#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ARF4	378	genome.wustl.edu	37	3	57563077	57563077	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:57563077C>T	ENST00000303436.6	-	4	563	c.296G>A	c.(295-297)aGa>aAa	p.R99K	ARF4_ENST00000489843.1_5'UTR|ARF4_ENST00000496292.1_Missense_Mutation_p.R72K	NM_001660.3	NP_001651.1	P18085	ARF4_HUMAN	ADP-ribosylation factor 4	99					activation of phospholipase D activity (GO:0031584)|brain development (GO:0007420)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein transport (GO:0015031)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to axon injury (GO:0048678)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	epidermal growth factor receptor binding (GO:0005154)|GTP binding (GO:0005525)			large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0449)|Kidney(284;0.0561)		TTCCTGAATTCTTTCACGATC	0.348																																																	0													124.0	138.0	133.0					3																	57563077		2203	4300	6503	SO:0001583	missense	378			M36341	CCDS2884.1	3p21.2-p21.1	2007-03-19			ENSG00000168374	ENSG00000168374		"""ADP-ribosylation factors"""	655	protein-coding gene	gene with protein product		601177	"""ADP-ribosylation factor 2"""	ARF2		2107548	Standard	NM_001660		Approved		uc003dix.4	P18085	OTTHUMG00000158601	ENST00000303436.6:c.296G>A	3.37:g.57563077C>T	ENSP00000306010:p.Arg99Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7J7|P21371	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R99K	ENST00000303436.6	37	c.296	CCDS2884.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.810618	0.96975	.	.	ENSG00000168374	ENST00000303436;ENST00000496292;ENST00000463880	T;T;T	0.78246	-1.16;-1.16;-1.16	5.6	5.6	0.85130	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90988	0.7166	H	0.95294	3.65	0.80722	D	1	P;P	0.49961	0.924;0.93	P;P	0.57911	0.765;0.829	D	0.93161	0.6558	10	0.87932	D	0	-11.6579	19.618	0.95643	0.0:1.0:0.0:0.0	.	72;99	C9JAK5;P18085	.;ARF4_HUMAN	K	99;72;99	ENSP00000306010:R99K;ENSP00000417501:R72K;ENSP00000420254:R99K	ENSP00000306010:R99K	R	-	2	0	ARF4	57538117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.786000	0.85741	2.635000	0.89317	0.650000	0.86243	AGA	ARF4	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.348	ARF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF4	HGNC	protein_coding	OTTHUMT00000351443.1	C	NM_001660		57563077	-1	no_errors	ENST00000303436	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGEF38	54848	genome.wustl.edu	37	4	106566402	106566402	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr4:106566402G>A	ENST00000420470.2	+	6	876	c.732G>A	c.(730-732)gtG>gtA	p.V244V	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	244	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						TTCAACGTGTGATGAAATACC	0.423																																																	0																																										SO:0001819	synonymous_variant	54848			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.732G>A	4.37:g.106566402G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JIB4	Silent	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.V244	ENST00000420470.2	37	c.732	CCDS56338.1	4																																																																																			ARHGEF38	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.423	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	G	NM_017700		106566402	+1	no_errors	ENST00000420470	ensembl	human	putative	70_37	silent	SNP	1.000	A
ATP1B3	483	genome.wustl.edu	37	3	141644553	141644553	+	3'UTR	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:141644553G>A	ENST00000286371.3	+	0	1038				ATP1B3_ENST00000539728.1_3'UTR|ATP1B3_ENST00000484727.1_3'UTR|ATP1B3_ENST00000462082.1_3'UTR	NM_001679.2	NP_001670.1	P54709	AT1B3_HUMAN	ATPase, Na+/K+ transporting, beta 3 polypeptide						blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|transport (GO:0006810)	caveola (GO:0005901)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|sodium:potassium-exchanging ATPase activity (GO:0005391)			cervix(1)|endometrium(1)|lung(2)	4						GTATGAGTAGGATATCTCCAC	0.413																																																	0													149.0	132.0	138.0					3																	141644553		2203	4300	6503	SO:0001624	3_prime_UTR_variant	483			BC011835	CCDS3121.1	3q23	2012-10-22			ENSG00000069849	ENSG00000069849		"""CD molecules"", ""ATPases / P-type"""	806	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-3"", ""sodium pump subunit beta-3"", ""sodium-potassium ATPase subunit beta 3 (non-catalytic)"""	601867				8798450, 9457675	Standard	NM_001679		Approved	FLJ29027, CD298	uc003eug.1	P54709	OTTHUMG00000159081	ENST00000286371.3:c.*10G>A	3.37:g.141644553G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1N7	RNA	SNP	-	NULL	ENST00000286371.3	37	NULL	CCDS3121.1	3																																																																																			ATP1B3	-	-		0.413	ATP1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1B3	HGNC	protein_coding	OTTHUMT00000353218.1	G	NM_001679		141644553	+1	no_errors	ENST00000484727	ensembl	human	putative	70_37	rna	SNP	0.003	A
BATF2	116071	genome.wustl.edu	37	11	64764365	64764365	+	Missense_Mutation	SNP	C	C	T	rs564496581		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr11:64764365C>T	ENST00000301887.4	-	1	152	c.22G>A	c.(22-24)Ggg>Agg	p.G8R		NM_138456.3	NP_612465.3	Q8N1L9	BATF2_HUMAN	basic leucine zipper transcription factor, ATF-like 2	8					defense response to protozoan (GO:0042832)|myeloid dendritic cell differentiation (GO:0043011)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|skin(1)	9						GTCAGCAGCCCATTGCCCCCA	0.637																																																	0													77.0	66.0	70.0					11																	64764365		2201	4297	6498	SO:0001583	missense	116071			AK092453	CCDS8087.1, CCDS73317.1	11q13.1	2013-01-10			ENSG00000168062	ENSG00000168062		"""basic leucine zipper proteins"""	25163	protein-coding gene	gene with protein product		614983					Standard	NM_138456		Approved	MGC20410	uc001ocf.1	Q8N1L9	OTTHUMG00000165633	ENST00000301887.4:c.22G>A	11.37:g.64764365C>T	ENSP00000301887:p.Gly8Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	D9IC56|Q8NAF4|Q8NAL8|Q96EH4	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.G8R	ENST00000301887.4	37	c.22	CCDS8087.1	11	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679210	0.29783	.	.	ENSG00000168062	ENST00000301887;ENST00000534177	T;T	0.47528	0.87;0.84	4.32	3.4	0.38934	.	2.170440	0.02348	N	0.075636	T	0.33265	0.0857	N	0.14661	0.345	0.25643	N	0.986177	P	0.38195	0.622	B	0.33750	0.169	T	0.32955	-0.9887	10	0.44086	T	0.13	2.3358	8.4098	0.32636	0.0:0.8877:0.0:0.1123	.	8	Q8N1L9	BATF2_HUMAN	R	8	ENSP00000301887:G8R;ENSP00000435640:G8R	ENSP00000301887:G8R	G	-	1	0	BATF2	64520941	0.001000	0.12720	0.001000	0.08648	0.047000	0.14425	1.346000	0.33964	0.929000	0.37192	0.467000	0.42956	GGG	BATF2	-	superfamily_Euk_TF_DNA-bd		0.637	BATF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF2	HGNC	protein_coding	OTTHUMT00000385478.2	C	NM_138456		64764365	-1	no_errors	ENST00000301887	ensembl	human	known	70_37	missense	SNP	0.005	T
BEND7	222389	genome.wustl.edu	37	10	13481266	13481266	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr10:13481266G>A	ENST00000396900.2	-	9	1465	c.1466C>T	c.(1465-1467)tCa>tTa	p.S489L	BEND7_ENST00000341083.3_Missense_Mutation_p.S438L|BEND7_ENST00000486542.1_5'UTR			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	489						extracellular vesicular exosome (GO:0070062)		p.S438L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						aagtgtagctgagacctgagt	0.483																																																	1	Substitution - Missense(1)	breast(1)											293.0	263.0	273.0					10																	13481266		2203	4300	6503	SO:0001583	missense	222389			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1466C>T	10.37:g.13481266G>A	ENSP00000380108:p.Ser489Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	pfam_BEN_domain	p.S489L	ENST00000396900.2	37	c.1466		10	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422427	0.43020	.	.	ENSG00000165626	ENST00000396900;ENST00000341083	T;T	0.50813	0.74;0.73	2.62	1.69	0.24217	.	.	.	.	.	T	0.26629	0.0651	N	0.08118	0	0.09310	N	1	P	0.34934	0.476	B	0.35278	0.199	T	0.17561	-1.0365	9	0.87932	D	0	.	7.2934	0.26378	0.0:0.3027:0.6973:0.0	.	438	Q8N7W2-3	.	L	489;438	ENSP00000380108:S489L;ENSP00000345773:S438L	ENSP00000345773:S438L	S	-	2	0	BEND7	13521272	0.009000	0.17119	0.002000	0.10522	0.030000	0.12068	1.262000	0.32992	0.666000	0.31087	0.655000	0.94253	TCA	BEND7	-	NULL		0.483	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		G	NM_152751		13481266	-1	no_errors	ENST00000396900	ensembl	human	known	70_37	missense	SNP	0.002	A
C15orf40	123207	genome.wustl.edu	37	15	83680348	83680348	+	Silent	SNP	G	G	A	rs375497525	byFrequency	TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr15:83680348G>A	ENST00000513601.2	-	1	19	c.12C>T	c.(10-12)ctC>ctT	p.L4L	RP11-382A20.7_ENST00000570202.1_RNA|C15orf40_ENST00000538348.2_Silent_p.L4L|RP11-382A20.5_ENST00000566841.1_RNA|C15orf40_ENST00000304177.5_5'UTR|C15orf40_ENST00000451195.3_Silent_p.L4L|C15orf40_ENST00000565712.1_Silent_p.L4L			Q8WUR7	CO040_HUMAN	chromosome 15 open reading frame 40	4										large_intestine(3)|lung(2)|skin(1)	6						GCCCGCTGCGGAGCCGCAGCA	0.706											OREG0023391	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													14.0	18.0	17.0					15																	83680348		690	1590	2280	SO:0001819	synonymous_variant	123207			BC019820	CCDS32312.1, CCDS32312.2, CCDS53968.1, CCDS53969.1	15q25.2	2012-05-30			ENSG00000169609	ENSG00000169609			28443	protein-coding gene	gene with protein product							Standard	NM_144597		Approved	MGC29937	uc010uoo.1	Q8WUR7	OTTHUMG00000160473	ENST00000513601.2:c.12C>T	15.37:g.83680348G>A		Somatic	1223	WXS	Illumina HiSeq	Phase_IV	A6NIC9|B2R5E7|F5GX92|F8WD31|G5EA00	Silent	SNP	pfam_DUF167,superfamily_DUF167	p.L4	ENST00000513601.2	37	c.12	CCDS32312.2	15																																																																																			C15orf40	-	NULL		0.706	C15orf40-001	KNOWN	basic|CCDS	protein_coding	C15orf40	HGNC	protein_coding	OTTHUMT00000360737.2	G	NM_144597		83680348	-1	no_errors	ENST00000451195	ensembl	human	known	70_37	silent	SNP	0.000	A
C7orf57	136288	genome.wustl.edu	37	7	48081068	48081068	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr7:48081068G>C	ENST00000348904.3	+	3	405	c.193G>C	c.(193-195)Gaa>Caa	p.E65Q	C7orf57_ENST00000435376.1_5'UTR|C7orf57_ENST00000430738.1_Missense_Mutation_p.E110Q|C7orf57_ENST00000420324.1_Missense_Mutation_p.E110Q|C7orf57_ENST00000539619.1_Missense_Mutation_p.E65Q	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	65										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						CTGGATAAAAGAAACAGATTC	0.607																																																	0													38.0	41.0	40.0					7																	48081068		1912	4125	6037	SO:0001583	missense	136288			BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.193G>C	7.37:g.48081068G>C	ENSP00000335500:p.Glu65Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JBJ8	Missense_Mutation	SNP	NULL	p.E65Q	ENST00000348904.3	37	c.193	CCDS47583.1	7	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191263	0.78902	.	.	ENSG00000164746	ENST00000420324;ENST00000430738;ENST00000348904;ENST00000539619	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.69	5.69	0.88448	.	0.183466	0.46145	D	0.000310	T	0.49133	0.1539	M	0.66939	2.045	0.36265	D	0.854808	P	0.45827	0.867	B	0.44044	0.439	T	0.62378	-0.6867	10	0.62326	D	0.03	-28.3446	17.2972	0.87173	0.0:0.0:1.0:0.0	.	65	Q8NEG2	CG057_HUMAN	Q	110;110;65;65	ENSP00000394648:E110Q;ENSP00000410944:E110Q;ENSP00000335500:E65Q;ENSP00000442474:E65Q	ENSP00000335500:E65Q	E	+	1	0	C7orf57	48047593	1.000000	0.71417	0.947000	0.38551	0.622000	0.37654	6.127000	0.71642	2.670000	0.90874	0.563000	0.77884	GAA	C7orf57	-	NULL		0.607	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf57	HGNC	protein_coding	OTTHUMT00000341745.1	G	NM_001100159		48081068	+1	no_errors	ENST00000348904	ensembl	human	known	70_37	missense	SNP	1.000	C
CCAR1	55749	genome.wustl.edu	37	10	70546378	70546378	+	Missense_Mutation	SNP	T	T	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr10:70546378T>C	ENST00000265872.6	+	21	2928	c.2809T>C	c.(2809-2811)Tgt>Cgt	p.C937R	CCAR1_ENST00000535016.1_Missense_Mutation_p.C922R|CCAR1_ENST00000543719.1_Missense_Mutation_p.C922R	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	937					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TCAAAGTCATTGTGGTTACCT	0.318																																																	0													91.0	91.0	91.0					10																	70546378		2203	4300	6503	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2809T>C	10.37:g.70546378T>C	ENSP00000265872:p.Cys937Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.C937R	ENST00000265872.6	37	c.2809	CCDS7282.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.2|22.2	4.263348|4.263348	0.80358|0.80358	.|.	.|.	ENSG00000060339|ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539|ENST00000543706	T;T;T;T|.	0.00357|.	7.89;7.89;7.89;7.89|.	5.47|5.47	5.47|5.47	0.80525|0.80525	EF-hand-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76033|0.76033	0.3931|0.3931	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	D|.	0.65815|.	0.995|.	D|.	0.75484|.	0.986|.	T|T	0.77208|0.77208	-0.2672|-0.2672	10|5	0.56958|.	D|.	0.05|.	-10.4421|-10.4421	15.8482|15.8482	0.78907|0.78907	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	937|.	Q8IX12|.	CCAR1_HUMAN|.	R|S	937;922;922;922|226	ENSP00000265872:C937R;ENSP00000441820:C922R;ENSP00000445254:C922R;ENSP00000439252:C922R|.	ENSP00000265872:C937R|.	C|L	+|+	1|2	0|0	CCAR1|CCAR1	70216384|70216384	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.624000|7.624000	0.83124|0.83124	2.190000|2.190000	0.69967|0.69967	0.533000|0.533000	0.62120|0.62120	TGT|TTG	CCAR1	-	NULL		0.318	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	T	NM_018237		70546378	+1	no_errors	ENST00000265872	ensembl	human	known	70_37	missense	SNP	1.000	C
GBA2	57704	genome.wustl.edu	37	9	35736237	35736237	+	IGR	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr9:35736237C>T	ENST00000378103.3	-	0	3611				CREB3_ENST00000353704.2_Missense_Mutation_p.S237F|CREB3_ENST00000486056.1_3'UTR|GBA2_ENST00000467252.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTACTAGTCTCCTTCTGCCTC	0.522											OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													301.0	271.0	281.0					9																	35736237		2203	4300	6503	SO:0001628	intergenic_variant	10488			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35736237C>T		Somatic	857	WXS	Illumina HiSeq	Phase_IV	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S237F	ENST00000378103.3	37	c.710	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161952	0.78226	.	.	ENSG00000107175	ENST00000353704	T	0.70516	-0.49	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.84714	0.5533	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85064	0.0936	10	0.59425	D	0.04	.	19.3915	0.94584	0.0:1.0:0.0:0.0	.	261;237	O43889;O43889-2	CREB3_HUMAN;.	F	237	ENSP00000342136:S237F	ENSP00000342136:S237F	S	+	2	0	CREB3	35726237	1.000000	0.71417	0.998000	0.56505	0.792000	0.44763	5.507000	0.66999	2.702000	0.92279	0.655000	0.94253	TCC	CREB3	-	NULL		0.522	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CREB3	HGNC	protein_coding	OTTHUMT00000055456.1	C	NM_020944		35736237	+1	no_errors	ENST00000353704	ensembl	human	known	70_37	missense	SNP	1.000	T
CTCF	10664	genome.wustl.edu	37	16	67645908	67645908	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr16:67645908C>T	ENST00000264010.4	+	4	1280	c.836C>T	c.(835-837)tCa>tTa	p.S279L	CTCF_ENST00000401394.1_Intron|AC009095.4_ENST00000388909.4_RNA	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	279					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		CCACGGCGTTCAAATTTGGAT	0.458																																					Colon(175;1200 1966 6945 23069 27405)												0													147.0	121.0	130.0					16																	67645908		2198	4300	6498	SO:0001583	missense	10664			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.836C>T	16.37:g.67645908C>T	ENSP00000264010:p.Ser279Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S279L	ENST00000264010.4	37	c.836	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.141192	0.94560	.	.	ENSG00000102974	ENST00000264010	T	0.30981	1.51	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000030	T	0.42268	0.1195	N	0.19112	0.55	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.43893	-0.9363	10	0.87932	D	0	.	18.8894	0.92392	0.0:1.0:0.0:0.0	.	279	P49711	CTCF_HUMAN	L	279	ENSP00000264010:S279L	ENSP00000264010:S279L	S	+	2	0	CTCF	66203409	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.697000	0.92050	0.655000	0.94253	TCA	CTCF	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.458	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	C	NM_006565		67645908	+1	no_errors	ENST00000264010	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJC14	85406	genome.wustl.edu	37	12	56221331	56221331	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr12:56221331G>A	ENST00000357606.3	-	3	1401	c.1112C>T	c.(1111-1113)tCt>tTt	p.S371F	RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317287.5_Missense_Mutation_p.S371F|TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317269.3_Missense_Mutation_p.S371F			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	371					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CAAGGCTGGAGAATCCAGCCA	0.557																																																	0													69.0	70.0	70.0					12																	56221331		2203	4300	6503	SO:0001583	missense	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.1112C>T	12.37:g.56221331G>A	ENSP00000350223:p.Ser371Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.S371F	ENST00000357606.3	37	c.1112	CCDS8894.1	12	.	.	.	.	.	.	.	.	.	.	G	6.189	0.402994	0.11696	.	.	ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000537962;ENST00000317287	T;T;T	0.36520	1.25;1.25;1.25	5.47	3.54	0.40534	.	0.325140	0.24321	N	0.039546	T	0.22244	0.0536	L	0.27053	0.805	0.33409	D	0.57844	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.002	T	0.21518	-1.0243	9	.	.	.	-3.0085	7.9134	0.29803	0.0883:0.0:0.7536:0.1581	.	371;371	Q6Y2X3;A8K5A7	DJC14_HUMAN;.	F	371;371;81;371	ENSP00000350223:S371F;ENSP00000316240:S371F;ENSP00000317500:S371F	.	S	-	2	0	DNAJC14	54507598	0.950000	0.32346	0.992000	0.48379	0.099000	0.18886	1.368000	0.34216	0.700000	0.31782	0.655000	0.94253	TCT	DNAJC14	-	NULL		0.557	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC14	HGNC	protein_coding	OTTHUMT00000409095.1	G	NM_032364		56221331	-1	no_errors	ENST00000317269	ensembl	human	known	70_37	missense	SNP	0.996	A
DUS3L	56931	genome.wustl.edu	37	19	5789395	5789395	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr19:5789395G>A	ENST00000309061.7	-	3	819	c.723C>T	c.(721-723)ccC>ccT	p.P241P	DUS3L_ENST00000320699.8_Intron|DUS3L_ENST00000590681.1_5'UTR	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	241							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CAGCGGCAGCGGGTGTGGGGC	0.726																																																	0													6.0	9.0	8.0					19																	5789395		2107	4104	6211	SO:0001819	synonymous_variant	56931				CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.723C>T	19.37:g.5789395G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	NULL	p.P174L	ENST00000309061.7	37	c.521	CCDS32880.1	19																																																																																			DUS3L	-	NULL		0.726	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS3L	HGNC	protein_coding	OTTHUMT00000451870.2	G	NM_020175		5789395	-1	no_errors	ENST00000590110	ensembl	human	known	70_37	missense	SNP	0.000	A
ELAVL2	1993	genome.wustl.edu	37	9	23762091	23762091	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr9:23762091G>A	ENST00000397312.2	-	2	416	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	ELAVL2_ENST00000223951.6_Nonsense_Mutation_p.Q48*|ELAVL2_ENST00000380117.1_Nonsense_Mutation_p.Q48*|ELAVL2_ENST00000544538.1_Nonsense_Mutation_p.Q48*|ELAVL2_ENST00000380110.4_Nonsense_Mutation_p.Q77*|ELAVL2_ENST00000462649.1_5'Flank	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	48	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		GTCATGTTCTGAGGAAGGTAG	0.423																																																	0													278.0	252.0	261.0					9																	23762091		2203	4300	6503	SO:0001587	stop_gained	1993			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.142C>T	9.37:g.23762091G>A	ENSP00000380479:p.Gln48*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.Q76*	ENST00000397312.2	37	c.226	CCDS6515.1	9	.	.	.	.	.	.	.	.	.	.	G	39	7.620462	0.98393	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	.	.	.	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	20.33	0.98713	0.0:0.0:1.0:0.0	.	.	.	.	X	48;48;48;48;48;76;48	.	ENSP00000223951:Q48X	Q	-	1	0	ELAVL2	23752091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.810000	0.96702	0.585000	0.79938	CAG	ELAVL2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF		0.423	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	ELAVL2	HGNC	protein_coding	OTTHUMT00000051943.2	G	NM_004432		23762091	-1	no_errors	ENST00000359598	ensembl	human	known	70_37	nonsense	SNP	1.000	A
FLJ35934	400579	genome.wustl.edu	37	17	18315314	18315314	+	lincRNA	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr17:18315314C>T	ENST00000577684.1	+	0	842																											CCCACCTTCTCGCAGCAGCGA	0.592																																																	0																																												0																															17.37:g.18315314C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000577684.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	.	8.359	0.832729	0.16820	.	.	ENSG00000220161	ENST00000407600	.	.	.	.	.	.	.	.	.	.	.	T	0.47060	0.1425	.	.	.	.	.	.	.	.	.	.	.	.	T	0.56251	-0.8010	3	0.87932	D	0	.	5.9763	0.19382	0.0:0.9994:0.0:6.0E-4	.	.	.	.	L	155	.	ENSP00000385341:S155L	S	+	2	0	AL353997.1	18256039	0.828000	0.29307	0.289000	0.24876	0.293000	0.27360	1.967000	0.40491	0.172000	0.19760	0.175000	0.17021	TCG	RP1-37N7.3	-	-		0.592	RP1-37N7.3-001	KNOWN	basic	lincRNA	ENSG00000220161	Clone_based_vega_gene	lincRNA	OTTHUMT00000447480.1	C			18315314	+1	no_errors	ENST00000407600	ensembl	human	known	70_37	rna	SNP	0.925	T
AP000233.4	0	genome.wustl.edu	37	21	26541865	26541865	+	lincRNA	SNP	T	T	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr21:26541865T>C	ENST00000409758.1	-	0	642																											AACAGACAGGTTGTAGCATgc	0.433																																																	0																																												0																															21.37:g.26541865T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000409758.1	37	NULL		21																																																																																			AP000233.4	-	-		0.433	AP000233.4-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000222042	Clone_based_vega_gene	lincRNA	OTTHUMT00000171136.3	T			26541865	-1	no_errors	ENST00000409758	ensembl	human	known	70_37	rna	SNP	0.000	C
ATF2	1386	genome.wustl.edu	37	2	176032661	176032661	+	Intron	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr2:176032661G>A	ENST00000264110.2	-	1	157				MIR933_ENST00000401154.1_RNA|ATF2_ENST00000426833.3_Intron|AC096649.2_ENST00000449168.1_RNA|ATF2_ENST00000487334.2_Intron|ATF2_ENST00000345739.5_Intron|ATF2_ENST00000392544.1_Intron|ATF2_ENST00000409635.1_Intron|ATF2_ENST00000392543.2_Intron|ATF2_ENST00000409499.1_Intron|ATF2_ENST00000538946.1_Intron|ATF2_ENST00000409833.1_Intron|ATF2_ENST00000413123.1_Intron	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2						adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	AGGAGCACCCGAGGTGATGGG	0.647																																					Pancreas(17;87 705 4534 15538 30988)												0																																										SO:0001627	intron_variant	0			X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.141+116C>T	2.37:g.176032661G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	RNA	SNP	-	NULL	ENST00000264110.2	37	NULL	CCDS2262.1	2																																																																																			AC096649.2	-	-		0.647	ATF2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000229750	Clone_based_vega_gene	protein_coding	OTTHUMT00000255562.1	G	NM_001880		176032661	+1	no_errors	ENST00000449168	ensembl	human	known	70_37	rna	SNP	0.977	A
CTC-367F4.1	0	genome.wustl.edu	37	5	144608325	144608325	+	lincRNA	SNP	G	G	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:144608325G>T	ENST00000504204.1	-	0	220																											TCACTGCACCGTGAAGACAGA	0.517																																																	0																																												0																															5.37:g.144608325G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000504204.1	37	NULL		5																																																																																			CTC-367F4.1	-	-		0.517	CTC-367F4.1-001	KNOWN	basic	lincRNA	ENSG00000251031	Clone_based_vega_gene	lincRNA	OTTHUMT00000372800.1	G			144608325	-1	no_errors	ENST00000504204	ensembl	human	known	70_37	rna	SNP	0.414	T
FAM155B	27112	genome.wustl.edu	37	X	68749616	68749616	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chrX:68749616C>A	ENST00000252338.4	+	3	1278	c.1236C>A	c.(1234-1236)agC>agA	p.S412R		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	413						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						GCCGTGTCAGCAACAAGCCCG	0.602																																																	0													153.0	105.0	121.0					X																	68749616		2203	4300	6503	SO:0001583	missense	27112			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1236C>A	X.37:g.68749616C>A	ENSP00000252338:p.Ser412Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	NULL	p.S412R	ENST00000252338.4	37	c.1236	CCDS35317.1	X	.	.	.	.	.	.	.	.	.	.	C	0.860	-0.735732	0.03111	.	.	ENSG00000130054	ENST00000252338	T	0.44482	0.92	4.05	1.16	0.20824	.	0.650758	0.15210	N	0.274542	T	0.21921	0.0528	N	0.14661	0.345	0.30256	N	0.793595	B	0.28880	0.226	B	0.31101	0.124	T	0.28138	-1.0053	10	0.15952	T	0.53	-2.6256	7.419	0.27061	0.0:0.6681:0.0:0.3319	.	412	O75949-2	.	R	412	ENSP00000252338:S412R	ENSP00000252338:S412R	S	+	3	2	FAM155B	68666341	0.999000	0.42202	0.866000	0.34008	0.040000	0.13550	0.943000	0.29030	0.244000	0.21351	-0.487000	0.04747	AGC	FAM155B	-	NULL		0.602	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155B	HGNC	protein_coding	OTTHUMT00000057037.1	C	NM_015686		68749616	+1	no_errors	ENST00000252338	ensembl	human	known	70_37	missense	SNP	0.865	A
FAM174B	400451	genome.wustl.edu	37	15	93162638	93162638	+	3'UTR	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr15:93162638G>A	ENST00000327355.5	-	0	826				FAM174B_ENST00000553393.1_Intron|FAM174B_ENST00000555748.1_Missense_Mutation_p.A35V|FAM174B_ENST00000555696.1_Missense_Mutation_p.A35V|FAM174B_ENST00000555064.1_Missense_Mutation_p.A35V|RP11-386M24.9_ENST00000607766.1_RNA	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B							integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						ACCCCAGGTTGCAGCTGACCA	0.532																																																	0													51.0	56.0	54.0					15																	93162638		2010	4189	6199	SO:0001624	3_prime_UTR_variant	400451				CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.*48C>T	15.37:g.93162638G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3ZCR9|Q8NBH7	Missense_Mutation	SNP	NULL	p.A35V	ENST00000327355.5	37	c.104	CCDS45355.1	15	.	.	.	.	.	.	.	.	.	.	G	7.981	0.751219	0.15778	.	.	ENSG00000185442	ENST00000555748	.	.	.	2.89	0.894	0.19242	.	.	.	.	.	T	0.32071	0.0817	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25363	-1.0134	4	.	.	.	.	7.4731	0.27361	0.0:0.0:0.5043:0.4957	.	.	.	.	V	35	.	.	A	-	2	0	FAM174B	90963642	0.001000	0.12720	0.016000	0.15963	0.899000	0.52679	0.539000	0.23175	0.243000	0.21327	0.561000	0.74099	GCA	FAM174B	-	NULL		0.532	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM174B	HGNC	protein_coding	OTTHUMT00000414931.1	G	NM_207446		93162638	-1	no_errors	ENST00000555064	ensembl	human	putative	70_37	missense	SNP	0.019	A
FAM174B	400451	genome.wustl.edu	37	15	93277233	93277233	+	RNA	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr15:93277233C>T	ENST00000556424.1	-	0	95																											TCCAGCACCTCTGCAGTGAGG	0.582																																																	0																																												400451																															15.37:g.93277233C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000556424.1	37	NULL		15																																																																																			FAM174B	-	-		0.582	RP11-386M24.4-002	KNOWN	basic	processed_transcript	FAM174B	HGNC	pseudogene	OTTHUMT00000471216.1	C			93277233	-1	no_errors	ENST00000556424	ensembl	human	known	70_37	rna	SNP	0.996	T
NUTM2D	728130	genome.wustl.edu	37	10	89125891	89125891	+	Intron	SNP	C	C	T	rs61858522	byFrequency	TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr10:89125891C>T	ENST00000381697.2	+	7	2233				NUTM2D_ENST00000412718.1_Intron			Q5VT03	NTM2D_HUMAN	NUT family member 2D																		CCTTTCCTCCCGCAGCTAGTG	0.632																																																	0																																										SO:0001627	intron_variant	728130					10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.1636-5C>T	10.37:g.89125891C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGV9	RNA	SNP	-	NULL	ENST00000381697.2	37	NULL		10																																																																																			FAM22D	-	-		0.632	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	FAM22D	HGNC	protein_coding	OTTHUMT00000470142.1	C	NR_075100		89125891	+1	no_errors	ENST00000465545	ensembl	human	known	70_37	rna	SNP	0.001	T
FANCA	2175	genome.wustl.edu	37	16	89849269	89849269	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr16:89849269C>A	ENST00000389301.3	-	17	1654	c.1624G>T	c.(1624-1626)Gag>Tag	p.E542*	FANCA_ENST00000568369.1_Nonsense_Mutation_p.E542*	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	542					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AACATTACCTCAGTAATGTCC	0.463			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													65.0	61.0	62.0					16																	89849269		2198	4300	6498	SO:0001587	stop_gained	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1624G>T	16.37:g.89849269C>A	ENSP00000373952:p.Glu542*	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Nonsense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.E542*	ENST00000389301.3	37	c.1624	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997403	0.74818	.	.	ENSG00000187741	ENST00000389301	.	.	.	5.45	1.21	0.21127	.	0.506604	0.19707	N	0.107912	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-15.8608	8.2712	0.31844	0.0:0.3027:0.5379:0.1593	.	.	.	.	X	542	.	ENSP00000373952:E542X	E	-	1	0	FANCA	88376770	0.731000	0.28111	0.316000	0.25252	0.073000	0.16967	0.865000	0.27940	0.260000	0.21731	0.555000	0.69702	GAG	FANCA	-	NULL		0.463	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	C			89849269	-1	no_errors	ENST00000389301	ensembl	human	known	70_37	nonsense	SNP	0.306	A
FGF11	2256	genome.wustl.edu	37	17	7344828	7344828	+	Missense_Mutation	SNP	C	C	T	rs201458275		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr17:7344828C>T	ENST00000293829.4	+	2	826	c.232C>T	c.(232-234)Cgc>Tgc	p.R78C	FGF11_ENST00000575082.1_5'UTR|FGF11_ENST00000575398.1_5'UTR|RP11-104H15.10_ENST00000575331.1_RNA|FGF11_ENST00000575235.1_5'UTR|RP11-104H15.7_ENST00000575310.1_RNA|RP11-104H15.8_ENST00000576615.1_RNA|FGF11_ENST00000572907.1_5'UTR	NM_004112.2	NP_004103.1	Q92914	FGF11_HUMAN	fibroblast growth factor 11	78					cell-cell signaling (GO:0007267)|nervous system development (GO:0007399)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	growth factor activity (GO:0008083)			central_nervous_system(1)|large_intestine(3)|ovary(1)|prostate(1)	6		Prostate(122;0.157)				ACTGTTCTGCCGCCAGGGTTT	0.547																																																	0													69.0	69.0	69.0					17																	7344828		2203	4300	6503	SO:0001583	missense	2256				CCDS11105.1	17p13.1	2008-07-18			ENSG00000161958	ENSG00000161958			3667	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 3"""	601514				8790420	Standard	NM_004112		Approved	FHF3, FLJ16061, MGC45269, MGC102953	uc002ggz.3	Q92914	OTTHUMG00000108136	ENST00000293829.4:c.232C>T	17.37:g.7344828C>T	ENSP00000293829:p.Arg78Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YDX8	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.R78C	ENST00000293829.4	37	c.232	CCDS11105.1	17	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952773	0.73787	.	.	ENSG00000161958	ENST00000293829	D	0.83335	-1.71	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.92861	0.7729	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	D	0.93817	0.7115	10	0.87932	D	0	.	15.7627	0.78101	0.0:1.0:0.0:0.0	.	19;78	B7Z1C3;Q92914	.;FGF11_HUMAN	C	78	ENSP00000293829:R78C	ENSP00000293829:R78C	R	+	1	0	FGF11	7285552	0.930000	0.31532	1.000000	0.80357	1.000000	0.99986	0.037000	0.13840	2.802000	0.96397	0.650000	0.86243	CGC	FGF11	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd		0.547	FGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF11	HGNC	protein_coding	OTTHUMT00000226939.3	C	NM_004112		7344828	+1	no_errors	ENST00000293829	ensembl	human	known	70_37	missense	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240421305	240421305	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr1:240421305C>A	ENST00000319653.9	+	7	4356	c.4126C>A	c.(4126-4128)Cat>Aat	p.H1376N	FMN2_ENST00000545751.1_Intron	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1376	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GTCTAGCCTTCATTTAGATAT	0.323																																																	0													92.0	91.0	91.0					1																	240421305		2203	4298	6501	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4126C>A	1.37:g.240421305C>A	ENSP00000318884:p.His1376Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.H1376N	ENST00000319653.9	37	c.4126	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.237558	0.79800	.	.	ENSG00000155816	ENST00000319653;ENST00000441342	T;T	0.61510	1.12;0.1	5.42	5.42	0.78866	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000005	T	0.72391	0.3454	L	0.48877	1.53	0.80722	D	1	P;D;D	0.76494	0.734;0.999;0.999	P;D;D	0.87578	0.772;0.997;0.998	T	0.73930	-0.3827	10	0.87932	D	0	.	19.5833	0.95478	0.0:1.0:0.0:0.0	.	22;5;1376	F5H2C1;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	N	1376;22	ENSP00000318884:H1376N;ENSP00000388922:H22N	ENSP00000318884:H1376N	H	+	1	0	FMN2	238487928	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.245000	0.72398	2.708000	0.92522	0.561000	0.74099	CAT	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg		0.323	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	C	XM_371352		240421305	+1	no_errors	ENST00000319653	ensembl	human	known	70_37	missense	SNP	1.000	A
GNAT1	2779	genome.wustl.edu	37	3	50231284	50231284	+	Missense_Mutation	SNP	C	C	T	rs375795574		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:50231284C>T	ENST00000433068.1	+	5	604	c.548C>T	c.(547-549)aCg>aTg	p.T183M	GNAT1_ENST00000232461.3_Missense_Mutation_p.T183M|GNAT1_ENST00000481246.1_3'UTR	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	183					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		ATCATCGAGACGCAGTTCTCC	0.652																																																	0								C	MET/THR,MET/THR	0,4406		0,0,2203	81.0	73.0	76.0		548,548	5.7	1.0	3		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GNAT1	NM_000172.3,NM_144499.2	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	183/351,183/351	50231284	1,13005	2203	4300	6503	SO:0001583	missense	2779				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.548C>T	3.37:g.50231284C>T	ENSP00000387555:p.Thr183Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VBN2	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.T183M	ENST00000433068.1	37	c.548	CCDS2812.1	3	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407214	0.83230	0.0	1.16E-4	ENSG00000114349	ENST00000232461;ENST00000433068	D;D	0.89196	-2.48;-2.48	5.7	5.7	0.88788	.	0.045321	0.85682	D	0.000000	D	0.94945	0.8365	M	0.83118	2.625	0.47374	D	0.999403	D	0.89917	1.0	D	0.77004	0.989	D	0.95088	0.8219	10	0.72032	D	0.01	.	18.6092	0.91277	0.0:1.0:0.0:0.0	.	183	P11488	GNAT1_HUMAN	M	183	ENSP00000232461:T183M;ENSP00000387555:T183M	ENSP00000232461:T183M	T	+	2	0	GNAT1	50206288	1.000000	0.71417	0.981000	0.43875	0.984000	0.73092	4.464000	0.60134	2.711000	0.92665	0.561000	0.74099	ACG	GNAT1	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I		0.652	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GNAT1	HGNC	protein_coding	OTTHUMT00000345957.1	C	NM_000172		50231284	+1	no_errors	ENST00000232461	ensembl	human	known	70_37	missense	SNP	0.991	T
GPR128	84873	genome.wustl.edu	37	3	100364821	100364821	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:100364821C>T	ENST00000273352.3	+	9	1247	c.979C>T	c.(979-981)Caa>Taa	p.Q327*	GPR128_ENST00000475887.1_Nonsense_Mutation_p.Q32*|SNORA31_ENST00000517180.1_RNA	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	327					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						TGTAGTTTATCAAAATGACAA	0.318																																					Pancreas(87;185 1975 7223 18722)												0													71.0	69.0	69.0					3																	100364821		2202	4300	6502	SO:0001587	stop_gained	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.979C>T	3.37:g.100364821C>T	ENSP00000273352:p.Gln327*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14D94|Q86SQ2	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q327*	ENST00000273352.3	37	c.979	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.130280	0.98085	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	.	.	.	5.19	4.25	0.50352	.	0.000000	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6162	0.56578	0.0:0.8333:0.1667:0.0	.	.	.	.	X	327;32	.	ENSP00000273352:Q327X	Q	+	1	0	GPR128	101847511	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.322000	0.43814	2.568000	0.86640	0.655000	0.94253	CAA	GPR128	-	NULL		0.318	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	HGNC	protein_coding	OTTHUMT00000353236.1	C			100364821	+1	no_errors	ENST00000273352	ensembl	human	known	70_37	nonsense	SNP	1.000	T
GSG2	83903	genome.wustl.edu	37	17	3629351	3629351	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr17:3629351G>C	ENST00000325418.4	+	1	2141	c.2122G>C	c.(2122-2124)Gag>Cag	p.E708Q	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	708	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										TTCCATGGATGAGGACCTGTT	0.493																																																	0													118.0	104.0	109.0					17																	3629351		2203	4300	6503	SO:0001583	missense	83903			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.2122G>C	17.37:g.3629351G>C	ENSP00000325290:p.Glu708Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	pfam_DUF3635,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.E708Q	ENST00000325418.4	37	c.2122	CCDS11036.1	17	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472967	0.43942	.	.	ENSG00000177602	ENST00000325418	T	0.07567	3.18	5.41	3.29	0.37713	Protein kinase-like domain (1);Domain of unknown function DUF3635 (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.28001	0.0690	M	0.81497	2.545	0.24654	N	0.993502	D	0.56287	0.975	P	0.62089	0.898	T	0.08493	-1.0719	10	0.87932	D	0	-40.3389	15.5526	0.76164	0.0:0.3486:0.6513:0.0	.	708	Q8TF76	HASP_HUMAN	Q	708	ENSP00000325290:E708Q	ENSP00000325290:E708Q	E	+	1	0	GSG2	3576100	1.000000	0.71417	0.933000	0.37362	0.655000	0.38815	3.099000	0.50267	1.415000	0.47037	0.655000	0.94253	GAG	GSG2	-	pfam_DUF3635,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom		0.493	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG2	HGNC	protein_coding	OTTHUMT00000207391.1	G	NM_031965		3629351	+1	no_errors	ENST00000325418	ensembl	human	known	70_37	missense	SNP	0.305	C
HNRNPUL2	221092	genome.wustl.edu	37	11	62489768	62489768	+	Silent	SNP	G	G	A	rs557571395		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr11:62489768G>A	ENST00000301785.5	-	7	1372	c.1180C>T	c.(1180-1182)Ctg>Ttg	p.L394L	HNRNPUL2-BSCL2_ENST00000403734.2_Silent_p.L394L	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	394	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CGGTCTGCCAGGGAATCCTTG	0.473																																																	0													95.0	99.0	98.0					11																	62489768		1894	4112	6006	SO:0001819	synonymous_variant	221092				CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1180C>T	11.37:g.62489768G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3B3	Silent	SNP	pfam_SPRY_rcpt,pfam_SAP_DNA-bd,pfam_Zeta_toxin_domain,pfam_Chromatin_KTI12,superfamily_ConA-like_lec_gl_sf,smart_SAP_DNA-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_DNA-bd	p.L394	ENST00000301785.5	37	c.1180	CCDS41659.1	11																																																																																			HNRNPUL2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.473	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL2	HGNC	protein_coding	OTTHUMT00000396208.2	G	XM_495877		62489768	-1	no_errors	ENST00000301785	ensembl	human	known	70_37	silent	SNP	0.957	A
HOXC8	3224	genome.wustl.edu	37	12	54405015	54405015	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr12:54405015G>A	ENST00000040584.4	+	2	816	c.579G>A	c.(577-579)gtG>gtA	p.V193V	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	193					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						AGAGACAAGTGAAGATCTGGT	0.468																																					GBM(197;701 2226 7002 18822 41696)												0													99.0	97.0	98.0					12																	54405015		2203	4300	6503	SO:0001819	synonymous_variant	3224			X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.579G>A	12.37:g.54405015G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4J4|O15221|O15362	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_HTH_motif	p.V193	ENST00000040584.4	37	c.579	CCDS8870.1	12																																																																																			HOXC8	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_HTH_motif		0.468	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC8	HGNC	protein_coding	OTTHUMT00000358957.2	G			54405015	+1	no_errors	ENST00000040584	ensembl	human	known	70_37	silent	SNP	1.000	A
INCENP	3619	genome.wustl.edu	37	11	61906405	61906405	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr11:61906405G>A	ENST00000394818.3	+	7	1421	c.1219G>A	c.(1219-1221)Gag>Aag	p.E407K	INCENP_ENST00000278849.4_Missense_Mutation_p.E407K	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	407					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CAATGACACGGAGATTGCCAA	0.582																																																	0													134.0	121.0	125.0					11																	61906405		2202	4299	6501	SO:0001583	missense	3619			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1219G>A	11.37:g.61906405G>A	ENSP00000378295:p.Glu407Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MQD2|Q5Y192	Missense_Mutation	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.E407K	ENST00000394818.3	37	c.1219	CCDS44624.1	11	.	.	.	.	.	.	.	.	.	.	G	3.108	-0.183271	0.06340	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.12879	2.64;2.64	5.17	-0.0393	0.13876	.	0.558795	0.17233	N	0.181862	T	0.02304	0.0071	N	0.00347	-1.61	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.45190	-0.9278	10	0.02654	T	1	.	7.4324	0.27134	0.6197:0.0:0.3803:0.0	.	407;407;407	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	K	407	ENSP00000378295:E407K;ENSP00000278849:E407K	ENSP00000278849:E407K	E	+	1	0	INCENP	61662981	0.474000	0.25886	0.076000	0.20297	0.019000	0.09904	0.742000	0.26216	0.063000	0.16370	-0.290000	0.09829	GAG	INCENP	-	NULL		0.582	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	G	NM_020238		61906405	+1	no_errors	ENST00000394818	ensembl	human	known	70_37	missense	SNP	0.044	A
KCNJ8	3764	genome.wustl.edu	37	12	21919090	21919090	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr12:21919090G>A	ENST00000240662.2	-	3	1187	c.842C>T	c.(841-843)tCa>tTa	p.S281L	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	281					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	GTCAGTTGCTGAGATGTCATA	0.473																																																	0													78.0	65.0	69.0					12																	21919090		2203	4300	6503	SO:0001583	missense	3764			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.842C>T	12.37:g.21919090G>A	ENSP00000240662:p.Ser281Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O00657	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	p.S281L	ENST00000240662.2	37	c.842	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988594	0.93106	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.91996	-2.95	5.35	5.35	0.76521	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.059055	0.64402	D	0.000001	D	0.95335	0.8486	M	0.75085	2.285	0.80722	D	1	D	0.69078	0.997	P	0.59487	0.858	D	0.95485	0.8564	10	0.87932	D	0	.	19.2644	0.93980	0.0:0.0:1.0:0.0	.	281	Q15842	IRK8_HUMAN	L	281	ENSP00000240662:S281L	ENSP00000240662:S281L	S	-	2	0	KCNJ8	21810357	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	7.685000	0.84117	2.782000	0.95742	0.563000	0.77884	TCA	KCNJ8	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1		0.473	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1	G	NM_004982		21919090	-1	no_errors	ENST00000240662	ensembl	human	known	70_37	missense	SNP	1.000	A
IRAK3	11213	genome.wustl.edu	37	12	66638954	66638954	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr12:66638954C>T	ENST00000261233.4	+	11	1647	c.1226C>T	c.(1225-1227)cCc>cTc	p.P409L	IRAK3_ENST00000457197.2_Missense_Mutation_p.P348L	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		AAAGTGCCTCCCTGCCCTCGG	0.478																																																	0													81.0	82.0	81.0					12																	66638954		2203	4300	6503	SO:0001583	missense	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1226C>T	12.37:g.66638954C>T	ENSP00000261233:p.Pro409Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Death,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom	p.P409L	ENST00000261233.4	37	c.1226	CCDS8975.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622768	0.87460	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.35973	1.28;1.28	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.284214	0.35436	N	0.003205	T	0.54078	0.1836	L	0.52011	1.625	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.75484	0.976;0.986	T	0.44034	-0.9354	9	.	.	.	-15.9593	15.7568	0.78037	0.0:1.0:0.0:0.0	.	348;409	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	L	409;348	ENSP00000261233:P409L;ENSP00000409852:P348L	.	P	+	2	0	IRAK3	64925221	0.008000	0.16893	0.998000	0.56505	0.875000	0.50365	1.559000	0.36320	2.793000	0.96121	0.561000	0.74099	CCC	IRAK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.478	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK3	HGNC	protein_coding	OTTHUMT00000401908.1	C			66638954	+1	no_errors	ENST00000261233	ensembl	human	known	70_37	missense	SNP	1.000	T
KDM3B	51780	genome.wustl.edu	37	5	137727474	137727474	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:137727474C>G	ENST00000314358.5	+	8	2353	c.2153C>G	c.(2152-2154)tCt>tGt	p.S718C	KDM3B_ENST00000542866.1_Intron|KDM3B_ENST00000394866.1_Missense_Mutation_p.S374C	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	718	Ser-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CCAAGCCTCTCTGCCATGGGG	0.562																																																	0													42.0	50.0	47.0					5																	137727474		2198	4297	6495	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2153C>G	5.37:g.137727474C>G	ENSP00000326563:p.Ser718Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S718C	ENST00000314358.5	37	c.2153	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605898	0.46527	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.73897	-0.26;-0.79	5.42	5.42	0.78866	.	0.057976	0.64402	D	0.000001	T	0.74869	0.3773	N	0.19112	0.55	0.80722	D	1	D;P	0.54207	0.965;0.94	P;P	0.55824	0.785;0.707	T	0.77133	-0.2700	10	0.52906	T	0.07	-8.4696	19.1662	0.93559	0.0:1.0:0.0:0.0	.	374;718	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	C	718;508;374	ENSP00000326563:S718C;ENSP00000378335:S374C	ENSP00000326563:S718C	S	+	2	0	KDM3B	137755373	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.529000	0.45632	2.694000	0.91930	0.655000	0.94253	TCT	KDM3B	-	NULL		0.562	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	C	NM_016604		137727474	+1	no_errors	ENST00000314358	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM3B	51780	genome.wustl.edu	37	5	137727607	137727607	+	Silent	SNP	C	C	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:137727607C>G	ENST00000314358.5	+	8	2486	c.2286C>G	c.(2284-2286)ctC>ctG	p.L762L	KDM3B_ENST00000542866.1_Intron|KDM3B_ENST00000394866.1_Silent_p.L418L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	762					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ATCCCCTCCTCAAAACCTTTA	0.547																																																	0													155.0	173.0	167.0					5																	137727607		2203	4300	6503	SO:0001819	synonymous_variant	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2286C>G	5.37:g.137727607C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L762	ENST00000314358.5	37	c.2286	CCDS34242.1	5																																																																																			KDM3B	-	NULL		0.547	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	C	NM_016604		137727607	+1	no_errors	ENST00000314358	ensembl	human	known	70_37	silent	SNP	1.000	G
KDM3B	51780	genome.wustl.edu	37	5	137727650	137727650	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:137727650C>G	ENST00000314358.5	+	8	2529	c.2329C>G	c.(2329-2331)Ctg>Gtg	p.L777V	KDM3B_ENST00000542866.1_Intron|KDM3B_ENST00000394866.1_Missense_Mutation_p.L433V	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	777					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						AGGCGGCTTTCTGTCCTCCCC	0.532																																																	0													184.0	203.0	197.0					5																	137727650		2203	4300	6503	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2329C>G	5.37:g.137727650C>G	ENSP00000326563:p.Leu777Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L777V	ENST00000314358.5	37	c.2329	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	C	8.240	0.806653	0.16467	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.70164	0.12;-0.46	5.52	4.59	0.56863	.	0.335552	0.26262	N	0.025384	T	0.45074	0.1324	N	0.19112	0.55	0.80722	D	1	B;B	0.12013	0.002;0.005	B;B	0.13407	0.009;0.004	T	0.33650	-0.9860	10	0.12766	T	0.61	-24.2058	7.571	0.27907	0.0:0.7197:0.1695:0.1109	.	433;777	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	V	777;567;433	ENSP00000326563:L777V;ENSP00000378335:L433V	ENSP00000326563:L777V	L	+	1	2	KDM3B	137755549	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.975000	0.40569	2.761000	0.94854	0.655000	0.94253	CTG	KDM3B	-	NULL		0.532	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	C	NM_016604		137727650	+1	no_errors	ENST00000314358	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM3B	51780	genome.wustl.edu	37	5	137727777	137727777	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:137727777C>G	ENST00000314358.5	+	8	2656	c.2456C>G	c.(2455-2457)tCa>tGa	p.S819*	KDM3B_ENST00000542866.1_Intron|KDM3B_ENST00000394866.1_Nonsense_Mutation_p.S475*	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	819					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						AGTGACCTGTCAGATTTGAGT	0.537																																																	0													75.0	81.0	79.0					5																	137727777		2203	4300	6503	SO:0001587	stop_gained	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2456C>G	5.37:g.137727777C>G	ENSP00000326563:p.Ser819*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Nonsense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S819*	ENST00000314358.5	37	c.2456	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.569072	0.96540	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	.	.	.	5.83	5.83	0.93111	.	0.147544	0.47852	D	0.000207	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-19.1843	15.5741	0.76362	0.0:0.8628:0.1372:0.0	.	.	.	.	X	819;609;475	.	ENSP00000326563:S819X	S	+	2	0	KDM3B	137755676	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.500000	0.66943	2.762000	0.94881	0.561000	0.74099	TCA	KDM3B	-	NULL		0.537	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	C	NM_016604		137727777	+1	no_errors	ENST00000314358	ensembl	human	known	70_37	nonsense	SNP	1.000	G
KTN1	3895	genome.wustl.edu	37	14	56106701	56106701	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr14:56106701A>T	ENST00000395314.3	+	14	1962	c.1894A>T	c.(1894-1896)Agt>Tgt	p.S632C	KTN1_ENST00000438792.2_Missense_Mutation_p.S632C|KTN1_ENST00000413890.2_Missense_Mutation_p.S632C|KTN1_ENST00000416613.1_Missense_Mutation_p.S632C|KTN1_ENST00000395309.3_Missense_Mutation_p.S632C|KTN1_ENST00000395311.1_Missense_Mutation_p.S632C|KTN1_ENST00000395308.1_Missense_Mutation_p.S632C	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	632					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TCGTTTAACAAGTAAAGAAGA	0.308			T	RET	papillary thryoid																																			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													119.0	139.0	132.0					14																	56106701		2203	4299	6502	SO:0001583	missense	3895				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.1894A>T	14.37:g.56106701A>T	ENSP00000378725:p.Ser632Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	NULL	p.S632C	ENST00000395314.3	37	c.1894	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323518	0.81580	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	T;T;T;T;T;T;T	0.38722	1.12;1.21;1.17;1.21;1.12;1.12;1.21	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000012	T	0.61837	0.2379	L	0.59436	1.845	0.38333	D	0.943848	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.999;0.993;0.999	T	0.66795	-0.5833	10	0.59425	D	0.04	-8.8194	15.9669	0.79979	1.0:0.0:0.0:0.0	.	632;632;632;632	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	C	632	ENSP00000394992:S632C;ENSP00000378720:S632C;ENSP00000391964:S632C;ENSP00000378725:S632C;ENSP00000378719:S632C;ENSP00000378722:S632C;ENSP00000388807:S632C	ENSP00000378719:S632C	S	+	1	0	KTN1	55176454	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.094000	0.64523	2.166000	0.68216	0.402000	0.26972	AGT	KTN1	-	NULL		0.308	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	A			56106701	+1	no_errors	ENST00000395309	ensembl	human	known	70_37	missense	SNP	1.000	T
LIFR	3977	genome.wustl.edu	37	5	38557749	38557749	+	Intron	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr5:38557749G>A	ENST00000263409.4	-	2	144				LIFR_ENST00000453190.2_5'Flank|LIFR-AS1_ENST00000500733.2_RNA|LIFR_ENST00000503088.1_Intron|LIFR-AS1_ENST00000500817.2_RNA|MIR3650_ENST00000581972.1_RNA|LIFR-AS1_ENST00000514291.1_RNA	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha						cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ACCTTTCGATGAAACTCCAAA	0.363			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0																																										SO:0001627	intron_variant	100506495			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.19-26981C>T	5.37:g.38557749G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6LCD9	RNA	SNP	-	NULL	ENST00000263409.4	37	NULL	CCDS3927.1	5																																																																																			LIFR-AS1	-	-		0.363	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR-AS1	HGNC	protein_coding	OTTHUMT00000253823.1	G	NM_002310		38557749	+1	no_errors	ENST00000500733	ensembl	human	known	70_37	rna	SNP	0.058	A
LPCAT2	54947	genome.wustl.edu	37	16	55562473	55562473	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr16:55562473C>T	ENST00000262134.5	+	3	680	c.496C>T	c.(496-498)Cga>Tga	p.R166*		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	166					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						TATGGTATCTCGAAATGAGAA	0.378																																																	0													173.0	157.0	163.0					16																	55562473		2198	4300	6498	SO:0001587	stop_gained	54947			AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.496C>T	16.37:g.55562473C>T	ENSP00000262134:p.Arg166*	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KBM1|Q6MZJ6|Q9NX23	Nonsense_Mutation	SNP	pfam_EF-hand,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.R166*	ENST00000262134.5	37	c.496	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656979	0.67586	.	.	ENSG00000087253	ENST00000262134	.	.	.	5.8	3.67	0.42095	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-6.0514	10.1177	0.42601	0.2573:0.6424:0.1004:0.0	.	.	.	.	X	166	.	ENSP00000262134:R166X	R	+	1	2	LPCAT2	54119974	0.958000	0.32768	0.217000	0.23759	0.238000	0.25445	2.078000	0.41567	1.464000	0.47987	-0.234000	0.12200	CGA	LPCAT2	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase		0.378	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	HGNC	protein_coding	OTTHUMT00000256977.2	C	NM_017839		55562473	+1	no_errors	ENST00000262134	ensembl	human	known	70_37	nonsense	SNP	0.625	T
LY9	4063	genome.wustl.edu	37	1	160784494	160784494	+	Missense_Mutation	SNP	G	G	A	rs199963398		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr1:160784494G>A	ENST00000263285.6	+	4	1045	c.1015G>A	c.(1015-1017)Gtg>Atg	p.V339M	LY9_ENST00000392203.4_Missense_Mutation_p.V339M|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000341032.4_Missense_Mutation_p.V339M|LY9_ENST00000368037.5_Missense_Mutation_p.V339M|LY9_ENST00000368041.2_Missense_Mutation_p.V299M			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	339	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCATGCCTACGTGTGCTCAGA	0.587																																																	0													52.0	49.0	50.0					1																	160784494		2203	4300	6503	SO:0001583	missense	4063			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.1015G>A	1.37:g.160784494G>A	ENSP00000263285:p.Val339Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.V339M	ENST00000263285.6	37	c.1015	CCDS30916.1	1	.	.	.	.	.	.	.	.	.	.	G	9.644	1.139648	0.21205	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.01918	4.56;4.56	2.83	-3.34	0.04943	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00724	0.0024	L	0.60455	1.87	0.21445	N	0.99968	P;P;P;P;D;P	0.53151	0.93;0.93;0.82;0.921;0.958;0.93	B;B;B;B;B;B	0.37144	0.122;0.122;0.108;0.212;0.242;0.122	T	0.41520	-0.9504	9	0.87932	D	0	-0.1678	2.6617	0.05028	0.3953:0.0:0.2483:0.3563	.	339;299;299;339;339;339	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	M	339;339;339;339;299;299;241	ENSP00000342921:V339M;ENSP00000263285:V339M	ENSP00000263285:V339M	V	+	1	0	LY9	159051118	0.000000	0.05858	0.004000	0.12327	0.116000	0.19942	-1.249000	0.02888	-0.849000	0.04158	0.563000	0.77884	GTG	LY9	-	smart_Ig_sub		0.587	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LY9	HGNC	protein_coding	OTTHUMT00000060457.3	G	NM_002348		160784494	+1	no_errors	ENST00000263285	ensembl	human	known	70_37	missense	SNP	0.007	A
MIA2	117153	genome.wustl.edu	37	14	39722048	39722048	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr14:39722048C>T	ENST00000280082.3	+	5	1863	c.1664C>T	c.(1663-1665)tCa>tTa	p.S555L	RP11-407N17.3_ENST00000553728.1_Intron	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	0					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		TCGAAACCATCAGTAGACACC	0.393																																																	0													89.0	97.0	94.0					14																	39722048		2203	4300	6503	SO:0001583	missense	117153			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1664C>T	14.37:g.39722048C>T	ENSP00000280082:p.Ser555Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4H0|Q9H6C1	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.S555L	ENST00000280082.3	37	c.1664	CCDS9672.1	14	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883371	0.33255	.	.	ENSG00000150526	ENST00000280082	T	0.47869	0.83	5.29	2.41	0.29592	.	0.974484	0.08311	N	0.965363	T	0.30386	0.0763	.	.	.	0.09310	N	0.999999	B	0.14805	0.011	B	0.11329	0.006	T	0.26467	-1.0102	8	.	.	.	.	6.2025	0.20583	0.0:0.6699:0.1594:0.1707	.	555	Q96PC5-2	.	L	555	ENSP00000280082:S555L	.	S	+	2	0	MIA2	38791799	0.000000	0.05858	0.001000	0.08648	0.743000	0.42351	-0.212000	0.09319	0.299000	0.22661	0.585000	0.79938	TCA	MIA2	-	NULL		0.393	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	HGNC	protein_coding	OTTHUMT00000276768.3	C	NM_054024		39722048	+1	no_errors	ENST00000280082	ensembl	human	novel	70_37	missense	SNP	0.003	T
MIR137HG	400765	genome.wustl.edu	37	1	98515117	98515117	+	IGR	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr1:98515117C>T								MIR137HG (3390 upstream) : RP5-1070A16.1 (161185 downstream)																							CCAGTGCCTTCGCGTGGTGGC	0.592																																																	0																																										SO:0001628	intergenic_variant	400765																															1.37:g.98515117C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		1																																																																																			MIR137HG	-	-	0	0.592					MIR137HG	HGNC			C			98515117	-1	no_errors	ENST00000424528	ensembl	human	known	70_37	rna	SNP	1.000	T
MT-ND5	4540	genome.wustl.edu	37	M	13267	13267	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chrM:13267G>A	ENST00000361567.2	+	1	931	c.931G>A	c.(931-933)Gga>Aga	p.G311R	MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	311					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAAGTCAACTAGGACTCATAA	0.458																																																	0																																										SO:0001583	missense	4540					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.931G>A	M.37:g.13267G>A	ENSP00000354813:p.Gly311Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34773|Q8WCY3	Nonsense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.G311*	ENST00000361567.2	37	c.931		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.458	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		G	YP_003024036		13267	+1	no_errors	ENST00000361567	ensembl	human	known	70_37	nonsense	SNP	NULL	A
MUC4	4585	genome.wustl.edu	37	3	195492148	195492148	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:195492148G>A	ENST00000346145.4	-	8	1122	c.1083C>T	c.(1081-1083)gtC>gtT	p.V361V	MUC4_ENST00000475231.1_Silent_p.V4545V|MUC4_ENST00000463781.3_Silent_p.V4597V|MUC4_ENST00000349607.4_Silent_p.V310V	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1354					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACCTATGCTGACGGGTTGGA	0.652																																																	0													32.0	31.0	32.0					3																	195492148		2203	4300	6503	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.1083C>T	3.37:g.195492148G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V4597	ENST00000346145.4	37	c.13791	CCDS3310.1	3																																																																																			MUC4	-	pfam_AMOP,smart_AMOP,pfscan_AMOP		0.652	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	G	NM_018406		195492148	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	silent	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195506302	195506302	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:195506302G>T	ENST00000463781.3	-	2	12608	c.12149C>A	c.(12148-12150)cCt>cAt	p.P4050H	MUC4_ENST00000475231.1_Missense_Mutation_p.P4050H|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATTGGTGACAGGAAGAGGGGT	0.577																																																	0													37.0	20.0	26.0					3																	195506302		593	1222	1815	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12149C>A	3.37:g.195506302G>T	ENSP00000417498:p.Pro4050His	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P4050H	ENST00000463781.3	37	c.12149	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	4.183	0.032569	0.08101	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.31;1.36	.	.	.	.	.	.	.	.	T	0.19685	0.0473	N	0.19112	0.55	0.09310	N	1	B	0.23891	0.093	B	0.17433	0.018	T	0.23154	-1.0196	7	.	.	.	.	6.7067	0.23254	2.0E-4:0.0:0.9998:0.0	.	3922	E7ESK3	.	H	4050	ENSP00000417498:P4050H;ENSP00000420243:P4050H	.	P	-	2	0	MUC4	196991081	0.000000	0.05858	0.001000	0.08648	0.055000	0.15305	-2.428000	0.01025	0.488000	0.27723	0.064000	0.15345	CCT	MUC4	-	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195506302	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.021	T
OR51J1	79470	genome.wustl.edu	37	11	5424626	5424626	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr11:5424626G>T	ENST00000332043.1	+	1	800	c.800G>T	c.(799-801)gGa>gTa	p.G267V	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron			Q9H342	O51J1_HUMAN	olfactory receptor, family 51, subfamily J, member 1 (gene/pseudogene)	267					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CACCGCCTTGGACATCGTGTG	0.507																																																	0																																										SO:0001583	missense	79470					11p15.4	2012-08-09	2008-06-12	2004-03-10	ENSG00000184321	ENSG00000184321		"""GPCR / Class A : Olfactory receptors"""	14856	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily J, member 1"""	OR51J2, OR51J1P			Standard	NG_002252		Approved			Q9H342	OTTHUMG00000066666	ENST00000332043.1:c.800G>T	11.37:g.5424626G>T	ENSP00000332473:p.Gly267Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G267V	ENST00000332043.1	37	c.800		11	.	.	.	.	.	.	.	.	.	.	G	7.703	0.693572	0.15039	.	.	ENSG00000184321	ENST00000332043	T	0.37752	1.18	4.92	2.9	0.33743	.	.	.	.	.	T	0.47820	0.1466	.	.	.	0.39806	D	0.972631	.	.	.	.	.	.	T	0.53732	-0.8397	6	0.72032	D	0.01	.	10.2164	0.43170	0.0:0.1526:0.6995:0.148	.	.	.	.	V	267	ENSP00000332473:G267V	ENSP00000332473:G267V	G	+	2	0	OR51J1	5381202	0.108000	0.22018	0.929000	0.37066	0.102000	0.19082	1.107000	0.31110	1.256000	0.44068	0.563000	0.77884	GGA	OR51J1	-	pfscan_GPCR_Rhodpsn_7TM		0.507	OR51J1-001	KNOWN	basic|appris_principal	protein_coding	OR51J1	HGNC	protein_coding	OTTHUMT00000142957.1	G	NG_002252		5424626	+1	no_errors	ENST00000332043	ensembl	human	known	70_37	missense	SNP	0.890	T
PDE4C	5143	genome.wustl.edu	37	19	18331127	18331127	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr19:18331127G>A	ENST00000355502.3	-	11	1582	c.711C>T	c.(709-711)ttC>ttT	p.F237F	PDE4C_ENST00000594617.3_Silent_p.F237F|PDE4C_ENST00000539010.1_Silent_p.F6F|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000262805.12_Silent_p.F205F|PDE4C_ENST00000598111.2_Silent_p.F7F|PDE4C_ENST00000447275.3_Silent_p.F131F|PDE4C_ENST00000597297.1_Silent_p.F7F|PDE4C_ENST00000594465.3_Silent_p.F237F			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	237					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGATCCGCTTGAACTGGGGCG	0.622																																																	0													87.0	87.0	87.0					19																	18331127		2203	4300	6503	SO:0001819	synonymous_variant	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.711C>T	19.37:g.18331127G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.F237	ENST00000355502.3	37	c.711	CCDS12373.1	19																																																																																			PDE4C	-	NULL		0.622	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	G			18331127	-1	no_errors	ENST00000355502	ensembl	human	known	70_37	silent	SNP	1.000	A
PHKA2	5256	genome.wustl.edu	37	X	18944619	18944619	+	Missense_Mutation	SNP	T	T	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chrX:18944619T>C	ENST00000379942.4	-	14	2076	c.1411A>G	c.(1411-1413)Att>Gtt	p.I471V		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	471					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGGACTTGAATTGGATGAATG	0.473																																																	0													160.0	134.0	143.0					X																	18944619		2203	4300	6503	SO:0001583	missense	5256				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1411A>G	X.37:g.18944619T>C	ENSP00000369274:p.Ile471Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.I471V	ENST00000379942.4	37	c.1411	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	T	12.94	2.089486	0.36855	.	.	ENSG00000044446	ENST00000379942	D	0.91894	-2.93	5.38	5.38	0.77491	Glycoside hydrolase 15-related (1);	0.089368	0.85682	D	0.000000	D	0.90170	0.6928	L	0.60957	1.885	0.51482	D	0.999927	B	0.31680	0.335	B	0.35607	0.206	D	0.88532	0.3103	10	0.44086	T	0.13	-18.2701	11.1306	0.48345	0.0:0.0:0.152:0.848	.	471	P46019	KPB2_HUMAN	V	471	ENSP00000369274:I471V	ENSP00000369274:I471V	I	-	1	0	PHKA2	18854540	0.996000	0.38824	0.958000	0.39756	0.761000	0.43186	2.468000	0.45102	1.905000	0.55150	0.486000	0.48141	ATT	PHKA2	-	pfam_Glyco_hydro_15		0.473	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	T	NM_000292		18944619	-1	no_errors	ENST00000379942	ensembl	human	known	70_37	missense	SNP	0.985	C
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PLEKHA1	59338	genome.wustl.edu	37	10	124187844	124187844	+	Intron	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr10:124187844G>A	ENST00000368990.3	+	12	1031				PLEKHA1_ENST00000433307.1_Intron|PLEKHA1_ENST00000368988.1_Intron|PLEKHA1_ENST00000368989.2_Intron|PLEKHA1_ENST00000538022.1_Missense_Mutation_p.R318K	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1						androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TATACATCAAGAGCTGGTGAA	0.473																																																	0																																										SO:0001627	intron_variant	59338			AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.901-1296G>A	10.37:g.124187844G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ55|D3DRE2|Q9BVK0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R318K	ENST00000368990.3	37	c.953	CCDS7629.1	10	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261792	0.39995	.	.	ENSG00000107679	ENST00000538022	T	0.17370	2.28	5.76	5.76	0.90799	.	.	.	.	.	T	0.08313	0.0207	.	.	.	0.24756	N	0.992953	P	0.36683	0.565	B	0.29176	0.099	T	0.20940	-1.0260	8	0.02654	T	1	.	18.5043	0.90892	0.0:0.0:1.0:0.0	.	318	B3KQ55	.	K	318	ENSP00000438608:R318K	ENSP00000438608:R318K	R	+	2	0	PLEKHA1	124177834	1.000000	0.71417	0.741000	0.31004	0.994000	0.84299	8.236000	0.89805	2.882000	0.98803	0.655000	0.94253	AGA	PLEKHA1	-	NULL		0.473	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA1	HGNC	protein_coding	OTTHUMT00000050783.1	G	NM_001001974		124187844	+1	no_errors	ENST00000538022	ensembl	human	known	70_37	missense	SNP	1.000	A
PLTP	5360	genome.wustl.edu	37	20	44540071	44540071	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr20:44540071G>A	ENST00000477313.1	-	1	615	c.21C>T	c.(19-21)ctC>ctT	p.L7L	PLTP_ENST00000354050.4_Silent_p.L7L|PLTP_ENST00000420868.2_Silent_p.L7L|PLTP_ENST00000372420.1_5'Flank|PLTP_ENST00000372431.3_Silent_p.L7L|PLTP_ENST00000542937.1_Silent_p.L27L			P55058	PLTP_HUMAN	phospholipid transfer protein	7					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GCGCTAGGAAGAGGGCCCCGA	0.647																																																	0													33.0	39.0	37.0					20																	44540071		2187	4274	6461	SO:0001819	synonymous_variant	5360			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.21C>T	20.37:g.44540071G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Silent	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.L27	ENST00000477313.1	37	c.81	CCDS13386.1	20																																																																																			PLTP	-	NULL		0.647	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLTP	HGNC	protein_coding	OTTHUMT00000354633.1	G	NM_006227		44540071	-1	no_errors	ENST00000542937	ensembl	human	known	70_37	silent	SNP	0.266	A
RASD2	23551	genome.wustl.edu	37	22	35947704	35947704	+	Silent	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr22:35947704C>T	ENST00000216127.4	+	3	1068	c.426C>T	c.(424-426)aaC>aaT	p.N142N		NM_014310.3	NP_055125.2	Q96D21	RHES_HUMAN	RASD family, member 2	142					locomotory behavior (GO:0007626)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein sumoylation (GO:0033235)|regulation of cAMP-mediated signaling (GO:0043949)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission, dopaminergic (GO:0001963)	plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	13						GCAACAAGAACGACCACGGCG	0.622																																																	0													65.0	57.0	59.0					22																	35947704		2203	4300	6503	SO:0001819	synonymous_variant	23551			AF279143	CCDS13916.1	22q13.1	2014-05-09			ENSG00000100302	ENSG00000100302			18229	protein-coding gene	gene with protein product	"""tumor endothelial marker 2"", ""Ras homolog enriched in striatum"""	612842				10947988, 10467249, 14724584	Standard	NM_014310		Approved	TEM2, Rhes, MGC:4834	uc003anx.3	Q96D21	OTTHUMG00000150607	ENST00000216127.4:c.426C>T	22.37:g.35947704C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O95520|Q5THY8	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.N142	ENST00000216127.4	37	c.426	CCDS13916.1	22																																																																																			RASD2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.622	RASD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASD2	HGNC	protein_coding	OTTHUMT00000319063.1	C	NM_014310		35947704	+1	no_errors	ENST00000216127	ensembl	human	known	70_37	silent	SNP	0.809	T
SLC10A3	8273	genome.wustl.edu	37	X	153716978	153716978	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chrX:153716978G>A	ENST00000393587.4	-	3	565	c.302C>T	c.(301-303)cCt>cTt	p.P101L	SLC10A3_ENST00000369649.4_Missense_Mutation_p.P101L|UBL4A_ENST00000477777.1_5'Flank|UBL4A_ENST00000369653.4_5'Flank|SLC10A3_ENST00000393586.1_Missense_Mutation_p.P156L|UBL4A_ENST00000369660.4_5'Flank|SLC10A3_ENST00000263512.4_Missense_Mutation_p.P101L	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	101					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CATGGGGCCAGGCGCCGTCCT	0.592																																																	0													117.0	98.0	105.0					X																	153716978		2203	4300	6503	SO:0001583	missense	8273			X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.302C>T	X.37:g.153716978G>A	ENSP00000377212:p.Pro101Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HY79|Q9BSL2	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.P101L	ENST00000393587.4	37	c.302	CCDS14755.1	X	.	.	.	.	.	.	.	.	.	.	G	0.007	-2.015434	0.00422	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587;ENST00000453912	T;T;T;T	0.07908	3.16;3.15;3.2;3.2	5.23	0.199	0.15175	.	0.879471	0.09611	U	0.778889	T	0.07728	0.0194	L	0.41079	1.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.38308	-0.9667	10	0.32370	T	0.25	-1.1876	9.3159	0.37934	0.5856:0.0:0.4144:0.0	.	101;101	Q9BSL2;P09131	.;P3_HUMAN	L	101;156;101;101;101	ENSP00000358663:P101L;ENSP00000377211:P156L;ENSP00000263512:P101L;ENSP00000377212:P101L	ENSP00000263512:P101L	P	-	2	0	SLC10A3	153370172	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.160000	0.16462	0.027000	0.15297	0.529000	0.55759	CCT	SLC10A3	-	NULL		0.592	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A3	HGNC	protein_coding	OTTHUMT00000037235.3	G	NM_019848		153716978	-1	no_errors	ENST00000263512	ensembl	human	known	70_37	missense	SNP	0.000	A
SLC37A3	84255	genome.wustl.edu	37	7	140051159	140051159	+	Missense_Mutation	SNP	T	T	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr7:140051159T>G	ENST00000326232.9	-	9	999	c.796A>C	c.(796-798)Aat>Cat	p.N266H	SLC37A3_ENST00000340308.3_Missense_Mutation_p.N266H|SLC37A3_ENST00000447932.2_Missense_Mutation_p.N266H|SLC37A3_ENST00000429996.2_3'UTR	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	266					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.N266H(2)		endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					ATTGAATAATTCGGCTCATAT	0.428																																					Esophageal Squamous(133;211 1716 4665 11387 37873)												2	Substitution - Missense(2)	kidney(2)											172.0	154.0	160.0					7																	140051159		2203	4300	6503	SO:0001583	missense	84255			AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.796A>C	7.37:g.140051159T>G	ENSP00000321498:p.Asn266His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.N266H	ENST00000326232.9	37	c.796	CCDS5859.1	7	.	.	.	.	.	.	.	.	.	.	T	14.84	2.655275	0.47467	.	.	ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232	T;T;T	0.18960	2.18;2.43;2.43	5.2	2.82	0.32997	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.493107	0.25422	N	0.030781	T	0.28995	0.0720	L	0.55743	1.74	0.80722	D	1	P;D;P	0.57899	0.654;0.981;0.581	B;P;P	0.53062	0.413;0.717;0.549	T	0.01249	-1.1406	10	0.48119	T	0.1	-22.2554	9.2848	0.37751	0.0:0.1493:0.0:0.8507	.	266;266;266	Q8NCC5-2;Q8NCC5-3;Q8NCC5	.;.;SPX3_HUMAN	H	266	ENSP00000343358:N266H;ENSP00000397481:N266H;ENSP00000321498:N266H	ENSP00000321498:N266H	N	-	1	0	SLC37A3	139697628	0.871000	0.30034	0.116000	0.21606	0.691000	0.40173	1.443000	0.35057	0.388000	0.25054	0.460000	0.39030	AAT	SLC37A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.428	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC37A3	HGNC	protein_coding	OTTHUMT00000348492.1	T	NM_032295		140051159	-1	no_errors	ENST00000326232	ensembl	human	known	70_37	missense	SNP	0.872	G
SLC44A1	23446	genome.wustl.edu	37	9	108147760	108147760	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr9:108147760G>C	ENST00000374720.3	+	15	2174	c.1927G>C	c.(1927-1929)Gat>Cat	p.D643H	SLC44A1_ENST00000374724.1_Missense_Mutation_p.D643H|SLC44A1_ENST00000343170.7_Missense_Mutation_p.D435H|SLC44A1_ENST00000374723.1_Missense_Mutation_p.D643H	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	643					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	AGGCGTCGCTGATTCCAGAGA	0.468																																																	0													54.0	51.0	52.0					9																	108147760		2198	4296	6494	SO:0001583	missense	23446			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1927G>C	9.37:g.108147760G>C	ENSP00000363852:p.Asp643His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.D643H	ENST00000374720.3	37	c.1927	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469096	0.63625	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.18810	3.04;3.07;3.04;2.19	5.71	5.71	0.89125	.	0.407952	0.30771	N	0.008917	T	0.19805	0.0476	N	0.22421	0.69	0.39468	D	0.967686	B;B;P	0.37864	0.098;0.161;0.61	B;B;B	0.38106	0.056;0.038;0.265	T	0.02852	-1.1102	10	0.52906	T	0.07	-17.0125	19.8632	0.96793	0.0:0.0:1.0:0.0	.	643;643;643	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	H	643;643;643;435	ENSP00000363855:D643H;ENSP00000363852:D643H;ENSP00000363856:D643H;ENSP00000341856:D435H	ENSP00000341856:D435H	D	+	1	0	SLC44A1	107187581	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.715000	0.84713	2.699000	0.92147	0.655000	0.94253	GAT	SLC44A1	-	NULL		0.468	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	G	NM_080546		108147760	+1	no_errors	ENST00000374720	ensembl	human	known	70_37	missense	SNP	1.000	C
SLX4	84464	genome.wustl.edu	37	16	3632683	3632683	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr16:3632683C>G	ENST00000294008.3	-	15	5805	c.5165G>C	c.(5164-5166)tGt>tCt	p.C1722S	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1722	Interaction with PLK1 and TERF2-TERF2IP.|Interaction with SLX1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TCCAAACTCACAGGAGGAAGA	0.592								Direct reversal of damage																																									0													32.0	31.0	32.0					16																	3632683		2197	4300	6497	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.5165G>C	16.37:g.3632683C>G	ENSP00000294008:p.Cys1722Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.C1722S	ENST00000294008.3	37	c.5165	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.022366	0.00414	.	.	ENSG00000188827	ENST00000294008	T	0.00958	5.5	5.04	1.85	0.25348	.	1.649760	0.03139	N	0.166361	T	0.00637	0.0021	N	0.05230	-0.09	0.09310	N	1	B	0.18013	0.025	B	0.12156	0.007	T	0.44667	-0.9313	10	0.06757	T	0.87	.	5.0801	0.14651	0.0:0.427:0.3268:0.2463	.	1722	Q8IY92	SLX4_HUMAN	S	1722	ENSP00000294008:C1722S	ENSP00000294008:C1722S	C	-	2	0	SLX4	3572684	0.000000	0.05858	0.165000	0.22776	0.667000	0.39255	0.336000	0.19823	0.127000	0.18452	0.462000	0.41574	TGT	SLX4	-	NULL		0.592	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	C	NM_032444		3632683	-1	no_errors	ENST00000294008	ensembl	human	known	70_37	missense	SNP	0.005	G
SRRD	402055	genome.wustl.edu	37	22	26887615	26887615	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr22:26887615G>A	ENST00000215917.7	+	7	1011	c.997G>A	c.(997-999)Gaa>Aaa	p.E333K	TFIP11_ENST00000407690.1_3'UTR	NM_001013694.2	NP_001013716.2	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	333					rhythmic process (GO:0048511)					endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GAACAAGAGAGAAGATCCTTC	0.468																																																	0													55.0	53.0	54.0					22																	26887615		1952	4152	6104	SO:0001583	missense	402055			BC066962	CCDS42995.1	22q12.1	2008-10-31			ENSG00000100104	ENSG00000100104			33910	protein-coding gene	gene with protein product	"""hepatocellular carcinoma complicating hemochromatosis"""	602254					Standard	NM_001013694		Approved	HC/HCC, SRR1L	uc010gve.3	Q9UH36	OTTHUMG00000150885	ENST00000215917.7:c.997G>A	22.37:g.26887615G>A	ENSP00000215917:p.Glu333Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NXP8	Missense_Mutation	SNP	pfam_SRR1-like	p.E333K	ENST00000215917.7	37	c.997	CCDS42995.1	22	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210355	0.39003	.	.	ENSG00000100104	ENST00000215917	T	0.47177	0.85	4.86	-6.51	0.01878	.	2.882770	0.00990	N	0.003500	T	0.30479	0.0766	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.06770	-1.0808	10	0.27785	T	0.31	5.967	1.569	0.02611	0.3946:0.2345:0.2515:0.1194	.	333;326	Q9UH36;B4DF37	SRR1L_HUMAN;.	K	333	ENSP00000215917:E333K	ENSP00000215917:E333K	E	+	1	0	SRRD	25217615	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.655000	0.24933	-1.258000	0.02471	-0.282000	0.10007	GAA	SRRD	-	NULL		0.468	SRRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRD	HGNC	protein_coding	OTTHUMT00000320423.2	G	NM_001013694		26887615	+1	no_errors	ENST00000215917	ensembl	human	known	70_37	missense	SNP	0.000	A
CAPZA1	829	genome.wustl.edu	37	1	113162416	113162416	+	5'UTR	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr1:113162416C>T	ENST00000263168.3	+	0	622				ST7L_ENST00000544629.1_5'Flank|ST7L_ENST00000543570.1_5'Flank|ST7L_ENST00000343210.7_5'Flank|ST7L_ENST00000358039.4_5'Flank|ST7L_ENST00000369669.1_5'Flank|ST7L_ENST00000369666.1_5'Flank|ST7L_ENST00000490067.1_5'Flank|ST7L_ENST00000538187.1_5'Flank|ST7L_ENST00000360743.4_5'Flank|ST7L_ENST00000463235.1_Intron|ST7L_ENST00000369668.2_5'Flank	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACTCGGCTTTCTTCCCGGCCT	0.652																																																	0													19.0	16.0	17.0					1																	113162416		2202	4299	6501	SO:0001623	5_prime_UTR_variant	54879			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.-51C>T	1.37:g.113162416C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53FQ6|Q6FHD5	RNA	SNP	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																			ST7L	-	-		0.652	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST7L	HGNC	protein_coding	OTTHUMT00000032567.2	C	NM_006135		113162416	-1	no_errors	ENST00000492274	ensembl	human	known	70_37	rna	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170871052	170871053	+	Frame_Shift_Del	DEL	GC	GC	-	rs112083427|rs369312237	byFrequency	TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr6:170871052_170871053delGC	ENST00000392092.2	+	3	507_508	c.228_229delGC	c.(226-231)cagcagfs	p.QQ76fs	TBP_ENST00000540980.1_Frame_Shift_Del_p.QQ56fs|TBP_ENST00000230354.6_Frame_Shift_Del_p.QQ76fs	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagca	0.574																																																	4	Substitution - coding silent(4)	lung(3)|prostate(1)																																								SO:0001589	frameshift_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228_229delGC	6.37:g.170871052_170871053delGC	ENSP00000375942:p.Gln76fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Frame_Shift_Del	DEL	pfam_TBP,prints_TBP	p.Q77fs	ENST00000392092.2	37	c.228_229	CCDS5315.1	6																																																																																			TBP	-	NULL		0.574	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	GC	NM_003194		170871053	+1	no_errors	ENST00000230354	ensembl	human	known	70_37	frame_shift_del	DEL	0.994:0.996	-
TBP	6908	genome.wustl.edu	37	6	170871055	170871055	+	Frame_Shift_Del	DEL	G	G	-	rs112928724|rs369312237		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr6:170871055delG	ENST00000392092.2	+	3	510	c.231delG	c.(229-231)cagfs	p.Q95fs	TBP_ENST00000540980.1_Frame_Shift_Del_p.Q75fs|TBP_ENST00000230354.6_Frame_Shift_Del_p.Q95fs	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	95	Poly-Gln.		Missing. {ECO:0000269|PubMed:2374612}.	Missing (in Ref. 4; BAG65425). {ECO:0000305}.	cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacagcagcagcagcagcagc	0.572																																																	0													14.0	18.0	17.0					6																	170871055		1934	3804	5738	SO:0001589	frameshift_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.231delG	6.37:g.170871055delG	ENSP00000375942:p.Gln95fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Frame_Shift_Del	DEL	pfam_TBP,prints_TBP	p.Q77fs	ENST00000392092.2	37	c.231	CCDS5315.1	6																																																																																			TBP	-	NULL		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	G	NM_003194		170871055	+1	no_errors	ENST00000230354	ensembl	human	known	70_37	frame_shift_del	DEL	0.993	-
TET1	80312	genome.wustl.edu	37	10	70333214	70333215	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr10:70333214_70333215insC	ENST00000373644.4	+	2	1328_1329	c.1119_1120insC	c.(1120-1122)catfs	p.H374fs		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	374					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTGCTATCCCACATCAATGGGA	0.51																																																	0																																										SO:0001589	frameshift_variant	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1120dupC	10.37:g.70333215_70333215dupC	ENSP00000362748:p.His374fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Frame_Shift_Ins	INS	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.H373fs	ENST00000373644.4	37	c.1119_1120	CCDS7281.1	10																																																																																			TET1	-	NULL		0.510	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	-	NM_030625		70333215	+1	no_errors	ENST00000373644	ensembl	human	known	70_37	frame_shift_ins	INS	0.725:0.713	C
TMEM52B	120939	genome.wustl.edu	37	12	10339160	10339160	+	Silent	SNP	C	C	T	rs145013082	byFrequency	TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr12:10339160C>T	ENST00000381923.2	+	5	683	c.279C>T	c.(277-279)caC>caT	p.H93H	TMEM52B_ENST00000536952.1_Silent_p.H93H|TMEM52B_ENST00000298530.3_Silent_p.H73H			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	93						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTTTCGATCACGACAGCACTC	0.522																																																	0								C		0,4406		0,0,2203	97.0	87.0	91.0		219	-6.6	0.9	12	dbSNP_134	91	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	C12orf59	NM_153022.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		73/164	10339160	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	120939			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.279C>T	12.37:g.10339160C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96NA7	Silent	SNP	NULL	p.H93	ENST00000381923.2	37	c.279		12																																																																																			TMEM52B	-	NULL		0.522	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	TMEM52B	HGNC	protein_coding	OTTHUMT00000399645.1	C	NM_153022		10339160	+1	no_errors	ENST00000381923	ensembl	human	known	70_37	silent	SNP	0.903	T
TNPO3	23534	genome.wustl.edu	37	7	128657089	128657089	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr7:128657089G>A	ENST00000265388.5	-	3	486	c.343C>T	c.(343-345)Ctt>Ttt	p.L115F	TNPO3_ENST00000471234.1_Missense_Mutation_p.L115F|TNPO3_ENST00000471166.1_Missense_Mutation_p.L115F|TNPO3_ENST00000393245.1_Missense_Mutation_p.L115F|TNPO3_ENST00000482320.1_Missense_Mutation_p.L49F			Q9Y5L0	TNPO3_HUMAN	transportin 3	115					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						TGTAGGGCAAGATCTGCTATT	0.358																																					Pancreas(147;583 2585 39696 52331)												0													115.0	112.0	113.0					7																	128657089		2203	4300	6503	SO:0001583	missense	23534			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.343C>T	7.37:g.128657089G>A	ENSP00000265388:p.Leu115Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.L115F	ENST00000265388.5	37	c.343	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.253509	0.95336	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.81	5.81	0.92471	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.061461	0.64402	D	0.000002	T	0.75148	0.3810	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	0.974;1.0;1.0	P;D;D	0.97110	0.873;1.0;1.0	T	0.71784	-0.4488	10	0.33940	T	0.23	.	17.572	0.87937	0.0:0.0:1.0:0.0	.	115;115;115	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	F	115;115;49;115;115	ENSP00000376936:L115F;ENSP00000265388:L115F;ENSP00000420089:L49F;ENSP00000418646:L115F;ENSP00000418267:L115F	ENSP00000265388:L115F	L	-	1	0	TNPO3	128444325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.736000	0.98828	2.746000	0.94184	0.655000	0.94253	CTT	TNPO3	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold		0.358	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	G	NM_012470		128657089	-1	no_errors	ENST00000393245	ensembl	human	known	70_37	missense	SNP	1.000	A
TRIB2	28951	genome.wustl.edu	37	2	12880515	12880515	+	Silent	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr2:12880515C>T	ENST00000155926.4	+	3	2046	c.627C>T	c.(625-627)ctC>ctT	p.L209L	MIR3125_ENST00000579927.1_RNA|TRIB2_ENST00000381465.2_Silent_p.L73L	NM_021643.3	NP_067675.1			tribbles pseudokinase 2											breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGATTCCCTCTCCGACAAGC	0.572																																																	0													88.0	81.0	83.0					2																	12880515		2203	4300	6503	SO:0001819	synonymous_variant	28951			AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000155926.4:c.627C>T	2.37:g.12880515C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L209	ENST00000155926.4	37	c.627	CCDS1683.1	2																																																																																			TRIB2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.572	TRIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB2	HGNC	protein_coding	OTTHUMT00000207114.2	C	NM_021643		12880515	+1	no_errors	ENST00000155926	ensembl	human	known	70_37	silent	SNP	0.387	T
TSC1	7248	genome.wustl.edu	37	9	135801121	135801121	+	Silent	SNP	G	G	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr9:135801121G>C	ENST00000298552.3	-	5	437	c.216C>G	c.(214-216)ctC>ctG	p.L72L	TSC1_ENST00000545250.1_Intron|TSC1_ENST00000403810.1_Silent_p.L72L|TSC1_ENST00000475903.1_5'UTR|TSC1_ENST00000440111.2_Silent_p.L72L	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	72			L -> P (in TSC1). {ECO:0000269|PubMed:10533069}.		activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)			NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TCCTGTCCAAGAGGTGCTGAA	0.428			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	0													78.0	72.0	74.0					9																	135801121		2203	4300	6503	SO:0001819	synonymous_variant	7248	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.216C>G	9.37:g.135801121G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z897|Q5VVN5	Silent	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.L72	ENST00000298552.3	37	c.216	CCDS6956.1	9																																																																																			TSC1	-	pfam_Hamartin,superfamily_ARM-type_fold		0.428	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	G			135801121	-1	no_errors	ENST00000298552	ensembl	human	known	70_37	silent	SNP	1.000	C
TSKS	60385	genome.wustl.edu	37	19	50243366	50243366	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr19:50243366G>A	ENST00000246801.3	-	10	1654	c.1572C>T	c.(1570-1572)gaC>gaT	p.D524D	TSKS_ENST00000358830.3_Silent_p.D324D	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	524					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GCAGGGCCTCGTCTTGGGCCA	0.627																																																	0													66.0	70.0	68.0					19																	50243366		2203	4300	6503	SO:0001819	synonymous_variant	60385			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1572C>T	19.37:g.50243366G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WXJ0	Silent	SNP	NULL	p.D524	ENST00000246801.3	37	c.1572	CCDS12780.1	19																																																																																			TSKS	-	NULL		0.627	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	G	NM_021733		50243366	-1	no_errors	ENST00000246801	ensembl	human	known	70_37	silent	SNP	1.000	A
TTC6	319089	genome.wustl.edu	37	14	38220270	38220270	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr14:38220270C>T	ENST00000553443.1	+	13	2969	c.2969C>T	c.(2968-2970)tCa>tTa	p.S990L				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	215										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GCATATTTGTCAAAAGCAGAA	0.323																																																	0																																										SO:0001583	missense	319089			BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.2969C>T	14.37:g.38220270C>T	ENSP00000451131:p.Ser990Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SY88|Q96CE6	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S990L	ENST00000553443.1	37	c.2969		14	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981135	0.74474	.	.	ENSG00000139865	ENST00000553443	T	0.75589	-0.95	5.58	5.58	0.84498	.	.	.	.	.	D	0.84051	0.5387	.	.	.	.	.	.	.	.	.	.	.	.	T	0.82849	-0.0254	4	.	.	.	.	19.1571	0.93516	0.0:1.0:0.0:0.0	.	.	.	.	L	990	ENSP00000451131:S990L	.	S	+	2	0	TTC6	37290021	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	4.264000	0.58859	2.627000	0.88993	0.591000	0.81541	TCA	TTC6	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.323	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	HGNC	protein_coding	OTTHUMT00000348620.4	C	XM_002343299		38220270	+1	no_errors	ENST00000553443	ensembl	human	novel	70_37	missense	SNP	1.000	T
VARS	7407	genome.wustl.edu	37	6	31746941	31746941	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr6:31746941C>T	ENST00000375663.3	-	29	3969	c.3529G>A	c.(3529-3531)Gct>Act	p.A1177T	VWA7_ENST00000375686.3_5'Flank|Y_RNA_ENST00000364685.1_RNA|VWA7_ENST00000447450.1_5'Flank|VWA7_ENST00000467576.1_5'Flank|VWA7_ENST00000375688.4_5'Flank|VARS_ENST00000482996.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1177					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	AGAGCCACAGCGCAACCCTGG	0.697																																																	0													14.0	13.0	13.0					6																	31746941		1496	2685	4181	SO:0001583	missense	7407			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.3529G>A	6.37:g.31746941C>T	ENSP00000364815:p.Ala1177Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Glutathione_S-Trfase_N,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_GST_C,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_tRNA-bd_arm,prints_Valyl-tRNA_ligase,tigrfam_Valyl-tRNA_ligase	p.A1177T	ENST00000375663.3	37	c.3529	CCDS34412.1	6	.	.	.	.	.	.	.	.	.	.	C	17.77	3.469962	0.63625	.	.	ENSG00000204394	ENST00000375663	T	0.12147	2.71	4.7	4.7	0.59300	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.26629	0.0651	M	0.80332	2.49	0.80722	D	1	D	0.76494	0.999	D	0.63283	0.913	T	0.01776	-1.1276	10	0.56958	D	0.05	-11.6359	13.0074	0.58712	0.0:1.0:0.0:0.0	.	1177	P26640	SYVC_HUMAN	T	1177	ENSP00000364815:A1177T	ENSP00000364815:A1177T	A	-	1	0	VARS	31854920	1.000000	0.71417	0.986000	0.45419	0.084000	0.17831	5.956000	0.70315	2.451000	0.82905	0.313000	0.20887	GCT	VARS	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Valyl-tRNA_ligase		0.697	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	HGNC	protein_coding	OTTHUMT00000076619.2	C	NM_006295		31746941	-1	no_errors	ENST00000375663	ensembl	human	known	70_37	missense	SNP	1.000	T
VPRBP	9730	genome.wustl.edu	37	3	51457980	51457980	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr3:51457980C>T	ENST00000335891.5	-	7	1106	c.1097G>A	c.(1096-1098)cGg>cAg	p.R366Q				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	815	Protein kinase-like.				B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TCCTGACACCCGTTCAATGAG	0.512																																																	0													51.0	50.0	50.0					3																	51457980		2048	4191	6239	SO:0001583	missense	9730			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.1097G>A	3.37:g.51457980C>T	ENSP00000338857:p.Arg366Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.R366Q	ENST00000335891.5	37	c.1097		3	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379467	0.82682	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.48522	0.81;0.81	6.06	6.06	0.98353	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.65533	0.2700	L	0.51914	1.62	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.62412	-0.6860	10	0.54805	T	0.06	-14.923	20.6244	0.99512	0.0:1.0:0.0:0.0	.	815	Q9Y4B6	VPRBP_HUMAN	Q	386;366	ENSP00000393183:R386Q;ENSP00000338857:R366Q	ENSP00000338857:R366Q	R	-	2	0	VPRBP	51433020	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.555000	0.67301	2.879000	0.98667	0.650000	0.86243	CGG	VPRBP	-	superfamily_ARM-type_fold		0.512	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		C	NM_014703		51457980	-1	no_errors	ENST00000335891	ensembl	human	known	70_37	missense	SNP	1.000	T
YES1	7525	genome.wustl.edu	37	18	742944	742944	+	Missense_Mutation	SNP	T	T	G			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr18:742944T>G	ENST00000584307.1	-	8	1204	c.1034A>C	c.(1033-1035)tAc>tCc	p.Y345S	YES1_ENST00000577961.1_Missense_Mutation_p.Y350S|YES1_ENST00000314574.4_Missense_Mutation_p.Y345S			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	345	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	AGTGACAATGTAAATTGGTTC	0.308																																																	0													79.0	81.0	80.0					18																	742944		2202	4299	6501	SO:0001583	missense	7525			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.1034A>C	18.37:g.742944T>G	ENSP00000462468:p.Tyr345Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLB3|D3DUH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.Y345S	ENST00000584307.1	37	c.1034	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	T	23.0	4.362063	0.82353	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.13196	2.61	5.78	5.78	0.91487	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.27169	0.0666	L	0.31294	0.92	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.01899	-1.1251	10	0.87932	D	0	.	16.1215	0.81361	0.0:0.0:0.0:1.0	.	345	P07947	YES_HUMAN	S	345	ENSP00000324740:Y345S	ENSP00000324740:Y345S	Y	-	2	0	YES1	732944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.102000	0.71486	2.208000	0.71279	0.528000	0.53228	TAC	YES1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.308	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	T	NM_005433		742944	-1	no_errors	ENST00000314574	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF214	7761	genome.wustl.edu	37	11	7022682	7022682	+	Missense_Mutation	SNP	A	A	C			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr11:7022682A>C	ENST00000278314.4	-	3	547	c.232T>G	c.(232-234)Tat>Gat	p.Y78D	ZNF214_ENST00000531083.1_5'UTR|ZNF214_ENST00000536068.1_Missense_Mutation_p.Y78D	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGATTCTCATACATCTGGGCG	0.433																																					Ovarian(22;251 657 736 21522 46864)												0													234.0	231.0	232.0					11																	7022682		2201	4295	6496	SO:0001583	missense	7761			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.232T>G	11.37:g.7022682A>C	ENSP00000278314:p.Tyr78Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8Q1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y78D	ENST00000278314.4	37	c.232	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	A	6.287	0.421141	0.11928	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.05447	3.44;3.44	4.14	1.75	0.24633	Krueppel-associated box (1);	1.557580	0.03999	N	0.296218	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.17098	0.017	T	0.40664	-0.9551	10	0.36615	T	0.2	.	1.3749	0.02218	0.5359:0.1851:0.1004:0.1786	.	78	Q9UL59	ZN214_HUMAN	D	78	ENSP00000278314:Y78D;ENSP00000445373:Y78D	ENSP00000278314:Y78D	Y	-	1	0	ZNF214	6979258	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.071000	0.14594	0.244000	0.21351	-0.333000	0.08304	TAT	ZNF214	-	pfscan_Krueppel-associated_box		0.433	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	HGNC	protein_coding	OTTHUMT00000385349.1	A			7022682	-1	no_errors	ENST00000278314	ensembl	human	known	70_37	missense	SNP	0.000	C
ZNF490	57474	genome.wustl.edu	37	19	12721468	12721468	+	Silent	SNP	G	G	A			TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr19:12721468G>A	ENST00000311437.6	-	1	149	c.27C>T	c.(25-27)ttC>ttT	p.F9F	ZNF791_ENST00000343325.4_5'Flank|ZNF791_ENST00000446165.1_5'Flank|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000540038.1_5'Flank|ZNF791_ENST00000458122.3_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						GCTCCATCTGGAAACTGAGAC	0.577																																																	0													139.0	110.0	119.0					19																	12721468		2203	4300	6503	SO:0001819	synonymous_variant	57474			AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.27C>T	19.37:g.12721468G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F9	ENST00000311437.6	37	c.27	CCDS12272.1	19																																																																																			ZNF490	-	NULL		0.577	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF490	HGNC	protein_coding	OTTHUMT00000344073.1	G	NM_020714		12721468	-1	no_errors	ENST00000311437	ensembl	human	known	70_37	silent	SNP	0.155	A
ZNF285	26974	genome.wustl.edu	37	19	44891043	44891043	+	Missense_Mutation	SNP	G	G	T	rs77661661		TCGA-Q1-A5R1-01A-11D-A28B-09	TCGA-Q1-A5R1-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	43f1663d-29b7-4653-ac53-0b2a724ed57e	e9ae2a3c-f934-43a6-a00b-ea04105a5926	g.chr19:44891043G>T	ENST00000330997.4	-	4	1428	c.1364C>A	c.(1363-1365)cCa>cAa	p.P455Q	ZNF285_ENST00000591679.1_Missense_Mutation_p.P462Q|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.P455Q	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P455Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GCATTTGTATGGTTTCTCCCC	0.448																																																	1	Substitution - Missense(1)	skin(1)																																								SO:0001583	missense	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1364C>A	19.37:g.44891043G>T	ENSP00000333595:p.Pro455Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P455Q	ENST00000330997.4	37	c.1364	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224441	0.58668	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.17213	2.29	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41834	0.1176	M	0.75447	2.3	0.30665	N	0.754012	D;B	0.89917	1.0;0.012	D;B	0.83275	0.996;0.04	T	0.45323	-0.9269	9	0.62326	D	0.03	.	13.918	0.63914	0.0:0.0:1.0:0.0	.	479;455	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	Q	478;455	ENSP00000333595:P455Q	ENSP00000333595:P455Q	P	-	2	0	ZNF285	49582883	1.000000	0.71417	0.862000	0.33874	0.982000	0.71751	5.120000	0.64685	1.598000	0.50083	0.298000	0.19748	CCA	ZNF285	-	pfscan_Znf_C2H2		0.448	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	G	NM_152354		44891043	-1	no_errors	ENST00000330997	ensembl	human	known	70_37	missense	SNP	0.995	T
