#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC5	10057	genome.wustl.edu	37	3	183655783	183655783	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:183655783C>A	ENST00000334444.6	-	26	4000	c.3760G>T	c.(3760-3762)Gat>Tat	p.D1254Y	ABCC5_ENST00000265586.6_Missense_Mutation_p.D1211Y	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1254	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CTCACTCCATCAATCTTGATG	0.532																																																	0													96.0	96.0	96.0					3																	183655783		2047	4208	6255	SO:0001583	missense	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3760G>T	3.37:g.183655783C>A	ENSP00000333926:p.Asp1254Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D1254Y	ENST00000334444.6	37	c.3760	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	C	29.6	5.018358	0.93404	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.92199	-2.99;-2.99	5.73	5.73	0.89815	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.97136	0.9064	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97492	1.0054	10	0.87932	D	0	-22.0613	19.8948	0.96954	0.0:1.0:0.0:0.0	.	1211;1254	Q86UX3;O15440	.;MRP5_HUMAN	Y	1254;1211	ENSP00000333926:D1254Y;ENSP00000265586:D1211Y	ENSP00000265586:D1211Y	D	-	1	0	ABCC5	185138477	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	7.802000	0.85969	2.699000	0.92147	0.655000	0.94253	GAT	ABCC5	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.532	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	C	NM_005688		183655783	-1	no_errors	ENST00000334444	ensembl	human	known	70_37	missense	SNP	1.000	A
ACAN	176	genome.wustl.edu	37	15	89386651	89386651	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr15:89386651C>T	ENST00000561243.1	+	5	823	c.823C>T	c.(823-825)Cgg>Tgg	p.R275W	ACAN_ENST00000439576.2_Missense_Mutation_p.R275W|ACAN_ENST00000559004.1_Missense_Mutation_p.R275W|ACAN_ENST00000558207.1_Missense_Mutation_p.R275W|ACAN_ENST00000352105.7_Missense_Mutation_p.R275W			P16112	PGCA_HUMAN	aggrecan	275	G1-B'.|Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.		R -> Q (in dbSNP:rs34949187).		carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGAGTGCCGGCGGCTGGGTGC	0.642																																																	0													17.0	20.0	19.0					15																	89386651		1929	4139	6068	SO:0001583	missense	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.823C>T	15.37:g.89386651C>T	ENSP00000453342:p.Arg275Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.R275W	ENST00000561243.1	37	c.823	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983345	0.53827	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.09630	2.96;2.96	5.56	2.5	0.30297	.	0.000000	0.30593	N	0.009286	T	0.29817	0.0745	M	0.67397	2.05	0.31534	N	0.660868	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.76071	0.987;0.987;0.873	T	0.33523	-0.9865	10	0.72032	D	0.01	-18.6464	14.3885	0.66963	0.6642:0.3358:0.0:0.0	.	275;275;275	E7ENV9;E7EX88;Q6PID9	.;.;.	W	275	ENSP00000387356:R275W;ENSP00000341615:R275W	ENSP00000268134:R275W	R	+	1	2	ACAN	87187655	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	2.086000	0.41643	0.245000	0.21373	0.650000	0.86243	CGG	ACAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link		0.642	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	C	NM_001135		89386651	+1	no_errors	ENST00000439576	ensembl	human	known	70_37	missense	SNP	0.996	T
AGAP11	119385	genome.wustl.edu	37	10	88760456	88760457	+	RNA	INS	-	-	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr10:88760456_88760457insT	ENST00000444431.1	+	0	1586_1587				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.14_ENST00000444180.3_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										ACTGTGCATCGTTTTTTTTTTG	0.371																																																	0																																												119385					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88760466_88760466dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIP7|D3DWE4	RNA	INS	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			AGAP11	-	-		0.371	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	HGNC	processed_transcript	OTTHUMT00000049193.1	-	NM_133447		88760457	+1	no_errors	ENST00000444431	ensembl	human	known	70_37	rna	INS	0.001:0.003	T
ARHGEF17	9828	genome.wustl.edu	37	11	73021308	73021308	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:73021308G>A	ENST00000263674.3	+	1	1975	c.1625G>A	c.(1624-1626)cGg>cAg	p.R542Q	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	542					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCCACTCTGCGGAGAGCAAAG	0.642																																																	0													51.0	51.0	51.0					11																	73021308		2200	4293	6493	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1625G>A	11.37:g.73021308G>A	ENSP00000263674:p.Arg542Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.R542Q	ENST00000263674.3	37	c.1625	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794086	0.90453	.	.	ENSG00000110237	ENST00000263674	T	0.74737	-0.87	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000010	T	0.79482	0.4453	L	0.29908	0.895	0.39370	D	0.96606	D	0.89917	1.0	D	0.80764	0.994	T	0.83138	-0.0110	10	0.87932	D	0	-16.8264	16.1961	0.82025	0.0:0.0:1.0:0.0	.	542	Q96PE2	ARHGH_HUMAN	Q	542	ENSP00000263674:R542Q	ENSP00000263674:R542Q	R	+	2	0	ARHGEF17	72698956	1.000000	0.71417	0.510000	0.27712	0.867000	0.49689	9.597000	0.98273	2.384000	0.81235	0.561000	0.74099	CGG	ARHGEF17	-	superfamily_Vinculin/catenin		0.642	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	G	NM_014786		73021308	+1	no_errors	ENST00000263674	ensembl	human	known	70_37	missense	SNP	0.957	A
ARID3B	10620	genome.wustl.edu	37	15	74887963	74887964	+	Frame_Shift_Ins	INS	-	-	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr15:74887963_74887964insC	ENST00000346246.5	+	9	1762_1763	c.1531_1532insC	c.(1531-1533)gccfs	p.A511fs		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	512	Interaction with ARID3A.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						TGTGCTGTTTGCCCAGAAGCCT	0.604																																																	0																																										SO:0001589	frameshift_variant	10620				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.1534dupC	15.37:g.74887966_74887966dupC	ENSP00000343126:p.Ala511fs	Somatic		WXS	Illumina HiSeq	Phase_IV	O95443|Q59HC9|Q6P9C9	Frame_Shift_Ins	INS	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q512fs	ENST00000346246.5	37	c.1531_1532	CCDS10264.1	15																																																																																			ARID3B	-	NULL		0.604	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	-	NM_006465		74887964	+1	no_errors	ENST00000346246	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	C
ASXL1	171023	genome.wustl.edu	37	20	31022441	31022442	+	Frame_Shift_Ins	INS	-	-	G			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr20:31022441_31022442insG	ENST00000375687.4	+	13	2350_2351	c.1926_1927insG	c.(1927-1929)gggfs	p.G643fs	ASXL1_ENST00000306058.5_Frame_Shift_Ins_p.G638fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	643	Gly-rich.|Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.G643fs*15(5)|p.A640fs*14(2)|p.T639_G659>PPWD(1)|p.A637fs*13(1)|p.A640_S664>PCSGG(1)|p.T639fs*14(1)|p.T639fs*19(1)|p.T639_P647>PPSDGS(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CTGCCATCGGAGGGGGGGGTGG	0.693			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	13	Insertion - Frameshift(5)|Deletion - Frameshift(4)|Complex - deletion inframe(3)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(13)																																								SO:0001589	frameshift_variant	171023			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1934dupG	20.37:g.31022449_31022449dupG	ENSP00000364839:p.Gly643fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Ins	INS	NULL	p.G645fs	ENST00000375687.4	37	c.1926_1927	CCDS13201.1	20																																																																																			ASXL1	-	NULL		0.693	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	-	NM_015338		31022442	+1	no_errors	ENST00000375687	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	G
BCOR	54880	genome.wustl.edu	37	X	39931728	39931728	+	Silent	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:39931728C>T	ENST00000378444.4	-	4	3099	c.2871G>A	c.(2869-2871)ccG>ccA	p.P957P	BCOR_ENST00000397354.3_Silent_p.P957P|BCOR_ENST00000342274.4_Silent_p.P957P|BCOR_ENST00000378455.4_Silent_p.P957P	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	957					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TAGATGGCTTCGGTTTCAGAA	0.502			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																	Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													84.0	56.0	65.0					X																	39931728		2201	4300	6501	SO:0001819	synonymous_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2871G>A	X.37:g.39931728C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P957	ENST00000378444.4	37	c.2871	CCDS48093.1	X																																																																																			BCOR	-	NULL		0.502	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	C	NM_017745		39931728	-1	no_errors	ENST00000378444	ensembl	human	known	70_37	silent	SNP	0.992	T
BCOR	54880	genome.wustl.edu	37	X	39933165	39933165	+	Silent	SNP	G	G	A	rs371048617		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:39933165G>A	ENST00000378444.4	-	4	1662	c.1434C>T	c.(1432-1434)tcC>tcT	p.S478S	BCOR_ENST00000397354.3_Silent_p.S478S|BCOR_ENST00000342274.4_Silent_p.S478S|BCOR_ENST00000378455.4_Silent_p.S478S	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	478					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCTCACTTCCGGAGAGCACTA	0.498			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic						G|||	1	0.000264901	0.0008	0.0	3775	,	,		14151	0.0		0.0	False		,,,				2504	0.0							Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0								G	,,,	1,3832		0,0,1,1631,570	81.0	73.0	75.0		1434,1434,1434,1434	-3.5	0.8	X		75	0,6728		0,0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BCOR	NM_001123383.1,NM_001123384.1,NM_001123385.1,NM_017745.5	,,,	0,0,1,4059,2442	AA,AG,A,GG,G		0.0,0.0261,0.0095	,,,	478/1722,478/1704,478/1756,478/1722	39933165	1,10560	2202	4300	6502	SO:0001819	synonymous_variant	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.1434C>T	X.37:g.39933165G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S478	ENST00000378444.4	37	c.1434	CCDS48093.1	X																																																																																			BCOR	-	NULL		0.498	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	G	NM_017745		39933165	-1	no_errors	ENST00000378444	ensembl	human	known	70_37	silent	SNP	0.315	A
LMNTD2	256329	genome.wustl.edu	37	11	557577	557577	+	Missense_Mutation	SNP	C	C	A	rs146558617	byFrequency	TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:557577C>A	ENST00000329451.3	-	6	681	c.619G>T	c.(619-621)Ggg>Tgg	p.G207W	RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000431809.1_5'Flank|RP11-496I9.1_ENST00000527113.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		207										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCACCTCCCCGGTGGGGGCC	0.637																																																	0													59.0	58.0	58.0					11																	557577		2202	4300	6502	SO:0001583	missense	256329																														ENST00000329451.3:c.619G>T	11.37:g.557577C>A	ENSP00000331167:p.Gly207Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Lamin_tail_dom	p.G207W	ENST00000329451.3	37	c.619	CCDS7701.1	11	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082976	0.36758	.	.	ENSG00000185522	ENST00000329451;ENST00000441853;ENST00000486629	T;T;T	0.34472	1.36;1.36;1.36	3.2	0.175	0.15045	.	0.173210	0.27622	N	0.018548	T	0.37019	0.0988	L	0.27053	0.805	0.09310	N	0.999997	D	0.89917	1.0	D	0.80764	0.994	T	0.13361	-1.0512	10	0.87932	D	0	-3.8301	3.4346	0.07441	0.0:0.4803:0.2574:0.2623	.	207	Q8IXW0	CK035_HUMAN	W	207;214;217	ENSP00000331167:G207W;ENSP00000393529:G214W;ENSP00000435529:G217W	ENSP00000331167:G207W	G	-	1	0	C11orf35	547577	0.000000	0.05858	0.146000	0.22360	0.637000	0.38172	-1.756000	0.01813	0.052000	0.16007	0.456000	0.33151	GGG	C11orf35	-	NULL		0.637	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf35	HGNC	protein_coding	OTTHUMT00000254973.2	C			557577	-1	no_errors	ENST00000329451	ensembl	human	known	70_37	missense	SNP	0.122	A
KDF1	126695	genome.wustl.edu	37	1	27278790	27278790	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:27278790C>A	ENST00000320567.5	-	2	170	c.82G>T	c.(82-84)Gag>Tag	p.E28*		NM_152365.2	NP_689578.2	Q8NAX2	KDF1_HUMAN		28	Pro-rich.				developmental growth (GO:0048589)|establishment of skin barrier (GO:0061436)|keratinocyte development (GO:0003334)|limb epidermis development (GO:0060887)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|positive regulation of epidermal cell differentiation (GO:0045606)|regulation of epidermal cell division (GO:0010482)	cell cortex (GO:0005938)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		TCATATGTCTCCAGACATAGC	0.622																																																	0													30.0	33.0	32.0					1																	27278790		2193	4276	6469	SO:0001587	stop_gained	126695																														ENST00000320567.5:c.82G>T	1.37:g.27278790C>A	ENSP00000319179:p.Glu28*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5QP32|Q8N0S7	Nonsense_Mutation	SNP	NULL	p.E28*	ENST00000320567.5	37	c.82	CCDS293.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025904	0.75390	.	.	ENSG00000175707	ENST00000320567;ENST00000374109	.	.	.	4.79	4.79	0.61399	.	0.234470	0.38897	N	0.001524	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.1399	0.72601	0.0:1.0:0.0:0.0	.	.	.	.	X	28	.	ENSP00000319179:E28X	E	-	1	0	C1orf172	27151377	0.988000	0.35896	0.999000	0.59377	0.768000	0.43524	1.932000	0.40143	2.485000	0.83878	0.650000	0.86243	GAG	C1orf172	-	NULL		0.622	C1orf172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf172	HGNC	protein_coding	OTTHUMT00000012340.1	C			27278790	-1	no_errors	ENST00000320567	ensembl	human	known	70_37	nonsense	SNP	0.998	A
C1orf216	127703	genome.wustl.edu	37	1	36181649	36181649	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:36181649C>A	ENST00000270815.4	-	2	1044	c.274G>T	c.(274-276)Ggg>Tgg	p.G92W	C1orf216_ENST00000503824.1_5'Flank	NM_152374.1	NP_689587.1	Q8TAB5	CA216_HUMAN	chromosome 1 open reading frame 216	92										kidney(2)|lung(3)|skin(2)|urinary_tract(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GGCTCAGCCCCGGGAATCTCT	0.637											OREG0013357	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													45.0	48.0	47.0					1																	36181649		2203	4300	6503	SO:0001583	missense	127703			AK096303	CCDS395.1	1p34.3	2007-08-10			ENSG00000142686	ENSG00000142686			26800	protein-coding gene	gene with protein product						12477932	Standard	NM_152374		Approved	FLJ38984	uc001bzh.1	Q8TAB5	OTTHUMG00000004167	ENST00000270815.4:c.274G>T	1.37:g.36181649C>A	ENSP00000425166:p.Gly92Trp	Somatic	861	WXS	Illumina HiSeq	Phase_IV	D3DPS1|Q8N8N6	Missense_Mutation	SNP	NULL	p.G92W	ENST00000270815.4	37	c.274	CCDS395.1	1	.	.	.	.	.	.	.	.	.	.	c	15.45	2.836934	0.50951	.	.	ENSG00000142686	ENST00000270815	.	.	.	5.32	-6.76	0.01732	.	0.619716	0.15601	N	0.253907	T	0.39572	0.1083	N	0.22421	0.69	0.09310	N	0.999997	D	0.60575	0.988	P	0.57324	0.818	T	0.52624	-0.8551	9	0.66056	D	0.02	-2.5917	16.3535	0.83227	0.0:0.3302:0.0:0.6698	.	92	Q8TAB5	CA216_HUMAN	W	92	.	ENSP00000425166:G92W	G	-	1	0	C1orf216	35954236	0.000000	0.05858	0.022000	0.16811	0.842000	0.47809	-0.645000	0.05409	-1.306000	0.02324	-0.215000	0.12644	GGG	C1orf216	-	NULL		0.637	C1orf216-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf216	HGNC	protein_coding	OTTHUMT00000012013.3	C	NM_152374		36181649	-1	no_errors	ENST00000270815	ensembl	human	known	70_37	missense	SNP	0.003	A
C21orf49	54067	genome.wustl.edu	37	21	34157085	34157086	+	Intron	INS	-	-	T	rs376234765		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr21:34157085_34157086insT	ENST00000477513.1	+	2	121				C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000453404.1_Intron|C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000382375.4_Intron					chromosome 21 open reading frame 49																		gtcctcatcagttttttttttt	0.436																																																	0																																										SO:0001627	intron_variant	54067					21q22.11	2013-01-15			ENSG00000205930	ENSG00000205930			1290	other	unknown							Standard	NR_024622		Approved		uc002yqu.4	Q17RA5	OTTHUMG00000064992	ENST00000477513.1:c.-81-22->T	21.37:g.34157096_34157096dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	INS	-	e1-1	ENST00000477513.1	37	c.1-1_0		21																																																																																			C21orf49	-	-		0.436	C21orf49-006	NOVEL	basic|appris_candidate|exp_conf	protein_coding	C21orf49	HGNC	protein_coding	OTTHUMT00000193339.1	-	NR_024622		34157086	+1	no_errors	ENST00000454365	ensembl	human	known	70_37	splice_site_ins	INS	0.122:0.122	T
CACNA1E	777	genome.wustl.edu	37	1	181680090	181680090	+	Splice_Site	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:181680090G>T	ENST00000367573.2	+	8	1056	c.1056G>T	c.(1054-1056)ggG>ggT	p.G352G	CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000367570.1_Splice_Site_p.G352G|CACNA1E_ENST00000357570.5_Splice_Site_p.G303G|CACNA1E_ENST00000358338.5_Splice_Site_p.G303G|CACNA1E_ENST00000360108.3_Splice_Site_p.G352G|CACNA1E_ENST00000526775.1_Splice_Site_p.G352G	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	352					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTGTCCACAGGGAATTTGCCA	0.512																																																	0													54.0	56.0	56.0					1																	181680090		1927	4135	6062	SO:0001630	splice_region_variant	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1056-1G>T	1.37:g.181680090G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.G352	ENST00000367573.2	37	c.1056	CCDS55664.1	1																																																																																			CACNA1E	-	prints_VDCCAlpha1		0.512	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	G	NM_000721	Silent	181680090	+1	no_errors	ENST00000367573	ensembl	human	known	70_37	silent	SNP	1.000	T
CDH11	1009	genome.wustl.edu	37	16	65038559	65038559	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr16:65038559C>T	ENST00000268603.4	-	3	829	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	CDH11_ENST00000394156.3_Missense_Mutation_p.V72M|CDH11_ENST00000566827.1_Intron|CDH11_ENST00000569624.1_5'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CCCACAAGCACGGGGTCAGGC	0.582			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													52.0	42.0	46.0					16																	65038559		2202	4300	6502	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.214G>A	16.37:g.65038559C>T	ENSP00000268603:p.Val72Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V72M	ENST00000268603.4	37	c.214	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	C	19.81	3.897018	0.72639	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000536902	T;T	0.00325	8.1;8.1	5.62	5.62	0.85841	Cadherin (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.00412	0.0013	N	0.25060	0.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.971	D	0.98740	1.0716	10	0.31617	T	0.26	.	18.6407	0.91394	0.0:1.0:0.0:0.0	.	72;72	P55287-2;P55287	.;CAD11_HUMAN	M	72	ENSP00000268603:V72M;ENSP00000377711:V72M	ENSP00000268603:V72M	V	-	1	0	CDH11	63596060	0.989000	0.36119	0.981000	0.43875	0.717000	0.41224	2.834000	0.48167	2.662000	0.90505	0.591000	0.81541	GTG	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like		0.582	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	C	NM_033664		65038559	-1	no_errors	ENST00000268603	ensembl	human	known	70_37	missense	SNP	1.000	T
CELP	1057	genome.wustl.edu	37	9	135962664	135962664	+	RNA	SNP	G	G	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr9:135962664G>C	ENST00000411440.2	+	0	1171					NR_001275.2				carboxyl ester lipase pseudogene																		ATCAGCCTTGGTCTCAAGAGG	0.562																																																	0																																												1057			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962664G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-		0.562	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	G	NM_001808		135962664	+1	no_errors	ENST00000411440	ensembl	human	known	70_37	rna	SNP	0.004	C
CEP164	22897	genome.wustl.edu	37	11	117242155	117242155	+	Silent	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:117242155G>T	ENST00000278935.3	+	9	1272	c.1125G>T	c.(1123-1125)ctG>ctT	p.L375L	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	375					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTTCTGCTCTGGAAGAGGGCA	0.577																																																	0													78.0	72.0	74.0					11																	117242155		2201	4296	6497	SO:0001819	synonymous_variant	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.1125G>T	11.37:g.117242155G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.L375	ENST00000278935.3	37	c.1125	CCDS31683.1	11																																																																																			CEP164	-	NULL		0.577	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1	G	NM_014956		117242155	+1	no_errors	ENST00000278935	ensembl	human	known	70_37	silent	SNP	0.000	T
CLCN6	1185	genome.wustl.edu	37	1	11866380	11866380	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:11866380C>A	ENST00000346436.6	+	1	113	c.61C>A	c.(61-63)Cgt>Agt	p.R21S	CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376496.3_Missense_Mutation_p.R21S|CLCN6_ENST00000376497.3_Missense_Mutation_p.R21S|CLCN6_ENST00000312413.6_Missense_Mutation_p.R21S|MTHFR_ENST00000376585.1_5'Flank|MTHFR_ENST00000376583.3_5'Flank|CLCN6_ENST00000376487.3_Missense_Mutation_p.R21S|MTHFR_ENST00000376590.3_5'Flank	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	21					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCGGTGAGCGTGAGACCCG	0.677																																																	0													26.0	19.0	21.0					1																	11866380		2196	4290	6486	SO:0001583	missense	1185			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.61C>A	1.37:g.11866380C>A	ENSP00000234488:p.Arg21Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.R21S	ENST00000346436.6	37	c.61	CCDS138.1	1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557458	0.65425	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376497;ENST00000376487;ENST00000376496;ENST00000376490;ENST00000376491;ENST00000376492	D;D;T;D;D	0.92299	-3.01;-2.81;-1.11;-2.87;-2.85	4.44	4.44	0.53790	.	0.111984	0.64402	D	0.000008	D	0.87928	0.6301	L	0.36672	1.1	0.41435	D	0.98788	B;B;B;B;P;B	0.47841	0.097;0.15;0.239;0.239;0.901;0.058	B;B;B;B;B;B	0.42798	0.015;0.072;0.099;0.099;0.398;0.033	D	0.86809	0.1997	10	0.29301	T	0.29	-7.5842	14.254	0.66038	0.0:1.0:0.0:0.0	.	21;21;21;21;21;21	F8W9R3;P51797-3;P51797-4;P51797-2;P51797-5;P51797	.;.;.;.;.;CLCN6_HUMAN	S	21	ENSP00000308367:R21S;ENSP00000234488:R21S;ENSP00000365680:R21S;ENSP00000365670:R21S;ENSP00000365679:R21S	ENSP00000308367:R21S	R	+	1	0	CLCN6	11788967	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.861000	0.39438	2.471000	0.83476	0.549000	0.68633	CGT	CLCN6	-	NULL		0.677	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	C	NM_001286		11866380	+1	no_errors	ENST00000346436	ensembl	human	known	70_37	missense	SNP	1.000	A
COL17A1	1308	genome.wustl.edu	37	10	105816868	105816868	+	Missense_Mutation	SNP	C	C	T	rs566545663	byFrequency	TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr10:105816868C>T	ENST00000353479.5	-	17	1620	c.1330G>A	c.(1330-1332)Gct>Act	p.A444T	COL17A1_ENST00000369733.3_Missense_Mutation_p.A444T|COL17A1_ENST00000480127.1_5'Flank	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	444	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		ccgccgccagcgccaccaaca	0.647																																																	0													29.0	38.0	35.0					10																	105816868		2202	4300	6502	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1330G>A	10.37:g.105816868C>T	ENSP00000340937:p.Ala444Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.A444T	ENST00000353479.5	37	c.1330	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	13.84	2.355931	0.41700	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872	T;T	0.44482	0.92;0.92	4.72	0.668	0.17912	.	1.998870	0.02803	N	0.123398	T	0.32526	0.0832	N	0.22421	0.69	0.21762	N	0.999552	B;B	0.26935	0.164;0.102	B;B	0.22880	0.042;0.019	T	0.34304	-0.9834	10	0.62326	D	0.03	1.2344	9.3783	0.38297	0.0:0.6993:0.0:0.3007	.	444;444	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	T	444;444;428	ENSP00000340937:A444T;ENSP00000358748:A444T	ENSP00000340937:A444T	A	-	1	0	COL17A1	105806858	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.010000	0.13242	-0.149000	0.11215	0.313000	0.20887	GCT	COL17A1	-	NULL		0.647	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	C	NM_130778, NM_000494		105816868	-1	no_errors	ENST00000353479	ensembl	human	known	70_37	missense	SNP	0.008	T
COL4A5	1287	genome.wustl.edu	37	X	107683188	107683189	+	5'UTR	INS	-	-	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:107683188_107683189insT	ENST00000361603.2	+	0	77_78				COL4A5_ENST00000477429.1_3'UTR|COL4A6_ENST00000394872.2_5'Flank|COL4A6_ENST00000461897.1_5'Flank|COL4A6_ENST00000334504.7_5'Flank|COL4A6_ENST00000538570.1_5'Flank|COL4A6_ENST00000545689.1_5'Flank|COL4A6_ENST00000372216.4_5'Flank|COL4A5_ENST00000328300.6_5'UTR	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TCTTCTTCTTCTTTTTTTTTTC	0.46									Alport syndrome with Diffuse Leiomyomatosis																																								0																																										SO:0001623	5_prime_UTR_variant	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.-167->T	X.37:g.107683198_107683198dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	RNA	INS	-	NULL	ENST00000361603.2	37	NULL	CCDS14543.1	X																																																																																			COL4A5	-	-		0.460	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	-			107683189	+1	no_errors	ENST00000477429	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
CXCR5	643	genome.wustl.edu	37	11	118764809	118764809	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:118764809C>T	ENST00000292174.4	+	2	732	c.556C>T	c.(556-558)Ctc>Ttc	p.L186F	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	186					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GCCAGAGATTCTCTTCGCCAA	0.602																																																	0													68.0	58.0	61.0					11																	118764809		2200	4295	6495	SO:0001583	missense	643			X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.556C>T	11.37:g.118764809C>T	ENSP00000292174:p.Leu186Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14811	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR5,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR4,prints_ATII_rcpt	p.L186F	ENST00000292174.4	37	c.556	CCDS8402.1	11	.	.	.	.	.	.	.	.	.	.	C	7.159	0.585391	0.13749	.	.	ENSG00000160683	ENST00000292174	T	0.73152	-0.72	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.155077	0.43110	D	0.000610	T	0.56411	0.1983	L	0.41573	1.285	0.80722	D	1	B	0.33637	0.42	B	0.31686	0.134	T	0.58651	-0.7599	10	0.48119	T	0.1	.	6.413	0.21702	0.1965:0.7054:0.0:0.0981	.	186	P32302	CXCR5_HUMAN	F	186	ENSP00000292174:L186F	ENSP00000292174:L186F	L	+	1	0	CXCR5	118270019	0.949000	0.32298	0.996000	0.52242	0.256000	0.26092	1.778000	0.38614	2.029000	0.59856	0.313000	0.20887	CTC	CXCR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_ATII_rcpt		0.602	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR5	HGNC	protein_coding	OTTHUMT00000389309.1	C	NM_001716		118764809	+1	no_errors	ENST00000292174	ensembl	human	known	70_37	missense	SNP	0.984	T
DNAH9	1770	genome.wustl.edu	37	17	11778359	11778359	+	Missense_Mutation	SNP	G	G	A	rs370250741		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr17:11778359G>A	ENST00000262442.4	+	53	10404	c.10336G>A	c.(10336-10338)Gac>Aac	p.D3446N	RP11-628O18.1_ENST00000579621.1_RNA|DNAH9_ENST00000454412.2_Missense_Mutation_p.D3446N	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3446	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCTCCCAGCCGACCGCATGTC	0.567																																																	0								G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	98.0	87.0	91.0		10336	4.5	1.0	17		91	0,8600		0,0,4300	no	missense	DNAH9	NM_001372.3	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3446/4487	11778359	1,13005	2203	4300	6503	SO:0001583	missense	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10336G>A	17.37:g.11778359G>A	ENSP00000262442:p.Asp3446Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.D3446N	ENST00000262442.4	37	c.10336	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.326990	0.95708	2.27E-4	0.0	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.33654	1.4;1.4	4.51	4.51	0.55191	.	0.139498	0.51477	D	0.000095	T	0.70176	0.3194	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80256	-0.1458	10	0.87932	D	0	.	17.4107	0.87485	0.0:0.0:1.0:0.0	.	3446	Q9NYC9	DYH9_HUMAN	N	3446;3446;2028	ENSP00000262442:D3446N;ENSP00000414874:D3446N	ENSP00000262442:D3446N	D	+	1	0	DNAH9	11719084	1.000000	0.71417	0.959000	0.39883	0.912000	0.54170	7.717000	0.84732	2.357000	0.79964	0.655000	0.94253	GAC	DNAH9	-	NULL		0.567	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	G	NM_001372		11778359	+1	no_errors	ENST00000262442	ensembl	human	known	70_37	missense	SNP	1.000	A
EAPP	55837	genome.wustl.edu	37	14	34998644	34998644	+	Silent	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr14:34998644C>T	ENST00000250454.3	-	4	471	c.390G>A	c.(388-390)aaG>aaA	p.K130K		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	130					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		TTGTTGGAATCTTGTGTTGTT	0.343																																																	0													143.0	126.0	131.0					14																	34998644		1835	4087	5922	SO:0001819	synonymous_variant	55837			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.390G>A	14.37:g.34998644C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BVF4|Q9NWV5|Q9NZ86	Silent	SNP	pfam_E2F-assoc_phosphoprotein	p.K130	ENST00000250454.3	37	c.390	CCDS41941.1	14																																																																																			EAPP	-	NULL		0.343	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EAPP	HGNC	protein_coding	OTTHUMT00000409847.1	C	NM_018453		34998644	-1	no_errors	ENST00000250454	ensembl	human	known	70_37	silent	SNP	0.998	T
ENPEP	2028	genome.wustl.edu	37	4	111397949	111397949	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr4:111397949G>A	ENST00000265162.5	+	1	721	c.379G>A	c.(379-381)Gct>Act	p.A127T		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	127					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CAACCTGAGCGCTCCCACCCG	0.652																																																	0													87.0	92.0	90.0					4																	111397949		2203	4300	6503	SO:0001583	missense	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.379G>A	4.37:g.111397949G>A	ENSP00000265162:p.Ala127Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A127T	ENST00000265162.5	37	c.379	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138272	0.37728	.	.	ENSG00000138792	ENST00000265162	T	0.02656	4.21	5.83	-10.5	0.00291	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	2.281760	0.01674	N	0.025770	T	0.01387	0.0045	N	0.11845	0.185	0.09310	N	1	P	0.38551	0.636	B	0.35114	0.196	T	0.44772	-0.9306	10	0.49607	T	0.09	.	1.8202	0.03109	0.2988:0.3719:0.1211:0.2082	.	127	Q07075	AMPE_HUMAN	T	127	ENSP00000265162:A127T	ENSP00000265162:A127T	A	+	1	0	ENPEP	111617398	0.000000	0.05858	0.000000	0.03702	0.528000	0.34623	-0.866000	0.04245	-1.520000	0.01773	0.561000	0.74099	GCT	ENPEP	-	pfam_Peptidase_M1_N		0.652	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	G			111397949	+1	no_errors	ENST00000265162	ensembl	human	known	70_37	missense	SNP	0.000	A
CBFA2T3	863	genome.wustl.edu	37	16	89016744	89016744	+	Intron	SNP	G	G	C	rs113555184		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr16:89016744G>C	ENST00000268679.4	-	1	548				CBFA2T3_ENST00000436887.2_Intron|RP11-830F9.6_ENST00000378347.2_Missense_Mutation_p.R73P|CBFA2T3_ENST00000448839.1_Intron|CBFA2T3_ENST00000360302.2_Intron	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3						cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CAGTTCACCCGTCCCCTGGAC	0.652			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0																																										SO:0001627	intron_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.151+26320C>G	16.37:g.89016744G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	NULL	p.R73P	ENST00000268679.4	37	c.218	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.681196	0.00745	.	.	ENSG00000205018	ENST00000378347	.	.	.	.	.	.	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.21020	N	0.999808	.	.	.	.	.	.	T	0.43114	-0.9411	4	0.87932	D	0	.	5.4706	0.16668	1.0E-4:0.3497:0.6503:0.0	.	.	.	.	P	73	.	ENSP00000367598:R73P	R	+	2	0	AC092384.1	87544245	0.057000	0.20700	0.014000	0.15608	0.015000	0.08874	0.035000	0.13797	-1.729000	0.01364	-1.721000	0.00707	CGT	RP11-830F9.6	-	NULL		0.652	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000205018	Clone_based_vega_gene	protein_coding	OTTHUMT00000269545.2	G	NM_005187		89016744	+1	no_errors	ENST00000378347	ensembl	human	putative	70_37	missense	SNP	0.364	C
AC092329.1	0	genome.wustl.edu	37	19	23369133	23369133	+	RNA	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:23369133G>A	ENST00000408551.1	+	0	100																											ttaagagtccgtttatttagc	0.448																																																	0																																												0																															19.37:g.23369133G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000408551.1	37	NULL		19																																																																																			AC092329.1	-	-		0.448	AC092329.1-201	NOVEL	basic	miRNA	ENSG00000221478	Clone_based_ensembl_gene	miRNA		G			23369133	+1	no_errors	ENST00000408551	ensembl	human	novel	70_37	rna	SNP	0.242	A
MIB1	57534	genome.wustl.edu	37	18	19291975	19291975	+	Intron	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr18:19291975C>A	ENST00000578646.1	+	1	167				SNORA81_ENST00000516868.1_RNA			Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1						blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			CTTTATAATCCAATGCTGTTA	0.478																																																	0																																										SO:0001627	intron_variant	0			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000578646.1:c.167+6891C>A	18.37:g.19291975C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	RNA	SNP	-	NULL	ENST00000578646.1	37	NULL		18																																																																																			SNORA81	-	-		0.478	MIB1-004	KNOWN	basic	processed_transcript	ENSG00000252677	RFAM	protein_coding	OTTHUMT00000445642.1	C	NM_020774		19291975	-1	no_errors	ENST00000516868	ensembl	human	novel	70_37	rna	SNP	0.886	A
PCSK6	5046	genome.wustl.edu	37	15	101844271	101844271	+	5'UTR	SNP	C	C	A	rs45595135		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr15:101844271C>A	ENST00000561177.1	-	0	4268				RP11-299G20.2_ENST00000558838.1_RNA|PCSK6_ENST00000348070.1_3'UTR|PCSK6_ENST00000358417.3_3'UTR			P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6						determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AATGCACTGTCGTCAAACAGG	0.408																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000561177.1:c.-139G>T	15.37:g.101844271C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	RNA	SNP	-	NULL	ENST00000561177.1	37	NULL		15																																																																																			RP11-299G20.2	-	-		0.408	PCSK6-001	KNOWN	basic	processed_transcript	ENSG00000259172	Clone_based_vega_gene	protein_coding	OTTHUMT00000416811.5	C	NM_002570		101844271	+1	no_errors	ENST00000558838	ensembl	human	known	70_37	rna	SNP	0.000	A
DNM1P47	100216544	genome.wustl.edu	37	15	102301268	102301268	+	RNA	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr15:102301268C>T	ENST00000561463.1	+	0	9314									DNM1 pseudogene 47																		TGCTGTCCAACCTGTACTCGC	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102301268C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	0.174	-1.068678	0.01934	.	.	ENSG00000228788	ENST00000425045	.	.	.	1.39	1.39	0.22231	.	.	.	.	.	T	0.56031	0.1958	.	.	.	.	.	.	.	.	.	.	.	.	T	0.67333	-0.5697	4	0.87932	D	0	.	8.847	0.35177	0.0:1.0:0.0:0.0	.	.	.	.	S	13	.	ENSP00000415911:P13S	P	+	1	0	AC107977.4	100118791	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	1.728000	0.38105	1.113000	0.41760	0.064000	0.15345	CCT	CTD-2611K5.6	-	-		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	ENSG00000259660	Clone_based_vega_gene	pseudogene	OTTHUMT00000417589.1	C	NG_009149		102301268	+1	no_errors	ENST00000561463	ensembl	human	known	70_37	rna	SNP	1.000	T
ERBB3	2065	genome.wustl.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:56478854G>A	ENST00000267101.3	+	3	750	c.310G>A	c.(310-312)Gtg>Atg	p.V104M	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000411731.2_Missense_Mutation_p.V104M|ERBB3_ENST00000415288.2_Missense_Mutation_p.V45M	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	104			V -> M (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V104M(7)|p.V104L(2)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517																																																	9	Substitution - Missense(9)	large_intestine(5)|endometrium(2)|ovary(1)|NS(1)											186.0	159.0	168.0					12																	56478854		2203	4300	6503	SO:0001583	missense	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.310G>A	12.37:g.56478854G>A	ENSP00000267101:p.Val104Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V104M	ENST00000267101.3	37	c.310	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103691	0.56291	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48;-1.48	5.82	4.93	0.64822	EGF receptor, L domain (1);	0.096412	0.43416	D	0.000573	D	0.87438	0.6177	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.59221	0.698;0.854	D	0.88227	0.2901	10	0.59425	D	0.04	.	10.6531	0.45659	0.1547:0.0:0.8453:0.0	.	104;104	P21860;P21860-2	ERBB3_HUMAN;.	M	104;45;104;104;104;45;45	ENSP00000448636:V104M;ENSP00000449138:V45M;ENSP00000267101:V104M;ENSP00000415753:V104M;ENSP00000449713:V45M;ENSP00000408340:V45M	ENSP00000267101:V104M	V	+	1	0	ERBB3	54765121	1.000000	0.71417	0.892000	0.35008	0.052000	0.14988	4.300000	0.59079	1.450000	0.47717	0.655000	0.94253	GTG	ERBB3	-	pfam_EGF_rcpt_L,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt		0.517	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	G			56478854	+1	no_errors	ENST00000267101	ensembl	human	known	70_37	missense	SNP	0.994	A
FRMD4A	55691	genome.wustl.edu	37	10	13687647	13687647	+	3'UTR	SNP	T	T	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr10:13687647T>C	ENST00000357447.2	-	0	4879				FRMD4A_ENST00000358621.4_3'UTR	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A						establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CATGGGCCCTTTGGGAGCTGA	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	55691			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.*1391A>G	10.37:g.13687647T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y3|Q5T377	RNA	SNP	-	NULL	ENST00000357447.2	37	NULL	CCDS7101.1	10																																																																																			FRMD4A	-	-		0.428	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	T	NM_018027		13687647	-1	no_errors	ENST00000460348	ensembl	human	known	70_37	rna	SNP	0.285	C
FSIP2	401024	genome.wustl.edu	37	2	186670333	186670333	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr2:186670333G>A	ENST00000424728.1	+	17	16300	c.16300G>A	c.(16300-16302)Gca>Aca	p.A5434T	FSIP2_ENST00000343098.5_Missense_Mutation_p.A5523T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5434										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAGCAGATGTGCAAAAGAGAA	0.368																																																	0													102.0	95.0	98.0					2																	186670333		1846	4091	5937	SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16300G>A	2.37:g.186670333G>A	ENSP00000401306:p.Ala5434Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.A5523T	ENST00000424728.1	37	c.16567		2	.	.	.	.	.	.	.	.	.	.	G	13.97	2.397357	0.42512	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.43688	0.94;0.94	5.13	-3.89	0.04193	.	.	.	.	.	T	0.15998	0.0385	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.25293	-1.0136	7	0.12766	T	0.61	.	1.1535	0.01791	0.1324:0.2486:0.2814:0.3375	.	.	.	.	T	5523;5434	ENSP00000344403:A5523T;ENSP00000401306:A5434T	ENSP00000344403:A5523T	A	+	1	0	FSIP2	186378578	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.170000	0.16663	-0.401000	0.07644	-0.740000	0.03531	GCA	FSIP2	-	NULL		0.368	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	G	NM_173651		186670333	+1	no_errors	ENST00000343098	ensembl	human	known	70_37	missense	SNP	0.000	A
G6PD	2539	genome.wustl.edu	37	X	153763558	153763558	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:153763558G>A	ENST00000393564.2	-	5	422	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	G6PD_ENST00000497281.1_5'UTR|G6PD_ENST00000393562.2_Missense_Mutation_p.R134C|G6PD_ENST00000369620.2_Missense_Mutation_p.R104C	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	104					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TAGGAGTTGCGGGCAAAGAAG	0.597																																																	0													113.0	67.0	83.0					X																	153763558		2203	4300	6503	SO:0001583	missense	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.310C>T	X.37:g.153763558G>A	ENSP00000377194:p.Arg104Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,pirsf_G6P_DH,prints_G6P_DH	p.R104C	ENST00000393564.2	37	c.310	CCDS44023.1	X	.	.	.	.	.	.	.	.	.	.	G	9.003	0.980704	0.18812	.	.	ENSG00000160211	ENST00000393562;ENST00000291567;ENST00000393564;ENST00000369620;ENST00000439227;ENST00000440967;ENST00000433845	D;D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97;-4.97	5.81	4.95	0.65309	NAD(P)-binding domain (1);Glucose-6-phosphate dehydrogenase, NAD-binding (1);	0.053150	0.85682	D	0.000000	D	0.96892	0.8985	M	0.81942	2.565	0.80722	D	1	B;B	0.30634	0.221;0.288	B;B	0.21360	0.034;0.033	D	0.95342	0.8439	10	0.38643	T	0.18	.	11.8017	0.52130	0.0868:0.0:0.9132:0.0	.	104;134	P11413;P11413-3	G6PD_HUMAN;.	C	134;104;104;104;104;104;104	ENSP00000377192:R134C;ENSP00000377194:R104C;ENSP00000358633:R104C;ENSP00000395599:R104C;ENSP00000400648:R104C;ENSP00000394690:R104C	ENSP00000291567:R104C	R	-	1	0	G6PD	153416752	0.999000	0.42202	0.997000	0.53966	0.011000	0.07611	4.821000	0.62679	1.212000	0.43366	-0.197000	0.12766	CGC	G6PD	-	pfam_G6P_DH_NAD-bd,pirsf_G6P_DH		0.597	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	G6PD	HGNC	protein_coding	OTTHUMT00000061170.3	G	NM_000402		153763558	-1	no_errors	ENST00000369620	ensembl	human	known	70_37	missense	SNP	0.998	A
GNE	10020	genome.wustl.edu	37	9	36222893	36222893	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr9:36222893G>A	ENST00000539815.1	-	8	1554	c.1514C>T	c.(1513-1515)tCt>tTt	p.S505F	GNE_ENST00000447283.2_Intron|GNE_ENST00000377902.5_Missense_Mutation_p.S505F|GNE_ENST00000543356.2_Missense_Mutation_p.S500F|GNE_ENST00000539208.1_Missense_Mutation_p.S395F|GNE_ENST00000396594.3_Missense_Mutation_p.S536F			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	505	N-acetylmannosamine kinase.				carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			CAAAGTGTCAGAAAGGGGGGT	0.498																																					GBM(184;106 2118 20004 35750 50727)												0													130.0	123.0	126.0					9																	36222893		2203	4300	6503	SO:0001583	missense	10020			AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.1514C>T	9.37:g.36222893G>A	ENSP00000439155:p.Ser505Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	pfam_UDP_GlcNAc_Epimerase_2,pfam_ROK,prints_Hexokinase,tigrfam_UDP-GlcNAc_Epase	p.S536F	ENST00000539815.1	37	c.1607	CCDS6602.1	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945712	0.73672	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208	D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19	5.7	5.7	0.88788	.	0.048469	0.85682	D	0.000000	D	0.96676	0.8915	M	0.88241	2.94	0.80722	D	1	P;P;P;P	0.46327	0.688;0.85;0.85;0.876	B;B;B;B	0.41619	0.181;0.325;0.325;0.361	D	0.97324	0.9946	10	0.66056	D	0.02	-3.5279	17.3339	0.87274	0.0:0.0:1.0:0.0	.	395;464;536;505	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223	.;.;.;GLCNE_HUMAN	F	505;536;500;505;477;395	ENSP00000367134:S505F;ENSP00000379839:S536F;ENSP00000439155:S505F;ENSP00000445117:S395F	ENSP00000340770:S500F	S	-	2	0	GNE	36212893	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.162000	0.94745	2.675000	0.91044	0.591000	0.81541	TCT	GNE	-	pfam_ROK		0.498	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GNE	HGNC	protein_coding	OTTHUMT00000052412.4	G	NM_005476		36222893	-1	no_errors	ENST00000396594	ensembl	human	known	70_37	missense	SNP	1.000	A
HSP90AA6P	441051	genome.wustl.edu	37	4	171502653	171502653	+	RNA	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr4:171502653G>A	ENST00000325407.4	-	0	273									heat shock protein 90kDa alpha (cytosolic), class A member 6, pseudogene																		taaggagcaggcaacttggat	0.532																																																	0																																												441051			AY956762		4q33	2014-02-12	2011-04-15			ENSG00000181359			32536	pseudogene	pseudogene						16269234	Standard	NG_025183		Approved						4.37:g.171502653G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000325407.4	37	NULL		4																																																																																			HSP90AA6P	-	-		0.532	HSP90AA6P-002	KNOWN	basic	processed_transcript	HSP90AA6P	HGNC	pseudogene	OTTHUMT00000366140.1	G			171502653	-1	no_errors	ENST00000325407	ensembl	human	known	70_37	rna	SNP	0.143	A
IER2	9592	genome.wustl.edu	37	19	13264405	13264405	+	Silent	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:13264405G>T	ENST00000588173.1	+	1	1617	c.405G>T	c.(403-405)ctG>ctT	p.L135L	CTC-250I14.6_ENST00000586483.1_RNA|CTC-250I14.6_ENST00000592882.1_RNA|IER2_ENST00000587885.1_Silent_p.L135L|IER2_ENST00000292433.3_Silent_p.L135L			Q9BTL4	IER2_HUMAN	immediate early response 2	135						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			ACGCTGGACTGGTCCCGAGCA	0.682											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													14.0	15.0	15.0					19																	13264405		2180	4276	6456	SO:0001819	synonymous_variant	9592			M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.405G>T	19.37:g.13264405G>T		Somatic	686	WXS	Illumina HiSeq	Phase_IV	Q03827|Q2TAZ2	Silent	SNP	pfam_IER	p.L135	ENST00000588173.1	37	c.405	CCDS12295.1	19																																																																																			IER2	-	pfam_IER		0.682	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IER2	HGNC	protein_coding	OTTHUMT00000453033.1	G	NM_004907		13264405	+1	no_errors	ENST00000292433	ensembl	human	known	70_37	silent	SNP	0.985	T
ILK	3611	genome.wustl.edu	37	11	6631719	6631719	+	Silent	SNP	C	C	T	rs569395635		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:6631719C>T	ENST00000396751.2	+	12	1692	c.1236C>T	c.(1234-1236)acC>acT	p.T412T	ILK_ENST00000420936.2_Silent_p.T412T|ILK_ENST00000299421.4_Silent_p.T412T|TAF10_ENST00000531760.1_5'Flank|RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000537806.1_Silent_p.T278T|ILK_ENST00000528995.1_Silent_p.T351T	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	412	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TTCGGCCTACCATCCCACCAG	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20365	0.0		0.0	False		,,,				2504	0.0																0													79.0	79.0	79.0					11																	6631719		2201	4296	6497	SO:0001819	synonymous_variant	3611			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1236C>T	11.37:g.6631719C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Integrin-linked_kinase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T412	ENST00000396751.2	37	c.1236	CCDS7768.1	11																																																																																			ILK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Integrin-linked_kinase,pfscan_Prot_kinase_cat_dom		0.488	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ILK	HGNC	protein_coding	OTTHUMT00000384519.1	C	NM_004517		6631719	+1	no_errors	ENST00000299421	ensembl	human	known	70_37	silent	SNP	1.000	T
INADL	10207	genome.wustl.edu	37	1	62566054	62566054	+	Intron	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:62566054C>T	ENST00000371158.2	+	34	4491				INADL_ENST00000543708.1_Missense_Mutation_p.H265Y|INADL_ENST00000545929.1_Intron|INADL_ENST00000316485.6_Missense_Mutation_p.H1481Y	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)						cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						catgctgcatcatcctgtgac	0.468																																																	0													35.0	38.0	37.0					1																	62566054		692	1591	2283	SO:0001627	intron_variant	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4378-8055C>T	1.37:g.62566054C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H265Y	ENST00000371158.2	37	c.793	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	C	5.495	0.276383	0.10403	.	.	ENSG00000132849	ENST00000316485;ENST00000371156;ENST00000543708	T;T	0.16743	2.51;2.32	0.865	0.865	0.19074	.	.	.	.	.	T	0.10594	0.0259	.	.	.	0.09310	N	0.999999	B;P	0.42039	0.448;0.769	B;P	0.49332	0.415;0.607	T	0.12734	-1.0536	8	0.02654	T	1	.	5.0323	0.14417	0.0:1.0:0.0:0.0	.	265;1481	B4DE90;F8W8T2	.;.	Y	1481;1481;265	ENSP00000326199:H1481Y;ENSP00000445790:H265Y	ENSP00000326199:H1481Y	H	+	1	0	INADL	62338642	0.072000	0.21174	0.014000	0.15608	0.056000	0.15407	0.305000	0.19254	0.737000	0.32582	0.563000	0.77884	CAT	INADL	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.468	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	C	NM_170605		62566054	+1	no_errors	ENST00000543708	ensembl	human	known	70_37	missense	SNP	0.018	T
ITM2A	9452	genome.wustl.edu	37	X	78622732	78622732	+	5'UTR	SNP	C	C	T	rs374427238		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:78622732C>T	ENST00000373298.2	-	0	124				ITM2A_ENST00000434584.2_5'UTR|ITM2A_ENST00000469541.1_5'Flank	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						TCGGGCTGCGCGGTAAGGCGC	0.562																																																	0													33.0	23.0	27.0					X																	78622732		2203	4300	6503	SO:0001623	5_prime_UTR_variant	9452			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.-20G>A	X.37:g.78622732C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7X5|B4E062|Q6IBC9	RNA	SNP	-	NULL	ENST00000373298.2	37	NULL	CCDS14444.1	X																																																																																			ITM2A	-	-		0.562	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2A	HGNC	protein_coding	OTTHUMT00000057329.1	C	NM_004867		78622732	-1	no_errors	ENST00000461357	ensembl	human	known	70_37	rna	SNP	0.983	T
JDP2	122953	genome.wustl.edu	37	14	75936102	75936102	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr14:75936102G>A	ENST00000435893.2	+	4	689	c.416G>A	c.(415-417)tGc>tAc	p.C139Y	JDP2_ENST00000437176.1_Missense_Mutation_p.C139Y|JDP2_ENST00000419727.2_Missense_Mutation_p.C139Y|JDP2_ENST00000267569.5_Missense_Mutation_p.C150Y	NM_001135047.1|NM_130469.3	NP_001128519.1|NP_569736.1	Q8WYK2	JDP2_HUMAN	Jun dimerization protein 2	139					negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone deacetylation (GO:0031065)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.0296)	Pseudoephedrine(DB00852)	CGCCCCACCTGCATCGTCCGG	0.612																																																	0													67.0	60.0	63.0					14																	75936102		2203	4300	6503	SO:0001583	missense	122953			AF111167	CCDS9842.1, CCDS45139.1	14q24.2	2013-01-10		2008-04-10				"""basic leucine zipper proteins"""	17546	protein-coding gene	gene with protein product	"""progesterone receptor co-activator"""	608657				12052888, 9154808, 17545590	Standard	NM_130469		Approved	JUNDM2	uc001xrq.3	Q8WYK2		ENST00000435893.2:c.416G>A	14.37:g.75936102G>A	ENSP00000399587:p.Cys139Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	J3KN58|O95430|Q9UIE4	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.C150Y	ENST00000435893.2	37	c.449	CCDS9842.1	14	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208898	0.79240	.	.	ENSG00000140044	ENST00000419727;ENST00000437176;ENST00000435893;ENST00000267569	T;T;T;T	0.65732	-0.09;-0.09;-0.09;-0.17	4.58	3.68	0.42216	.	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	L	0.32530	0.975	0.51012	D	0.999902	D	0.71674	0.998	D	0.80764	0.994	T	0.72940	-0.4139	10	0.87932	D	0	-1.8192	14.1339	0.65273	0.0:0.0:0.8489:0.1511	.	139	Q8WYK2	JDP2_HUMAN	Y	139;139;139;150	ENSP00000415558:C139Y;ENSP00000409787:C139Y;ENSP00000399587:C139Y;ENSP00000267569:C150Y	ENSP00000267569:C150Y	C	+	2	0	JDP2	75005855	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.458000	0.97634	1.139000	0.42245	0.467000	0.42956	TGC	JDP2	-	prints_Leuzip_Fos		0.612	JDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JDP2	HGNC	protein_coding	OTTHUMT00000415505.1	G	NM_130469		75936102	+1	no_errors	ENST00000267569	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA0556	23247	genome.wustl.edu	37	16	27781196	27781196	+	Missense_Mutation	SNP	C	C	A	rs538934615		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr16:27781196C>A	ENST00000261588.4	+	21	4009	c.3990C>A	c.(3988-3990)caC>caA	p.H1330Q		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1330						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGATTGTCCACGTCTCCCTGG	0.567																																																	0													144.0	144.0	144.0					16																	27781196		2197	4300	6497	SO:0001583	missense	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3990C>A	16.37:g.27781196C>A	ENSP00000261588:p.His1330Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C2	Missense_Mutation	SNP	superfamily_Thaumatin	p.H1330Q	ENST00000261588.4	37	c.3990	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	C	15.44	2.834498	0.50951	.	.	ENSG00000047578	ENST00000261588	T	0.12774	2.65	5.03	3.06	0.35304	.	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	L	0.55743	1.74	0.40375	D	0.97938	D	0.76494	0.999	D	0.68943	0.961	T	0.01889	-1.1253	10	0.66056	D	0.02	.	6.8736	0.24135	0.0:0.6449:0.0:0.3551	.	1330	O60303	K0556_HUMAN	Q	1330	ENSP00000261588:H1330Q	ENSP00000261588:H1330Q	H	+	3	2	KIAA0556	27688697	0.983000	0.35010	0.997000	0.53966	0.774000	0.43823	0.156000	0.16382	1.094000	0.41399	0.655000	0.94253	CAC	KIAA0556	-	NULL		0.567	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	HGNC	protein_coding	OTTHUMT00000433724.1	C	NM_015202		27781196	+1	no_errors	ENST00000261588	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA1407	57577	genome.wustl.edu	37	3	113729657	113729657	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:113729657C>A	ENST00000295878.3	-	9	1521	c.1375G>T	c.(1375-1377)Gca>Tca	p.A459S	KIAA1407_ENST00000545063.1_Missense_Mutation_p.A290S	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	459										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						ATGGCTGTTGCCTCCTCAGGT	0.463																																																	0													159.0	144.0	149.0					3																	113729657		2203	4300	6503	SO:0001583	missense	57577			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1375G>T	3.37:g.113729657C>A	ENSP00000295878:p.Ala459Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.A459S	ENST00000295878.3	37	c.1375	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362475	0.24684	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.44881	1.51;0.91;0.93	5.94	1.64	0.23874	.	1.364740	0.04196	N	0.329085	T	0.44052	0.1275	M	0.65975	2.015	0.21325	N	0.999722	P;P;P	0.47841	0.649;0.901;0.767	B;B;B	0.41510	0.359;0.359;0.359	T	0.38628	-0.9652	10	0.22109	T	0.4	.	10.3091	0.43697	0.0:0.6817:0.0:0.3183	.	446;335;459	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	S	459;290;446	ENSP00000295878:A459S;ENSP00000446381:A290S;ENSP00000418099:A446S	ENSP00000295878:A459S	A	-	1	0	KIAA1407	115212347	0.000000	0.05858	0.241000	0.24154	0.058000	0.15608	-0.081000	0.11321	0.414000	0.25790	-0.136000	0.14681	GCA	KIAA1407	-	NULL		0.463	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2	C	NM_020817		113729657	-1	no_errors	ENST00000295878	ensembl	human	known	70_37	missense	SNP	0.219	A
KIF26B	55083	genome.wustl.edu	37	1	245772793	245772793	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:245772793G>A	ENST00000407071.2	+	8	2317	c.1877G>A	c.(1876-1878)gGc>gAc	p.G626D	KIF26B_ENST00000366518.4_Missense_Mutation_p.G245D	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	626	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CAGTCCCCGGGCGTGTACCTC	0.687																																																	0													12.0	16.0	15.0					1																	245772793		1970	4129	6099	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1877G>A	1.37:g.245772793G>A	ENSP00000385545:p.Gly626Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G626D	ENST00000407071.2	37	c.1877	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451090	0.63290	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.74209	-0.82;-0.82	5.54	4.61	0.57282	Kinesin, motor domain (4);	.	.	.	.	D	0.83714	0.5314	L	0.56396	1.775	0.80722	D	1	D;P	0.76494	0.999;0.943	D;P	0.79784	0.993;0.874	D	0.85810	0.1379	9	0.87932	D	0	.	15.9336	0.79686	0.0:0.0:0.8636:0.1364	.	245;626	B7WPD9;Q2KJY2	.;KI26B_HUMAN	D	626;245;242	ENSP00000385545:G626D;ENSP00000355475:G245D	ENSP00000355475:G245D	G	+	2	0	KIF26B	243839416	1.000000	0.71417	0.989000	0.46669	0.931000	0.56810	9.813000	0.99286	1.437000	0.47472	0.650000	0.86243	GGC	KIF26B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.687	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	G	XM_371354		245772793	+1	no_errors	ENST00000407071	ensembl	human	known	70_37	missense	SNP	1.000	A
KRT16P3	644945	genome.wustl.edu	37	17	20405802	20405802	+	RNA	SNP	T	T	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr17:20405802T>C	ENST00000580113.1	-	0	1012									keratin 16 pseudogene 3																		TCTGGTCCCATCCTGAGAAAA	0.498																																																	0																																												644945			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20405802T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-		0.498	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	T	NR_029393		20405802	-1	no_errors	ENST00000580621	ensembl	human	known	70_37	rna	SNP	0.000	C
LINGO2	158038	genome.wustl.edu	37	9	27949873	27949873	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr9:27949873A>T	ENST00000379992.2	-	6	1246	c.797T>A	c.(796-798)tTc>tAc	p.F266Y	LINGO2_ENST00000308675.3_Missense_Mutation_p.F266Y	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	266						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		AAAGGCAAGGAAGGGTACAGT	0.478																																																	0													266.0	241.0	250.0					9																	27949873		2203	4300	6503	SO:0001583	missense	158038			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.797T>A	9.37:g.27949873A>T	ENSP00000369328:p.Phe266Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.F266Y	ENST00000379992.2	37	c.797	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	A	0.296	-0.976706	0.02215	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79940	-1.32;-1.32	6.17	5.0	0.66597	.	0.056742	0.64402	D	0.000001	T	0.57169	0.2035	N	0.05351	-0.065	0.39180	D	0.962751	B	0.02656	0.0	B	0.04013	0.001	T	0.54801	-0.8239	9	.	.	.	.	5.047	0.14488	0.654:0.0:0.0877:0.2583	.	266	Q7L985	LIGO2_HUMAN	Y	266	ENSP00000369328:F266Y;ENSP00000310126:F266Y	.	F	-	2	0	LINGO2	27939873	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	3.009000	0.49552	2.371000	0.80710	0.533000	0.62120	TTC	LINGO2	-	smart_Leu-rich_rpt_typical-subtyp		0.478	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	A	NM_152570		27949873	-1	no_errors	ENST00000308675	ensembl	human	known	70_37	missense	SNP	1.000	T
LMAN1	3998	genome.wustl.edu	37	18	57020469	57020469	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr18:57020469G>A	ENST00000251047.5	-	5	1321	c.604C>T	c.(604-606)Cga>Tga	p.R202*	LMAN1_ENST00000587940.1_5'Flank	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	202	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	ATCTTTGCTCGGACAGGATAG	0.408																																																	0			GRCh37	CM990809	LMAN1	M							181.0	168.0	173.0					18																	57020469		2203	4300	6503	SO:0001587	stop_gained	3998			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.604C>T	18.37:g.57020469G>A	ENSP00000251047:p.Arg202*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Nonsense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf,superfamily_HMG_superfamily	p.R202*	ENST00000251047.5	37	c.604	CCDS11974.1	18	.	.	.	.	.	.	.	.	.	.	g	37	6.252319	0.97412	.	.	ENSG00000074695	ENST00000251047	.	.	.	6.01	5.15	0.70609	.	0.052613	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9692	14.1709	0.65510	0.0:0.0:0.7269:0.2731	.	.	.	.	X	202	.	ENSP00000251047:R202X	R	-	1	2	LMAN1	55171449	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.218000	0.51192	1.565000	0.49641	-0.121000	0.15023	CGA	LMAN1	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf		0.408	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN1	HGNC	protein_coding	OTTHUMT00000256129.2	G	NM_005570		57020469	-1	no_errors	ENST00000251047	ensembl	human	known	70_37	nonsense	SNP	0.997	A
AP001372.2	0	genome.wustl.edu	37	11	74209056	74209056	+	lincRNA	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:74209056C>T	ENST00000526036.1	+	0	1971																											aggaatgcttcttcctctcta	0.363																																																	0													52.0	53.0	53.0					11																	74209056		692	1591	2283			100287896																															11.37:g.74209056C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526036.1	37	NULL		11																																																																																			AP001372.2	-	-		0.363	AP001372.2-001	KNOWN	basic	lincRNA	LOC100287896	Clone_based_vega_gene	lincRNA	OTTHUMT00000317865.2	C			74209056	+1	no_errors	ENST00000526036	ensembl	human	known	70_37	rna	SNP	0.439	T
AKT2	208	genome.wustl.edu	37	19	40781050	40781050	+	Intron	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:40781050C>A	ENST00000392038.2	-	2	215				AKT2_ENST00000579047.1_Intron|CTC-425O23.2_ENST00000378432.1_RNA	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2						activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			GGAGCCCGGACCCCTCTCCTC	0.617			A		"""ovarian, pancreatic """																																			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0																																										SO:0001627	intron_variant	100507646			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.84-9792G>T	19.37:g.40781050C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	RNA	SNP	-	NULL	ENST00000392038.2	37	NULL	CCDS12552.1	19	.	.	.	.	.	.	.	.	.	.	C	4.015	0.000190	0.07819	.	.	ENSG00000205041	ENST00000378432	.	.	.	2.42	0.161	0.14977	.	.	.	.	.	T	0.37293	0.0998	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38628	-0.9652	5	0.87932	D	0	.	4.0375	0.09737	0.0:0.4802:0.0:0.5198	.	.	.	.	V	106	.	ENSP00000367689:G106V	G	-	2	0	AC118344.1	45472890	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.279000	0.02807	0.063000	0.16370	-0.448000	0.05591	GGT	CTC-425O23.2	-	-		0.617	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100507646	Clone_based_vega_gene	protein_coding	OTTHUMT00000268029.1	C	NM_001626		40781050	-1	no_errors	ENST00000378432	ensembl	human	known	70_37	rna	SNP	0.000	A
LRIF1	55791	genome.wustl.edu	37	1	111494244	111494244	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:111494244G>T	ENST00000369763.4	-	2	1652	c.1262C>A	c.(1261-1263)tCt>tAt	p.S421Y	LRIF1_ENST00000485275.2_Intron|RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CATCTGGGAAGATTTACTTTT	0.408																																																	0													169.0	174.0	173.0					1																	111494244		2203	4300	6503	SO:0001583	missense	55791			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1262C>A	1.37:g.111494244G>T	ENSP00000358778:p.Ser421Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	NULL	p.S421Y	ENST00000369763.4	37	c.1262	CCDS30800.1	1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137079	0.56936	.	.	ENSG00000121931	ENST00000369763	T	0.35789	1.29	5.83	5.83	0.93111	.	0.446550	0.23245	N	0.050317	T	0.46658	0.1404	L	0.51422	1.61	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	T	0.37150	-0.9718	10	0.62326	D	0.03	-8.08	17.6072	0.88041	0.0:0.0:1.0:0.0	.	421	Q5T3J3	LRIF1_HUMAN	Y	421	ENSP00000358778:S421Y	ENSP00000358778:S421Y	S	-	2	0	LRIF1	111295767	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.364000	0.52328	2.762000	0.94881	0.591000	0.81541	TCT	LRIF1	-	NULL		0.408	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	HGNC	protein_coding	OTTHUMT00000032932.2	G	NM_018372		111494244	-1	no_errors	ENST00000369763	ensembl	human	known	70_37	missense	SNP	1.000	T
MAN1A2	10905	genome.wustl.edu	37	1	117910706	117910706	+	5'UTR	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:117910706G>A	ENST00000356554.3	+	0	636				RP11-188D8.1_ENST00000604156.1_lincRNA|MAN1A2_ENST00000482811.1_3'UTR	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2						cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		GCAAAATTGAGTTTTCCCATT	0.413																																					Ovarian(33;199 881 8228 13687 31538)												0																																										SO:0001623	5_prime_UTR_variant	10905			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.-100G>A	1.37:g.117910706G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H510	RNA	SNP	-	NULL	ENST00000356554.3	37	NULL	CCDS895.1	1																																																																																			MAN1A2	-	-		0.413	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A2	HGNC	protein_coding	OTTHUMT00000033593.1	G	NM_006699		117910706	+1	no_errors	ENST00000482811	ensembl	human	known	70_37	rna	SNP	0.743	A
MFRP	83552	genome.wustl.edu	37	11	119212390	119212390	+	Silent	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:119212390G>T	ENST00000530681.1	-	13	1752	c.1608C>A	c.(1606-1608)ccC>ccA	p.P536P	MFRP_ENST00000449574.2_Silent_p.P536P|MFRP_ENST00000360167.4_Silent_p.P418P|C1QTNF5_ENST00000528368.1_5'Flank|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000555262.1_Silent_p.P536P|C1QTNF5_ENST00000525657.1_5'Flank	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	536	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		AGCGGCAAGGGGGCAGAACAC	0.652																																																	0													33.0	39.0	37.0					11																	119212390		2199	4295	6494	SO:0001819	synonymous_variant	83552			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1608C>A	11.37:g.119212390G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Silent	SNP	pfam_CUB,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt	p.P536	ENST00000530681.1	37	c.1608	CCDS8421.1	11																																																																																			MFRP	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom		0.652	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	MFRP	HGNC	protein_coding	OTTHUMT00000415179.1	G	NM_031433		119212390	-1	no_errors	ENST00000449574	ensembl	human	known	70_37	silent	SNP	1.000	T
TMF1	7110	genome.wustl.edu	37	3	69098114	69098114	+	Intron	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:69098114G>A	ENST00000398559.2	-	2	359				CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|TMF1_ENST00000543976.1_Intron|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|MIR3136_ENST00000583498.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1						acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		AAACTAATATGGAACTAACTG	0.303																																																	0																																										SO:0001627	intron_variant	100422859				CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.143-401C>T	3.37:g.69098114G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLJ2|Q17R87|Q59GK0	RNA	SNP	-	NULL	ENST00000398559.2	37	NULL	CCDS43105.1	3																																																																																			MIR3136	-	-		0.303	TMF1-001	KNOWN	basic|CCDS	protein_coding	MIR3136	HGNC	protein_coding	OTTHUMT00000352106.1	G	NM_007114		69098114	-1	no_errors	ENST00000583498	ensembl	human	known	70_37	rna	SNP	0.000	A
KMT2D	8085	genome.wustl.edu	37	12	49426773	49426773	+	Silent	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:49426773C>T	ENST00000301067.7	-	39	11714	c.11715G>A	c.(11713-11715)caG>caA	p.Q3905Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3905	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										gctgttgcagctgctgctgct	0.562																																																	0													12.0	15.0	14.0					12																	49426773		1760	3253	5013	SO:0001819	synonymous_variant	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11715G>A	12.37:g.49426773C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Silent	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3905	ENST00000301067.7	37	c.11715	CCDS44873.1	12																																																																																			MLL2	-	NULL		0.562	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	C			49426773	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	silent	SNP	0.723	T
MSH4	4438	genome.wustl.edu	37	1	76276488	76276488	+	Missense_Mutation	SNP	T	T	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:76276488T>C	ENST00000263187.3	+	4	799	c.695T>C	c.(694-696)tTc>tCc	p.F232S		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	232					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ACAGAAAATTTCAAGGTAAGT	0.274								Mismatch excision repair (MMR)																																									0													72.0	71.0	72.0					1																	76276488		2203	4299	6502	SO:0001583	missense	4438			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.695T>C	1.37:g.76276488T>C	ENSP00000263187:p.Phe232Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.F232S	ENST00000263187.3	37	c.695	CCDS670.1	1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109648	0.77096	.	.	ENSG00000057468	ENST00000263187	D	0.86769	-2.17	4.64	4.64	0.57946	DNA mismatch repair protein MutS, connector (2);	0.099038	0.64402	D	0.000001	D	0.92182	0.7521	M	0.85041	2.73	0.54753	D	0.999989	D	0.63880	0.993	D	0.70935	0.971	D	0.92233	0.5794	10	0.44086	T	0.13	-14.4307	14.7795	0.69754	0.0:0.0:0.0:1.0	.	232	O15457	MSH4_HUMAN	S	232	ENSP00000263187:F232S	ENSP00000263187:F232S	F	+	2	0	MSH4	76049076	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.154000	0.77437	2.024000	0.59613	0.383000	0.25322	TTC	MSH4	-	pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_connt		0.274	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	HGNC	protein_coding	OTTHUMT00000026983.1	T	NM_002440		76276488	+1	no_errors	ENST00000263187	ensembl	human	known	70_37	missense	SNP	1.000	C
MXI1	4601	genome.wustl.edu	37	10	112039840	112039840	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr10:112039840C>T	ENST00000239007.7	+	5	738	c.520C>T	c.(520-522)Cga>Tga	p.R174*	MXI1_ENST00000369612.1_Nonsense_Mutation_p.R138*|MXI1_ENST00000361248.4_Nonsense_Mutation_p.R128*|MXI1_ENST00000332674.5_Nonsense_Mutation_p.R241*|MXI1_ENST00000485566.1_3'UTR|MXI1_ENST00000393134.1_Nonsense_Mutation_p.R164*	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein	174					cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGATTCAGAGCGAGGTAGGCA	0.443																																																	0													93.0	84.0	87.0					10																	112039840		2203	4300	6503	SO:0001587	stop_gained	4601			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.520C>T	10.37:g.112039840C>T	ENSP00000239007:p.Arg174*	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	Nonsense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.R241*	ENST00000239007.7	37	c.721	CCDS7564.2	10	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911600	0.72983	.	.	ENSG00000119950	ENST00000332674;ENST00000361248;ENST00000239007;ENST00000369619;ENST00000393134;ENST00000369614;ENST00000369613;ENST00000369612	.	.	.	5.6	5.6	0.85130	.	0.132853	0.51477	D	0.000089	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.0555	14.7858	0.69803	0.1443:0.8557:0.0:0.0	.	.	.	.	X	241;128;174;164;164;138;138;138	.	ENSP00000239007:R174X	R	+	1	2	MXI1	112029830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.876000	0.39588	2.805000	0.96524	0.650000	0.86243	CGA	MXI1	-	NULL		0.443	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	MXI1	HGNC	protein_coding	OTTHUMT00000050316.1	C	NM_130439		112039840	+1	no_errors	ENST00000332674	ensembl	human	known	70_37	nonsense	SNP	1.000	T
NAA15	80155	genome.wustl.edu	37	4	140258071	140258071	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr4:140258071G>A	ENST00000296543.5	+	3	532	c.209G>A	c.(208-210)cGt>cAt	p.R70H	NAA15_ENST00000398947.1_Missense_Mutation_p.R70H|NAA15_ENST00000480277.2_3'UTR	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	70					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)	p.R70H(1)		NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						GAATTGGTTCGTAGAGGTTTG	0.353																																																	1	Substitution - Missense(1)	large_intestine(1)											136.0	127.0	130.0					4																	140258071		1897	4156	6053	SO:0001583	missense	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.209G>A	4.37:g.140258071G>A	ENSP00000296543:p.Arg70His	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R70H	ENST00000296543.5	37	c.209	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530583	0.85706	.	.	ENSG00000164134	ENST00000296543;ENST00000398947	T;T	0.52057	0.68;0.68	5.26	5.26	0.73747	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.70561	0.3238	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.74878	-0.3514	10	0.87932	D	0	-9.4103	18.8597	0.92267	0.0:0.0:1.0:0.0	.	70	Q9BXJ9	NAA15_HUMAN	H	70	ENSP00000296543:R70H;ENSP00000381920:R70H	ENSP00000296543:R70H	R	+	2	0	NAA15	140477521	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	9.476000	0.97823	2.442000	0.82660	0.563000	0.77884	CGT	NAA15	-	smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR-contain_dom		0.353	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	G	NM_057175		140258071	+1	no_errors	ENST00000296543	ensembl	human	known	70_37	missense	SNP	1.000	A
NBEAL2	23218	genome.wustl.edu	37	3	47045644	47045644	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:47045644G>A	ENST00000450053.3	+	37	6138	c.5959G>A	c.(5959-5961)Gca>Aca	p.A1987T	NBEAL2_ENST00000292309.5_Missense_Mutation_p.A1803T|NBEAL2_ENST00000383740.2_Missense_Mutation_p.A266T	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1987					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GCGCCGTTCAGCACTTGAGCT	0.587																																																	0													170.0	181.0	177.0					3																	47045644		2093	4207	6300	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5959G>A	3.37:g.47045644G>A	ENSP00000415034:p.Ala1987Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1987T	ENST00000450053.3	37	c.5959	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.086900|5.086900	0.94100|0.94100	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053|ENST00000443829	T;T;T|T	0.79033|0.49139	-1.09;-0.88;-1.23|0.79	4.92|4.92	4.92|4.92	0.64577|0.64577	PH-BEACH domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71213|0.71213	0.3313|0.3313	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.87578|.	0.998;0.995|.	T|T	0.77040|0.77040	-0.2735|-0.2735	10|7	0.87932|0.66056	D|D	0|0.02	.|.	16.8698|16.8698	0.86038|0.86038	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1803;1987|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	T|N	1803;266;1987|355	ENSP00000292309:A1803T;ENSP00000373246:A266T;ENSP00000415034:A1987T|ENSP00000414560:S355N	ENSP00000292309:A1803T|ENSP00000414560:S355N	A|S	+|+	1|2	0|0	NBEAL2|NBEAL2	47020648|47020648	1.000000|1.000000	0.71417|0.71417	0.104000|0.104000	0.21259|0.21259	0.923000|0.923000	0.55619|0.55619	9.657000|9.657000	0.98554|0.98554	2.573000|2.573000	0.86826|0.86826	0.561000|0.561000	0.74099|0.74099	GCA|AGC	NBEAL2	-	NULL		0.587	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	G	XM_291064		47045644	+1	no_errors	ENST00000450053	ensembl	human	known	70_37	missense	SNP	0.998	A
NEMF	9147	genome.wustl.edu	37	14	50263033	50263033	+	Intron	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr14:50263033G>A	ENST00000298310.5	-	26	2915				NEMF_ENST00000545773.1_Intron|NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000382135.2_5'Flank|NEMF_ENST00000546046.1_Intron			O60524	NEMF_HUMAN	nuclear export mediator factor						nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						aacatctgttgaCCGGTTGGT	0.408																																																	0																																										SO:0001627	intron_variant	9147			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.2466-371C>T	14.37:g.50263033G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	RNA	SNP	-	NULL	ENST00000298310.5	37	NULL	CCDS9694.1	14																																																																																			NEMF	-	-		0.408	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEMF	HGNC	protein_coding	OTTHUMT00000410798.1	G	NM_004713		50263033	-1	no_errors	ENST00000556925	ensembl	human	known	70_37	rna	SNP	0.001	A
NKAIN2	154215	genome.wustl.edu	37	6	124979592	124979592	+	Intron	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr6:124979592G>A	ENST00000368417.1	+	4	534				NKAIN2_ENST00000368416.1_Silent_p.A178A|NKAIN2_ENST00000545433.1_Intron|NKAIN2_ENST00000546092.1_Intron	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		ATTTCTGTGCGAACTCAGTGC	0.443																																																	0																																										SO:0001627	intron_variant	154215			AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.474+60G>A	6.37:g.124979592G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IYR4|Q8TF67	Silent	SNP	pfam_Na/K-Atpase_Interacting	p.A178	ENST00000368417.1	37	c.534	CCDS34526.1	6																																																																																			NKAIN2	-	NULL		0.443	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN2	HGNC	protein_coding	OTTHUMT00000042057.1	G	NM_001040214		124979592	+1	no_errors	ENST00000368416	ensembl	human	known	70_37	silent	SNP	0.000	A
NKRF	55922	genome.wustl.edu	37	X	118724034	118724034	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:118724034C>T	ENST00000371527.1	-	2	2006	c.1354G>A	c.(1354-1356)Gtg>Atg	p.V452M	NKRF_ENST00000542113.1_Missense_Mutation_p.V467M|NKRF_ENST00000487600.1_Intron|NKRF_ENST00000304449.5_Missense_Mutation_p.V452M	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	452					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						AGCGTGCACACGGGATTTGAA	0.423																																																	0													104.0	97.0	99.0					X																	118724034		2203	4300	6503	SO:0001583	missense	55922			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1354G>A	X.37:g.118724034C>T	ENSP00000360582:p.Val452Met	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_R3H_ss-bd,smart_Ds-RNA-bd,smart_G_patch_dom,smart_R3H_ss-bd,pfscan_G_patch_dom,pfscan_R3H_ss-bd	p.V467M	ENST00000371527.1	37	c.1399	CCDS35375.1	X	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730702	0.48939	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	T;T;T	0.78816	-1.21;-1.21;-1.21	5.49	5.49	0.81192	Double-stranded RNA-binding (1);Double-stranded RNA-binding-like (1);	0.056607	0.64402	D	0.000001	D	0.84511	0.5488	L	0.59436	1.845	0.50313	D	0.999864	D	0.89917	1.0	P	0.59825	0.864	D	0.86135	0.1577	10	0.72032	D	0.01	-12.7434	17.3043	0.87191	0.0:1.0:0.0:0.0	.	452	O15226	NKRF_HUMAN	M	452;452;467	ENSP00000360582:V452M;ENSP00000304803:V452M;ENSP00000442308:V467M	ENSP00000304803:V452M	V	-	1	0	NKRF	118608062	1.000000	0.71417	0.987000	0.45799	0.837000	0.47467	5.711000	0.68400	2.298000	0.77334	0.600000	0.82982	GTG	NKRF	-	smart_Ds-RNA-bd		0.423	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1	C	NM_017544		118724034	-1	no_errors	ENST00000542113	ensembl	human	known	70_37	missense	SNP	0.994	T
NUP85	79902	genome.wustl.edu	37	17	73206024	73206024	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr17:73206024C>G	ENST00000245544.4	+	3	305	c.234C>G	c.(232-234)atC>atG	p.I78M	NUP85_ENST00000449421.2_3'UTR|NUP85_ENST00000579298.1_Missense_Mutation_p.I78M|NUP85_ENST00000541827.1_Missense_Mutation_p.I32M|NUP85_ENST00000447371.2_5'UTR|NUP85_ENST00000579324.1_5'UTR	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	78					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CCCATGGAATCTTTCTGGGCC	0.423																																																	0													88.0	94.0	92.0					17																	73206024		2203	4300	6503	SO:0001583	missense	79902			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.234C>G	17.37:g.73206024C>G	ENSP00000245544:p.Ile78Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup85	p.I78M	ENST00000245544.4	37	c.234	CCDS32730.1	17	.	.	.	.	.	.	.	.	.	.	C	18.33	3.601266	0.66445	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000449421	.	.	.	5.94	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.76442	0.3988	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.72982	0.974;0.979	T	0.78259	-0.2273	9	0.66056	D	0.02	-27.1105	10.8729	0.46894	0.0:0.8925:0.0:0.1075	.	32;78	B4DMQ3;Q9BW27	.;NUP85_HUMAN	M	78;32;32	.	ENSP00000245544:I78M	I	+	3	3	NUP85	70717619	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.432000	0.34936	1.277000	0.44412	0.650000	0.86243	ATC	NUP85	-	pfam_Nucleoporin_Nup85		0.423	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	HGNC	protein_coding	OTTHUMT00000446619.1	C	NM_024844		73206024	+1	no_errors	ENST00000245544	ensembl	human	known	70_37	missense	SNP	1.000	G
NWD1	284434	genome.wustl.edu	37	19	16870140	16870140	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:16870140G>A	ENST00000552788.1	+	5	1874	c.1874G>A	c.(1873-1875)cGc>cAc	p.R625H	NWD1_ENST00000379808.3_Missense_Mutation_p.R625H|NWD1_ENST00000549814.1_Missense_Mutation_p.R625H|NWD1_ENST00000523826.1_Missense_Mutation_p.R419H|NWD1_ENST00000524140.2_Missense_Mutation_p.R625H|NWD1_ENST00000339803.6_Missense_Mutation_p.R490H			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	625	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GAGCTGCTGCGCTTCCCGCCC	0.652																																																	0													60.0	46.0	51.0					19																	16870140		2203	4300	6503	SO:0001583	missense	284434			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1874G>A	19.37:g.16870140G>A	ENSP00000447224:p.Arg625His	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R625H	ENST00000552788.1	37	c.1874		19	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470681	0.84533	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.64991	-0.13;-0.07;-0.13;-0.13;-0.09;-0.09	4.44	4.44	0.53790	.	0.136414	0.47852	D	0.000210	T	0.81465	0.4828	M	0.90198	3.095	0.46774	D	0.999193	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.996	D	0.85180	0.1003	10	0.72032	D	0.01	-25.0446	12.5617	0.56286	0.0:0.0:1.0:0.0	.	625;625;490	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	H	490;625;625;625;419;625;490	ENSP00000428579:R625H;ENSP00000447548:R625H;ENSP00000369136:R625H;ENSP00000428955:R419H;ENSP00000447224:R625H;ENSP00000340159:R490H	ENSP00000340159:R490H	R	+	2	0	NWD1	16731140	1.000000	0.71417	0.934000	0.37439	0.791000	0.44710	6.038000	0.70964	2.044000	0.60594	0.542000	0.68232	CGC	NWD1	-	NULL		0.652	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	G	NM_001007525		16870140	+1	no_errors	ENST00000379808	ensembl	human	known	70_37	missense	SNP	0.976	A
OR5G5P	81191	genome.wustl.edu	37	11	56569578	56569578	+	RNA	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr11:56569578C>T	ENST00000378368.2	-	0	692									olfactory receptor, family 5, subfamily G, member 5 pseudogene																		CTTTGCGTCTCGCGTCAGCAG	0.478																																																	0																																												81191					11q12.1	2014-03-20			ENSG00000205025	ENSG00000205025		"""GPCR / Class A : Olfactory receptors"""	15289	pseudogene	pseudogene							Standard	NG_004191		Approved				OTTHUMG00000154297		11.37:g.56569578C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000378368.2	37	NULL		11																																																																																			OR5G5P	-	-		0.478	OR5G5P-003	KNOWN	basic	processed_transcript	OR5G5P	HGNC	pseudogene	OTTHUMT00000392444.1	C			56569578	-1	no_errors	ENST00000378368	ensembl	human	known	70_37	rna	SNP	0.000	T
OVCH1	341350	genome.wustl.edu	37	12	29649490	29649490	+	Splice_Site	SNP	T	T	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:29649490T>C	ENST00000318184.5	-	2	181	c.182A>G	c.(181-183)cAg>cGg	p.Q61R		NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	61	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TGCACTGACCTGCCATGGATG	0.393																																																	0													87.0	84.0	85.0					12																	29649490		1884	4098	5982	SO:0001630	splice_region_variant	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.183+1A>G	12.37:g.29649490T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,pfscan_CUB,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q61R	ENST00000318184.5	37	c.182		12	.	.	.	.	.	.	.	.	.	.	T	16.45	3.125370	0.56721	.	.	ENSG00000187950	ENST00000318184	D	0.90620	-2.7	2.89	2.89	0.33648	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.93390	0.7892	M	0.87547	2.89	0.20563	N	0.999881	P	0.52170	0.951	P	0.54270	0.747	D	0.85954	0.1466	9	0.66056	D	0.02	.	7.6339	0.28255	0.0:0.0:0.0:1.0	.	61	Q7RTY7	OVCH1_HUMAN	R	61	ENSP00000326708:Q61R	ENSP00000326708:Q61R	Q	-	2	0	OVCH1	29540757	0.805000	0.28982	0.912000	0.35992	0.235000	0.25334	0.424000	0.21330	1.577000	0.49804	0.459000	0.35465	CAG	OVCH1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.393	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	T	NM_183378	Missense_Mutation	29649490	-1	no_errors	ENST00000318184	ensembl	human	known	70_37	missense	SNP	0.927	C
PARP16	54956	genome.wustl.edu	37	15	65558985	65558985	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr15:65558985C>A	ENST00000261888.6	-	3	879	c.434G>T	c.(433-435)cGa>cTa	p.R145L	PARP16_ENST00000444347.2_Intron|PARP16_ENST00000558873.1_5'UTR	NM_017851.4	NP_060321.3	Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	145	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell death (GO:0060548)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum tubular network (GO:0071782)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	kinase binding (GO:0019900)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|protein serine/threonine kinase activator activity (GO:0043539)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						GATTAGGTCTCGTTCTCCTTT	0.493																																					NSCLC(50;885 1163 13509 21242 41978)												0													161.0	143.0	149.0					15																	65558985		2201	4299	6500	SO:0001583	missense	54956			AK000516	CCDS10204.1	15q22.2	2010-02-16	2004-08-25	2004-08-25	ENSG00000138617	ENSG00000138617		"""Poly (ADP-ribose) polymerases"""	26040	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 30"""	C15orf30		15273990	Standard	NM_017851		Approved	FLJ20509, FLJ25281, pART15	uc002aoq.3	Q8N5Y8	OTTHUMG00000133138	ENST00000261888.6:c.434G>T	15.37:g.65558985C>A	ENSP00000261888:p.Arg145Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PK64|Q9NX03	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.R145L	ENST00000261888.6	37	c.434	CCDS10204.1	15	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612832	0.46631	.	.	ENSG00000138617	ENST00000261888	T	0.15372	2.43	5.58	5.58	0.84498	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.105242	0.64402	D	0.000008	T	0.22166	0.0534	M	0.66939	2.045	0.80722	D	1	P;P	0.52463	0.942;0.953	B;P	0.45138	0.34;0.471	T	0.03483	-1.1032	10	0.14252	T	0.57	-7.414	13.8848	0.63702	0.0:0.9246:0.0:0.0754	.	145;145	Q8N5Y8-3;Q8N5Y8	.;PAR16_HUMAN	L	145	ENSP00000261888:R145L	ENSP00000261888:R145L	R	-	2	0	PARP16	63346038	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.575000	0.60908	2.630000	0.89119	0.462000	0.41574	CGA	PARP16	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom		0.493	PARP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP16	HGNC	protein_coding	OTTHUMT00000256827.2	C	NM_017851		65558985	-1	no_errors	ENST00000261888	ensembl	human	known	70_37	missense	SNP	1.000	A
PCDHB13	56123	genome.wustl.edu	37	5	140595503	140595503	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr5:140595503C>T	ENST00000341948.4	+	1	1995	c.1808C>T	c.(1807-1809)tCg>tTg	p.S603L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	603	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCTGGCTGTCGTACCAGCTG	0.731																																																	0													6.0	8.0	8.0					5																	140595503		1711	3407	5118	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1808C>T	5.37:g.140595503C>T	ENSP00000345491:p.Ser603Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9V6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S603L	ENST00000341948.4	37	c.1808	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	-	19.46	3.831557	0.71258	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.54071	0.59	3.3	3.3	0.37823	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.73202	0.3557	M	0.82517	2.595	0.37936	D	0.93216	D	0.89917	1.0	D	0.77557	0.99	T	0.81602	-0.0858	9	0.87932	D	0	.	14.5914	0.68368	0.0:1.0:0.0:0.0	.	603	Q9Y5F0	PCDBD_HUMAN	L	603;603;549	ENSP00000345491:S603L	ENSP00000345491:S603L	S	+	2	0	PCDHB13	140575687	0.991000	0.36638	0.990000	0.47175	0.644000	0.38419	4.775000	0.62346	1.576000	0.49790	0.298000	0.19748	TCG	PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.731	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	C	NM_018933		140595503	+1	no_errors	ENST00000341948	ensembl	human	known	70_37	missense	SNP	1.000	T
PCDHGB3	56102	genome.wustl.edu	37	5	140751844	140751844	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr5:140751844C>T	ENST00000576222.1	+	1	2014	c.1883C>T	c.(1882-1884)aCg>aTg	p.T628M	PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	628	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTGCGCACGGCGCGTACC	0.677																																																	0													38.0	44.0	42.0					5																	140751844		2175	4263	6438	SO:0001583	missense	56102			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1883C>T	5.37:g.140751844C>T	ENSP00000461862:p.Thr628Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T628M	ENST00000576222.1	37	c.1883	CCDS58980.1	5																																																																																			PCDHGB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.677	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	C	NM_018924		140751844	+1	no_errors	ENST00000576222	ensembl	human	known	70_37	missense	SNP	0.490	T
PMS2CL	441194	genome.wustl.edu	37	7	6777361	6777361	+	RNA	SNP	G	G	A	rs377436024		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr7:6777361G>A	ENST00000486256.1	+	0	1488					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene																		TACTCAGAACGTGTCAGCTTC	0.358																																																	0																																												441194			BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6777361G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DK88|Q764P1	RNA	SNP	-	NULL	ENST00000486256.1	37	NULL		7																																																																																			PMS2CL	-	-		0.358	PMS2CL-002	KNOWN	basic	processed_transcript	PMS2CL	HGNC	pseudogene	OTTHUMT00000324193.1	G	NR_002217		6777361	+1	no_errors	ENST00000431453	ensembl	human	known	70_37	rna	SNP	0.000	A
POLR1C	9533	genome.wustl.edu	37	6	43488402	43488402	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr6:43488402G>T	ENST00000372389.3	+	7	783	c.695G>T	c.(694-696)aGt>aTt	p.S232I	POLR1C_ENST00000304004.3_Missense_Mutation_p.S232I|POLR1C_ENST00000372344.2_Intron|RP3-337H4.9_ENST00000607571.1_RNA	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	232					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GCAACAGCCAGTTACAGGCTC	0.537																																																	0													96.0	100.0	98.0					6																	43488402		2203	4300	6503	SO:0001583	missense	9533			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.695G>T	6.37:g.43488402G>T	ENSP00000361465:p.Ser232Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O75395|Q5JTE3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_insert,pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like,superfamily_DNA-dir_RNA_pol_insert,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3	p.S232I	ENST00000372389.3	37	c.695	CCDS4901.1	6	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968707	0.92855	.	.	ENSG00000171453	ENST00000372389;ENST00000304004	D;T	0.83992	-1.79;-0.8	5.14	5.14	0.70334	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.000000	0.85682	D	0.000000	D	0.91737	0.7387	M	0.89840	3.065	0.80722	D	1	D;D	0.60160	0.984;0.987	P;D	0.70487	0.904;0.969	D	0.91700	0.5373	10	0.46703	T	0.11	-16.7909	18.9618	0.92680	0.0:0.0:1.0:0.0	.	232;232	O15160-2;O15160	.;RPAC1_HUMAN	I	232	ENSP00000361465:S232I;ENSP00000307212:S232I	ENSP00000307212:S232I	S	+	2	0	POLR1C	43596380	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.549000	0.98106	2.552000	0.86080	0.591000	0.81541	AGT	POLR1C	-	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3		0.537	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1C	HGNC	protein_coding	OTTHUMT00000040652.3	G	NM_004875		43488402	+1	no_errors	ENST00000372389	ensembl	human	known	70_37	missense	SNP	1.000	T
PRAM1	84106	genome.wustl.edu	37	19	8563824	8563824	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:8563824G>T	ENST00000423345.4	-	2	1388	c.868C>A	c.(868-870)Ctt>Att	p.L290I	PRAM1_ENST00000255612.3_Missense_Mutation_p.L290I			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	338	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						AGGTCCCCAAGCTCAGGCTGC	0.647																																																	0													28.0	31.0	30.0					19																	8563824		2192	4297	6489	SO:0001583	missense	84106			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.868C>A	19.37:g.8563824G>T	ENSP00000408342:p.Leu290Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6W7	Missense_Mutation	SNP	superfamily_SH3_domain	p.L290I	ENST00000423345.4	37	c.868	CCDS45954.2	19	.	.	.	.	.	.	.	.	.	.	G	7.309	0.614623	0.14129	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.14391	2.51;2.51	4.12	-2.13	0.07144	.	1.312210	0.05361	N	0.533604	T	0.07324	0.0185	N	0.14661	0.345	0.09310	N	1	B;B	0.30236	0.228;0.274	B;B	0.30179	0.083;0.112	T	0.38520	-0.9657	10	0.20046	T	0.44	.	5.8605	0.18745	0.4483:0.147:0.4047:0.0	.	290;338	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	I	290	ENSP00000255612:L290I;ENSP00000408342:L290I	ENSP00000255612:L290I	L	-	1	0	PRAM1	8469824	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.653000	0.05360	-0.501000	0.06605	-1.099000	0.02127	CTT	PRAM1	-	NULL		0.647	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	HGNC	protein_coding	OTTHUMT00000397040.3	G	NM_032152		8563824	-1	no_errors	ENST00000423345	ensembl	human	known	70_37	missense	SNP	0.000	T
PSG6	5675	genome.wustl.edu	37	19	43411950	43411950	+	Missense_Mutation	SNP	C	C	G	rs371665225		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:43411950C>G	ENST00000292125.2	-	4	807	c.763G>C	c.(763-765)Gat>Cat	p.D255H	PSG6_ENST00000187910.2_Missense_Mutation_p.D255H|PSG6_ENST00000402603.4_Intron	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	255	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GCTAACACATCCTTCTTCTCC	0.502																																																	0													304.0	286.0	292.0					19																	43411950		2201	4298	6499	SO:0001583	missense	5675				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.763G>C	19.37:g.43411950C>G	ENSP00000292125:p.Asp255His	Somatic		WXS	Illumina HiSeq	Phase_IV	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D255H	ENST00000292125.2	37	c.763	CCDS12613.1	19	.	.	.	.	.	.	.	.	.	.	N	11.00	1.508978	0.27036	.	.	ENSG00000170848	ENST00000187910;ENST00000292125	T;T	0.10668	2.85;2.85	1.42	1.42	0.22433	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38558	0.1045	M	0.94142	3.5	0.19300	N	0.999977	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.992	T	0.09271	-1.0682	9	0.72032	D	0.01	.	6.2927	0.21069	0.0:1.0:0.0:0.0	.	255;255	Q00889;Q00889-2	PSG6_HUMAN;.	H	255	ENSP00000187910:D255H;ENSP00000292125:D255H	ENSP00000187910:D255H	D	-	1	0	PSG6	48103790	0.000000	0.05858	0.002000	0.10522	0.037000	0.13140	-0.309000	0.08145	0.792000	0.33850	0.134000	0.15878	GAT	PSG6	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.502	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	C	NM_002782		43411950	-1	no_errors	ENST00000292125	ensembl	human	known	70_37	missense	SNP	0.006	G
PTP4A2	8073	genome.wustl.edu	37	1	32384717	32384717	+	5'UTR	DEL	A	A	-	rs532230753|rs370536901	byFrequency	TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:32384717delA	ENST00000602725.1	-	0	367				PTP4A2_ENST00000344035.6_5'UTR|PTP4A2_ENST00000470404.1_5'UTR|PTP4A2_ENST00000356536.3_5'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000457805.2_5'UTR|PTP4A2_ENST00000526960.1_5'Flank			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GGGGAAAGTGAAAAAAAAAAA	0.368													|||unknown(HR)	282	0.0563099	0.1762	0.013	5008	,	,		21482	0.0079		0.0139	False		,,,				2504	0.0184																0													35.0	38.0	37.0					1																	32384717		2203	4300	6503	SO:0001623	5_prime_UTR_variant	8073			L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-51T>-	1.37:g.32384717delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	DEL	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																			PTP4A2	-	-		0.368	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding	OTTHUMT00000468092.1	A	NM_080391		32384717	-1	no_errors	ENST00000532289	ensembl	human	putative	70_37	rna	DEL	0.000	-
RAB5A	5868	genome.wustl.edu	37	3	20017662	20017662	+	Splice_Site	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:20017662G>A	ENST00000273047.4	+	4	974		c.e4+1		RAB5A_ENST00000422242.1_Splice_Site	NM_004162.4	NP_004153.2	P20339	RAB5A_HUMAN	RAB5A, member RAS oncogene family						blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|nervous system development (GO:0007399)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of endosome size (GO:0051036)|regulation of filopodium assembly (GO:0051489)|regulation of synaptic vesicle exocytosis (GO:2000300)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoplasmic side of early endosome membrane (GO:0098559)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|somatodendritic compartment (GO:0036477)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			lung(1)|urinary_tract(1)	2						AGATTTCCAGGTATGTTAAAT	0.348																																																	0													50.0	48.0	49.0					3																	20017662		2203	4300	6503	SO:0001630	splice_region_variant	5868				CCDS2633.1	3p24-p22	2008-07-18			ENSG00000144566	ENSG00000144566		"""RAB, member RAS oncogene"""	9783	protein-coding gene	gene with protein product	"""RAS-associated protein RAB5A"""	179512		RAB5		1999336	Standard	NM_004162		Approved		uc003cbn.3	P20339	OTTHUMG00000129889	ENST00000273047.4:c.438+1G>A	3.37:g.20017662G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJA5|Q6FI44	Splice_Site	SNP	-	e3+1	ENST00000273047.4	37	c.438+1	CCDS2633.1	3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991686	0.74703	.	.	ENSG00000144566	ENST00000273047;ENST00000422242	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2397	0.89963	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAB5A	19992666	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.749000	0.98871	2.379000	0.81126	0.563000	0.77884	.	RAB5A	-	-		0.348	RAB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB5A	HGNC	protein_coding	OTTHUMT00000252137.2	G	NM_004162	Intron	20017662	+1	no_errors	ENST00000273047	ensembl	human	known	70_37	splice_site	SNP	1.000	A
RNF39	80352	genome.wustl.edu	37	6	30043421	30043421	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr6:30043421G>A	ENST00000244360.6	-	1	243	c.146C>T	c.(145-147)gCg>gTg	p.A49V	RNF39_ENST00000376751.3_Missense_Mutation_p.A49V	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	49						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CTTCGAGCGCGCAGATGGCGG	0.672																																					NSCLC(8;188 360 1520 20207 31481)												0													25.0	27.0	26.0					6																	30043421		2201	4296	6497	SO:0001583	missense	80352			AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.146C>T	6.37:g.30043421G>A	ENSP00000244360:p.Ala49Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.A49V	ENST00000244360.6	37	c.146	CCDS4673.1	6	.	.	.	.	.	.	.	.	.	.	g	18.49	3.635272	0.67130	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.71103	-0.06;-0.54	3.79	0.627	0.17675	.	.	.	.	.	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B;B	0.31318	0.013;0.319	B;B	0.18561	0.005;0.022	T	0.07616	-1.0763	9	0.35671	T	0.21	-2.6255	5.6728	0.17731	0.1038:0.0:0.454:0.4422	.	49;49	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	V	49	ENSP00000365942:A49V;ENSP00000244360:A49V	ENSP00000244360:A49V	A	-	2	0	RNF39	30151400	0.003000	0.15002	0.014000	0.15608	0.861000	0.49209	0.783000	0.26802	0.216000	0.20781	0.436000	0.28706	GCG	RNF39	-	NULL		0.672	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF39	HGNC	protein_coding	OTTHUMT00000076625.3	G	NM_170769		30043421	-1	no_errors	ENST00000244360	ensembl	human	known	70_37	missense	SNP	0.020	A
RPS6KA3	6197	genome.wustl.edu	37	X	20179862	20179862	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chrX:20179862T>A	ENST00000379565.3	-	20	2066	c.1859A>T	c.(1858-1860)aAt>aTt	p.N620I	RPS6KA3_ENST00000379548.4_Missense_Mutation_p.N590I|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.N591I|RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.N592I	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	620	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ATCAGGACCATTTGCAAATGG	0.318																																																	0													107.0	83.0	91.0					X																	20179862		2203	4300	6503	SO:0001583	missense	6197			U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1859A>T	X.37:g.20179862T>A	ENSP00000368884:p.Asn620Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N620I	ENST00000379565.3	37	c.1859	CCDS14197.1	X	.	.	.	.	.	.	.	.	.	.	T	16.29	3.080433	0.55753	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	L	0.31845	0.965	0.80722	D	1	B;B;D;B	0.69078	0.129;0.049;0.997;0.216	B;B;D;B	0.76071	0.191;0.077;0.987;0.191	T	0.74315	-0.3705	10	0.44086	T	0.13	.	15.2089	0.73202	0.0:0.0:0.0:1.0	.	591;590;592;620	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	I	620;592;590;591	ENSP00000368884:N620I;ENSP00000440220:N592I;ENSP00000368865:N590I;ENSP00000444837:N591I	ENSP00000368865:N590I	N	-	2	0	RPS6KA3	20089783	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	1.975000	0.57531	0.417000	0.27973	AAT	RPS6KA3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.318	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS6KA3	HGNC	protein_coding	OTTHUMT00000056011.3	T	NM_004586		20179862	-1	no_errors	ENST00000379565	ensembl	human	known	70_37	missense	SNP	1.000	A
RRN3P2	653390	genome.wustl.edu	37	16	29088021	29088021	+	RNA	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr16:29088021C>T	ENST00000564580.1	+	0	191							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		TTCAATTCTCCCCCAAGAAAA	0.348																																																	0																																												653390					16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29088021C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000564580.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	c	9.736	1.163569	0.21538	.	.	ENSG00000103472	ENST00000415221;ENST00000427965;ENST00000219758	.	.	.	1.58	1.58	0.23477	.	0.071577	0.56097	U	0.000032	T	0.55497	0.1924	.	.	.	.	.	.	.	.	.	.	.	.	T	0.68085	-0.5502	5	0.62326	D	0.03	.	9.1547	0.36985	0.0:1.0:0.0:0.0	.	.	.	.	L	45	.	ENSP00000219758:P45L	P	+	2	0	AC009093.1	28995522	0.994000	0.37717	0.972000	0.41901	0.720000	0.41350	4.579000	0.60936	1.196000	0.43129	0.184000	0.17185	CCC	RRN3P2	-	-		0.348	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	HGNC	pseudogene	OTTHUMT00000433243.1	C	NR_003369		29088021	+1	no_errors	ENST00000427965	ensembl	human	known	70_37	rna	SNP	0.984	T
SERPINA11	256394	genome.wustl.edu	37	14	94914645	94914645	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr14:94914645C>T	ENST00000334708.3	-	2	531	c.467G>A	c.(466-468)aGc>aAc	p.S156N	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	156					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		CTCCTTGATGCTGTCCAAATA	0.468																																																	0													160.0	169.0	166.0					14																	94914645		2203	4300	6503	SO:0001583	missense	256394			BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.467G>A	14.37:g.94914645C>T	ENSP00000335024:p.Ser156Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RV07	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S156N	ENST00000334708.3	37	c.467	CCDS32149.1	14	.	.	.	.	.	.	.	.	.	.	C	4.326	0.059797	0.08339	.	.	ENSG00000186910	ENST00000334708	D	0.84298	-1.83	5.04	-0.869	0.10649	Serpin domain (3);	0.775582	0.12121	N	0.497688	T	0.65565	0.2703	N	0.12637	0.245	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.50346	-0.8839	10	0.36615	T	0.2	.	1.4694	0.02412	0.1247:0.2029:0.2939:0.3785	.	156	Q86U17	SPA11_HUMAN	N	156	ENSP00000335024:S156N	ENSP00000335024:S156N	S	-	2	0	SERPINA11	93984398	0.000000	0.05858	0.003000	0.11579	0.549000	0.35272	-0.011000	0.12721	-0.411000	0.07530	-0.150000	0.13652	AGC	SERPINA11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.468	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA11	HGNC	protein_coding	OTTHUMT00000413091.1	C	NM_001080451		94914645	-1	no_errors	ENST00000334708	ensembl	human	known	70_37	missense	SNP	0.028	T
SGIP1	84251	genome.wustl.edu	37	1	66999882	66999882	+	5'Flank	SNP	C	C	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:66999882C>A	ENST00000371037.4	+	0	0				SGIP1_ENST00000237247.6_Intron|SGIP1_ENST00000371039.1_Intron|SGIP1_ENST00000371035.3_De_novo_Start_InFrame|SGIP1_ENST00000371036.3_De_novo_Start_InFrame|SGIP1_ENST00000468286.1_3'UTR	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1						endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						CAGCAGCATCCATGGCCTGTC	0.567																																																	0																																										SO:0001631	upstream_gene_variant	84251			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161		1.37:g.66999882C>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	RNA	SNP	-	NULL	ENST00000371037.4	37	NULL	CCDS30744.1	1																																																																																			SGIP1	-	-		0.567	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	C	NM_032291		66999882	+1	no_errors	ENST00000468286	ensembl	human	known	70_37	rna	SNP	1.000	A
SLC9B2	133308	genome.wustl.edu	37	4	103987647	103987647	+	Silent	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr4:103987647C>T	ENST00000394785.3	-	3	739	c.108G>A	c.(106-108)aaG>aaA	p.K36K	SLC9B2_ENST00000339611.4_Silent_p.K36K|SLC9B2_ENST00000505838.1_5'UTR|SLC9B2_ENST00000503103.1_Silent_p.K36K|SLC9B2_ENST00000362026.3_Silent_p.K36K|SLC9B2_ENST00000503230.1_Silent_p.K36K	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	36					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)										TACCTTTGAGCTTCATAACTG	0.318																																																	0													128.0	118.0	121.0					4																	103987647		2203	4299	6502	SO:0001819	synonymous_variant	133308			AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.108G>A	4.37:g.103987647C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME52|Q6ZMD8|Q96D95	Silent	SNP	pfam_Cation/H_exchanger	p.K36	ENST00000394785.3	37	c.108	CCDS3662.1	4																																																																																			SLC9B2	-	NULL		0.318	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9B2	HGNC	protein_coding	OTTHUMT00000253805.1	C	NM_178833		103987647	-1	no_errors	ENST00000362026	ensembl	human	known	70_37	silent	SNP	0.000	T
RPSA	3921	genome.wustl.edu	37	3	39449940	39449940	+	Intron	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:39449940G>A	ENST00000301821.6	+	3	242				SNORA62_ENST00000365493.1_RNA|RPSA_ENST00000443003.1_Intron|SNORA6_ENST00000384033.1_RNA	NM_001012321.1|NM_002295.4	NP_001012321.1|NP_002286.2			ribosomal protein SA											endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		TCTGAGTGTCGGAAGTGTGCT	0.458																																																	0													125.0	116.0	119.0					3																	39449940		876	1991	2867	SO:0001627	intron_variant	574040			S37431	CCDS2686.1	3p21.3	2014-09-17	2002-08-29	2005-02-11	ENSG00000168028	ENSG00000168028			6502	protein-coding gene	gene with protein product		150370	"""laminin receptor 1 (67kD, ribosomal protein SA)"""	LAMR1		1534510, 8760291	Standard	NM_001012321		Approved	LRP, 37LRP, p40, SA	uc003cjp.3	P08865	OTTHUMG00000131296	ENST00000301821.6:c.134-157G>A	3.37:g.39449940G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000301821.6	37	NULL	CCDS2686.1	3																																																																																			SNORA6	-	-		0.458	RPSA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SNORA6	HGNC	protein_coding	OTTHUMT00000254064.3	G	NM_002295		39449940	+1	no_errors	ENST00000384033	ensembl	human	known	70_37	rna	SNP	1.000	A
SPRR2D	6703	genome.wustl.edu	37	1	153012728	153012728	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:153012728C>G	ENST00000368757.1	-	2	375	c.95G>C	c.(94-96)tGc>tCc	p.C32S	SPRR2D_ENST00000368758.3_Missense_Mutation_p.C32S|SPRR2D_ENST00000368756.1_Missense_Mutation_p.C32S|SPRR2D_ENST00000360379.3_Missense_Mutation_p.C32S			P22532	SPR2D_HUMAN	small proline-rich protein 2D	32	3 X 9 AA tandem repeats of P-K-C-P-[EQ]- P-C-P-[PS].			C -> S (in Ref. 1; AAA36640). {ECO:0000305}.	epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				endometrium(1)|skin(1)	2	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGCTCAGGGCACTTCGGGGG	0.617																																																	0													118.0	102.0	107.0					1																	153012728		2203	4297	6500	SO:0001583	missense	6703			AF333954	CCDS30864.1	1q21-q22	2008-02-05			ENSG00000163216	ENSG00000163216			11264	protein-coding gene	gene with protein product						8325635	Standard	NM_006945		Approved		uc001fbb.2	P22532	OTTHUMG00000014396	ENST00000368757.1:c.95G>C	1.37:g.153012728C>G	ENSP00000357746:p.Cys32Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QN03|A8K5K2|D3DV33|Q5T523|Q96RM3	Missense_Mutation	SNP	NULL	p.C32S	ENST00000368757.1	37	c.95	CCDS30864.1	1	.	.	.	.	.	.	.	.	.	.	C	0.051	-1.251348	0.01469	.	.	ENSG00000163216	ENST00000360379;ENST00000368758;ENST00000368757;ENST00000368756	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	3.82	1.8	0.24995	.	0.482456	0.15948	N	0.236852	T	0.16514	0.0397	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.26677	-1.0096	9	0.87932	D	0	.	6.5453	0.22402	0.2079:0.5907:0.2014:0.0	.	32	P22532	SPR2D_HUMAN	S	32	ENSP00000353542:C32S;ENSP00000357747:C32S;ENSP00000357746:C32S;ENSP00000357745:C32S	ENSP00000353542:C32S	C	-	2	0	SPRR2D	151279352	0.916000	0.31088	0.002000	0.10522	0.002000	0.02628	1.419000	0.34793	0.186000	0.20125	-0.538000	0.04264	TGC	SPRR2D	-	NULL		0.617	SPRR2D-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2D	HGNC	protein_coding	OTTHUMT00000040051.1	C			153012728	-1	no_errors	ENST00000360379	ensembl	human	known	70_37	missense	SNP	0.008	G
SYT3	84258	genome.wustl.edu	37	19	51128817	51128817	+	Silent	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr19:51128817G>T	ENST00000338916.4	-	6	2040	c.1407C>A	c.(1405-1407)ccC>ccA	p.P469P	SYT3_ENST00000544769.1_Silent_p.P469P|SYT3_ENST00000600079.1_Silent_p.P469P|SYT3_ENST00000593901.1_Silent_p.P469P	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	469	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CCTTCACGTAGGGGTCTGGGA	0.597																																																	0													43.0	41.0	42.0					19																	51128817		2203	4300	6503	SO:0001819	synonymous_variant	84258			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1407C>A	19.37:g.51128817G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5Z1|Q8N640	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.P469	ENST00000338916.4	37	c.1407	CCDS12798.1	19																																																																																			SYT3	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.597	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	G	NM_032298		51128817	-1	no_errors	ENST00000338916	ensembl	human	known	70_37	silent	SNP	1.000	T
TAS2R19	259294	genome.wustl.edu	37	12	11174729	11174729	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:11174729T>A	ENST00000390673.2	-	1	490	c.442A>T	c.(442-444)Acc>Tcc	p.T148S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176888.1	NP_795369.1	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	148					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TCATCCATGGTTATCACAGCA	0.388																																																	0													119.0	108.0	112.0					12																	11174729		2203	4300	6503	SO:0001583	missense	259294			AX097730, AF494234	CCDS8640.1	12p13.2	2012-08-22			ENSG00000212124	ENSG00000212124		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19108	protein-coding gene	gene with protein product		613961	"""taste receptor, type 2, member 48"", ""taste receptor, type 2, member 23"""	TAS2R48, TAS2R23			Standard	NM_176888		Approved	T2R19, T2R23	uc010shj.2	P59542	OTTHUMG00000162687	ENST00000390673.2:c.442A>T	12.37:g.11174729T>A	ENSP00000375091:p.Thr148Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIJ4|Q645X8	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.T148S	ENST00000390673.2	37	c.442	CCDS8640.1	12	.	.	.	.	.	.	.	.	.	.	T	6.485	0.457677	0.12342	.	.	ENSG00000212124	ENST00000390673	T	0.00745	5.75	2.14	-4.29	0.03721	.	2.045250	0.02689	N	0.110475	T	0.00524	0.0017	N	0.05031	-0.125	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.48043	-0.9069	10	0.39692	T	0.17	.	3.8246	0.08849	0.5642:0.0:0.1895:0.2463	.	148	P59542	T2R19_HUMAN	S	148	ENSP00000375091:T148S	ENSP00000375091:T148S	T	-	1	0	TAS2R19	11065996	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.625000	0.05534	-1.044000	0.03254	0.333000	0.21579	ACC	TAS2R19	-	pfam_TAS2_rcpt		0.388	TAS2R19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R19	HGNC	protein_coding	OTTHUMT00000370080.1	T	NM_176888		11174729	-1	no_errors	ENST00000390673	ensembl	human	known	70_37	missense	SNP	0.000	A
TP73	7161	genome.wustl.edu	37	1	3639972	3639973	+	Frame_Shift_Ins	INS	-	-	GTAT			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:3639972_3639973insGTAT	ENST00000378295.4	+	6	826_827	c.671_672insGTAT	c.(670-675)cagtatfs	p.-226fs	TP73_ENST00000378288.4_Frame_Shift_Ins_p.-177fs|TP73_ENST00000357733.3_Frame_Shift_Ins_p.-226fs|TP73_ENST00000378285.1_Frame_Shift_Ins_p.-177fs|TP73_ENST00000604479.1_Frame_Shift_Ins_p.-226fs|TP73_ENST00000378280.1_Frame_Shift_Ins_p.-177fs|TP73_ENST00000603362.1_Frame_Shift_Ins_p.-226fs|TP73_ENST00000346387.4_Frame_Shift_Ins_p.-226fs|TP73_ENST00000604074.1_Frame_Shift_Ins_p.-226fs|TP73_ENST00000378290.4_Frame_Shift_Ins_p.-155fs|TP73_ENST00000354437.4_Frame_Shift_Ins_p.-226fs	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73						activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		AATCTCTCGCAGTATGTGGATG	0.629																																																	0																																										SO:0001589	frameshift_variant	7161			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.672_675dupGTAT	1.37:g.3639973_3639976dupGTAT	ENSP00000367545:p.Val226fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Frame_Shift_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.D227fs	ENST00000378295.4	37	c.671_672	CCDS49.1	1																																																																																			TP73	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.629	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP73	HGNC	protein_coding	OTTHUMT00000001468.4	-	NM_005427		3639973	+1	no_errors	ENST00000378295	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	GTAT
TCHHL1	126637	genome.wustl.edu	37	1	152058923	152058923	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:152058923G>A	ENST00000368806.1	-	3	1299	c.1235C>T	c.(1234-1236)aCt>aTt	p.T412I		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	412							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TAGTGGCCGAGTTTTTCTGTC	0.448																																																	0													134.0	131.0	132.0					1																	152058923		2203	4300	6503	SO:0001583	missense	126637				CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.1235C>T	1.37:g.152058923G>A	ENSP00000357796:p.Thr412Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.T412I	ENST00000368806.1	37	c.1235	CCDS30857.1	1	.	.	.	.	.	.	.	.	.	.	.	11.56	1.675184	0.29783	.	.	ENSG00000182898	ENST00000368806	T	0.26518	1.73	5.59	-2.6	0.06190	.	0.782790	0.10843	N	0.628045	T	0.03390	0.0098	N	0.16656	0.425	0.09310	N	1	B	0.21821	0.061	B	0.15870	0.014	T	0.39057	-0.9632	10	0.39692	T	0.17	0.0124	1.3378	0.02148	0.1839:0.1273:0.2381:0.4507	.	412	Q5QJ38	TCHL1_HUMAN	I	412	ENSP00000357796:T412I	ENSP00000357796:T412I	T	-	2	0	TCHHL1	150325547	0.000000	0.05858	0.000000	0.03702	0.223000	0.24884	-0.271000	0.08572	-0.245000	0.09625	-0.188000	0.12872	ACT	TCHHL1	-	NULL		0.448	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHHL1	HGNC	protein_coding	OTTHUMT00000036638.2	G	XM_060104		152058923	-1	no_errors	ENST00000368806	ensembl	human	known	70_37	missense	SNP	0.000	A
TRIAP1	51499	genome.wustl.edu	37	12	120883974	120883974	+	Intron	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:120883974G>T	ENST00000546954.1	-	1	187				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGATGAGTGTGGTGGGACACA	0.612																																																	0																																										SO:0001627	intron_variant	51499				CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.147+54C>A	12.37:g.120883974G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4Z7|Q5RKS5|Q6LCA7	RNA	SNP	-	NULL	ENST00000546954.1	37	NULL	CCDS9198.1	12																																																																																			TRIAP1	-	-		0.612	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	HGNC	protein_coding	OTTHUMT00000108980.3	G	NM_016399		120883974	-1	no_errors	ENST00000302432	ensembl	human	putative	70_37	rna	SNP	0.003	T
TRIP11	9321	genome.wustl.edu	37	14	92488177	92488177	+	Splice_Site	SNP	T	T	C			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr14:92488177T>C	ENST00000267622.4	-	4	686		c.e4-2			NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11						protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GATTTCTACCTATATATTTAT	0.348			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													48.0	52.0	51.0					14																	92488177		2201	4300	6501	SO:0001630	splice_region_variant	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.313-2A>G	14.37:g.92488177T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUT2|O14689|O15154|O95949	Splice_Site	SNP	-	e4-2	ENST00000267622.4	37	c.313-2	CCDS9899.1	14	.	.	.	.	.	.	.	.	.	.	t	19.75	3.886228	0.72410	.	.	ENSG00000100815	ENST00000267622	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6747	0.68969	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIP11	91557930	1.000000	0.71417	0.991000	0.47740	0.895000	0.52256	7.538000	0.82048	1.848000	0.53677	0.533000	0.62120	.	TRIP11	-	-		0.348	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	T		Intron	92488177	-1	no_errors	ENST00000267622	ensembl	human	known	70_37	splice_site	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179469753	179469753	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr2:179469753G>T	ENST00000591111.1	-	230	49452	c.49228C>A	c.(49228-49230)Ctt>Att	p.L16410I	TTN_ENST00000342992.6_Missense_Mutation_p.L15483I|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L9111I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.L8986I|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L9178I|TTN_ENST00000589042.1_Missense_Mutation_p.L18051I|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16410	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGAGCCAAGGCGATTGGAA	0.453																																																	0													280.0	259.0	265.0					2																	179469753		1947	4138	6085	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49228C>A	2.37:g.179469753G>T	ENSP00000465570:p.Leu16410Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L15483I	ENST00000591111.1	37	c.46447		2	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804210	0.31869	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.95	5.07	0.68467	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60392	0.2265	L	0.31207	0.915	0.37237	D	0.90595	P;P;P;P	0.49559	0.925;0.925;0.925;0.925	P;P;P;P	0.45071	0.468;0.468;0.468;0.468	T	0.70260	-0.4921	9	0.87932	D	0	.	15.0667	0.72002	0.0678:0.0:0.9322:0.0	.	8986;9111;9178;16410	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	15483;8986;9178;9111;8986	ENSP00000343764:L15483I;ENSP00000434586:L8986I;ENSP00000340554:L9178I;ENSP00000352154:L9111I	ENSP00000340554:L9178I	L	-	1	0	TTN	179177998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.385000	0.59613	1.534000	0.49203	0.563000	0.77884	CTT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179469753	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179582536	179582536	+	Splice_Site	SNP	C	C	T	rs397517514		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr2:179582536C>T	ENST00000591111.1	-	85	24338	c.24114G>A	c.(24112-24114)gcG>gcA	p.A8038A	TTN_ENST00000342992.6_Splice_Site_p.A7111A|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Splice_Site_p.A8355A			Q8WZ42	TITIN_HUMAN	titin	12230				A -> E (in Ref. 3; CAD12456). {ECO:0000305}.	adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A7111A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAGTTTGCGCGCTGTAAAGA	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21075	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)											34.0	33.0	34.0					2																	179582536		1849	4095	5944	SO:0001630	splice_region_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24113-1G>A	2.37:g.179582536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A7111	ENST00000591111.1	37	c.21333		2																																																																																			TTN	-	superfamily_RNaseH-like_dom		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378	Silent	179582536	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.999	T
UBE2O	63893	genome.wustl.edu	37	17	74394424	74394424	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr17:74394424G>T	ENST00000319380.7	-	12	2001	c.1937C>A	c.(1936-1938)gCt>gAt	p.A646D	UBE2O_ENST00000587581.1_5'UTR	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	646					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						AGGGTGGTCAGCAATGTCGTA	0.537											OREG0024751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													415.0	365.0	382.0					17																	74394424		2203	4300	6503	SO:0001583	missense	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.1937C>A	17.37:g.74394424G>T	ENSP00000323687:p.Ala646Asp	Somatic	1152	WXS	Illumina HiSeq	Phase_IV	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.A646D	ENST00000319380.7	37	c.1937	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575942	0.86645	.	.	ENSG00000175931	ENST00000319380	T	0.73469	-0.75	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.76593	0.4009	L	0.53249	1.67	0.54753	D	0.999986	D	0.62365	0.991	P	0.55055	0.767	T	0.71331	-0.4625	10	0.14656	T	0.56	-12.6134	12.8974	0.58108	0.0742:0.0:0.9258:0.0	.	646	Q9C0C9	UBE2O_HUMAN	D	646	ENSP00000323687:A646D	ENSP00000323687:A646D	A	-	2	0	UBE2O	71906019	1.000000	0.71417	0.984000	0.44739	0.965000	0.64279	8.021000	0.88750	2.653000	0.90120	0.563000	0.77884	GCT	UBE2O	-	NULL		0.537	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	G	NM_022066		74394424	-1	no_errors	ENST00000319380	ensembl	human	known	70_37	missense	SNP	1.000	T
UBE2Q1	55585	genome.wustl.edu	37	1	154524884	154524884	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:154524884G>T	ENST00000292211.4	-	7	950	c.871C>A	c.(871-873)Ctc>Atc	p.L291I	UBE2Q1_ENST00000497453.1_5'UTR|UBE2Q1-AS1_ENST00000441613.1_RNA	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	291					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ACTCACTTGAGGAGTTTGACA	0.507																																																	0													130.0	122.0	125.0					1																	154524884		2203	4300	6503	SO:0001583	missense	55585			AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.871C>A	1.37:g.154524884G>T	ENSP00000292211:p.Leu291Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.L291I	ENST00000292211.4	37	c.871	CCDS1069.1	1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433385	0.43224	.	.	ENSG00000160714	ENST00000292211	.	.	.	5.61	4.69	0.59074	Ubiquitin-conjugating enzyme, E2 (1);Ubiquitin-conjugating enzyme/RWD-like (2);	0.213702	0.37136	N	0.002236	T	0.28001	0.0690	L	0.29908	0.895	0.37973	D	0.933336	B	0.06786	0.001	B	0.09377	0.004	T	0.06826	-1.0805	9	0.22706	T	0.39	.	12.6835	0.56934	0.08:0.0:0.92:0.0	.	291	Q7Z7E8	UB2Q1_HUMAN	I	291	.	ENSP00000292211:L291I	L	-	1	0	UBE2Q1	152791508	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.349000	0.79376	2.654000	0.90174	0.563000	0.77884	CTC	UBE2Q1	-	superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.507	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2Q1	HGNC	protein_coding	OTTHUMT00000090704.1	G	NM_017582		154524884	-1	no_errors	ENST00000292211	ensembl	human	known	70_37	missense	SNP	1.000	T
ULK4	54986	genome.wustl.edu	37	3	41996205	41996205	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr3:41996205G>T	ENST00000301831.4	-	2	509	c.47C>A	c.(46-48)aCt>aAt	p.T16N	ULK4_ENST00000414606.1_Missense_Mutation_p.T16N|ULK4_ENST00000420927.1_Missense_Mutation_p.T16N	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	16	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		ATAGACAACAGTCTTGCTTCC	0.418																																																	0													144.0	137.0	139.0					3																	41996205		1874	4107	5981	SO:0001583	missense	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.47C>A	3.37:g.41996205G>T	ENSP00000301831:p.Thr16Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T16N	ENST00000301831.4	37	c.47	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313900	0.60414	.	.	ENSG00000168038	ENST00000301831;ENST00000420927;ENST00000414606	T;T;T	0.65549	-0.16;1.86;1.86	5.56	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.164665	0.53938	D	0.000047	T	0.72228	0.3434	L	0.54323	1.7	0.37401	D	0.912837	D;D	0.59357	0.973;0.985	P;P	0.58013	0.831;0.831	T	0.79354	-0.1838	10	0.72032	D	0.01	.	17.038	0.86481	0.0:0.1272:0.8728:0.0	.	16;16	B4E2M4;Q96C45	.;ULK4_HUMAN	N	16	ENSP00000301831:T16N;ENSP00000412187:T16N;ENSP00000399382:T16N	ENSP00000301831:T16N	T	-	2	0	ULK4	41971209	1.000000	0.71417	0.859000	0.33776	0.955000	0.61496	6.351000	0.73022	1.508000	0.48769	-0.231000	0.12243	ACT	ULK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.418	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	G	XM_929989		41996205	-1	no_errors	ENST00000301831	ensembl	human	known	70_37	missense	SNP	0.998	T
VWF	7450	genome.wustl.edu	37	12	6132797	6132797	+	Splice_Site	SNP	G	G	A	rs139579968	byFrequency	TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr12:6132797G>A	ENST00000261405.5	-	25	3633	c.3379C>T	c.(3379-3381)Ccc>Tcc	p.P1127S		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1127					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGTACTCACGGCACAATGTG	0.577																																																	0								G	SER/PRO	0,4406		0,0,2203	85.0	75.0	78.0		3379	5.1	1.0	12	dbSNP_134	78	1,8599		0,1,4299	yes	missense-near-splice	VWF	NM_000552.3	74	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1127/2814	6132797	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3379+1C>T	12.37:g.6132797G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCE8|Q99806	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pirsf_VWF,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.P1127S	ENST00000261405.5	37	c.3379	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	19.23	3.786672	0.70337	0.0	1.16E-4	ENSG00000110799	ENST00000261405	T	0.78126	-1.15	5.11	5.11	0.69529	Uncharacterised domain, cysteine-rich (2);	0.000000	0.43416	D	0.000573	D	0.89291	0.6673	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90064	0.4158	9	.	.	.	.	17.8912	0.88872	0.0:0.0:1.0:0.0	.	1127	P04275	VWF_HUMAN	S	1127	ENSP00000261405:P1127S	.	P	-	1	0	VWF	6003058	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	7.578000	0.82498	2.533000	0.85409	0.455000	0.32223	CCC	VWF	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich,pirsf_VWF		0.577	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	G	NM_000552	Missense_Mutation	6132797	-1	no_errors	ENST00000261405	ensembl	human	known	70_37	missense	SNP	1.000	A
CFAP57	149465	genome.wustl.edu	37	1	43647253	43647253	+	Missense_Mutation	SNP	G	G	T	rs201770048		TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr1:43647253G>T	ENST00000372492.4	+	3	530	c.206G>T	c.(205-207)cGg>cTg	p.R69L	WDR65_ENST00000528956.1_Missense_Mutation_p.R69L	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		69										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGTCCCAATCGGCGGTACCTC	0.468																																																	0													90.0	80.0	84.0					1																	43647253		2203	4300	6503	SO:0001583	missense	149465																														ENST00000372492.4:c.206G>T	1.37:g.43647253G>T	ENSP00000361570:p.Arg69Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R69L	ENST00000372492.4	37	c.206		1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686323	0.88639	.	.	ENSG00000243710	ENST00000372492;ENST00000528956;ENST00000529956	T;T;T	0.41065	5.02;1.01;5.02	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.061015	0.64402	D	0.000004	T	0.70168	0.3193	M	0.87269	2.87	0.51482	D	0.99992	D;D	0.89917	0.993;1.0	D;D	0.81914	0.937;0.995	T	0.70464	-0.4864	10	0.37606	T	0.19	.	19.3319	0.94293	0.0:0.0:1.0:0.0	.	69;69	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	L	69	ENSP00000361570:R69L;ENSP00000435310:R69L;ENSP00000434133:R69L	ENSP00000361570:R69L	R	+	2	0	WDR65	43419840	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.665000	0.74442	2.672000	0.90937	0.460000	0.39030	CGG	WDR65	-	superfamily_WD40_repeat_dom		0.468	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1	G			43647253	+1	no_errors	ENST00000528956	ensembl	human	known	70_37	missense	SNP	1.000	T
WWC2	80014	genome.wustl.edu	37	4	184175053	184175053	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr4:184175053G>A	ENST00000403733.3	+	9	1296	c.1097G>A	c.(1096-1098)cGt>cAt	p.R366H	WWC2_ENST00000448232.2_Missense_Mutation_p.R366H|WWC2_ENST00000513834.1_Missense_Mutation_p.R366H|WWC2_ENST00000504005.1_Missense_Mutation_p.R48H|WWC2_ENST00000378925.3_Missense_Mutation_p.R268H	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	366					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CCACAGAAACGTACCCAAGAT	0.493																																																	0													70.0	75.0	73.0					4																	184175053		2203	4300	6503	SO:0001583	missense	80014			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1097G>A	4.37:g.184175053G>A	ENSP00000384222:p.Arg366His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.R366H	ENST00000403733.3	37	c.1097	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358249	0.82243	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.15487	3.22;2.42;3.29;3.08;3.05	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000001	T	0.41811	0.1175	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02104	-1.1213	10	0.39692	T	0.17	-16.8646	19.663	0.95879	0.0:0.0:1.0:0.0	.	366	Q6AWC2	WWC2_HUMAN	H	366;268;366;366;48	ENSP00000384222:R366H;ENSP00000368205:R268H;ENSP00000425054:R366H;ENSP00000398577:R366H;ENSP00000427569:R48H	ENSP00000368205:R268H	R	+	2	0	WWC2	184412047	1.000000	0.71417	0.956000	0.39512	0.646000	0.38490	9.365000	0.97139	2.871000	0.98454	0.655000	0.94253	CGT	WWC2	-	NULL		0.493	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2	HGNC	protein_coding	OTTHUMT00000319608.1	G	NM_024949		184175053	+1	no_errors	ENST00000448232	ensembl	human	known	70_37	missense	SNP	1.000	A
ZBTB12	221527	genome.wustl.edu	37	6	31868724	31868724	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr6:31868724C>T	ENST00000375527.2	-	2	534	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						GAGGGCATTCCGGCATTTCTC	0.567																																																	0													78.0	74.0	75.0					6																	31868724		2203	4300	6503	SO:0001583	missense	221527			BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.359G>A	6.37:g.31868724C>T	ENSP00000364677:p.Arg120Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B0UY00|Q5JQ98	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R120Q	ENST00000375527.2	37	c.359	CCDS4727.1	6	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115145	0.37339	.	.	ENSG00000204366	ENST00000375527	T	0.66995	-0.24	4.4	2.57	0.30868	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.071281	0.56097	N	0.000037	T	0.28300	0.0699	L	0.35854	1.095	0.21675	N	0.999593	B	0.28178	0.202	B	0.19946	0.027	T	0.13818	-1.0495	10	0.23891	T	0.37	.	7.6971	0.28600	0.1627:0.7478:0.0:0.0895	.	120	Q9Y330	ZBT12_HUMAN	Q	120	ENSP00000364677:R120Q	ENSP00000364677:R120Q	R	-	2	0	ZBTB12	31976703	0.300000	0.24435	0.760000	0.31359	0.991000	0.79684	2.693000	0.47027	0.291000	0.22468	0.530000	0.56133	CGG	ZBTB12	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.567	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	HGNC	protein_coding	OTTHUMT00000076315.2	C	NM_181842		31868724	-1	no_errors	ENST00000375527	ensembl	human	known	70_37	missense	SNP	0.273	T
ZBTB34	403341	genome.wustl.edu	37	9	129642988	129642988	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr9:129642988G>T	ENST00000373452.2	+	1	1362	c.1298G>T	c.(1297-1299)tGc>tTc	p.C433F	ZBTB34_ENST00000319119.4_Missense_Mutation_p.C437F			Q8NCN2	ZBT34_HUMAN	zinc finger and BTB domain containing 34	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C437Y(1)		endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12						TGTGAGATCTGCGGGAAGTGC	0.527																																																	1	Substitution - Missense(1)	endometrium(1)											84.0	83.0	83.0					9																	129642988		2009	4176	6185	SO:0001583	missense	403341			DQ227306	CCDS48023.1	9q33.3	2013-01-08			ENSG00000177125	ENSG00000177125		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31446	protein-coding gene	gene with protein product		611692				16718364	Standard	NM_001099270		Approved	KIAA1993, MGC24652, ZNF918	uc004bqm.4	Q8NCN2	OTTHUMG00000020694	ENST00000373452.2:c.1298G>T	9.37:g.129642988G>T	ENSP00000362551:p.Cys433Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q38IA7|Q5VYE9	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C437F	ENST00000373452.2	37	c.1310	CCDS48023.1	9	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643507	0.67244	.	.	ENSG00000177125	ENST00000319119;ENST00000373452	D;D	0.99974	-10.2;-10.2	5.88	5.88	0.94601	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	D	0.99984	0.9995	H	0.97707	4.06	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99285	1.0897	10	0.87932	D	0	.	20.2279	0.98344	0.0:0.0:1.0:0.0	.	433	Q8NCN2	ZBT34_HUMAN	F	437;433	ENSP00000317534:C437F;ENSP00000362551:C433F	ENSP00000317534:C437F	C	+	2	0	ZBTB34	128682809	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.414000	0.97362	2.778000	0.95560	0.655000	0.94253	TGC	ZBTB34	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.527	ZBTB34-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB34	HGNC	protein_coding		G	NM_001099270		129642988	+1	no_errors	ENST00000319119	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF655	79027	genome.wustl.edu	37	7	99172797	99172797	+	3'UTR	SNP	G	G	T			TCGA-Q1-A73R-01A-11D-A33O-09	TCGA-Q1-A73R-10B-01D-A33O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	88f672e6-0cc0-477f-894e-6d3629f0fcf0	ba1d4010-a849-4c5f-a482-29e1898f03f5	g.chr7:99172797G>T	ENST00000394163.2	+	0	3249				ZNF655_ENST00000419215.2_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron|ZNF655_ENST00000424881.1_3'UTR|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000425063.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655						negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					GCATGCCTAAGCTTAGAGTTC	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	79027			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.*1590G>T	7.37:g.99172797G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	RNA	SNP	-	NULL	ENST00000394163.2	37	NULL	CCDS5669.1	7																																																																																			ZNF655	-	-		0.468	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	G	NM_138494		99172797	+1	no_errors	ENST00000419215	ensembl	human	known	70_37	rna	SNP	0.132	T
