#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACSBG1	23205	genome.wustl.edu	37	15	78466844	78466844	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr15:78466844C>T	ENST00000258873.4	-	12	1930	c.1725G>A	c.(1723-1725)ggG>ggA	p.G575G	ACSBG1_ENST00000541759.1_Silent_p.G333G|ACSBG1_ENST00000560817.1_Silent_p.G333G	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	575					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GCACATTCTCCCCACCAGCTG	0.592																																																	0													75.0	61.0	66.0					15																	78466844		2196	4293	6489	SO:0001819	synonymous_variant	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1725G>A	15.37:g.78466844C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.G575	ENST00000258873.4	37	c.1725	CCDS10298.1	15																																																																																			ACSBG1	-	pfam_AMP-dep_Synth/Lig		0.592	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	C	NM_015162		78466844	-1	no_errors	ENST00000258873	ensembl	human	known	70_37	silent	SNP	0.990	T
ADAMTS10	81794	genome.wustl.edu	37	19	8645823	8645823	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:8645823C>T	ENST00000597188.1	-	26	3536	c.3266G>A	c.(3265-3267)cGa>cAa	p.R1089Q	AC130469.2_ENST00000597256.1_RNA|ADAMTS10_ENST00000595838.1_Missense_Mutation_p.R576Q|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.R1089Q	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	1089	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GAAGTAGGCTCGGCTGCAGAA	0.632											OREG0025220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													41.0	34.0	36.0					19																	8645823		2203	4300	6503	SO:0001583	missense	81794			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.3266G>A	19.37:g.8645823C>T	ENSP00000471851:p.Arg1089Gln	Somatic	650	WXS	Illumina HiSeq	Phase_IV	M0QZE4	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1089Q	ENST00000597188.1	37	c.3266	CCDS12206.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.925092	0.97110	.	.	ENSG00000142303	ENST00000270328	T	0.47528	0.84	5.47	5.47	0.80525	PLAC (2);	0.000000	0.64402	U	0.000003	T	0.63414	0.2509	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.56208	-0.8017	10	0.24483	T	0.36	.	18.3281	0.90260	0.0:1.0:0.0:0.0	.	1089;576	Q9H324;E9PCI6	ATS10_HUMAN;.	Q	1089	ENSP00000270328:R1089Q	ENSP00000270328:R1089Q	R	-	2	0	ADAMTS10	8551823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.396000	0.79891	2.566000	0.86566	0.549000	0.68633	CGA	ADAMTS10	-	pfam_PLAC,pfscan_PLAC		0.632	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS10	HGNC	protein_coding	OTTHUMT00000460085.3	C	NM_030957		8645823	-1	no_errors	ENST00000270328	ensembl	human	known	70_37	missense	SNP	1.000	T
ANKRD27	84079	genome.wustl.edu	37	19	33135369	33135369	+	Silent	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:33135369G>A	ENST00000306065.4	-	5	545	c.387C>T	c.(385-387)ccC>ccT	p.P129P	ANKRD27_ENST00000587352.1_Silent_p.P129P	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	129					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGGGATCTGAGGGTGCCAAAG	0.507																																																	0													200.0	214.0	209.0					19																	33135369		2203	4300	6503	SO:0001819	synonymous_variant	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.387C>T	19.37:g.33135369G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	NULL	p.P77L	ENST00000306065.4	37	c.230	CCDS32986.1	19																																																																																			ANKRD27	-	NULL		0.507	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	G	NM_032139		33135369	-1	no_errors	ENST00000588700	ensembl	human	known	70_37	missense	SNP	0.412	A
ASH1L	55870	genome.wustl.edu	37	1	155327406	155327406	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr1:155327406C>T	ENST00000368346.3	-	14	7584	c.6945G>A	c.(6943-6945)aaG>aaA	p.K2315K	ASH1L_ENST00000392403.3_Silent_p.K2310K|RNU6-106P_ENST00000384405.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2315					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TAGACTTTCTCTTCTCTTTTG	0.443																																																	0													244.0	216.0	226.0					1																	155327406		2203	4300	6503	SO:0001819	synonymous_variant	55870			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.6945G>A	1.37:g.155327406C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.K2315	ENST00000368346.3	37	c.6945		1																																																																																			ASH1L	-	superfamily_Bromodomain		0.443	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	C	NM_018489		155327406	-1	no_errors	ENST00000368346	ensembl	human	known	70_37	silent	SNP	1.000	T
BOD1L1	259282	genome.wustl.edu	37	4	13612555	13612556	+	Intron	INS	-	-	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr4:13612555_13612556insA	ENST00000040738.5	-	6	1627					NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1							nucleus (GO:0005634)	DNA binding (GO:0003677)										AAACTGGACTTACAATGGACTG	0.371																																																	0																																										SO:0001627	intron_variant	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1491+1->T	4.37:g.13612556_13612556dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Splice_Site	INS	-	e6+2	ENST00000040738.5	37	c.1491+2_1491+1	CCDS3411.2	4																																																																																			BOD1L1	-	-		0.371	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	NM_148894		13612556	-1	no_errors	ENST00000040738	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	A
CALR	811	genome.wustl.edu	37	19	13054640	13054640	+	Missense_Mutation	SNP	G	G	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:13054640G>T	ENST00000316448.5	+	9	1240	c.1167G>T	c.(1165-1167)gaG>gaT	p.E389D	RAD23A_ENST00000316856.3_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000541222.1_5'Flank|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000592268.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	389	Asp/Glu/Lys-rich.|C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	aggatgatgaggacaaagatg	0.542																																																	0													263.0	208.0	226.0					19																	13054640		2201	4297	6498	SO:0001583	missense	811			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1167G>T	19.37:g.13054640G>T	ENSP00000320866:p.Glu389Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,pirsf_Calreticulin,prints_Calret/calnex	p.E389D	ENST00000316448.5	37	c.1167	CCDS12288.1	19	.	.	.	.	.	.	.	.	.	.	G	8.192	0.796296	0.16327	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.05649	3.41	5.29	-9.28	0.00656	.	0.566492	0.18123	N	0.150990	T	0.02083	0.0065	N	0.24115	0.695	0.52501	D	0.999959	B	0.02656	0.0	B	0.01281	0.0	T	0.44862	-0.9300	10	0.09338	T	0.73	-13.3376	1.76	0.02990	0.1525:0.1622:0.2526:0.4327	.	389	P27797	CALR_HUMAN	D	389;268	ENSP00000320866:E389D	ENSP00000320866:E389D	E	+	3	2	CALR	12915640	0.000000	0.05858	0.322000	0.25334	0.385000	0.30292	-2.805000	0.00758	-0.793000	0.04475	0.555000	0.69702	GAG	CALR	-	pirsf_Calreticulin		0.542	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR	HGNC	protein_coding	OTTHUMT00000451952.1	G	NM_004343		13054640	+1	no_errors	ENST00000316448	ensembl	human	known	70_37	missense	SNP	0.958	T
CYB561D2	11068	genome.wustl.edu	37	3	50390809	50390809	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:50390809C>T	ENST00000418577.1	+	3	879	c.303C>T	c.(301-303)ctC>ctT	p.L101L	XXcos-LUCA11.5_ENST00000606589.1_Intron|NPRL2_ENST00000232501.3_5'Flank|CYB561D2_ENST00000424512.1_Silent_p.L101L|CYB561D2_ENST00000232508.5_Silent_p.L101L|CYB561D2_ENST00000425346.1_Silent_p.L101L|CYB561D2_ENST00000419046.1_3'UTR			O14569	C56D2_HUMAN	cytochrome b561 family, member D2	101	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TGCTGGGCCTCGGCCTTGTCA	0.652																																																	0													49.0	50.0	50.0					3																	50390809		2203	4300	6503	SO:0001819	synonymous_variant	11068			AF040704	CCDS2827.1	3p21.3	2013-03-14	2013-03-14		ENSG00000114395	ENSG00000114395		"""Cytochrome b genes"""	30253	protein-coding gene	gene with protein product	"""putative tumor suppressor 101F6"""	607068	"""cytochrome b-561 domain containing 2"""			9122200, 11085536, 23249217	Standard	XM_005264832		Approved	101F6, TSP10	uc003dal.3	O14569	OTTHUMG00000156813	ENST00000418577.1:c.303C>T	3.37:g.50390809C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K552	Silent	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.L101	ENST00000418577.1	37	c.303	CCDS2827.1	3																																																																																			CYB561D2	-	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM		0.652	CYB561D2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYB561D2	HGNC	protein_coding	OTTHUMT00000345973.1	C	NM_007022		50390809	+1	no_errors	ENST00000232508	ensembl	human	known	70_37	silent	SNP	0.254	T
DLG5	9231	genome.wustl.edu	37	10	79601670	79601670	+	Missense_Mutation	SNP	G	G	A	rs374686972		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr10:79601670G>A	ENST00000372391.2	-	7	1411	c.1406C>T	c.(1405-1407)gCg>gTg	p.A469V	DLG5_ENST00000372388.2_Missense_Mutation_p.A469V	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	469					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CTCATTGGCCGCCTTCTTCTC	0.612																																																	0								G	VAL/ALA	0,4406		0,0,2203	94.0	78.0	83.0		1406	3.6	1.0	10		83	2,8598	2.2+/-6.3	0,2,4298	no	missense	DLG5	NM_004747.3	64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	469/1920	79601670	2,13004	2203	4300	6503	SO:0001583	missense	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.1406C>T	10.37:g.79601670G>A	ENSP00000361467:p.Ala469Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	pfam_PDZ,pfam_DUF622,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,superfamily_DEATH-like,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_CARD,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.A469V	ENST00000372391.2	37	c.1406	CCDS7353.2	10	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210378	0.58343	0.0	2.33E-4	ENSG00000151208	ENST00000372391;ENST00000372388	T;T	0.04156	3.72;3.69	5.67	3.59	0.41128	.	0.000000	0.37219	N	0.002197	T	0.01353	0.0044	N	0.00879	-1.12	0.29630	N	0.845559	B;B;B	0.17667	0.022;0.013;0.023	B;B;B	0.15484	0.013;0.006;0.004	T	0.38265	-0.9669	10	0.17369	T	0.5	.	4.2264	0.10582	0.4587:0.0:0.5413:0.0	.	359;469;469	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	V	469	ENSP00000361467:A469V;ENSP00000361464:A469V	ENSP00000361464:A469V	A	-	2	0	DLG5	79271676	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	7.324000	0.79115	1.412000	0.46977	0.462000	0.41574	GCG	DLG5	-	NULL		0.612	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	HGNC	protein_coding	OTTHUMT00000048900.2	G			79601670	-1	no_errors	ENST00000372391	ensembl	human	known	70_37	missense	SNP	1.000	A
DZIP1	22873	genome.wustl.edu	37	13	96240001	96240001	+	Intron	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr13:96240001G>A	ENST00000376829.2	-	20	2879				DZIP1_ENST00000347108.3_Intron|DZIP1_ENST00000361156.3_Intron|DZIP1_ENST00000361396.2_Intron	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1						cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			AATCAACACCGAGATAGGGGC	0.507																																																	0													42.0	38.0	39.0					13																	96240001		2203	4300	6503	SO:0001627	intron_variant	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.2028-18C>T	13.37:g.96240001G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	RNA	SNP	-	NULL	ENST00000376829.2	37	NULL	CCDS9478.1	13																																																																																			DZIP1	-	-		0.507	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	G	NM_014934		96240001	-1	no_errors	ENST00000485031	ensembl	human	known	70_37	rna	SNP	0.000	A
ECM1	1893	genome.wustl.edu	37	1	150483501	150483501	+	Missense_Mutation	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr1:150483501C>G	ENST00000369047.4	+	6	660	c.535C>G	c.(535-537)Caa>Gaa	p.Q179E	ECM1_ENST00000369049.4_Missense_Mutation_p.Q206E|ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000346569.6_Missense_Mutation_p.Q179E	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	179	2 X approximate repeats.				angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CAATCTGAACCAAATCTGCCT	0.602																																					Melanoma(156;1696 2560 11093 19685)												0													134.0	142.0	139.0					1																	150483501		2203	4300	6503	SO:0001583	missense	1893			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.535C>G	1.37:g.150483501C>G	ENSP00000358043:p.Gln179Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	pfam_ECM1,superfamily_Serum_albumin-like	p.Q206E	ENST00000369047.4	37	c.616	CCDS953.1	1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431002	0.62844	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	T;T;T	0.79033	-1.23;-1.23;-1.23	5.04	5.04	0.67666	.	0.179243	0.40144	N	0.001180	T	0.81250	0.4783	M	0.62723	1.935	0.29109	N	0.880982	D;D;D;D;D;D	0.69078	0.992;0.99;0.996;0.997;0.961;0.997	D;D;D;D;P;D	0.80764	0.987;0.979;0.978;0.994;0.652;0.994	T	0.75363	-0.3344	10	0.45353	T	0.12	-14.9399	13.7487	0.62894	0.0:1.0:0.0:0.0	.	101;108;206;179;179;179	B7ZAS5;Q16610-3;Q16610-4;C8CHS3;Q16610-2;Q16610	.;.;.;.;.;ECM1_HUMAN	E	206;179;179	ENSP00000358045:Q206E;ENSP00000358043:Q179E;ENSP00000271630:Q179E	ENSP00000271630:Q179E	Q	+	1	0	ECM1	148750125	0.990000	0.36364	1.000000	0.80357	0.907000	0.53573	2.143000	0.42187	2.640000	0.89533	0.655000	0.94253	CAA	ECM1	-	pfam_ECM1		0.602	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM1	HGNC	protein_coding	OTTHUMT00000035832.2	C	NM_004425		150483501	+1	no_errors	ENST00000369049	ensembl	human	known	70_37	missense	SNP	1.000	G
ELMOD1	55531	genome.wustl.edu	37	11	107463876	107463876	+	Intron	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr11:107463876G>A	ENST00000265840.7	+	1	180				ELMOD1_ENST00000531234.1_Intron|ELMOD1_ENST00000443271.2_Intron|ELMOD1_ENST00000529675.1_3'UTR|AP000889.3_ENST00000600612.1_3'UTR	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CTGCCAGGCTGCTTCTGCAAG	0.393																																																	0																																										SO:0001627	intron_variant	55531			AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+1741G>A	11.37:g.107463876G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E167|G5E9S5|Q9NPW3	RNA	SNP	-	NULL	ENST00000265840.7	37	NULL	CCDS44723.1	11																																																																																			ELMOD1	-	-		0.393	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ELMOD1	HGNC	protein_coding	OTTHUMT00000389406.1	G	NM_018712		107463876	+1	no_errors	ENST00000529675	ensembl	human	putative	70_37	rna	SNP	0.961	A
PHKG1	5260	genome.wustl.edu	37	7	62694086	62694086	+	RNA	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr7:62694086G>A	ENST00000451381.1	-	0	98																											GGCCTCTTCCGCTGTGCAGCA	0.607																																																	0																																												0																															7.37:g.62694086G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000451381.1	37	NULL		7																																																																																			RP5-905H7.3	-	-		0.607	RP5-905H7.3-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000244550	Clone_based_vega_gene	processed_transcript	OTTHUMT00000343675.1	G			62694086	-1	no_errors	ENST00000451381	ensembl	human	putative	70_37	rna	SNP	1.000	A
ENTPD4	9583	genome.wustl.edu	37	8	23292045	23292046	+	Intron	DEL	CA	CA	-	rs139348326		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr8:23292045_23292046delCA	ENST00000358689.4	-	12	1696				ENTPD4_ENST00000521321.1_Intron|ENTPD4_ENST00000356206.6_Intron|ENTPD4_ENST00000417069.2_Intron	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4						UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GTCAAGATGGcacacacacaca	0.545																																																	0																																										SO:0001627	intron_variant	9583			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1461-54TG>-	8.37:g.23292055_23292056delCA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSS3|O15092	RNA	DEL	-	NULL	ENST00000358689.4	37	NULL	CCDS6041.1	8																																																																																			ENTPD4	-	-		0.545	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	CA	NM_004901		23292046	-1	no_errors	ENST00000522913	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
EP300	2033	genome.wustl.edu	37	22	41565529	41565529	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr22:41565529G>A	ENST00000263253.7	+	26	5414	c.4195G>A	c.(4195-4197)Gat>Aat	p.D1399N	RNU6-375P_ENST00000517050.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1399	Acetyl-CoA binding. {ECO:0000269|PubMed:24819397}.|CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with histone. {ECO:0000269|PubMed:18273021}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.D1399N(5)|p.D1399Y(2)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ATCTTACCTCGATAGTGTTCA	0.338			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	7	Substitution - Missense(7)	lung(3)|upper_aerodigestive_tract(1)|stomach(1)|central_nervous_system(1)|cervix(1)											98.0	93.0	95.0					22																	41565529		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4195G>A	22.37:g.41565529G>A	ENSP00000263253:p.Asp1399Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.D1399N	ENST00000263253.7	37	c.4195	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998529	0.93227	.	.	ENSG00000100393	ENST00000263253	D	0.99422	-5.88	5.55	5.55	0.83447	.	0.000000	0.46758	D	0.000275	D	0.99743	0.9898	H	0.96633	3.855	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.97288	0.9922	10	0.87932	D	0	-10.979	19.5071	0.95124	0.0:0.0:1.0:0.0	.	1399	Q09472	EP300_HUMAN	N	1399	ENSP00000263253:D1399N	ENSP00000263253:D1399N	D	+	1	0	EP300	39895475	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.760000	0.98935	2.617000	0.88574	0.557000	0.71058	GAT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109		0.338	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	G	NM_001429		41565529	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	missense	SNP	1.000	A
FAAH2	158584	genome.wustl.edu	37	X	57405196	57405196	+	Silent	SNP	C	C	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chrX:57405196C>A	ENST00000374900.4	+	6	975	c.855C>A	c.(853-855)gtC>gtA	p.V285V		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	285						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						TGTTGAAGGTCATGGCAGGAC	0.453										HNSCC(52;0.14)																																							0													131.0	99.0	110.0					X																	57405196		2203	4300	6503	SO:0001819	synonymous_variant	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.855C>A	X.37:g.57405196C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VT2|Q96N98	Silent	SNP	pfam_Amidase,superfamily_Amidase_dom	p.V285	ENST00000374900.4	37	c.855	CCDS14375.1	X																																																																																			FAAH2	-	pfam_Amidase,superfamily_Amidase_dom		0.453	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	C	NM_174912		57405196	+1	no_errors	ENST00000374900	ensembl	human	known	70_37	silent	SNP	1.000	A
TVP23A	780776	genome.wustl.edu	37	16	10855155	10855155	+	5'UTR	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr16:10855155C>T	ENST00000572980.1	-	0	1194				NUBP1_ENST00000283027.5_Intron|NUBP1_ENST00000433392.2_Intron|NUBP1_ENST00000571790.1_Intron			A6NH52	TV23A_HUMAN	trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)							integral component of membrane (GO:0016021)											GCCATCCCCTCGGTTGCACAG	0.502																																																	0																																										SO:0001623	5_prime_UTR_variant	780776				CCDS45408.1	16p13.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000166676	ENSG00000166676			20398	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member A"""	FAM18A			Standard	NM_001079512		Approved	YDR084C	uc010buo.1	A6NH52	OTTHUMG00000177389	ENST00000572980.1:c.-380G>A	16.37:g.10855155C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUV4|B7ZW18	RNA	SNP	-	NULL	ENST00000572980.1	37	NULL		16																																																																																			FAM18A	-	-		0.502	TVP23A-007	KNOWN	basic	processed_transcript	FAM18A	HGNC	protein_coding	OTTHUMT00000436674.1	C	NM_001079512		10855155	-1	no_errors	ENST00000572980	ensembl	human	known	70_37	rna	SNP	0.000	T
FPR1	2357	genome.wustl.edu	37	19	52249272	52249272	+	Missense_Mutation	SNP	C	C	T	rs551338523		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:52249272C>T	ENST00000595042.1	-	3	1117	c.976G>A	c.(976-978)Gag>Aag	p.E326K	FPR1_ENST00000304748.4_Missense_Mutation_p.E326K	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	326					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	GTTGAGTCCTCGGTCAGGGCC	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17651	0.0		0.0	False		,,,				2504	0.0																0													134.0	128.0	130.0					19																	52249272		2203	4300	6503	SO:0001583	missense	2357			M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.976G>A	19.37:g.52249272C>T	ENSP00000471493:p.Glu326Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Frt_met_rcpt,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt	p.E326K	ENST00000595042.1	37	c.976	CCDS12839.1	19	.	.	.	.	.	.	.	.	.	.	.	23.8	4.458181	0.84317	.	.	ENSG00000171051	ENST00000304748	T	0.38240	1.15	3.55	3.55	0.40652	.	0.162142	0.39687	N	0.001283	T	0.65780	0.2724	M	0.91196	3.185	0.43824	D	0.99639	D	0.89917	1.0	D	0.79108	0.992	T	0.75436	-0.3318	10	0.87932	D	0	.	13.4069	0.60919	0.0:1.0:0.0:0.0	.	326	P21462	FPR1_HUMAN	K	326	ENSP00000302707:E326K	ENSP00000302707:E326K	E	-	1	0	FPR1	56941084	1.000000	0.71417	0.846000	0.33378	0.055000	0.15305	6.726000	0.74758	1.907000	0.55213	0.650000	0.86243	GAG	FPR1	-	NULL		0.572	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR1	HGNC	protein_coding	OTTHUMT00000466905.1	C	NM_002029		52249272	-1	no_errors	ENST00000304748	ensembl	human	known	70_37	missense	SNP	0.996	T
GPRASP1	9737	genome.wustl.edu	37	X	101911753	101911753	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chrX:101911753C>T	ENST00000361600.5	+	5	3713	c.2912C>T	c.(2911-2913)tCt>tTt	p.S971F	GPRASP1_ENST00000444152.1_Missense_Mutation_p.S971F|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.S971F|GPRASP1_ENST00000415986.1_Missense_Mutation_p.S971F	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	971	Glu-rich.|OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ATTGTTGGGTCTTGGTTTGAG	0.502																																																	0													133.0	118.0	123.0					X																	101911753		2203	4300	6503	SO:0001583	missense	9737			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2912C>T	X.37:g.101911753C>T	ENSP00000355146:p.Ser971Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O43168|Q96LA1	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.S971F	ENST00000361600.5	37	c.2912	CCDS35352.1	X	.	.	.	.	.	.	.	.	.	.	C	1.980	-0.434356	0.04669	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	2.82	-0.666	0.11399	.	.	.	.	.	T	0.04907	0.0132	N	0.12471	0.22	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39121	-0.9629	9	0.42905	T	0.14	-0.4439	2.3419	0.04262	0.4024:0.2571:0.0:0.3404	.	971	Q5JY77	GASP1_HUMAN	F	971	ENSP00000393691:S971F;ENSP00000409420:S971F;ENSP00000355146:S971F;ENSP00000445683:S971F	ENSP00000355146:S971F	S	+	2	0	GPRASP1	101798409	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.454000	0.21827	-0.260000	0.09418	-0.568000	0.04159	TCT	GPRASP1	-	NULL		0.502	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	C	NM_014710		101911753	+1	no_errors	ENST00000361600	ensembl	human	known	70_37	missense	SNP	0.000	T
GPS2	2874	genome.wustl.edu	37	17	7216157	7216157	+	Splice_Site	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:7216157G>A	ENST00000380728.2	-	11	1202	c.902C>T	c.(901-903)tCg>tTg	p.S301L	GPS2_ENST00000389167.5_Splice_Site_p.S301L|GPS2_ENST00000391950.3_Intron|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	301					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				TGCAAAGCCCGACTGGTGGTG	0.517																																																	0													147.0	144.0	145.0					17																	7216157		2203	4300	6503	SO:0001630	splice_region_variant	2874			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.901-1C>T	17.37:g.7216157G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXA1|Q6FHM8	Missense_Mutation	SNP	NULL	p.S301L	ENST00000380728.2	37	c.902	CCDS11100.1	17	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762599	0.89932	.	.	ENSG00000132522	ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.57595	0.39;0.39	4.76	4.76	0.60689	.	0.183072	0.35378	U	0.003253	T	0.52948	0.1766	N	0.19112	0.55	0.80722	D	1	D	0.61697	0.99	P	0.55455	0.776	T	0.59521	-0.7439	10	0.66056	D	0.02	3.2962	16.7104	0.85383	0.0:0.0:1.0:0.0	.	301	Q13227	GPS2_HUMAN	L	301	ENSP00000370104:S301L;ENSP00000379841:S301L	ENSP00000319371:S301L	S	-	2	0	GPS2	7156881	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.480000	0.66820	2.471000	0.83476	0.655000	0.94253	TCG	GPS2	-	NULL		0.517	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	G	NM_004489	Missense_Mutation	7216157	-1	no_errors	ENST00000380728	ensembl	human	known	70_37	missense	SNP	0.999	A
HRASLS	57110	genome.wustl.edu	37	3	192980926	192980926	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:192980926G>T	ENST00000602513.1	+	3	716	c.307G>T	c.(307-309)Gag>Tag	p.E103*	HRASLS_ENST00000264735.2_Nonsense_Mutation_p.E208*			Q9HDD0	HRSL1_HUMAN	HRAS-like suppressor	103					ether lipid metabolic process (GO:0046485)|lipid catabolic process (GO:0016042)|peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|nuclear envelope lumen (GO:0005641)|peroxisome (GO:0005777)	phospholipase activity (GO:0004620)|transferase activity (GO:0016740)			breast(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	10	all_cancers(143;9.1e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000159)		AAAGCGGTCAGAGTTTGTAAT	0.423																																																	0													117.0	120.0	119.0					3																	192980926		2203	4300	6503	SO:0001587	stop_gained	57110			AB030816	CCDS3303.1, CCDS3303.2	3q29	2008-05-15			ENSG00000127252	ENSG00000127252			14922	protein-coding gene	gene with protein product		606487					Standard	NM_020386		Approved	H-REV107, HRASLS1	uc003fta.4	Q9HDD0	OTTHUMG00000156104	ENST00000602513.1:c.307G>T	3.37:g.192980926G>T	ENSP00000473258:p.Glu103*	Somatic		WXS	Illumina HiSeq	Phase_IV	D2KX19	Nonsense_Mutation	SNP	pfam_LRAT-like_dom	p.E103*	ENST00000602513.1	37	c.307		3	.	.	.	.	.	.	.	.	.	.	G	39	7.479831	0.98309	.	.	ENSG00000127252	ENST00000264735	.	.	.	6.17	6.17	0.99709	.	0.111999	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-1.4914	19.8676	0.96824	0.0:0.0:1.0:0.0	.	.	.	.	X	103	.	ENSP00000264735:E103X	E	+	1	0	HRASLS	194463620	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	4.505000	0.60421	2.941000	0.99782	0.655000	0.94253	GAG	HRASLS	-	pfam_LRAT-like_dom		0.423	HRASLS-201	KNOWN	basic|appris_principal	protein_coding	HRASLS	HGNC	protein_coding		G			192980926	+1	no_errors	ENST00000264735	ensembl	human	known	70_37	nonsense	SNP	1.000	T
IFNAR1	3454	genome.wustl.edu	37	21	34715718	34715718	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr21:34715718C>T	ENST00000270139.3	+	4	673	c.521C>T	c.(520-522)tCa>tTa	p.S174L	IFNAR1_ENST00000416947.2_Missense_Mutation_p.S105L|IFNAR1_ENST00000442357.2_Missense_Mutation_p.S174L	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	174	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AAAAACTCTTCAGGTGTAGAA	0.318																																					Esophageal Squamous(73;817 1211 32990 35667 42746)												0													128.0	136.0	133.0					21																	34715718		2203	4300	6503	SO:0001583	missense	3454				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.521C>T	21.37:g.34715718C>T	ENSP00000270139:p.Ser174Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1	p.S174L	ENST00000270139.3	37	c.521	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175959	0.57692	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.52526	0.66;0.66;0.66	5.59	4.69	0.59074	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.860316	0.10357	N	0.684432	T	0.66848	0.2831	M	0.78637	2.42	0.35711	D	0.816411	D	0.71674	0.998	D	0.63033	0.91	T	0.68788	-0.5316	10	0.54805	T	0.06	-4.7047	10.8303	0.46656	0.0:0.9117:0.0:0.0883	.	174	P17181	INAR1_HUMAN	L	105;174;174	ENSP00000395606:S105L;ENSP00000270139:S174L;ENSP00000407406:S174L	ENSP00000270139:S174L	S	+	2	0	IFNAR1	33637588	0.957000	0.32711	0.062000	0.19696	0.367000	0.29736	2.288000	0.43514	1.322000	0.45245	0.650000	0.86243	TCA	IFNAR1	-	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pirsf_Interferon_alpha/beta_rcpt-1		0.318	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	HGNC	protein_coding	OTTHUMT00000139823.4	C			34715718	+1	no_errors	ENST00000270139	ensembl	human	known	70_37	missense	SNP	0.832	T
IL4R	3566	genome.wustl.edu	37	16	27373942	27373942	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr16:27373942C>T	ENST00000395762.2	+	11	1528	c.1269C>T	c.(1267-1269)tgC>tgT	p.C423C	IL4R_ENST00000543915.2_Silent_p.C423C|IL4R_ENST00000380922.3_Silent_p.C408C|IL4R_ENST00000170630.2_Silent_p.C423C	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	423					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GGGGCTTTTGCCAGCAGGACA	0.607																																																	0													71.0	72.0	71.0					16																	27373942		2197	4300	6497	SO:0001819	synonymous_variant	3566			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1269C>T	16.37:g.27373942C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	pfam_IL4Ra_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.C423	ENST00000395762.2	37	c.1269	CCDS10629.1	16																																																																																			IL4R	-	NULL		0.607	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	C			27373942	+1	no_errors	ENST00000170630	ensembl	human	known	70_37	silent	SNP	0.005	T
ING1	3621	genome.wustl.edu	37	13	111367831	111367831	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr13:111367831G>A	ENST00000375774.3	+	1	503	c.41G>A	c.(40-42)cGa>cAa	p.R14Q	ING1_ENST00000333219.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000338450.7_Intron|ING1_ENST00000464141.1_3'UTR|CARS2_ENST00000535398.1_5'Flank	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	14					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCTGCGGAACGATTGGTCGCT	0.532																																																	0													124.0	126.0	125.0					13																	111367831		2203	4300	6503	SO:0001583	missense	3621				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.41G>A	13.37:g.111367831G>A	ENSP00000364929:p.Arg14Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R14Q	ENST00000375774.3	37	c.41	CCDS9517.1	13	.	.	.	.	.	.	.	.	.	.	G	7.641	0.680980	0.14907	.	.	ENSG00000153487	ENST00000375774	T	0.54866	0.55	4.32	-8.64	0.00874	.	2.776700	0.03384	N	0.200840	T	0.24736	0.0600	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.13683	-1.0500	10	0.51188	T	0.08	-0.001	1.7469	0.02963	0.1648:0.3319:0.1301:0.3732	.	14	Q9UK53	ING1_HUMAN	Q	14	ENSP00000364929:R14Q	ENSP00000364929:R14Q	R	+	2	0	ING1	110165832	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	-0.804000	0.04535	-2.120000	0.00826	-0.258000	0.10820	CGA	ING1	-	NULL		0.532	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	HGNC	protein_coding	OTTHUMT00000045770.2	G	NM_005537		111367831	+1	no_errors	ENST00000375774	ensembl	human	known	70_37	missense	SNP	0.000	A
KALRN	8997	genome.wustl.edu	37	3	124215171	124215171	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:124215171G>A	ENST00000240874.3	+	33	4997	c.4840G>A	c.(4840-4842)Gat>Aat	p.D1614N	KALRN_ENST00000460856.1_Missense_Mutation_p.D1605N|KALRN_ENST00000360013.3_Missense_Mutation_p.D1614N	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1614					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGGAGTGGAGGATATTGACAG	0.547																																																	0													107.0	105.0	106.0					3																	124215171		2203	4300	6503	SO:0001583	missense	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4840G>A	3.37:g.124215171G>A	ENSP00000240874:p.Asp1614Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.D1614N	ENST00000240874.3	37	c.4840	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.484035	0.96307	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.21734	1.99;1.99;1.99	5.25	5.25	0.73442	.	0.115400	0.56097	D	0.000027	T	0.38214	0.1032	L	0.49126	1.545	0.80722	D	1	P;P;P	0.48911	0.749;0.884;0.917	B;P;P	0.56960	0.434;0.516;0.81	T	0.01195	-1.1422	10	0.45353	T	0.12	.	19.3982	0.94617	0.0:0.0:1.0:0.0	.	1605;1614;1614	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	N	1605;1614;1614	ENSP00000418611:D1605N;ENSP00000240874:D1614N;ENSP00000353109:D1614N	ENSP00000240874:D1614N	D	+	1	0	KALRN	125697861	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.601000	0.98297	2.894000	0.99253	0.655000	0.94253	GAT	KALRN	-	NULL		0.547	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	G	NM_003947		124215171	+1	no_errors	ENST00000360013	ensembl	human	known	70_37	missense	SNP	1.000	A
KDM4C	23081	genome.wustl.edu	37	9	7174651	7174651	+	Silent	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr9:7174651G>A	ENST00000381309.3	+	22	3658	c.3093G>A	c.(3091-3093)aaG>aaA	p.K1031K	KDM4C_ENST00000442236.2_Silent_p.K776K|KDM4C_ENST00000428870.2_Silent_p.K718K	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	1031					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CCAGGTTTAAGAATGAATATG	0.473																																																	0													172.0	175.0	174.0					9																	7174651		2203	4300	6503	SO:0001819	synonymous_variant	23081			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.3093G>A	9.37:g.7174651G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.K1031	ENST00000381309.3	37	c.3093	CCDS6471.1	9																																																																																			KDM4C	-	superfamily_Chorismate_mutase_type_II		0.473	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	G	NM_015061		7174651	+1	no_errors	ENST00000381309	ensembl	human	known	70_37	silent	SNP	1.000	A
KRT71	112802	genome.wustl.edu	37	12	52941658	52941658	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr12:52941658C>T	ENST00000267119.5	-	6	1156	c.1087G>A	c.(1087-1089)Gag>Aag	p.E363K		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	363	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		TTCACGTTCTCGATCTCTGAG	0.562																																																	0													189.0	182.0	184.0					12																	52941658		2203	4300	6503	SO:0001583	missense	112802			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1087G>A	12.37:g.52941658C>T	ENSP00000267119:p.Glu363Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.E363K	ENST00000267119.5	37	c.1087	CCDS8831.1	12	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675949	0.88445	.	.	ENSG00000139648	ENST00000267119	D	0.89415	-2.51	3.93	3.93	0.45458	Filament (1);	0.144836	0.30911	N	0.008640	D	0.91304	0.7258	M	0.88979	2.995	0.49582	D	0.999807	P	0.45957	0.869	B	0.42959	0.403	D	0.93713	0.7026	10	0.72032	D	0.01	.	16.8429	0.85973	0.0:1.0:0.0:0.0	.	363	Q3SY84	K2C71_HUMAN	K	363	ENSP00000267119:E363K	ENSP00000267119:E363K	E	-	1	0	KRT71	51227925	0.998000	0.40836	0.982000	0.44146	0.988000	0.76386	4.764000	0.62264	2.129000	0.65627	0.563000	0.77884	GAG	KRT71	-	pfam_F,superfamily_Prefoldin		0.562	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT71	HGNC	protein_coding	OTTHUMT00000396487.1	C	NM_033448		52941658	-1	no_errors	ENST00000267119	ensembl	human	known	70_37	missense	SNP	0.995	T
KRT74	121391	genome.wustl.edu	37	12	52964473	52964473	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr12:52964473C>T	ENST00000305620.2	-	5	1035	c.988G>A	c.(988-990)Gag>Aag	p.E330K	KRT74_ENST00000549343.1_Missense_Mutation_p.E330K	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	330	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		TACAGGGCCTCGGCCTCGGCC	0.592																																																	0													70.0	63.0	65.0					12																	52964473		2203	4300	6503	SO:0001583	missense	121391			BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.988G>A	12.37:g.52964473C>T	ENSP00000307240:p.Glu330Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MD61|Q86Y45	Missense_Mutation	SNP	pfam_F,prints_Keratin_II	p.E330K	ENST00000305620.2	37	c.988	CCDS8832.1	12	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896222	0.72639	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.93763	-3.28;-3.28	4.49	3.59	0.41128	Filament (1);	0.000000	0.35772	N	0.002995	D	0.96140	0.8742	H	0.98388	4.22	0.48395	D	0.999646	P	0.49447	0.924	B	0.42738	0.396	D	0.96991	0.9722	10	0.72032	D	0.01	.	15.1876	0.73016	0.0:0.8579:0.1421:0.0	.	330	Q7RTS7	K2C74_HUMAN	K	330	ENSP00000447447:E330K;ENSP00000307240:E330K	ENSP00000307240:E330K	E	-	1	0	KRT74	51250740	0.995000	0.38212	0.388000	0.26195	0.738000	0.42128	3.312000	0.51927	1.194000	0.43101	0.655000	0.94253	GAG	KRT74	-	pfam_F		0.592	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT74	HGNC	protein_coding	OTTHUMT00000405324.1	C	NM_175053		52964473	-1	no_errors	ENST00000305620	ensembl	human	known	70_37	missense	SNP	0.999	T
HSPB6	126393	genome.wustl.edu	37	19	36243848	36243848	+	IGR	SNP	G	G	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:36243848G>C	ENST00000592984.1	-	0	1634				AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_Missense_Mutation_p.K75N|AC002398.12_ENST00000587767.1_RNA|AC002398.9_ENST00000591613.2_3'UTR			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCGGAGGAAGAAGAGGAGGG	0.642																																																	0													30.0	35.0	33.0					19																	36243848		2051	4195	6246	SO:0001628	intergenic_variant	55957			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36243848G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	NULL	p.K75N	ENST00000592984.1	37	c.225	CCDS12475.1	19	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262638	0.80358	.	.	ENSG00000188223	ENST00000301159	T	0.39229	1.09	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	M	0.77820	2.39	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.69320	-0.5176	10	0.72032	D	0.01	-1.7527	14.5201	0.67844	0.0:0.0:1.0:0.0	.	75	Q96GY3	LIN37_HUMAN	N	75	ENSP00000301159:K75N	ENSP00000301159:K75N	K	+	3	2	LIN37	40935688	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.099000	0.71466	2.415000	0.81967	0.462000	0.41574	AAG	LIN37	-	NULL		0.642	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN37	HGNC	protein_coding	OTTHUMT00000109498.3	G	NM_144617		36243848	+1	no_errors	ENST00000301159	ensembl	human	known	70_37	missense	SNP	1.000	C
KRTAP5-2	440021	genome.wustl.edu	37	11	1619714	1619714	+	5'Flank	SNP	C	C	G	rs371630849	byFrequency	TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr11:1619714C>G	ENST00000412090.1	-	0	0				KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTAAATTTGTCTTTTTCCCCA	0.433													c|||	5	0.000998403	0.0	0.0	5008	,	,		14976	0.005		0.0	False		,,,				2504	0.0																0																																										SO:0001631	upstream_gene_variant	338651			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4			11.37:g.1619714C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A9JTZ1	RNA	SNP	-	NULL	ENST00000412090.1	37	NULL	CCDS31331.1	11																																																																																			RP13-25N22.1	-	-		0.433	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC338651	Clone_based_vega_gene	protein_coding	OTTHUMT00000384775.1	C	NM_001004325		1619714	+1	no_errors	ENST00000424148	ensembl	human	known	70_37	rna	SNP	0.002	G
KRTAP5-2	440021	genome.wustl.edu	37	11	1619857	1619857	+	5'Flank	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr11:1619857C>G	ENST00000412090.1	-	0	0				KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCACGTGCTCTCATCTTTCC	0.463																																																	0																																										SO:0001631	upstream_gene_variant	338651			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4			11.37:g.1619857C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A9JTZ1	RNA	SNP	-	NULL	ENST00000412090.1	37	NULL	CCDS31331.1	11																																																																																			RP13-25N22.1	-	-		0.463	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC338651	Clone_based_vega_gene	protein_coding	OTTHUMT00000384775.1	C	NM_001004325		1619857	+1	no_errors	ENST00000424148	ensembl	human	known	70_37	rna	SNP	0.004	G
LRRFIP2	9209	genome.wustl.edu	37	3	37095399	37095399	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:37095399C>T	ENST00000336686.4	-	28	2189	c.2109G>A	c.(2107-2109)ctG>ctA	p.L703L	MLH1_ENST00000536378.1_Intron|LRRFIP2_ENST00000421276.2_Silent_p.L406L|LRRFIP2_ENST00000396428.2_Silent_p.L485L|LRRFIP2_ENST00000421307.1_Silent_p.L703L|LRRFIP2_ENST00000354379.4_Silent_p.L382L|LRRFIP2_ENST00000440230.1_Silent_p.L406L			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	703					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GCCGCTTGGCCAGGTGGCTGT	0.532																																																	1	Whole gene deletion(1)	ovary(1)											174.0	149.0	158.0					3																	37095399		2203	4300	6503	SO:0001819	synonymous_variant	9209			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.2109G>A	3.37:g.37095399C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_dom,superfamily_Prefoldin	p.L703	ENST00000336686.4	37	c.2109	CCDS2664.1	3																																																																																			LRRFIP2	-	NULL		0.532	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	C	NM_006309		37095399	-1	no_errors	ENST00000336686	ensembl	human	known	70_37	silent	SNP	1.000	T
LSG1	55341	genome.wustl.edu	37	3	194392797	194392797	+	Missense_Mutation	SNP	G	G	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:194392797G>C	ENST00000265245.5	-	1	409	c.95C>G	c.(94-96)tCc>tGc	p.S32C	LSG1_ENST00000480853.1_Intron	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	32					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		TCTTACCCAGGAGTCAGTGTG	0.567																																																	0													60.0	57.0	58.0					3																	194392797		2203	4300	6503	SO:0001583	missense	55341				CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.95C>G	3.37:g.194392797G>C	ENSP00000265245:p.Ser32Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	pfam_GTP_binding_domain,prints_GTP_binding_domain	p.S32C	ENST00000265245.5	37	c.95	CCDS33922.1	3	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375499	0.61735	.	.	ENSG00000041802	ENST00000265245	T	0.49720	0.77	4.16	4.16	0.48862	.	0.543494	0.21154	N	0.079263	T	0.60170	0.2248	M	0.77313	2.365	0.44579	D	0.997544	D	0.53312	0.959	P	0.53062	0.717	T	0.65623	-0.6123	10	0.72032	D	0.01	.	12.2548	0.54617	0.0:0.0:1.0:0.0	.	32	Q9H089	LSG1_HUMAN	C	32	ENSP00000265245:S32C	ENSP00000265245:S32C	S	-	2	0	LSG1	195874086	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	2.263000	0.43293	2.594000	0.87642	0.563000	0.77884	TCC	LSG1	-	NULL		0.567	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSG1	HGNC	protein_coding	OTTHUMT00000342740.1	G	NM_018385		194392797	-1	no_errors	ENST00000265245	ensembl	human	known	70_37	missense	SNP	1.000	C
MAK	4117	genome.wustl.edu	37	6	10804111	10804111	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr6:10804111C>T	ENST00000313243.2	-	7	887	c.505G>A	c.(505-507)Gaa>Aaa	p.E169K	RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000538030.1_Missense_Mutation_p.E169K|MAK_ENST00000354489.2_Missense_Mutation_p.E169K|MAK_ENST00000474039.1_Missense_Mutation_p.E169K|MAK_ENST00000536370.1_Missense_Mutation_p.E169K|SYCP2L_ENST00000543878.1_Intron			P20794	MAK_HUMAN	male germ cell-associated kinase	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				AGTAAAACTTCAGGGGCACGA	0.418																																																	0													82.0	77.0	79.0					6																	10804111		2203	4300	6503	SO:0001583	missense	4117				CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.505G>A	6.37:g.10804111C>T	ENSP00000313021:p.Glu169Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	F1T0K6|G1FL29|Q547D0|Q9NUH7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E169K	ENST00000313243.2	37	c.505	CCDS4516.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.333804	0.95758	.	.	ENSG00000111837	ENST00000313243;ENST00000354489;ENST00000538030;ENST00000536370	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90263	0.6955	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93818	0.7116	10	0.87932	D	0	.	19.2488	0.93913	0.0:1.0:0.0:0.0	.	169	P20794	MAK_HUMAN	K	169	ENSP00000313021:E169K;ENSP00000346484:E169K;ENSP00000442250:E169K;ENSP00000442221:E169K	ENSP00000313021:E169K	E	-	1	0	MAK	10912097	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	7.616000	0.83018	2.547000	0.85894	0.557000	0.71058	GAA	MAK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.418	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAK	HGNC	protein_coding	OTTHUMT00000039841.1	C	NM_005906		10804111	-1	no_errors	ENST00000313243	ensembl	human	known	70_37	missense	SNP	1.000	T
MCM10	55388	genome.wustl.edu	37	10	13233298	13233298	+	Splice_Site	DEL	G	G	-			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr10:13233298delG	ENST00000484800.2	+	11	1521		c.e11-1		MCM10_ENST00000378714.3_Splice_Site|MCM10_ENST00000378694.1_Splice_Site			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TGTCATTTCAGTGCAGCAGCT	0.428																																																	0													89.0	83.0	85.0					10																	13233298		2203	4300	6503	SO:0001630	splice_region_variant	55388			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1419-1G>-	10.37:g.13233298delG		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Splice_Site	DEL	-	e10-1	ENST00000484800.2	37	c.1419-1	CCDS7096.1	10																																																																																			MCM10	-	-		0.428	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	G	NM_182751	Intron	13233298	+1	no_errors	ENST00000361282	ensembl	human	known	70_37	splice_site_del	DEL	0.997	-
MED13	9969	genome.wustl.edu	37	17	60050199	60050199	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:60050199G>A	ENST00000397786.2	-	17	3932	c.3856C>T	c.(3856-3858)Cag>Tag	p.Q1286*		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1286					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGAACTGGCTGAAGAGAGAGG	0.408																																																	0													202.0	199.0	200.0					17																	60050199		1868	4108	5976	SO:0001587	stop_gained	9969			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3856C>T	17.37:g.60050199G>A	ENSP00000380888:p.Gln1286*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU05|O60334	Nonsense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.Q1286*	ENST00000397786.2	37	c.3856	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	G	43	10.382607	0.99395	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-24.7916	20.099	0.97865	0.0:0.0:1.0:0.0	.	.	.	.	X	1286;1285	.	ENSP00000262436:Q1285X	Q	-	1	0	MED13	57404981	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.752000	0.94435	0.655000	0.94253	CAG	MED13	-	NULL		0.408	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	G	NM_005121		60050199	-1	no_errors	ENST00000397786	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MORC3	23515	genome.wustl.edu	37	21	37732332	37732332	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr21:37732332C>T	ENST00000400485.1	+	11	1364	c.1288C>T	c.(1288-1290)Cct>Tct	p.P430S	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	430					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						GGATCAACTTCCTGAAAAATG	0.448																																																	0													199.0	186.0	190.0					21																	37732332		2011	4197	6208	SO:0001583	missense	23515			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1288C>T	21.37:g.37732332C>T	ENSP00000383333:p.Pro430Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA92|Q9UEZ2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.P430S	ENST00000400485.1	37	c.1288	CCDS42924.1	21	.	.	.	.	.	.	.	.	.	.	C	27.8	4.859646	0.91433	.	.	ENSG00000159256	ENST00000400485	T	0.19394	2.15	5.68	5.68	0.88126	Zinc finger, CW-type (2);	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	M	0.76938	2.355	0.80722	D	1	P	0.44309	0.832	P	0.51415	0.669	T	0.17349	-1.0372	10	0.62326	D	0.03	-14.0654	13.0594	0.58997	0.0:0.9267:0.0:0.0733	.	430	Q14149	MORC3_HUMAN	S	430	ENSP00000383333:P430S	ENSP00000383333:P430S	P	+	1	0	MORC3	36654202	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.596000	0.82721	2.672000	0.90937	0.557000	0.71058	CCT	MORC3	-	pfam_Znf_CW,pfscan_Znf_CW		0.448	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	HGNC	protein_coding	OTTHUMT00000194640.1	C	NM_015358		37732332	+1	no_errors	ENST00000400485	ensembl	human	known	70_37	missense	SNP	1.000	T
MUC4	4585	genome.wustl.edu	37	3	195513052	195513052	+	Missense_Mutation	SNP	G	G	A	rs200836018		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:195513052G>A	ENST00000463781.3	-	2	5858	c.5399C>T	c.(5398-5400)tCg>tTg	p.S1800L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1800L|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCCGAGGAAACGTC	0.592																																																	0													69.0	69.0	69.0					3																	195513052		689	1591	2280	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5399C>T	3.37:g.195513052G>A	ENSP00000417498:p.Ser1800Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S1800L	ENST00000463781.3	37	c.5399	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	6.255	0.415258	0.11870	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34667	1.35;1.36	.	.	.	.	.	.	.	.	T	0.14787	0.0357	N	0.19112	0.55	0.09310	N	1	P	0.47841	0.901	B	0.28991	0.097	T	0.14587	-1.0467	7	.	.	.	.	5.8679	0.18786	8.0E-4:0.0:0.9992:0.0	.	1800	E7ESK3	.	L	1800	ENSP00000417498:S1800L;ENSP00000420243:S1800L	.	S	-	2	0	MUC4	196997447	0.657000	0.27393	0.004000	0.12327	0.004000	0.04260	2.680000	0.46918	0.088000	0.17205	0.089000	0.15464	TCG	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513052	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.001	A
MYH13	8735	genome.wustl.edu	37	17	10235467	10235467	+	Silent	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:10235467G>A	ENST00000418404.3	-	19	2410	c.2247C>T	c.(2245-2247)ctC>ctT	p.L749L	RP11-401O9.3_ENST00000577743.1_RNA|MYH13_ENST00000252172.4_Silent_p.L749L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	749	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGGAGTTGAGGAGCTTCTCTG	0.552																																																	0													147.0	152.0	151.0					17																	10235467		2084	4234	6318	SO:0001819	synonymous_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2247C>T	17.37:g.10235467G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L749	ENST00000418404.3	37	c.2247	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	G	NM_003802		10235467	-1	no_errors	ENST00000252172	ensembl	human	known	70_37	silent	SNP	0.945	A
NAB1	4664	genome.wustl.edu	37	2	191535149	191535149	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr2:191535149G>A	ENST00000337386.5	+	5	1378	c.917G>A	c.(916-918)cGa>cAa	p.R306Q	NAB1_ENST00000357215.5_Missense_Mutation_p.R306Q|NAB1_ENST00000409641.1_Missense_Mutation_p.R306Q|NAB1_ENST00000545490.1_Missense_Mutation_p.R76Q|NAB1_ENST00000409581.1_Missense_Mutation_p.R306Q|NAB1_ENST00000484774.1_Intron	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	306	NCD2.				endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			CAGATTTCTCGAGAAGTCACC	0.403																																																	0													90.0	95.0	94.0					2																	191535149		2203	4300	6503	SO:0001583	missense	4664				CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.917G>A	2.37:g.191535149G>A	ENSP00000336894:p.Arg306Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	pfam_Nab1_C,pfam_NAB_co-repressor_dom,pfam_Nab_N,superfamily_SAM/pointed	p.R306Q	ENST00000337386.5	37	c.917	CCDS2307.1	2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800863	0.90538	.	.	ENSG00000138386	ENST00000409581;ENST00000337386;ENST00000357215;ENST00000409641;ENST00000545490	.	.	.	6.06	6.06	0.98353	NAB co-repressor, domain (1);	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	M	0.73962	2.25	0.80722	D	1	B;B;B	0.21688	0.003;0.059;0.059	B;B;B	0.18561	0.003;0.022;0.022	T	0.67401	-0.5680	9	0.87932	D	0	-5.5316	19.609	0.95594	0.0:0.0:1.0:0.0	.	306;306;306	F8W8J7;B8ZZS2;Q13506	.;.;NAB1_HUMAN	Q	306;306;306;306;76	.	ENSP00000336894:R306Q	R	+	2	0	NAB1	191243394	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.552000	0.82192	2.882000	0.98803	0.655000	0.94253	CGA	NAB1	-	pfam_NAB_co-repressor_dom		0.403	NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAB1	HGNC	protein_coding	OTTHUMT00000255986.1	G	NM_005966		191535149	+1	no_errors	ENST00000337386	ensembl	human	known	70_37	missense	SNP	1.000	A
NOM1	64434	genome.wustl.edu	37	7	156759085	156759085	+	Missense_Mutation	SNP	A	A	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr7:156759085A>T	ENST00000275820.3	+	8	2170	c.2155A>T	c.(2155-2157)Agg>Tgg	p.R719W		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	719	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TGAATATGAAAGGAGATTTCA	0.458																																																	0													147.0	128.0	135.0					7																	156759085		2203	4300	6503	SO:0001583	missense	64434			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2155A>T	7.37:g.156759085A>T	ENSP00000275820:p.Arg719Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96I08	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.R719W	ENST00000275820.3	37	c.2155	CCDS34787.1	7	.	.	.	.	.	.	.	.	.	.	A	19.41	3.822564	0.71028	.	.	ENSG00000146909	ENST00000275820	T	0.31769	1.48	4.91	2.35	0.29111	Initiation factor eIF-4 gamma, MA3 (3);	0.000000	0.85682	D	0.000000	T	0.62405	0.2425	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67864	-0.5560	10	0.87932	D	0	-34.184	11.3277	0.49458	0.7101:0.2899:0.0:0.0	.	719	Q5C9Z4	NOM1_HUMAN	W	719	ENSP00000275820:R719W	ENSP00000275820:R719W	R	+	1	2	NOM1	156451846	0.998000	0.40836	0.152000	0.22495	0.928000	0.56348	2.937000	0.48979	0.174000	0.19809	0.533000	0.62120	AGG	NOM1	-	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI		0.458	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOM1	HGNC	protein_coding	OTTHUMT00000327098.1	A	NM_138400		156759085	+1	no_errors	ENST00000275820	ensembl	human	known	70_37	missense	SNP	0.998	T
PCDH15	65217	genome.wustl.edu	37	10	55949131	55949131	+	Intron	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr10:55949131C>G	ENST00000320301.6	-	12	1700				PCDH15_ENST00000409834.1_Missense_Mutation_p.G44A|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.G440A|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000361849.3_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Intron|PCDH15_ENST00000395430.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.G440A|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373955.1_Intron|PCDH15_ENST00000395433.1_Intron|PCDH15_ENST00000437009.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TACAGGAACTCCACTGGGTGG	0.348										HNSCC(58;0.16)																																							0													88.0	81.0	83.0					10																	55949131		1564	3577	5141	SO:0001627	intron_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1306-4103G>C	10.37:g.55949131C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G44A	ENST00000320301.6	37	c.131	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	9.426	1.084268	0.20309	.	.	ENSG00000150275	ENST00000373965;ENST00000409834;ENST00000395445	T;T;T	0.60171	0.48;0.21;0.45	5.47	3.6	0.41247	.	.	.	.	.	T	0.26702	0.0653	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.19549	-1.0302	9	0.02654	T	1	.	3.9071	0.09186	0.1703:0.5788:0.1642:0.0867	.	440;440	C6ZEF5;A2A3E2	.;.	A	440;44;440	ENSP00000363076:G440A;ENSP00000386693:G44A;ENSP00000378832:G440A	ENSP00000363076:G440A	G	-	2	0	PCDH15	55619137	0.999000	0.42202	0.986000	0.45419	0.302000	0.27658	1.527000	0.35975	1.309000	0.44985	0.585000	0.79938	GGA	PCDH15	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.348	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	C	NM_033056		55949131	-1	no_errors	ENST00000409834	ensembl	human	putative	70_37	missense	SNP	0.969	G
PCDHGB1	56104	genome.wustl.edu	37	5	140731931	140731931	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr5:140731931G>A	ENST00000523390.1	+	1	2104	c.2104G>A	c.(2104-2106)Gcg>Acg	p.A702T	PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	702					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTCTCCTCGCGGTGATTCT	0.622																																																	0													126.0	136.0	133.0					5																	140731931		2078	4197	6275	SO:0001583	missense	56104			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.2104G>A	5.37:g.140731931G>A	ENSP00000429273:p.Ala702Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A702T	ENST00000523390.1	37	c.2104	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	0.147	-1.095198	0.01858	.	.	ENSG00000254221	ENST00000523390	T	0.14640	2.49	5.68	2.39	0.29439	.	.	.	.	.	T	0.08268	0.0206	L	0.45352	1.415	0.09310	N	1	B;B	0.31485	0.003;0.325	B;B	0.20384	0.01;0.029	T	0.31668	-0.9935	9	0.17832	T	0.49	.	2.3207	0.04209	0.3535:0.0:0.4231:0.2234	.	702;702	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	T	702	ENSP00000429273:A702T	ENSP00000429273:A702T	A	+	1	0	PCDHGB1	140712115	0.381000	0.25140	0.093000	0.20910	0.022000	0.10575	-0.229000	0.09098	0.838000	0.34948	-0.137000	0.14449	GCG	PCDHGB1	-	NULL		0.622	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	G	NM_018922		140731931	+1	no_errors	ENST00000523390	ensembl	human	known	70_37	missense	SNP	0.003	A
PIEZO1	9780	genome.wustl.edu	37	16	88792849	88792849	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr16:88792849C>T	ENST00000301015.9	-	27	4057	c.3811G>A	c.(3811-3813)Gac>Aac	p.D1271N		NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1271					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TGGTCTCTGTCCATCATCTCC	0.667																																																	0													78.0	81.0	80.0					16																	88792849		692	1589	2281	SO:0001583	missense	9780			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.3811G>A	16.37:g.88792849C>T	ENSP00000301015:p.Asp1271Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.D1271N	ENST00000301015.9	37	c.3811	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.745|4.745	0.138455|0.138455	0.09083|0.09083	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.72725|.	-0.68|.	4.61|4.61	-3.39|-3.39	0.04868|0.04868	.|.	1.373400|.	0.04403|.	N|.	0.364560|.	T|T	0.34745|0.34745	0.0908|0.0908	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	B|.	0.15141|.	0.012|.	B|.	0.14023|.	0.01|.	T|T	0.40683|0.40683	-0.9550|-0.9550	10|5	0.17369|.	T|.	0.5|.	-7.7629|-7.7629	11.6535|11.6535	0.51304|0.51304	0.0:0.3708:0.0:0.6292|0.0:0.3708:0.0:0.6292	.|.	1271|.	Q92508|.	PIEZ1_HUMAN|.	N|E	1271|1216	ENSP00000301015:D1271N|.	ENSP00000301015:D1271N|.	D|G	-|-	1|2	0|0	FAM38A|FAM38A	87320350|87320350	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.562000|0.562000	0.35680|0.35680	-1.132000|-1.132000	0.03235|0.03235	-0.478000|-0.478000	0.06823|0.06823	0.484000|0.484000	0.47621|0.47621	GAC|GGA	PIEZO1	-	NULL		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	C	NM_014745		88792849	-1	no_errors	ENST00000301015	ensembl	human	novel	70_37	missense	SNP	0.001	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PLEKHH2	130271	genome.wustl.edu	37	2	43965569	43965569	+	Silent	SNP	G	G	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr2:43965569G>C	ENST00000282406.4	+	20	3143	c.3033G>C	c.(3031-3033)ctG>ctC	p.L1011L		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1011	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AAATCTGCCTGACACATCCTG	0.418																																																	0													93.0	95.0	95.0					2																	43965569		2203	4300	6503	SO:0001819	synonymous_variant	130271			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3033G>C	2.37:g.43965569G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.L1011	ENST00000282406.4	37	c.3033	CCDS1812.1	2																																																																																			PLEKHH2	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom		0.418	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	G	NM_172069		43965569	+1	no_errors	ENST00000282406	ensembl	human	known	70_37	silent	SNP	1.000	C
PLOD1	5351	genome.wustl.edu	37	1	12032700	12032700	+	Intron	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr1:12032700C>T	ENST00000196061.4	+	18	1929				PLOD1_ENST00000376369.3_Intron	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1						cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	tccttcccctctgttctcttc	0.512																																																	0																																										SO:0001627	intron_variant	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1903-229C>T	1.37:g.12032700C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR87|Q96AV9|Q9H132	RNA	SNP	-	NULL	ENST00000196061.4	37	NULL	CCDS142.1	1																																																																																			PLOD1	-	-		0.512	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	C	NM_000302		12032700	+1	no_errors	ENST00000481933	ensembl	human	known	70_37	rna	SNP	0.000	T
PXMP2	5827	genome.wustl.edu	37	12	133272500	133272500	+	Missense_Mutation	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr12:133272500C>G	ENST00000317479.3	+	3	332	c.267C>G	c.(265-267)ttC>ttG	p.F89L	PXMP2_ENST00000545677.1_Intron|PXMP2_ENST00000428960.2_5'UTR|PXMP2_ENST00000539093.1_Intron|PXMP2_ENST00000543589.1_Intron|RP13-672B3.2_ENST00000537262.1_Intron	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	89						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)				large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		TGAGTCACTTCTTCTACTTCT	0.582																																																	0													65.0	64.0	65.0					12																	133272500		2203	4300	6503	SO:0001583	missense	5827				CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.267C>G	12.37:g.133272500C>G	ENSP00000321271:p.Phe89Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Mpv17_PMP22	p.F89L	ENST00000317479.3	37	c.267	CCDS9279.1	12	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240983	0.39598	.	.	ENSG00000176894	ENST00000317479	D	0.89552	-2.53	5.36	3.53	0.40419	.	0.402860	0.30446	N	0.009613	T	0.79215	0.4408	L	0.28504	0.86	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.69367	-0.5164	10	0.20519	T	0.43	.	6.5157	0.22246	0.0:0.724:0.0:0.276	.	89	Q9NR77	PXMP2_HUMAN	L	89	ENSP00000321271:F89L	ENSP00000321271:F89L	F	+	3	2	PXMP2	131782573	0.945000	0.32115	0.981000	0.43875	0.791000	0.44710	0.521000	0.22893	1.272000	0.44329	-0.136000	0.14681	TTC	PXMP2	-	NULL		0.582	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXMP2	HGNC	protein_coding	OTTHUMT00000397553.1	C	NM_018663		133272500	+1	no_errors	ENST00000317479	ensembl	human	known	70_37	missense	SNP	0.930	G
RABEPK	10244	genome.wustl.edu	37	9	127995018	127995018	+	Missense_Mutation	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr9:127995018C>G	ENST00000373538.3	+	7	1130	c.820C>G	c.(820-822)Cac>Gac	p.H274D	RABEPK_ENST00000394125.4_Missense_Mutation_p.H274D|RABEPK_ENST00000259460.8_Missense_Mutation_p.H223D|RABEPK_ENST00000394124.4_3'UTR	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	274					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						GTACCAGTATCACACAGGTGA	0.502																																																	0													50.0	49.0	49.0					9																	127995018		2203	4300	6503	SO:0001583	missense	10244			BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.820C>G	9.37:g.127995018C>G	ENSP00000362639:p.His274Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.H274D	ENST00000373538.3	37	c.820	CCDS6862.1	9	.	.	.	.	.	.	.	.	.	.	C	9.010	0.982183	0.18889	.	.	ENSG00000136933	ENST00000394125;ENST00000259460;ENST00000373538	T;T;T	0.60548	0.18;0.18;0.18	5.29	4.39	0.52855	Kelch-type beta propeller (1);	0.366783	0.34156	N	0.004203	T	0.30634	0.0771	N	0.04387	-0.21	0.80722	D	1	B;B;B	0.11235	0.004;0.001;0.004	B;B;B	0.09377	0.004;0.002;0.004	T	0.24440	-1.0160	10	0.02654	T	1	-4.6636	13.6372	0.62229	0.0:0.7036:0.2964:0.0	.	274;223;274	A8K403;Q7Z6M1-2;Q7Z6M1	.;.;RABEK_HUMAN	D	274;223;274	ENSP00000377683:H274D;ENSP00000259460:H223D;ENSP00000362639:H274D	ENSP00000259460:H223D	H	+	1	0	RABEPK	127034839	1.000000	0.71417	0.986000	0.45419	0.909000	0.53808	3.013000	0.49582	1.203000	0.43233	0.655000	0.94253	CAC	RABEPK	-	pfam_Kelch_2,pfam_Kelch_1		0.502	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEPK	HGNC	protein_coding	OTTHUMT00000054064.1	C	NM_005833		127995018	+1	no_errors	ENST00000373538	ensembl	human	known	70_37	missense	SNP	1.000	G
RBM12B	389677	genome.wustl.edu	37	8	94745772	94745772	+	Missense_Mutation	SNP	G	G	A	rs371306525		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr8:94745772G>A	ENST00000399300.2	-	3	3080	c.2867C>T	c.(2866-2868)tCg>tTg	p.S956L	RBM12B_ENST00000517700.1_Missense_Mutation_p.S836L|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	956	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			ATACTGTATCGAAACTGAATC	0.333																																																	0								G	LEU/SER	1,3699		0,1,1849	52.0	52.0	52.0		2867	3.9	1.0	8		52	0,8168		0,0,4084	no	missense	RBM12B	NM_203390.2	145	0,1,5933	AA,AG,GG		0.0,0.027,0.0084	probably-damaging	956/1002	94745772	1,11867	1850	4084	5934	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2867C>T	8.37:g.94745772G>A	ENSP00000382239:p.Ser956Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S956L	ENST00000399300.2	37	c.2867	CCDS43755.1	8	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295391	0.60086	2.7E-4	0.0	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.04502	3.61;3.61	5.71	3.9	0.45041	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.896288	0.09512	N	0.792090	T	0.11281	0.0275	L	0.41632	1.29	0.25616	N	0.986451	D	0.76494	0.999	D	0.64144	0.922	T	0.33033	-0.9884	10	0.33141	T	0.24	0.1983	6.5265	0.22305	0.069:0.1306:0.665:0.1355	.	956	Q8IXT5	RB12B_HUMAN	L	956;836	ENSP00000382239:S956L;ENSP00000427729:S836L	ENSP00000382239:S956L	S	-	2	0	RBM12B	94814948	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	3.573000	0.53856	0.750000	0.32877	0.563000	0.77884	TCG	RBM12B	-	smart_RRM_dom,pfscan_RRM_dom		0.333	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	G	NM_203390		94745772	-1	no_errors	ENST00000399300	ensembl	human	known	70_37	missense	SNP	0.991	A
RNF213	57674	genome.wustl.edu	37	17	78326837	78326837	+	Silent	SNP	C	C	T	rs372098453		TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:78326837C>T	ENST00000582970.1	+	33	10544	c.10401C>T	c.(10399-10401)ttC>ttT	p.F3467F	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Silent_p.F3516F|RNF213_ENST00000336301.6_Silent_p.F1540F|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3467					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCCAGCTGTTCGCGCCCGGAG	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		19968	0.001		0.0	False		,,,				2504	0.0																0								C		0,4406		0,0,2203	70.0	64.0	66.0		10548	2.5	0.3	17		66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RNF213	NM_020914.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		3516/5257	78326837	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10401C>T	17.37:g.78326837C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.F3467	ENST00000582970.1	37	c.10401	CCDS58606.1	17																																																																																			RNF213	-	NULL		0.632	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	C	NM_020914		78326837	+1	no_errors	ENST00000582970	ensembl	human	known	70_37	silent	SNP	0.479	T
SCN7A	6332	genome.wustl.edu	37	2	167319021	167319021	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr2:167319021C>T	ENST00000409855.1	-	9	1087	c.961G>A	c.(961-963)Gtg>Atg	p.V321M		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	321					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TTTACACACACATATCCTTCA	0.368																																																	0													68.0	61.0	63.0					2																	167319021		1853	4098	5951	SO:0001583	missense	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.961G>A	2.37:g.167319021C>T	ENSP00000386796:p.Val321Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.V321M	ENST00000409855.1	37	c.961	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	5.688	0.311521	0.10789	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98234	-4.18;-4.19;-4.81	4.43	-1.04	0.10068	Ion transport (1);	0.536026	0.15387	N	0.265013	D	0.93449	0.7910	L	0.33093	0.98	0.09310	N	1	B	0.34103	0.437	B	0.32805	0.153	D	0.88115	0.2828	10	0.21540	T	0.41	.	4.755	0.13078	0.1456:0.4317:0.0:0.4227	.	321	Q01118	SCN7A_HUMAN	M	321	ENSP00000386796:V321M;ENSP00000413699:V321M;ENSP00000403846:V321M	ENSP00000259060:V321M	V	-	1	0	SCN7A	167027267	0.000000	0.05858	0.154000	0.22540	0.953000	0.61014	-0.675000	0.05227	0.073000	0.16731	-0.237000	0.12165	GTG	SCN7A	-	pfam_Ion_trans_dom		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	C			167319021	-1	no_errors	ENST00000409855	ensembl	human	known	70_37	missense	SNP	0.013	T
SDHAP1	255812	genome.wustl.edu	37	3	195711096	195711096	+	RNA	SNP	G	G	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr3:195711096G>C	ENST00000427841.1	-	0	636					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AATGCACGCTGATAAATCTTC	0.473																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												255812			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195711096G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-		0.473	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	G			195711096	-1	no_errors	ENST00000413474	ensembl	human	known	70_37	rna	SNP	1.000	C
SHPK	23729	genome.wustl.edu	37	17	3539499	3539499	+	Silent	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:3539499C>T	ENST00000225519.3	-	1	117	c.15G>A	c.(13-15)ccG>ccA	p.P5P	CTNS_ENST00000046640.3_5'Flank|CTNS_ENST00000381870.3_5'Flank|CTNS_ENST00000441220.2_5'Flank|CTNS_ENST00000399306.2_5'Flank|CTNS_ENST00000414524.2_5'Flank	NM_013276.2	NP_037408	Q9UHJ6	SHPK_HUMAN	sedoheptulokinase	5					carbohydrate metabolic process (GO:0005975)|cellular response to interleukin-13 (GO:0035963)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|phosphorylation (GO:0016310)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|sedoheptulokinase activity (GO:0050277)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				COAD - Colon adenocarcinoma(5;0.0828)		CGAGGGTGATCGGCCGCGCAG	0.706																																																	0													24.0	30.0	28.0					17																	3539499		2198	4278	6476	SO:0001819	synonymous_variant	23729			AF163573	CCDS11030.1	17p13	2008-02-08	2008-02-08	2008-02-08	ENSG00000197417	ENSG00000197417	2.7.1.14		1492	protein-coding gene	gene with protein product		605060	"""carbohydrate kinase-like"""	CARKL		10673275, 18186520	Standard	NM_013276		Approved	SHK	uc002fvz.1	Q9UHJ6	OTTHUMG00000090694	ENST00000225519.3:c.15G>A	17.37:g.3539499C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R640|Q8WUH3	Silent	SNP	pfam_Carb_kinase_FGGY_N	p.P5	ENST00000225519.3	37	c.15	CCDS11030.1	17																																																																																			SHPK	-	NULL		0.706	SHPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHPK	HGNC	protein_coding	OTTHUMT00000207378.2	C			3539499	-1	no_errors	ENST00000225519	ensembl	human	known	70_37	silent	SNP	0.000	T
SLC19A2	10560	genome.wustl.edu	37	1	169437992	169437992	+	Silent	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr1:169437992G>A	ENST00000236137.5	-	4	1349	c.1113C>T	c.(1111-1113)ctC>ctT	p.L371L	SLC19A2_ENST00000367804.4_Silent_p.L170L	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	371					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	CAGCAATCAGGAGAGAAAAGA	0.393																																																	0													174.0	150.0	158.0					1																	169437992		2203	4300	6503	SO:0001819	synonymous_variant	10560			AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.1113C>T	1.37:g.169437992G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Silent	SNP	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier	p.L371	ENST00000236137.5	37	c.1113	CCDS1280.1	1																																																																																			SLC19A2	-	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier		0.393	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A2	HGNC	protein_coding	OTTHUMT00000086106.1	G	NM_006996		169437992	-1	no_errors	ENST00000236137	ensembl	human	known	70_37	silent	SNP	0.931	A
SIPA1L2	57568	genome.wustl.edu	37	1	232581533	232581533	+	Splice_Site	SNP	C	C	G			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr1:232581533C>G	ENST00000366630.1	-	10	3454		c.e10-1		SIPA1L2_ENST00000262861.4_Splice_Site|SIPA1L2_ENST00000308942.4_Splice_Site			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2						regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGAACACCCTCTGTTGGGCCA	0.547																																																	0													78.0	80.0	79.0					1																	232581533		1931	4116	6047	SO:0001630	splice_region_variant	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3096-1G>C	1.37:g.232581533C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Splice_Site	SNP	-	e9-1	ENST00000366630.1	37	c.3096-1	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772842	0.49680	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.196	0.93689	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIPA1L2	230648156	1.000000	0.71417	0.990000	0.47175	0.323000	0.28346	7.484000	0.81180	2.531000	0.85337	0.650000	0.86243	.	SIPA1L2	-	-		0.547	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	C	XM_045839	Intron	232581533	-1	no_errors	ENST00000262861	ensembl	human	known	70_37	splice_site	SNP	1.000	G
SNX8	29886	genome.wustl.edu	37	7	2314765	2314765	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr7:2314765G>A	ENST00000222990.3	-	3	442	c.400C>T	c.(400-402)Ccc>Tcc	p.P134S		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	134	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		ATTCTCTTGGGTGGCAGGGCA	0.617																																																	0													118.0	111.0	113.0					7																	2314765		2203	4300	6503	SO:0001583	missense	29886			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.400C>T	7.37:g.2314765G>A	ENSP00000222990:p.Pro134Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D207|Q96I67	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.P134S	ENST00000222990.3	37	c.400	CCDS5331.1	7	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736175	0.89482	.	.	ENSG00000106266	ENST00000222990;ENST00000435060;ENST00000457286;ENST00000435336;ENST00000447136	T;T;T;T;T	0.37058	1.22;1.22;1.55;1.22;1.22	4.9	4.9	0.64082	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.58836	0.2150	M	0.64080	1.96	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.61950	-0.6957	10	0.59425	D	0.04	.	18.0753	0.89425	0.0:0.0:1.0:0.0	.	134	Q9Y5X2	SNX8_HUMAN	S	134;120;81;81;81	ENSP00000222990:P134S;ENSP00000392437:P120S;ENSP00000406954:P81S;ENSP00000406212:P81S;ENSP00000403608:P81S	ENSP00000222990:P134S	P	-	1	0	SNX8	2281291	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.035000	0.93752	2.253000	0.74438	0.563000	0.77884	CCC	SNX8	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox		0.617	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2	G			2314765	-1	no_errors	ENST00000222990	ensembl	human	known	70_37	missense	SNP	1.000	A
TBC1D16	125058	genome.wustl.edu	37	17	77984149	77984149	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr17:77984149C>T	ENST00000310924.2	-	3	704	c.589G>A	c.(589-591)Gag>Aag	p.E197K		NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	197							Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			CGCCCCTCCTCGGTGACATCC	0.682																																					Ovarian(14;397 562 4850 31922 49378)												0													30.0	32.0	32.0					17																	77984149		2200	4296	6496	SO:0001583	missense	125058			AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.589G>A	17.37:g.77984149C>T	ENSP00000309794:p.Glu197Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E197K	ENST00000310924.2	37	c.589	CCDS11766.1	17	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155977	0.57259	.	.	ENSG00000167291	ENST00000310924	T	0.10099	2.91	4.74	4.74	0.60224	.	0.828882	0.11028	N	0.607583	T	0.04861	0.0131	N	0.08118	0	0.80722	D	1	P	0.48640	0.913	B	0.30855	0.121	T	0.49606	-0.8922	10	0.07482	T	0.82	.	17.7209	0.88351	0.0:1.0:0.0:0.0	.	197	Q8TBP0	TBC16_HUMAN	K	197	ENSP00000309794:E197K	ENSP00000309794:E197K	E	-	1	0	TBC1D16	75598744	0.682000	0.27624	0.318000	0.25279	0.538000	0.34931	2.608000	0.46308	2.178000	0.69098	0.591000	0.81541	GAG	TBC1D16	-	NULL		0.682	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D16	HGNC	protein_coding	OTTHUMT00000437145.1	C	NM_019020		77984149	-1	no_errors	ENST00000310924	ensembl	human	known	70_37	missense	SNP	1.000	T
TRPM7	54822	genome.wustl.edu	37	15	50904978	50904978	+	Missense_Mutation	SNP	T	T	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr15:50904978T>C	ENST00000313478.7	-	16	2100	c.1819A>G	c.(1819-1821)Att>Gtt	p.I607V	TRPM7_ENST00000560955.1_Missense_Mutation_p.I607V	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	607					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ATGTCTACAATTTCATCTTTG	0.358																																																	0													202.0	200.0	200.0					15																	50904978		1821	4077	5898	SO:0001583	missense	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1819A>G	15.37:g.50904978T>C	ENSP00000320239:p.Ile607Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.I607V	ENST00000313478.7	37	c.1819	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	T	6.391	0.440180	0.12104	.	.	ENSG00000092439	ENST00000313478	T	0.73575	-0.76	5.38	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	L	0.27053	0.805	0.39670	D	0.970744	B	0.02656	0.0	B	0.06405	0.002	T	0.39333	-0.9619	10	0.15066	T	0.55	-8.381	7.3223	0.26533	0.1351:0.0704:0.0:0.7945	.	607	Q96QT4	TRPM7_HUMAN	V	607	ENSP00000320239:I607V	ENSP00000320239:I607V	I	-	1	0	TRPM7	48692270	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.589000	0.36644	0.413000	0.25759	0.477000	0.44152	ATT	TRPM7	-	NULL		0.358	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	T	NM_017672		50904978	-1	no_errors	ENST00000313478	ensembl	human	known	70_37	missense	SNP	1.000	C
UNC13C	440279	genome.wustl.edu	37	15	54542589	54542589	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr15:54542589G>A	ENST00000260323.11	+	7	3395	c.3395G>A	c.(3394-3396)gGa>gAa	p.G1132E	UNC13C_ENST00000545554.1_Missense_Mutation_p.G1132E|UNC13C_ENST00000537900.1_Missense_Mutation_p.G1130E	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1132					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTGGAGTGTGGAGTGAAATGC	0.507																																																	0													93.0	94.0	94.0					15																	54542589		2176	4288	6464	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3395G>A	15.37:g.54542589G>A	ENSP00000260323:p.Gly1132Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.G1132E	ENST00000260323.11	37	c.3395	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293100	0.80914	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.92858	-3.12;-3.12;-3.12	5.56	5.56	0.83823	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.114120	0.64402	D	0.000015	D	0.94971	0.8373	M	0.78916	2.43	0.80722	D	1	P	0.47604	0.898	P	0.53549	0.729	D	0.95321	0.8420	10	0.87932	D	0	.	18.5213	0.90954	0.0:0.0:1.0:0.0	.	1132	Q8NB66	UN13C_HUMAN	E	1132;1132;1130	ENSP00000260323:G1132E;ENSP00000438156:G1132E;ENSP00000442569:G1130E	ENSP00000260323:G1132E	G	+	2	0	UNC13C	52329881	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.856000	0.99531	2.626000	0.88956	0.650000	0.86243	GGA	UNC13C	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd		0.507	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	G	NM_173166		54542589	+1	no_errors	ENST00000260323	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR13	64743	genome.wustl.edu	37	X	48458814	48458814	+	Missense_Mutation	SNP	C	C	T			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chrX:48458814C>T	ENST00000218056.5	+	5	1136	c.631C>T	c.(631-633)Cgc>Tgc	p.R211C	WDR13_ENST00000376729.5_Missense_Mutation_p.R211C	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	211						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CACAGTGCTTCGCGTGCTACG	0.647																																																	0													96.0	61.0	73.0					X																	48458814		2203	4300	6503	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.631C>T	X.37:g.48458814C>T	ENSP00000218056:p.Arg211Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R211C	ENST00000218056.5	37	c.631	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720249	0.30503	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.67171	-0.25;-0.25	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.307062	0.36778	N	0.002418	T	0.57844	0.2081	L	0.35723	1.085	0.39456	D	0.967488	B;B	0.10296	0.003;0.001	B;B	0.10450	0.004;0.005	T	0.57201	-0.7852	10	0.44086	T	0.13	-9.7846	14.6671	0.68915	0.0:1.0:0.0:0.0	.	89;211	B4DVQ7;Q9H1Z4	.;WDR13_HUMAN	C	211	ENSP00000365919:R211C;ENSP00000218056:R211C	ENSP00000218056:R211C	R	+	1	0	WDR13	48343758	1.000000	0.71417	0.850000	0.33497	0.421000	0.31385	3.550000	0.53691	2.044000	0.60594	0.436000	0.28706	CGC	WDR13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.647	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	C			48458814	+1	no_errors	ENST00000218056	ensembl	human	known	70_37	missense	SNP	0.995	T
WDR60	55112	genome.wustl.edu	37	7	158664075	158664077	+	In_Frame_Del	DEL	GAA	GAA	-	rs3833679|rs145233696	byFrequency	TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr7:158664075_158664077delGAA	ENST00000407559.3	+	3	470_472	c.312_314delGAA	c.(310-315)ctgaag>ctg	p.K105del		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	105					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K105delK(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		aagaaaagctgaaggagaaacat	0.542														583	0.116414	0.0908	0.0965	5008	,	,		19368	0.0556		0.1889	False		,,,				2504	0.1534																1	Deletion - In frame(1)	central_nervous_system(1)								346,3112		52,242,1435						-8.3	0.0		dbSNP_107	66	1313,5999		217,879,2560	no	coding	WDR60	NM_018051.4		269,1121,3995	A1A1,A1R,RR		17.9568,10.0058,15.4039				1659,9111				SO:0001651	inframe_deletion	55112				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.312_314delGAA	7.37:g.158664075_158664077delGAA	ENSP00000384290:p.Lys105del	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NW58	In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.K105in_frame_del	ENST00000407559.3	37	c.312_314	CCDS47757.1	7																																																																																			WDR60	-	NULL		0.542	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR60	HGNC	protein_coding	OTTHUMT00000322668.1	GAA	NM_018051		158664077	+1	no_errors	ENST00000407559	ensembl	human	known	70_37	in_frame_del	DEL	0.000:0.001:0.001	-
ZER1	10444	genome.wustl.edu	37	9	131513726	131513726	+	Missense_Mutation	SNP	G	G	C			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr9:131513726G>C	ENST00000291900.2	-	6	1410	c.1004C>G	c.(1003-1005)tCt>tGt	p.S335C	ZER1_ENST00000494461.1_5'Flank|snoU13_ENST00000459043.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	335					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.S335F(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						GCGGCACAGAGAGTTCTCAAA	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											87.0	95.0	93.0					9																	131513726		2203	4300	6503	SO:0001583	missense	10444			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1004C>G	9.37:g.131513726G>C	ENSP00000291900:p.Ser335Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.S335C	ENST00000291900.2	37	c.1004	CCDS6910.1	9	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964488	0.74131	.	.	ENSG00000160445	ENST00000291900	T	0.49720	0.77	5.39	5.39	0.77823	.	0.242428	0.41712	D	0.000839	T	0.50343	0.1610	L	0.48642	1.525	0.53005	D	0.999965	D	0.58620	0.983	P	0.47075	0.536	T	0.53746	-0.8395	10	0.59425	D	0.04	-30.6644	17.7253	0.88363	0.0:0.0:1.0:0.0	.	335	Q7Z7L7	ZER1_HUMAN	C	335	ENSP00000291900:S335C	ENSP00000291900:S335C	S	-	2	0	ZER1	130553547	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.715000	0.61909	2.548000	0.85928	0.313000	0.20887	TCT	ZER1	-	NULL		0.587	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZER1	HGNC	protein_coding	OTTHUMT00000054491.1	G	NM_006336		131513726	-1	no_errors	ENST00000291900	ensembl	human	known	70_37	missense	SNP	1.000	C
ZNF469	84627	genome.wustl.edu	37	16	88501328	88501328	+	Missense_Mutation	SNP	G	G	A	rs561743358	byFrequency	TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr16:88501328G>A	ENST00000437464.1	+	2	7366	c.7366G>A	c.(7366-7368)Ggg>Agg	p.G2456R	ZNF469_ENST00000565624.1_Missense_Mutation_p.G2484R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CTTCCGCTCCGGGCCGGGCCT	0.667													G|||	2	0.000399361	0.0	0.0	5008	,	,		13268	0.002		0.0	False		,,,				2504	0.0																0													4.0	5.0	5.0					16																	88501328		653	1519	2172	SO:0001583	missense	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7366G>A	16.37:g.88501328G>A	ENSP00000402343:p.Gly2456Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G2456R	ENST00000437464.1	37	c.7366	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	7.244	0.601949	0.13939	.	.	ENSG00000225614	ENST00000437464	T	0.46063	0.88	4.41	-5.82	0.02333	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.14787	0.0357	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.36578	-0.9742	9	0.08179	T	0.78	.	8.1343	0.31046	0.7017:0.1371:0.1612:0.0	.	2456	Q96JG9	ZN469_HUMAN	R	2456	ENSP00000402343:G2456R	ENSP00000402343:G2456R	G	+	1	0	ZNF469	87028829	0.000000	0.05858	0.000000	0.03702	0.606000	0.37113	-0.380000	0.07427	-1.024000	0.03338	-2.362000	0.00238	GGG	ZNF469	-	smart_Znf_C2H2-like		0.667	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		G	NG_012236		88501328	+1	no_errors	ENST00000437464	ensembl	human	known	70_37	missense	SNP	0.001	A
ZNF57	126295	genome.wustl.edu	37	19	2917298	2917298	+	Missense_Mutation	SNP	G	G	A			TCGA-MY-A5BE-01A-21D-A26G-09	TCGA-MY-A5BE-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7c777ea-be05-4bca-966a-479f3d3b0461	927cdf95-d9ff-430f-9e97-a6eb590774bc	g.chr19:2917298G>A	ENST00000306908.5	+	4	827	c.679G>A	c.(679-681)Gag>Aag	p.E227K	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_Missense_Mutation_p.E195K	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACAAATGCGAGCAGTGTCG	0.473																																					NSCLC(150;910 1964 4303 10464 26498)												0													99.0	88.0	92.0					19																	2917298		2203	4300	6503	SO:0001583	missense	126295			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.679G>A	19.37:g.2917298G>A	ENSP00000303696:p.Glu227Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E227K	ENST00000306908.5	37	c.679	CCDS12098.1	19	.	.	.	.	.	.	.	.	.	.	G	1.940	-0.443754	0.04604	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.15256	2.44;2.44	2.34	-1.38	0.09027	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07908	0.0198	L	0.31065	0.9	0.09310	N	1	B	0.15141	0.012	B	0.08055	0.003	T	0.41945	-0.9480	9	0.02654	T	1	.	3.4674	0.07554	0.338:0.0:0.4501:0.2119	.	227	Q68EA5	ZNF57_HUMAN	K	227;229;195	ENSP00000303696:E227K;ENSP00000430223:E195K	ENSP00000303696:E227K	E	+	1	0	ZNF57	2868298	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-5.843000	0.00095	-0.581000	0.05937	-0.424000	0.05967	GAG	ZNF57	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.473	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF57	HGNC	protein_coding	OTTHUMT00000378969.1	G	NM_173480		2917298	+1	no_errors	ENST00000306908	ensembl	human	known	70_37	missense	SNP	0.000	A
