000265814.3_Nonsense_Mutation_p.K494*|RUNX1T1_ENST00000436581.2_Nonsense_Mutation_p.K505*|RUNX1T1_ENST00000518844.1_Nonsense_Mutation_p.K467*|RUNX1T1_ENST00000396218.1_Nonsense_Mutation_p.K467*	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	494					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCCTGCCGTTTGGCCTCGGCG	0.572																																																	0													66.0	58.0	61.0					8																	92982945		2203	4300	6503	SO:0001587	stop_gained	862			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1480A>T	8.37:g.92982945T>A	ENSP00000428543:p.Lys494*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Nonsense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.K505*	ENST00000523629.1	37	c.1513	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	T	36	5.953206	0.97139	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	.	.	.	5.77	5.77	0.91146	.	0.042368	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.6836	16.099	0.81152	0.0:0.0:0.0:1.0	.	.	.	.	X	494;467;494;457;457;457;505;467	.	ENSP00000265814:K494X	K	-	1	0	RUNX1T1	93052121	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	8.040000	0.89188	2.203000	0.70933	0.533000	0.62120	AAA	RUNX1T1	-	NULL		0.572	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	T	NM_004349, NM_175635		92982945	-1	no_errors	ENST00000436581	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SLC4A1AP	22950	genome.wustl.edu	37	2	27905202	27905202	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr2:27905202C>A	ENST00000326019.6	+	9	2133	c.1851C>A	c.(1849-1851)ttC>ttA	p.F617L		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	617						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GAAGCAAATTCAAATTAAAAA	0.378																																																	0													61.0	60.0	60.0					2																	27905202		2203	4300	6503	SO:0001583	missense	22950				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1851C>A	2.37:g.27905202C>A	ENSP00000323837:p.Phe617Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.F617L	ENST00000326019.6	37	c.1851	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013663	0.54468	.	.	ENSG00000163798	ENST00000326019	T	0.31247	1.5	5.66	4.6	0.57074	.	0.044409	0.85682	D	0.000000	T	0.41396	0.1157	M	0.68317	2.08	0.80722	D	1	P	0.51653	0.947	P	0.53035	0.716	T	0.08513	-1.0718	10	0.21540	T	0.41	-12.0745	11.9282	0.52831	0.0:0.8519:0.0:0.1481	.	617	Q9BWU0	NADAP_HUMAN	L	617	ENSP00000323837:F617L	ENSP00000323837:F617L	F	+	3	2	SLC4A1AP	27758706	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.391000	0.44424	2.653000	0.90120	0.561000	0.74099	TTC	SLC4A1AP	-	NULL		0.378	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	C	NM_018158		27905202	+1	no_errors	ENST00000326019	ensembl	human	known	70_37	missense	SNP	1.000	A
SPTLC2	9517	genome.wustl.edu	37	14	78045425	78045425	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr14:78045425C>T	ENST00000216484.2	-	3	548	c.355G>A	c.(355-357)Gaa>Aaa	p.E119K		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	119					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	TAAAAGTTTTCAAAATCTTGA	0.368																																																	0													57.0	54.0	55.0					14																	78045425		2203	4300	6503	SO:0001583	missense	9517			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.355G>A	14.37:g.78045425C>T	ENSP00000216484:p.Glu119Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16685	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E119K	ENST00000216484.2	37	c.355	CCDS9865.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.624065	0.96660	.	.	ENSG00000100596	ENST00000216484	T	0.70399	-0.48	5.52	5.52	0.82312	Pyridoxal phosphate-dependent transferase, major domain (1);	0.044188	0.85682	D	0.000000	D	0.83727	0.5317	M	0.75150	2.29	0.80722	D	1	D	0.71674	0.998	D	0.64687	0.928	D	0.85007	0.0903	10	0.66056	D	0.02	-22.5916	19.4336	0.94781	0.0:1.0:0.0:0.0	.	119	O15270	SPTC2_HUMAN	K	119	ENSP00000216484:E119K	ENSP00000216484:E119K	E	-	1	0	SPTLC2	77115178	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.713000	0.84693	2.591000	0.87537	0.561000	0.74099	GAA	SPTLC2	-	superfamily_PyrdxlP-dep_Trfase_major_dom		0.368	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC2	HGNC	protein_coding	OTTHUMT00000414030.1	C	NM_004863		78045425	-1	no_errors	ENST00000216484	ensembl	human	known	70_37	missense	SNP	1.000	T
SRSF3	6428	genome.wustl.edu	37	6	36564728	36564728	+	Silent	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr6:36564728C>T	ENST00000373715.6	+	2	305	c.189C>T	c.(187-189)gtC>gtT	p.V63V	SRSF3_ENST00000339436.7_Silent_p.V63V	NM_003017.4	NP_003008.1	P84103	SRSF3_HUMAN	serine/arginine-rich splicing factor 3	63	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficiernt for interaction with NXF1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(2)	7						CTGATGCAGTCCGAGAGCTAG	0.428																																																	0													57.0	60.0	59.0					6																	36564728		2203	4300	6503	SO:0001819	synonymous_variant	6428			L10838	CCDS4823.1	6p21	2013-02-12	2010-06-22	2010-06-22	ENSG00000112081	ENSG00000112081		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10785	protein-coding gene	gene with protein product		603364	"""splicing factor, arginine/serine-rich 3"""	SFRS3		1577277, 20516191	Standard	NM_003017		Approved	SRp20	uc003omj.3	P84103	OTTHUMG00000014599	ENST00000373715.6:c.189C>T	6.37:g.36564728C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E241|O08831|P23152|Q5R3K0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V63	ENST00000373715.6	37	c.189	CCDS4823.1	6																																																																																			SRSF3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.428	SRSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF3	HGNC	protein_coding	OTTHUMT00000040347.2	C	NM_003017		36564728	+1	no_errors	ENST00000373715	ensembl	human	known	70_37	silent	SNP	0.986	T
SSPO	23145	genome.wustl.edu	37	7	149508049	149508049	+	RNA	SNP	G	G	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr7:149508049G>A	ENST00000378016.2	+	0	9443							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCACGAGGGGCACCTCTAC	0.612																																																	0													47.0	55.0	52.0					7																	149508049		1956	4144	6100			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149508049G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-		0.612	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		G			149508049	+1	no_errors	ENST00000378016	ensembl	human	known	70_37	rna	SNP	0.862	A
ST3GAL2	6483	genome.wustl.edu	37	16	70416789	70416789	+	Missense_Mutation	SNP	G	G	C	rs143187183		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr16:70416789G>C	ENST00000393640.4	-	5	2905	c.798C>G	c.(796-798)caC>caG	p.H266Q	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.H266Q			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	266					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				TCCACCTGTCGTGGATATACT	0.552																																																	0													115.0	91.0	99.0					16																	70416789		2198	4300	6498	SO:0001583	missense	6483			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.798C>G	16.37:g.70416789G>C	ENSP00000377257:p.His266Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O00654	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.H266Q	ENST00000393640.4	37	c.798	CCDS10890.1	16	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904309	0.52333	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.28255	1.62;1.62	5.34	-10.5	0.00291	.	0.098719	0.64402	D	0.000001	T	0.37544	0.1007	L	0.55481	1.735	0.44635	D	0.997616	D	0.63046	0.992	P	0.60789	0.879	T	0.75741	-0.3211	10	0.27785	T	0.31	-16.376	18.4491	0.90696	0.6349:0.0:0.3651:0.0	.	266	Q16842	SIA4B_HUMAN	Q	266	ENSP00000345477:H266Q;ENSP00000377257:H266Q	ENSP00000345477:H266Q	H	-	3	2	ST3GAL2	68974290	0.002000	0.14202	0.323000	0.25347	0.656000	0.38851	-1.134000	0.03228	-2.416000	0.00567	-2.049000	0.00408	CAC	ST3GAL2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.552	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1	G	NM_006927		70416789	-1	no_errors	ENST00000342907	ensembl	human	known	70_37	missense	SNP	0.337	C
STXBP6	29091	genome.wustl.edu	37	14	25288491	25288491	+	Intron	SNP	G	G	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr14:25288491G>T	ENST00000323944.5	-	5	903				STXBP6_ENST00000358326.2_Intron|STXBP6_ENST00000550887.1_Intron|STXBP6_ENST00000548369.1_Missense_Mutation_p.P19T|STXBP6_ENST00000546511.1_Intron|STXBP6_ENST00000548724.1_Intron|STXBP6_ENST00000396700.1_Intron|STXBP6_ENST00000419632.2_Intron			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)						negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		TAAGAGGAAGGCAGGTCACAC	0.522																																																	0																																										SO:0001627	intron_variant	29091			AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.452-91C>A	14.37:g.25288491G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Missense_Mutation	SNP	pfam_Synaptobrevin,pfscan_Synaptobrevin	p.P19T	ENST00000323944.5	37	c.55	CCDS9634.1	14	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268294	0.40095	.	.	ENSG00000168952	ENST00000548369	.	.	.	3.26	0.997	0.19851	.	.	.	.	.	T	0.19565	0.0470	.	.	.	0.09310	N	1	B	0.28636	0.218	B	0.25140	0.058	T	0.20773	-1.0265	6	.	.	.	.	4.7431	0.13024	0.3769:0.0:0.6231:0.0	.	19	Q8NFX7-3	.	T	19	.	.	P	-	1	0	STXBP6	24358331	0.015000	0.18098	0.000000	0.03702	0.007000	0.05969	1.172000	0.31908	0.225000	0.20959	0.557000	0.71058	CCT	STXBP6	-	NULL		0.522	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STXBP6	HGNC	protein_coding	OTTHUMT00000409166.1	G			25288491	-1	no_errors	ENST00000548369	ensembl	human	known	70_37	missense	SNP	0.001	T
TAB2	23118	genome.wustl.edu	37	6	149719189	149719189	+	Missense_Mutation	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr6:149719189C>G	ENST00000367456.1	+	6	2426	c.1849C>G	c.(1849-1851)Caa>Gaa	p.Q617E	TAB2_ENST00000538427.1_Missense_Mutation_p.Q617E|TAB2_ENST00000286332.5_Missense_Mutation_p.Q617E|TAB2_ENST00000536230.1_Missense_Mutation_p.Q585E|SUMO4_ENST00000326669.4_5'Flank			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	617					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						TGATCTTTTTCAAGCCCGAGG	0.343																																																	0													74.0	74.0	74.0					6																	149719189		2203	4300	6503	SO:0001583	missense	23118			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.1849C>G	6.37:g.149719189C>G	ENSP00000356426:p.Gln617Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.Q617E	ENST00000367456.1	37	c.1849	CCDS5214.1	6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134477	0.77662	.	.	ENSG00000055208	ENST00000536230;ENST00000538427;ENST00000367456;ENST00000286332	T;T;T;T	0.75154	-0.91;-0.89;-0.89;-0.89	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.73644	0.3613	L	0.54323	1.7	0.80722	D	1	P;P	0.48764	0.915;0.915	P;P	0.49361	0.608;0.608	T	0.77474	-0.2574	10	0.87932	D	0	-10.5777	19.3539	0.94402	0.0:1.0:0.0:0.0	.	585;617	B4DIR9;Q9NYJ8	.;TAB2_HUMAN	E	585;617;617;617	ENSP00000443206:Q585E;ENSP00000445752:Q617E;ENSP00000356426:Q617E;ENSP00000286332:Q617E	ENSP00000286332:Q617E	Q	+	1	0	TAB2	149760882	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.502000	0.66956	2.640000	0.89533	0.591000	0.81541	CAA	TAB2	-	NULL		0.343	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3	C			149719189	+1	no_errors	ENST00000286332	ensembl	human	known	70_37	missense	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152555007	152555007	+	Missense_Mutation	SNP	G	G	C			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr6:152555007G>C	ENST00000367255.5	-	112	21222	c.20621C>G	c.(20620-20622)aCa>aGa	p.T6874R	SYNE1_ENST00000341594.5_Missense_Mutation_p.T6486R|SYNE1_ENST00000265368.4_Missense_Mutation_p.T6874R|SYNE1_ENST00000448038.1_Missense_Mutation_p.T6803R|SYNE1_ENST00000356820.4_Missense_Mutation_p.T1398R|SYNE1_ENST00000423061.1_Missense_Mutation_p.T6803R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6874					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGCGTGGCTGTGTCCACCTT	0.493										HNSCC(10;0.0054)																																							0													86.0	77.0	80.0					6																	152555007		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20621C>G	6.37:g.152555007G>C	ENSP00000356224:p.Thr6874Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.T6874R	ENST00000367255.5	37	c.20621	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948350	0.53186	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.51325	0.75;0.75;0.75;0.75;0.75;0.71	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000007	T	0.63094	0.2482	M	0.81497	2.545	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.74023	0.959;0.959;0.982	T	0.63945	-0.6522	10	0.46703	T	0.11	.	14.3058	0.66384	0.0705:0.0:0.9295:0.0	.	6874;6874;6803	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	R	6874;6803;6874;6803;6486;1398	ENSP00000356224:T6874R;ENSP00000396024:T6803R;ENSP00000265368:T6874R;ENSP00000390975:T6803R;ENSP00000341887:T6486R;ENSP00000349276:T1398R	ENSP00000265368:T6874R	T	-	2	0	SYNE1	152596700	1.000000	0.71417	0.982000	0.44146	0.043000	0.13939	7.658000	0.83755	2.779000	0.95612	0.655000	0.94253	ACA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	G	NM_182961		152555007	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	missense	SNP	1.000	C
TEFM	79736	genome.wustl.edu	37	17	29227461	29227461	+	Silent	SNP	T	T	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:29227461T>G	ENST00000581216.1	-	3	1236	c.615A>C	c.(613-615)ggA>ggC	p.G205G	TEFM_ENST00000579183.1_5'Flank|TEFM_ENST00000580840.1_Silent_p.G205G	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	205					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										ATGAGTATATTCCTCTCATTA	0.448																																																	0													106.0	101.0	103.0					17																	29227461		1900	4125	6025	SO:0001819	synonymous_variant	79736				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.615A>C	17.37:g.29227461T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Silent	SNP	superfamily_RNaseH-like_dom	p.G205	ENST00000581216.1	37	c.615	CCDS42291.1	17																																																																																			TEFM	-	superfamily_RNaseH-like_dom		0.448	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEFM	HGNC	protein_coding	OTTHUMT00000444498.1	T	NM_024683		29227461	-1	no_errors	ENST00000581216	ensembl	human	known	70_37	silent	SNP	0.988	G
TFCP2L1	29842	genome.wustl.edu	37	2	121989525	121989525	+	Silent	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr2:121989525C>G	ENST00000263707.5	-	13	1315	c.1218G>C	c.(1216-1218)ctG>ctC	p.L406L		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	406					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					TCAGCTCTTCCAGGAAGATGG	0.597																																																	0													204.0	160.0	175.0					2																	121989525		2203	4300	6503	SO:0001819	synonymous_variant	29842			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1218G>C	2.37:g.121989525C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG43	Silent	SNP	pfam_CP2,superfamily_SAM/pointed	p.L406	ENST00000263707.5	37	c.1218	CCDS2134.1	2																																																																																			TFCP2L1	-	NULL		0.597	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	HGNC	protein_coding	OTTHUMT00000338539.1	C	NM_014553		121989525	-1	no_errors	ENST00000263707	ensembl	human	known	70_37	silent	SNP	1.000	G
TOP2A	7153	genome.wustl.edu	37	17	38562885	38562885	+	Missense_Mutation	SNP	C	C	A			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr17:38562885C>A	ENST00000423485.1	-	15	1952	c.1794G>T	c.(1792-1794)tgG>tgT	p.W598C		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	598					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TAGAACTCTTCCACTCTTCAA	0.343																																																	0													134.0	128.0	130.0					17																	38562885		1802	4070	5872	SO:0001583	missense	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1794G>T	17.37:g.38562885C>A	ENSP00000411532:p.Trp598Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_ATPase-like_ATP-bd,superfamily_Topo_IIA_cen,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_CBFA/NFYB_topo	p.W598C	ENST00000423485.1	37	c.1794	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	C	12.43	1.936778	0.34189	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.26373	1.74	5.51	4.53	0.55603	DNA topoisomerase, type IIA, central (1);DNA topoisomerase, type IIA, subunit B/N-terminal (1);	0.114382	0.64402	D	0.000004	T	0.64940	0.2644	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79315	-0.1854	10	0.87932	D	0	.	16.6657	0.85253	0.0:0.8701:0.1299:0.0	.	598	P11388	TOP2A_HUMAN	C	598;678;621;634	ENSP00000411532:W598C	ENSP00000269577:W678C	W	-	3	0	TOP2A	35816411	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	7.750000	0.85110	1.455000	0.47813	-0.182000	0.12963	TGG	TOP2A	-	superfamily_Topo_IIA_cen,smart_Topo_IIA		0.343	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1	C			38562885	-1	no_errors	ENST00000423485	ensembl	human	known	70_37	missense	SNP	1.000	A
TTC8	123016	genome.wustl.edu	37	14	89300049	89300049	+	Missense_Mutation	SNP	G	G	A	rs546198909		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr14:89300049G>A	ENST00000380656.2	+	2	173	c.127G>A	c.(127-129)Gaa>Aaa	p.E43K	TTC8_ENST00000536576.1_Intron|TTC8_ENST00000345383.5_Intron|TTC8_ENST00000346301.4_Intron|TTC8_ENST00000338104.6_Intron|TTC8_ENST00000354441.6_Intron	NM_144596.2	NP_653197.2	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	43			Missing (in RP51).		axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						ACCAGATCCTGAATTGCCAGT	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		18337	0.001		0.0	False		,,,				2504	0.0																0													114.0	112.0	112.0					14																	89300049		2203	4300	6503	SO:0001583	missense	123016			AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000380656.2:c.127G>A	14.37:g.89300049G>A	ENSP00000370031:p.Glu43Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E43K	ENST00000380656.2	37	c.127	CCDS32137.1	14	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383077	0.25031	.	.	ENSG00000165533	ENST00000380656	T	0.76316	-1.01	5.79	5.79	0.91817	.	.	.	.	.	T	0.59266	0.2181	N	0.12182	0.205	0.80722	D	1	B	0.16396	0.017	B	0.16289	0.015	T	0.56691	-0.7937	9	0.06236	T	0.91	.	15.5324	0.75974	0.0:0.0:1.0:0.0	.	43	Q8TAM2-4	.	K	43	ENSP00000370031:E43K	ENSP00000370031:E43K	E	+	1	0	TTC8	88369802	0.991000	0.36638	0.635000	0.29338	0.974000	0.67602	3.511000	0.53400	2.736000	0.93811	0.561000	0.74099	GAA	TTC8	-	NULL		0.338	TTC8-008	KNOWN	basic|CCDS	protein_coding	TTC8	HGNC	protein_coding	OTTHUMT00000410866.1	G	NM_144596		89300049	+1	no_errors	ENST00000380656	ensembl	human	known	70_37	missense	SNP	0.916	A
TTN	7273	genome.wustl.edu	37	2	179611840	179611840	+	Intron	SNP	G	G	C	rs397517814		TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr2:179611840G>C	ENST00000591111.1	-	46	10585				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.S5096C|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGGGTGTGGAGTATCTCTC	0.537																																																	0													63.0	74.0	70.0					2																	179611840		2203	4299	6502	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5192C>G	2.37:g.179611840G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S5096C	ENST00000591111.1	37	c.15287		2	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069277	0.36470	.	.	ENSG00000155657	ENST00000360870	T	0.61980	0.06	5.49	5.49	0.81192	.	.	.	.	.	T	0.77164	0.4090	M	0.61703	1.905	0.58432	D	0.999999	D	0.89917	1.0	D	0.73380	0.98	T	0.76903	-0.2787	9	0.52906	T	0.07	.	17.9134	0.88942	0.0:0.0:1.0:0.0	.	5096	Q8WZ42-6	.	C	5096	ENSP00000354117:S5096C	ENSP00000354117:S5096C	S	-	2	0	TTN	179320085	0.000000	0.05858	0.653000	0.29593	0.609000	0.37215	0.466000	0.22019	2.748000	0.94277	0.655000	0.94253	TCC	TTN	-	NULL		0.537	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179611840	-1	no_errors	ENST00000360870	ensembl	human	known	70_37	missense	SNP	0.446	C
UBE2T	29089	genome.wustl.edu	37	1	202302388	202302388	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:202302388C>T	ENST00000367274.4	-	5	510	c.361G>A	c.(361-363)Gat>Aat	p.D121N		NM_014176.3	NP_054895.1	Q9NPD8	UBE2T_HUMAN	ubiquitin-conjugating enzyme E2T (putative)	121					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|skin(1)	5						AGCGGGTCATCAGGGTTGGGT	0.468																																																	0													311.0	307.0	308.0					1																	202302388		2203	4300	6503	SO:0001583	missense	29089			AF161499	CCDS1425.1	1q32.1	2008-02-05			ENSG00000077152	ENSG00000077152		"""Ubiquitin-conjugating enzymes E2"""	25009	protein-coding gene	gene with protein product		610538				11042152	Standard	NM_014176		Approved	HSPC150	uc001gxx.4	Q9NPD8	OTTHUMG00000041392	ENST00000367274.4:c.361G>A	1.37:g.202302388C>T	ENSP00000356243:p.Asp121Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TU36	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.D121N	ENST00000367274.4	37	c.361	CCDS1425.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.631419	0.96682	.	.	ENSG00000077152	ENST00000367274	T	0.37584	1.19	5.82	5.82	0.92795	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	L	0.53617	1.68	0.80722	D	1	P	0.37441	0.595	B	0.43575	0.424	T	0.38714	-0.9648	10	0.66056	D	0.02	-23.7498	18.8625	0.92278	0.0:1.0:0.0:0.0	.	121	Q9NPD8	UBE2T_HUMAN	N	121	ENSP00000356243:D121N	ENSP00000356243:D121N	D	-	1	0	UBE2T	200569011	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	7.391000	0.79828	2.755000	0.94549	0.591000	0.81541	GAT	UBE2T	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.468	UBE2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2T	HGNC	protein_coding	OTTHUMT00000099163.1	C	NM_014176		202302388	-1	no_errors	ENST00000367274	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF169	254225	genome.wustl.edu	37	11	74554326	74554326	+	IGR	SNP	C	C	G			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr11:74554326C>G	ENST00000299563.4	+	0	7823				XRRA1_ENST00000321448.8_Missense_Mutation_p.E491D|XRRA1_ENST00000527087.1_3'UTR|XRRA1_ENST00000340360.6_Missense_Mutation_p.E766D|RN7SL239P_ENST00000490061.2_RNA	NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169						cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						TGGGCTGGCTCTCACTCAGCG	0.617																																																	0													33.0	40.0	38.0					11																	74554326		2121	4233	6354	SO:0001628	intergenic_variant	143570			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516		11.37:g.74554326C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6N015	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E766D	ENST00000299563.4	37	c.2298	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249788	0.59212	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418	T;T	0.54866	0.55;1.29	4.71	-0.902	0.10537	.	.	.	.	.	T	0.38188	0.1031	L	0.57536	1.79	0.09310	N	1	B;P;P;P	0.44816	0.421;0.718;0.844;0.718	B;B;B;B	0.38500	0.073;0.152;0.275;0.152	T	0.26677	-1.0096	9	0.33141	T	0.24	-3.3433	0.7543	0.00996	0.3111:0.335:0.1633:0.1907	.	766;710;376;752	Q6P2D8;Q6P2D8-4;Q8TEH2;Q6P2D8-3	XRRA1_HUMAN;.;.;.	D	766;491;752;710	ENSP00000339918:E766D;ENSP00000319303:E491D	ENSP00000319303:E491D	E	-	3	2	XRRA1	74231974	0.000000	0.05858	0.000000	0.03702	0.296000	0.27459	-0.271000	0.08572	-0.024000	0.13941	0.563000	0.77884	GAG	XRRA1	-	NULL		0.617	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384741.1	C	XM_495886		74554326	-1	no_errors	ENST00000340360	ensembl	human	known	70_37	missense	SNP	0.000	G
ZFHX4	79776	genome.wustl.edu	37	8	77763451	77763451	+	Missense_Mutation	SNP	C	C	T			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr8:77763451C>T	ENST00000521891.2	+	10	4742	c.4294C>T	c.(4294-4296)Cgc>Tgc	p.R1432C	ZFHX4_ENST00000050961.6_Missense_Mutation_p.R1387C|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R1406C|ZFHX4_ENST00000455469.2_Missense_Mutation_p.R1387C	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTCTGCCAGCGCAGTTTCCG	0.468										HNSCC(33;0.089)																																							0													45.0	42.0	43.0					8																	77763451		1927	4143	6070	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4294C>T	8.37:g.77763451C>T	ENSP00000430497:p.Arg1432Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R1432C	ENST00000521891.2	37	c.4294	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420324	0.62622	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.94	4.94	0.65067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.44902	U	0.000408	T	0.56992	0.2023	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.997	T	0.60954	-0.7160	10	0.87932	D	0	.	18.4109	0.90550	0.0:1.0:0.0:0.0	.	1387;1387;1432	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	C	1432;1432;1387;1387;1406	ENSP00000430497:R1432C;ENSP00000399605:R1387C;ENSP00000050961:R1387C;ENSP00000430848:R1406C	ENSP00000050961:R1387C	R	+	1	0	ZFHX4	77926006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.819000	0.62664	2.589000	0.87451	0.549000	0.68633	CGC	ZFHX4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	C	NM_024721		77763451	+1	no_errors	ENST00000521891	ensembl	human	known	70_37	missense	SNP	1.000	T
ZFP69B	65243	genome.wustl.edu	37	1	40928938	40928938	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LP-A4AX-01A-12D-A243-09	TCGA-LP-A4AX-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c2dd5816-3dfb-4ad9-b3ca-a619cf70fb23	c4d565a5-8321-4cf0-899d-cb5beb75f2b9	g.chr1:40928938delT	ENST00000411995.2	+	6	1657	c.1282delT	c.(1282-1284)ttcfs	p.F428fs	RP1-228H13.5_ENST00000565390.1_RNA|ZFP69B_ENST00000361584.3_Frame_Shift_Del_p.F326fs|ZFP69B_ENST00000484445.1_3'UTR	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	428					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TAGTAAAACCTTCAGCCATAG	0.378																																																	0													81.0	83.0	82.0					1																	40928938		2203	4300	6503	SO:0001589	frameshift_variant	65243			BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.1282delT	1.37:g.40928938delT	ENSP00000399664:p.Phe428fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5QPL4	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.F428fs	ENST00000411995.2	37	c.1282	CCDS452.2	1																																																																																			ZNF643	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF643	HGNC	protein_coding	OTTHUMT00000019078.2	T	NM_023070		40928938	+1	no_errors	ENST00000411995	ensembl	human	known	70_37	frame_shift_del	DEL	0.770	-
