#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MOV10	4343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	113242318	113242320	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:113242318_113242320delAGA	ENST00000413052.2	+	18	2985_2987	c.2595_2597delAGA	c.(2593-2598)gtagaa>gta	p.E867del	MOV10_ENST00000369645.1_In_Frame_Del_p.E867del|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_In_Frame_Del_p.E811del|RP11-426L16.10_ENST00000471038.2_5'Flank|MOV10_ENST00000357443.2_In_Frame_Del_p.E867del	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	867					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		TGGGTTCAGTAGAAGAATTCCAA	0.562																																					p.865_866del		.											.	.	.	0			c.2594_2596del						.																																			SO:0001651	inframe_deletion	4343	exon18			TTCAGTAGAAGAA	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.2595_2597delAGA	1.37:g.113242321_113242323delAGA	ENSP00000399797:p.Glu867del	Somatic	43	0		WXS	Illumina HiSeq	.	35	10	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	In_Frame_Del	DEL	ENST00000413052.2	37	CCDS853.1																																																																																			.		0.562	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
F8	2157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	154194709	154194709	+	Silent	SNP	G	G	A	rs145623784		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chrX:154194709G>A	ENST00000360256.4	-	8	1463	c.1263C>T	c.(1261-1263)ccC>ccT	p.P421P	F8_ENST00000483822.1_5'UTR	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	421	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.P421P(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ACCTGTCATCGGGGGCGAGGA	0.443																																					p.P421P		.											.	.	.	2	Substitution - coding silent(2)	upper_aerodigestive_tract(2)	c.C1263T						.	G		0,3835		0,0,1632,571	92.0	71.0	79.0		1263	0.5	0.0	X	dbSNP_134	79	2,6726		0,2,2426,1872	no	coding-synonymous	F8	NM_000132.3		0,2,4058,2443	AA,AG,GG,G		0.0297,0.0,0.0189		421/2352	154194709	2,10561	2203	4300	6503	SO:0001819	synonymous_variant	2157	exon8			GTCATCGGGGGCG	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.1263C>T	X.37:g.154194709G>A		Somatic	76	0		WXS	Illumina HiSeq	.	24	4	NM_000132	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	CCDS35457.1																																																																																			0.000		0.443	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
DPYSL3	1809	hgsc.bcm.edu	37	5	146795287	146795287	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:146795287G>T	ENST00000398514.3	-	4	834	c.463C>A	c.(463-465)Ctc>Atc	p.L155I	DPYSL3_ENST00000343218.5_Missense_Mutation_p.L269I|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	155					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTTGATGAGGTTCTGCACT	0.527																																					p.L269I		.											DPYSL3,NS,carcinoma,0,1	DPYSL3	0	0			c.C805A						.						273.0	282.0	279.0					5																	146795287		2118	4238	6356	SO:0001583	missense	1809	exon4			TGATGAGGTTCTG	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.463C>A	5.37:g.146795287G>T	ENSP00000381526:p.Leu155Ile	Somatic	57	0		WXS	Illumina HiSeq	.	40	2	NM_001197294	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540736	0.85917	.	.	ENSG00000113657	ENST00000398514;ENST00000343218	D;D	0.90261	-2.64;-2.64	6.08	6.08	0.98989	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.064020	0.64402	D	0.000004	D	0.94742	0.8303	M	0.67569	2.06	0.80722	D	1	P;B	0.44690	0.841;0.212	D;P	0.69142	0.962;0.607	D	0.94081	0.7344	10	0.56958	D	0.05	-20.096	16.2709	0.82618	0.0:0.0:0.8597:0.1403	.	269;155	B3SXQ8;Q14195	.;DPYL3_HUMAN	I	155;269	ENSP00000381526:L155I;ENSP00000343690:L269I	ENSP00000343690:L269I	L	-	1	0	DPYSL3	146775480	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	4.054000	0.57434	2.894000	0.99253	0.591000	0.81541	CTC	.		0.527	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387	
SKAP1	8631	hgsc.bcm.edu	37	17	46262165	46262165	+	Missense_Mutation	SNP	G	G	A	rs573034197		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:46262165G>A	ENST00000336915.6	-	7	556	c.487C>T	c.(487-489)Cgg>Tgg	p.R163W	SKAP1_ENST00000584924.1_Missense_Mutation_p.R163W|RP11-456D7.1_ENST00000582246.1_RNA	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	163	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.R163W(1)		large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						GGGGCCATCCGTACACCGTAG	0.542																																					p.R163W		.											SKAP1,NS,carcinoma,0,2	SKAP1	0	1	Substitution - Missense(1)	prostate(1)	c.C487T						.						125.0	106.0	112.0					17																	46262165		2203	4300	6503	SO:0001583	missense	8631	exon7			CCATCCGTACACC	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.487C>T	17.37:g.46262165G>A	ENSP00000338171:p.Arg163Trp	Somatic	42	0		WXS	Illumina HiSeq	.	38	3	NM_003726	D3DTV1|O15268	Missense_Mutation	SNP	ENST00000336915.6	37	CCDS32674.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396557	0.83011	.	.	ENSG00000141293	ENST00000336915	T	0.77489	-1.1	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.211232	0.41194	D	0.000939	D	0.86781	0.6015	M	0.67397	2.05	0.45046	D	0.998066	D;D	0.89917	1.0;1.0	P;D	0.65443	0.863;0.935	D	0.87835	0.2647	10	0.72032	D	0.01	-53.9291	18.7013	0.91621	0.0:0.0:1.0:0.0	.	163;163	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	W	163	ENSP00000338171:R163W	ENSP00000338171:R163W	R	-	1	2	SKAP1	43617164	1.000000	0.71417	0.982000	0.44146	0.912000	0.54170	3.289000	0.51747	2.509000	0.84616	0.557000	0.71058	CGG	.		0.542	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	
ZNF831	128611	hgsc.bcm.edu;bcgsc.ca	37	20	57766888	57766888	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr20:57766888G>A	ENST00000371030.2	+	1	814	c.814G>A	c.(814-816)Gca>Aca	p.A272T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	272							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCCAGGGTCCGCATTTGCCGA	0.642																																					p.A272T		.											.	.	.	0			c.G814A						.						55.0	64.0	61.0					20																	57766888		2031	4177	6208	SO:0001583	missense	128611	exon1			GGGTCCGCATTTG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.814G>A	20.37:g.57766888G>A	ENSP00000360069:p.Ala272Thr	Somatic	69	0		WXS	Illumina HiSeq	.	59	4	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.563300	0.00134	.	.	ENSG00000124203	ENST00000371030	T	0.03982	3.74	4.92	-5.13	0.02884	.	.	.	.	.	T	0.00998	0.0033	N	0.00347	-1.61	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43261	-0.9402	9	0.02654	T	1	-1.7032	8.9178	0.35592	0.4454:0.1104:0.4442:0.0	.	272	Q5JPB2	ZN831_HUMAN	T	272	ENSP00000360069:A272T	ENSP00000360069:A272T	A	+	1	0	ZNF831	57200283	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.523000	0.06230	-1.374000	0.02131	-1.623000	0.00790	GCA	.		0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
TMEM147	10430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36037440	36037440	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:36037440G>T	ENST00000222284.5	+	3	305	c.160G>T	c.(160-162)Gcc>Tcc	p.A54S	TMEM147_ENST00000392204.2_Missense_Mutation_p.A5S|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000590717.1_RNA|TMEM147_ENST00000392205.1_Missense_Mutation_p.A54S|AD000090.2_ENST00000588286.1_RNA	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	54						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCTGTTCTTGGCCACTTTCTT	0.537																																					p.A54S		.											.	.	.	0			c.G160T						.						156.0	134.0	141.0					19																	36037440		2203	4300	6503	SO:0001583	missense	10430	exon3			TTCTTGGCCACTT	BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.160G>T	19.37:g.36037440G>T	ENSP00000222284:p.Ala54Ser	Somatic	45	0		WXS	Illumina HiSeq	.	21	7	NM_001242598	A8MWW0|O75790	Missense_Mutation	SNP	ENST00000222284.5	37	CCDS12466.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894444	0.91889	.	.	ENSG00000105677	ENST00000392204;ENST00000222284;ENST00000392205	T;T;T	0.59364	0.27;0.27;0.27	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.78259	0.4255	M	0.88842	2.985	0.80722	D	1	D	0.65815	0.995	P	0.62885	0.908	T	0.82438	-0.0457	10	0.72032	D	0.01	.	16.2094	0.82147	0.0:0.0:1.0:0.0	.	54	Q9BVK8	TM147_HUMAN	S	5;54;54	ENSP00000376040:A5S;ENSP00000222284:A54S;ENSP00000376041:A54S	ENSP00000222284:A54S	A	+	1	0	TMEM147	40729280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.735000	0.84939	2.676000	0.91093	0.655000	0.94253	GCC	.		0.537	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109469.2	NM_032635	
LENG1	79165	hgsc.bcm.edu	37	19	54662171	54662171	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:54662171G>T	ENST00000222224.3	-	2	347	c.161C>A	c.(160-162)gCc>gAc	p.A54D		NM_024316.1	NP_077292.1	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	54										breast(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	8	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGATGTCTGGCTTTCTTCCG	0.547																																					p.A54D		.											LENG1,NS,neuroblastoma,0,1	LENG1	0	0			c.C161A						.						83.0	85.0	84.0					19																	54662171		2203	4300	6503	SO:0001583	missense	79165	exon2			TGTCTGGCTTTCT	AF211966	CCDS12881.1	19q13.4	2008-02-05			ENSG00000105617	ENSG00000105617			15502	protein-coding gene	gene with protein product						10941842	Standard	NM_024316		Approved		uc002qdm.3	Q96BZ8	OTTHUMG00000066486	ENST00000222224.3:c.161C>A	19.37:g.54662171G>T	ENSP00000222224:p.Ala54Asp	Somatic	59	0		WXS	Illumina HiSeq	.	46	2	NM_024316	Q9HCU7	Missense_Mutation	SNP	ENST00000222224.3	37	CCDS12881.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899213	0.91962	.	.	ENSG00000105617	ENST00000222224	T	0.53206	0.63	5.18	5.18	0.71444	.	0.115003	0.64402	D	0.000020	T	0.75049	0.3797	M	0.91406	3.205	0.58432	D	0.999994	D	0.89917	1.0	D	0.76575	0.988	T	0.78089	-0.2340	10	0.39692	T	0.17	-16.4582	17.8446	0.88725	0.0:0.0:1.0:0.0	.	54	Q96BZ8	LENG1_HUMAN	D	54	ENSP00000222224:A54D	ENSP00000222224:A54D	A	-	2	0	LENG1	59353983	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.488000	0.73637	2.582000	0.87167	0.655000	0.94253	GCC	.		0.547	LENG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142159.1	NM_024316	
GPR98	84059	hgsc.bcm.edu	37	5	89923034	89923034	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:89923034G>A	ENST00000405460.2	+	7	775	c.679G>A	c.(679-681)Gaa>Aaa	p.E227K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	227	Calx-beta 2. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACAGGTACCAGAAAATGATGA	0.313																																					p.E227K		.											GPR98,colon,carcinoma,0,1	GPR98	0	0			c.G679A						.						18.0	18.0	18.0					5																	89923034		1802	4067	5869	SO:0001583	missense	84059	exon7			GTACCAGAAAATG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.679G>A	5.37:g.89923034G>A	ENSP00000384582:p.Glu227Lys	Somatic	30	0		WXS	Illumina HiSeq	.	40	2	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	34	5.363015	0.95877	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.61274	0.12	5.91	5.91	0.95273	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.81597	0.4856	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83848	0.0261	10	0.87932	D	0	.	20.3011	0.98612	0.0:0.0:1.0:0.0	.	227	Q8WXG9	GPR98_HUMAN	K	227	ENSP00000384582:E227K	ENSP00000296619:E227K	E	+	1	0	GPR98	89958790	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.512000	0.98008	2.804000	0.96469	0.650000	0.86243	GAA	.		0.313	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
MICAL2	9645	hgsc.bcm.edu;bcgsc.ca	37	11	12244189	12244189	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:12244189C>A	ENST00000256194.4	+	11	1636	c.1348C>A	c.(1348-1350)Cag>Aag	p.Q450K	MICAL2_ENST00000342902.5_Missense_Mutation_p.Q450K|MICAL2_ENST00000527546.1_Missense_Mutation_p.Q450K|MICAL2_ENST00000379612.3_Missense_Mutation_p.Q450K|MICAL2_ENST00000537344.1_Missense_Mutation_p.Q450K	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	450	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.Q450*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GCTGTTACCTCAGACAACCCC	0.567																																					p.Q450K		.											MICAL2_ENST00000379612,NS,carcinoma,0,2	MICAL2_ENST00000379612	0	1	Substitution - Nonsense(1)	lung(1)	c.C1348A						.						90.0	72.0	78.0					11																	12244189		2201	4294	6495	SO:0001583	missense	9645	exon11			TTACCTCAGACAA	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1348C>A	11.37:g.12244189C>A	ENSP00000256194:p.Gln450Lys	Somatic	64	0		WXS	Illumina HiSeq	.	62	4	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	C	33	5.271884	0.95429	.	.	ENSG00000133816	ENST00000537344;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	4.98	4.98	0.66077	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.38453	0.1041	M	0.84683	2.71	0.80722	D	1	P;D;D;P;D	0.65815	0.949;0.995;0.991;0.916;0.981	P;D;P;B;P	0.69479	0.495;0.964;0.814;0.299;0.546	T	0.31971	-0.9924	10	0.72032	D	0.01	.	18.4096	0.90546	0.0:1.0:0.0:0.0	.	450;450;450;450;450	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;MICA2_HUMAN	K	450	ENSP00000441689:Q450K;ENSP00000256194:Q450K;ENSP00000433965:Q450K;ENSP00000344894:Q450K;ENSP00000368932:Q450K	ENSP00000256194:Q450K	Q	+	1	0	MICAL2	12200765	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.609000	0.82925	2.746000	0.94184	0.655000	0.94253	CAG	.		0.567	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
ZDHHC24	254359	hgsc.bcm.edu	37	11	66311234	66311234	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:66311234G>T	ENST00000310442.3	-	2	734	c.500C>A	c.(499-501)gCc>gAc	p.A167D	ZDHHC24_ENST00000526986.1_Missense_Mutation_p.A167D|ZDHHC24_ENST00000525925.1_5'UTR|ACTN3_ENST00000502692.1_RNA	NM_207340.1	NP_997223.1	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	167	Leu-rich.					integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A167V(1)		endometrium(1)|large_intestine(3)|ovary(1)|prostate(1)|skin(1)	7						GGGCGTGTGGGCTCGCAGCAG	0.687											OREG0021110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A167D		.											ZDHHC24,colon,carcinoma,0,1	ZDHHC24	0	1	Substitution - Missense(1)	large_intestine(1)	c.C500A						.						27.0	27.0	27.0					11																	66311234		2196	4290	6486	SO:0001583	missense	254359	exon2			GTGTGGGCTCGCA	BC005015	CCDS8143.1	11q13.2	2008-05-02				ENSG00000174165		"""Zinc fingers, DHHC-type"""	27387	protein-coding gene	gene with protein product							Standard	NM_207340		Approved		uc001oin.1	Q6UX98		ENST00000310442.3:c.500C>A	11.37:g.66311234G>T	ENSP00000309429:p.Ala167Asp	Somatic	39	0	1090	WXS	Illumina HiSeq	.	36	2	NM_207340	Q6PEW7|Q9BSJ0	Missense_Mutation	SNP	ENST00000310442.3	37	CCDS8143.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832454	0.71258	.	.	ENSG00000174165	ENST00000526986;ENST00000310442	T;T	0.59906	0.23;1.87	3.91	3.91	0.45181	.	0.070453	0.56097	D	0.000035	T	0.54255	0.1847	N	0.20401	0.57	0.42263	D	0.99202	D;P	0.55605	0.972;0.789	D;P	0.64595	0.927;0.531	T	0.46359	-0.9197	10	0.10111	T	0.7	-13.4446	11.2834	0.49208	0.0:0.0:1.0:0.0	.	167;167	E9PLR9;Q6UX98	.;ZDH24_HUMAN	D	167	ENSP00000431321:A167D;ENSP00000309429:A167D	ENSP00000309429:A167D	A	-	2	0	ZDHHC24	66067810	1.000000	0.71417	0.971000	0.41717	0.887000	0.51463	4.349000	0.59385	2.027000	0.59764	0.462000	0.41574	GCC	.		0.687	ZDHHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393089.1	NM_207340	
CAD	790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27457075	27457075	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:27457075A>G	ENST00000403525.1	+	21	3554	c.3410A>G	c.(3409-3411)aAt>aGt	p.N1137S	CAD_ENST00000264705.4_Missense_Mutation_p.N1200S			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGACCCTTCAATCTGCAGCTC	0.537																																					p.N1200S		.											.	.	.	0			c.A3599G						.						67.0	61.0	63.0					2																	27457075		2203	4300	6503	SO:0001583	missense	790	exon22			CCTTCAATCTGCA	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.3410A>G	2.37:g.27457075A>G	ENSP00000384510:p.Asn1137Ser	Somatic	23	0		WXS	Illumina HiSeq	.	16	7	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	A	24.5	4.535397	0.85812	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.98474	-4.95;-4.95	5.85	5.85	0.93711	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.99462	0.9809	H	0.99325	4.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.98029	1.0375	10	0.87932	D	0	0.4033	15.0724	0.72049	1.0:0.0:0.0:0.0	.	1137;1200	F8VPD4;P27708	.;PYR1_HUMAN	S	1200;1137	ENSP00000264705:N1200S;ENSP00000384510:N1137S	ENSP00000264705:N1200S	N	+	2	0	CAD	27310579	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.494000	0.90477	2.237000	0.73441	0.459000	0.35465	AAT	.		0.537	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
WDR93	56964	hgsc.bcm.edu;ucsc.edu	37	15	90281353	90281353	+	Missense_Mutation	SNP	C	C	G	rs373980931		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:90281353C>G	ENST00000268130.7	+	16	1948	c.1847C>G	c.(1846-1848)cCa>cGa	p.P616R	WDR93_ENST00000560294.1_Missense_Mutation_p.P588R|WDR93_ENST00000444934.2_Missense_Mutation_p.P333R	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	616					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			GAGGCCTGCCCACTCCTGGAA	0.448																																					p.P616R		.											.	.	.	0			c.C1847G						.						237.0	244.0	242.0					15																	90281353		2200	4299	6499	SO:0001583	missense	56964	exon16			CCTGCCCACTCCT		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1847C>G	15.37:g.90281353C>G	ENSP00000268130:p.Pro616Arg	Somatic	19	0		WXS	Illumina HiSeq	.	28	4	NM_020212	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	ENST00000268130.7	37	CCDS32326.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.346034	0.41599	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	T;T	0.48522	1.82;0.81	5.0	2.83	0.33086	.	0.393191	0.21459	N	0.074186	T	0.57829	0.2080	L	0.59436	1.845	0.20489	N	0.999896	D;D	0.76494	0.996;0.999	P;D	0.66351	0.858;0.943	T	0.44877	-0.9299	10	0.72032	D	0.01	-0.8905	7.3898	0.26903	0.176:0.7257:0.0:0.0983	.	588;616	Q6P2C0-2;Q6P2C0	.;WDR93_HUMAN	R	616;333	ENSP00000268130:P616R;ENSP00000403871:P333R	ENSP00000268130:P616R	P	+	2	0	WDR93	88082357	0.001000	0.12720	0.949000	0.38748	0.623000	0.37688	0.485000	0.22324	1.079000	0.41038	0.650000	0.86243	CCA	.		0.448	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212	
LINC00645	100505967	hgsc.bcm.edu;broad.mit.edu	37	14	28102462	28102462	+	lincRNA	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr14:28102462G>T	ENST00000557399.1	+	0	194				hsa-mir-3171_ENST00000584270.1_RNA|CTD-3006G17.2_ENST00000553392.1_RNA	NR_039992.1				long intergenic non-protein coding RNA 645																		gatatatacagattccataca	0.209																																					.		.											.	.	.	0			.						.																																					100505967	.			TATACAGATTCCA	BC042069, BX538073, BX538140		14q12	2012-10-12			ENSG00000258548	ENSG00000258548		"""Long non-coding RNAs"""	44299	non-coding RNA	RNA, long non-coding							Standard	NR_039992		Approved		uc001wqc.3		OTTHUMG00000170580		14.37:g.28102462G>T		Somatic	72	0		WXS	Illumina HiSeq	.	85	4	.		RNA	SNP	ENST00000557399.1	37																																																																																				.		0.209	LINC00645-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000409673.1	NR_039992	
RPAP3	79657	hgsc.bcm.edu	37	12	48062853	48062853	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:48062853T>C	ENST00000005386.3	-	14	1674	c.1559A>G	c.(1558-1560)cAg>cGg	p.Q520R	RPAP3_ENST00000380650.4_Missense_Mutation_p.Q486R|RPAP3_ENST00000432584.3_Missense_Mutation_p.Q361R	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	520								p.Q520P(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					GCTGTAAGACTGACATACATC	0.408																																					p.Q520R		.											RPAP3,rectum,carcinoma,0,1	RPAP3	0	1	Substitution - Missense(1)	large_intestine(1)	c.A1559G						.						155.0	155.0	155.0					12																	48062853		2203	4300	6503	SO:0001583	missense	79657	exon14			TAAGACTGACATA	AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.1559A>G	12.37:g.48062853T>C	ENSP00000005386:p.Gln520Arg	Somatic	68	0		WXS	Illumina HiSeq	.	48	2	NM_024604	B4DRW9|Q6PHR5	Missense_Mutation	SNP	ENST00000005386.3	37	CCDS8753.1	.	.	.	.	.	.	.	.	.	.	T	9.772	1.172887	0.21704	.	.	ENSG00000005175	ENST00000005386;ENST00000432584;ENST00000380650	T;T;T	0.14893	2.88;2.47;2.89	5.9	4.76	0.60689	.	1.982520	0.02035	N	0.048895	T	0.27063	0.0663	L	0.60455	1.87	0.25942	N	0.98286	P;B	0.43094	0.799;0.016	P;B	0.45138	0.471;0.025	T	0.10941	-1.0608	10	0.37606	T	0.19	.	7.4042	0.26981	0.0:0.0758:0.1442:0.78	.	486;520	Q9H6T3-2;Q9H6T3	.;RPAP3_HUMAN	R	520;361;486	ENSP00000005386:Q520R;ENSP00000401823:Q361R;ENSP00000370024:Q486R	ENSP00000005386:Q520R	Q	-	2	0	RPAP3	46349120	1.000000	0.71417	0.478000	0.27316	0.235000	0.25334	1.854000	0.39368	1.064000	0.40671	0.523000	0.50628	CAG	.		0.408	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405340.1	NM_024604	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9089654	9089654	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:9089654T>C	ENST00000397910.4	-	1	2364	c.2161A>G	c.(2161-2163)Agc>Ggc	p.S721G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	721	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGCTGGTGCTTATCTTGGTG	0.493																																					p.S721G		.											.	.	.	0			c.A2161G						.						115.0	115.0	115.0					19																	9089654		2104	4234	6338	SO:0001583	missense	94025	exon1			TGGTGCTTATCTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2161A>G	19.37:g.9089654T>C	ENSP00000381008:p.Ser721Gly	Somatic	36	0		WXS	Illumina HiSeq	.	30	6	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	5.573	0.290637	0.10567	.	.	ENSG00000181143	ENST00000397910	T	0.02606	4.23	1.56	0.427	0.16489	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	.	.	.	P	0.50710	0.938	B	0.34722	0.188	T	0.48758	-0.9007	8	0.87932	D	0	.	4.2875	0.10862	0.0:0.0:0.3614:0.6386	.	721	B5ME49	.	G	721	ENSP00000381008:S721G	ENSP00000381008:S721G	S	-	1	0	MUC16	8950654	0.000000	0.05858	0.000000	0.03702	0.371000	0.29859	0.264000	0.18497	0.057000	0.16193	0.172000	0.16884	AGC	.		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55146734	55146734	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:55146734G>A	ENST00000396331.1	+	13	1941	c.1584G>A	c.(1582-1584)caG>caA	p.Q528Q	LILRB1_ENST00000396327.3_Silent_p.Q529Q|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000427581.2_Silent_p.Q578Q|LILRB1_ENST00000396321.2_Silent_p.Q528Q|LILRB1_ENST00000396315.1_Silent_p.Q529Q|LILRB1_ENST00000396317.1_Silent_p.Q512Q|LILRB1_ENST00000396332.4_Silent_p.Q528Q|LILRB1_ENST00000418536.2_Silent_p.Q512Q|LILRB1_ENST00000324602.7_Silent_p.Q529Q|LILRB1_ENST00000448689.1_Missense_Mutation_p.R503K|LILRB1_ENST00000434867.2_Silent_p.Q528Q	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	528					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCGATGCCCAGGAAGAAAACC	0.612										HNSCC(37;0.09)																											p.Q529Q		.											.	.	.	0			c.G1587A						.						64.0	71.0	68.0					19																	55146734		2203	4299	6502	SO:0001819	synonymous_variant	10859	exon12			TGCCCAGGAAGAA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1584G>A	19.37:g.55146734G>A		Somatic	65	0		WXS	Illumina HiSeq	.	41	11	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.522143	0.00967	.	.	ENSG00000104972	ENST00000448689	T	0.00530	6.77	1.35	0.215	0.15253	.	.	.	.	.	T	0.00328	0.0010	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.38286	-0.9668	6	0.28530	T	0.3	.	3.65	0.08199	0.2705:0.0:0.7295:0.0	.	.	.	.	K	503	ENSP00000409968:R503K	ENSP00000410165:R503K	R	+	2	0	LILRB1	59838546	0.350000	0.24878	0.027000	0.17364	0.064000	0.16182	0.691000	0.25467	0.114000	0.18032	0.205000	0.17691	AGG	.		0.612	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
LRRC23	10233	hgsc.bcm.edu	37	12	7022136	7022136	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:7022136G>T	ENST00000007969.8	+	7	1221	c.1001G>T	c.(1000-1002)cGt>cTt	p.R334L	LRRC23_ENST00000323702.5_Intron|ENO2_ENST00000544774.1_5'Flank|ENO2_ENST00000229277.1_5'Flank|ENO2_ENST00000535366.1_5'Flank|LRRC23_ENST00000429740.1_Intron|LRRC23_ENST00000443597.2_Missense_Mutation_p.R334L|ENO2_ENST00000538763.1_5'Flank|ENO2_ENST00000545045.2_5'Flank|LRRC23_ENST00000436789.1_Intron|ENO2_ENST00000541477.1_5'Flank	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	334										NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						GAGCCCCAGCGTGACCTGGAA	0.562																																					p.R334L		.											.	.	.	0			c.G1001T						.						141.0	143.0	142.0					12																	7022136		2203	4300	6503	SO:0001583	missense	10233	exon7			CCCAGCGTGACCT	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.1001G>T	12.37:g.7022136G>T	ENSP00000007969:p.Arg334Leu	Somatic	60	0		WXS	Illumina HiSeq	.	53	3	NM_001135217	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Missense_Mutation	SNP	ENST00000007969.8	37	CCDS8569.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323740	0.24080	.	.	ENSG00000010626	ENST00000007969;ENST00000443597	T;T	0.62498	0.02;0.02	5.27	-1.48	0.08745	.	.	.	.	.	T	0.27027	0.0662	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14755	-1.0461	9	0.29301	T	0.29	0.2883	2.0878	0.03650	0.4996:0.2417:0.1417:0.1169	.	334;334	A8K8K2;Q53EV4	.;LRC23_HUMAN	L	334	ENSP00000007969:R334L;ENSP00000390932:R334L	ENSP00000007969:R334L	R	+	2	0	LRRC23	6892397	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.150000	0.16263	0.069000	0.16605	-1.200000	0.01667	CGT	.		0.562	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
TCF4	6925	hgsc.bcm.edu	37	18	52895478	52895478	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr18:52895478G>T	ENST00000356073.4	-	19	2593	c.1982C>A	c.(1981-1983)tCg>tAg	p.S661*	TCF4_ENST00000570177.2_Nonsense_Mutation_p.S531*|TCF4_ENST00000561992.1_Nonsense_Mutation_p.S531*|TCF4_ENST00000543082.1_Nonsense_Mutation_p.S619*|TCF4_ENST00000564403.2_Nonsense_Mutation_p.S671*|TCF4_ENST00000457482.3_Nonsense_Mutation_p.S505*|TCF4_ENST00000566279.1_Nonsense_Mutation_p.S605*|TCF4_ENST00000537578.1_Nonsense_Mutation_p.S641*|TCF4_ENST00000354452.3_Nonsense_Mutation_p.S665*|TCF4_ENST00000568673.1_Nonsense_Mutation_p.S641*|TCF4_ENST00000567880.1_Nonsense_Mutation_p.S601*|TCF4_ENST00000537856.3_Nonsense_Mutation_p.S531*|TCF4_ENST00000544241.2_Nonsense_Mutation_p.S594*|TCF4_ENST00000561831.3_Nonsense_Mutation_p.S501*|TCF4_ENST00000564999.1_Nonsense_Mutation_p.S661*|TCF4_ENST00000566286.1_Nonsense_Mutation_p.S658*|TCF4_ENST00000565018.2_Nonsense_Mutation_p.S665*|TCF4_ENST00000564228.1_Nonsense_Mutation_p.S590*|TCF4_ENST00000540999.1_Nonsense_Mutation_p.S637*|TCF4_ENST00000398339.1_Nonsense_Mutation_p.S767*|TCF4_ENST00000568740.1_Nonsense_Mutation_p.S636*|TCF4_ENST00000570287.2_Nonsense_Mutation_p.S501*	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	661					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CATGTGATTCGATGCGTCTCC	0.493																																					p.S767X		.											TCF4_ENST00000398339,NS,carcinoma,0,2	TCF4_ENST00000398339	0	0			c.C2300A						.						112.0	94.0	100.0					18																	52895478		2203	4300	6503	SO:0001587	stop_gained	6925	exon20			TGATTCGATGCGT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1982C>A	18.37:g.52895478G>T	ENSP00000348374:p.Ser661*	Somatic	68	0		WXS	Illumina HiSeq	.	42	2	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Nonsense_Mutation	SNP	ENST00000356073.4	37	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	G	37	6.454640	0.97581	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	.	.	.	5.72	5.72	0.89469	.	0.372056	0.28470	N	0.015235	.	.	.	.	.	.	0.53005	D	0.999963	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-1.4801	18.6583	0.91462	0.0:0.0:1.0:0.0	.	.	.	.	X	665;505;661;619;637;641;594;531;767	.	ENSP00000346440:S665X	S	-	2	0	TCF4	51046476	0.858000	0.29795	0.389000	0.26208	0.984000	0.73092	4.514000	0.60482	2.689000	0.91719	0.650000	0.86243	TCG	.		0.493	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
ROBO4	54538	hgsc.bcm.edu;broad.mit.edu	37	11	124763789	124763789	+	Missense_Mutation	SNP	G	G	A	rs374471211		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:124763789G>A	ENST00000306534.3	-	9	1956	c.1471C>T	c.(1471-1473)Cgc>Tgc	p.R491C	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Missense_Mutation_p.R346C	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	491					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R491C(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CGGCGCCGGCGGTGGATACAC	0.647																																					p.R491C		.											ROBO4,NS,carcinoma,+1,1	ROBO4	+1	1	Substitution - Missense(1)	lung(1)	c.C1471T						.	G	CYS/ARG	1,4399		0,1,2199	19.0	22.0	21.0		1471	3.2	0.6	11		21	1,8595		0,1,4297	no	missense	ROBO4	NM_019055.5	180	0,2,6496	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	491/1008	124763789	2,12994	2200	4298	6498	SO:0001583	missense	54538	exon9			GCCGGCGGTGGAT	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1471C>T	11.37:g.124763789G>A	ENSP00000304945:p.Arg491Cys	Somatic	8	0		WXS	Illumina HiSeq	.	10	3	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910782	0.72983	2.27E-4	1.16E-4	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.68181	-0.31;0.08	5.31	3.16	0.36331	.	0.000000	0.33712	N	0.004622	T	0.70911	0.3278	L	0.56769	1.78	0.42356	D	0.992396	D;D;D	0.89917	0.994;0.999;1.0	P;P;P	0.59703	0.653;0.862;0.828	T	0.68823	-0.5307	10	0.54805	T	0.06	.	6.2249	0.20701	0.1046:0.0:0.7132:0.1822	.	491;381;491	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	C	491;381;346	ENSP00000304945:R491C;ENSP00000437129:R346C	ENSP00000304945:R491C	R	-	1	0	ROBO4	124268999	1.000000	0.71417	0.621000	0.29145	0.996000	0.88848	0.711000	0.25764	0.438000	0.26450	0.655000	0.94253	CGC	.		0.647	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
PCDHA6	56142	hgsc.bcm.edu	37	5	140209783	140209783	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:140209783G>A	ENST00000529310.1	+	1	2221	c.2107G>A	c.(2107-2109)Gcc>Acc	p.A703T	PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	703					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGATCATCGCCATCTGCGC	0.687																																					p.A703T		.											PCDHA6_ENST00000529310,NS,carcinoma,0,2	PCDHA6_ENST00000529310	0	0			c.G2107A						.						58.0	60.0	59.0					5																	140209783		2203	4296	6499	SO:0001583	missense	56142	exon1			ATCATCGCCATCT	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2107G>A	5.37:g.140209783G>A	ENSP00000433378:p.Ala703Thr	Somatic	52	0		WXS	Illumina HiSeq	.	45	2	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186855	0.38609	.	.	ENSG00000081842	ENST00000529310	T	0.20463	2.07	4.12	3.23	0.37069	.	0.000000	0.36482	U	0.002577	T	0.52008	0.1708	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70716	0.97;0.936	T	0.55879	-0.8071	10	0.87932	D	0	.	4.9613	0.14068	0.0829:0.1465:0.6195:0.1511	.	703;703	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	T	703	ENSP00000433378:A703T	ENSP00000433378:A703T	A	+	1	0	PCDHA6	140189967	0.572000	0.26668	0.917000	0.36280	0.106000	0.19336	1.585000	0.36600	1.059000	0.40554	0.306000	0.20318	GCC	.		0.687	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
EPHA2	1969	hgsc.bcm.edu;broad.mit.edu	37	1	16459707	16459707	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:16459707T>A	ENST00000358432.5	-	11	2175	c.2021A>T	c.(2020-2022)aAc>aTc	p.N674I		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	674	Mediates interaction with ARHGEF16 and ELMO2.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GCGGATGATGTTGTGGTGGCT	0.617																																					p.N674I		.											.	.	.	0			c.A2021T						.						79.0	76.0	77.0					1																	16459707		2203	4300	6503	SO:0001583	missense	1969	exon11			ATGATGTTGTGGT	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2021A>T	1.37:g.16459707T>A	ENSP00000351209:p.Asn674Ile	Somatic	13	0		WXS	Illumina HiSeq	.	10	5	NM_004431	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	t	24.7	4.560718	0.86335	.	.	ENSG00000142627	ENST00000358432	T	0.71222	-0.55	5.5	5.5	0.81552	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	D	0.90494	0.7022	H	0.98802	4.335	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.94044	0.7312	10	0.87932	D	0	.	14.4836	0.67599	0.0:0.0:0.0:1.0	.	674	P29317	EPHA2_HUMAN	I	674	ENSP00000351209:N674I	ENSP00000351209:N674I	N	-	2	0	EPHA2	16332294	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.280000	0.72626	2.119000	0.64992	0.515000	0.50301	AAC	.		0.617	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
SIPA1L3	23094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38579446	38579446	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:38579446G>A	ENST00000222345.6	+	4	2129	c.1620G>A	c.(1618-1620)gaG>gaA	p.E540E		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	540					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACCACAAGGAGCACGGACCTC	0.517																																					p.E540E		.											.	.	.	0			c.G1620A						.						146.0	119.0	128.0					19																	38579446		2203	4300	6503	SO:0001819	synonymous_variant	23094	exon4			CAAGGAGCACGGA	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.1620G>A	19.37:g.38579446G>A		Somatic	46	0		WXS	Illumina HiSeq	.	35	12	NM_015073	Q2TV87	Silent	SNP	ENST00000222345.6	37	CCDS33007.1																																																																																			.		0.517	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
ZNF416	55659	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	58084364	58084364	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:58084364C>A	ENST00000196489.3	-	4	1130	c.908G>T	c.(907-909)tGt>tTt	p.C303F		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TGATTTCCCACACTGACCACA	0.443																																					p.C303F		.											.	.	.	0			c.G908T						.						84.0	83.0	84.0					19																	58084364		2203	4300	6503	SO:0001583	missense	55659	exon4			TTCCCACACTGAC	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.908G>T	19.37:g.58084364C>A	ENSP00000196489:p.Cys303Phe	Somatic	45	0		WXS	Illumina HiSeq	.	28	4	NM_017879	Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	37	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998890	0.74818	.	.	ENSG00000083817	ENST00000196489	D	0.85861	-2.04	3.72	3.72	0.42706	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95268	0.8465	H	0.98646	4.29	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.97042	0.9758	9	0.87932	D	0	.	14.7895	0.69830	0.0:1.0:0.0:0.0	.	303	Q9BWM5	ZN416_HUMAN	F	303	ENSP00000196489:C303F	ENSP00000196489:C303F	C	-	2	0	ZNF416	62776176	1.000000	0.71417	0.817000	0.32601	0.997000	0.91878	4.002000	0.57053	2.068000	0.61886	0.655000	0.94253	TGT	.		0.443	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
CLEC10A	10462	hgsc.bcm.edu	37	17	6979444	6979444	+	Missense_Mutation	SNP	G	G	A	rs376732406		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:6979444G>A	ENST00000254868.4	-	6	708	c.380C>T	c.(379-381)aCg>aTg	p.T127M	CLEC10A_ENST00000416562.2_Intron|CLEC10A_ENST00000576617.1_Intron|CLEC10A_ENST00000571664.1_Intron	NM_182906.2	NP_878910.1	Q8IUN9	CLC10_HUMAN	C-type lectin domain family 10, member A	127					endocytosis (GO:0006897)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						TGCCTTCTGCGTAGTGTGTTC	0.597																																					p.T127M		.											CLEC10A,NS,carcinoma,0,2	CLEC10A	0	0			c.C380T						.	G	,MET/THR	0,4406		0,0,2203	66.0	57.0	60.0		,380	-0.9	0.0	17		60	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	CLEC10A	NM_006344.2,NM_182906.2	,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,127/317	6979444	1,13005	2203	4300	6503	SO:0001583	missense	10462	exon6			TTCTGCGTAGTGT	D50532	CCDS11087.1, CCDS45597.1	17p13.2	2014-05-20	2005-02-09	2005-02-11		ENSG00000132514		"""C-type lectin domain containing"", ""CD molecules"""	16916	protein-coding gene	gene with protein product	"""macrophage lectin 2 (calcium dependent)"""	605999	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 14 (macrophage-derived)"""	CLECSF13, CLECSF14		8598452	Standard	XM_005256411		Approved	HML2, HML, CD301	uc002gej.3	Q8IUN9		ENST00000254868.4:c.380C>T	17.37:g.6979444G>A	ENSP00000254868:p.Thr127Met	Somatic	61	0		WXS	Illumina HiSeq	.	57	3	NM_182906	A8K8J8|Q14538|Q6PIW3	Missense_Mutation	SNP	ENST00000254868.4	37	CCDS11087.1	.	.	.	.	.	.	.	.	.	.	g	9.322	1.058181	0.19987	0.0	1.16E-4	ENSG00000132514	ENST00000254868	T	0.17370	2.28	2.85	-0.849	0.10723	Hepatic lectin, N-terminal (1);	3.454410	0.00998	N	0.003632	T	0.08935	0.0221	N	0.08118	0	0.09310	N	1	B	0.23249	0.082	B	0.14578	0.011	T	0.24584	-1.0156	10	0.45353	T	0.12	.	3.9466	0.09350	0.0:0.1401:0.4608:0.3991	.	127	Q8IUN9	CLC10_HUMAN	M	127	ENSP00000254868:T127M	ENSP00000254868:T127M	T	-	2	0	CLEC10A	6920168	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.073000	0.14640	-0.074000	0.12820	-0.346000	0.07831	ACG	.		0.597	CLEC10A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439837.2	NM_006344	
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89018752	89018752	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:89018752C>A	ENST00000237612.3	-	13	2045	c.1500G>T	c.(1498-1500)aaG>aaT	p.K500N	ABCG2_ENST00000515655.1_Missense_Mutation_p.K500N	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	500	ABC transmembrane type-2.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CTGCCTTTGGCTTCAATCCTT	0.433																																					p.K500N		.											.	.	.	0			c.G1500T						.						86.0	80.0	82.0					4																	89018752		2203	4300	6503	SO:0001583	missense	9429	exon13			CTTTGGCTTCAAT	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1500G>T	4.37:g.89018752C>A	ENSP00000237612:p.Lys500Asn	Somatic	28	0		WXS	Illumina HiSeq	.	27	13	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828552	0.32329	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.71341	-0.56;-0.56	5.65	-5.16	0.02857	ABC-2 type transporter (1);	0.131624	0.64402	D	0.000002	T	0.60547	0.2277	L	0.35288	1.05	0.23204	N	0.99813	P;P;B	0.38535	0.494;0.635;0.299	B;P;B	0.44811	0.221;0.461;0.259	T	0.60110	-0.7327	10	0.38643	T	0.18	-18.0878	14.8258	0.70110	0.0:0.5266:0.0:0.4734	.	500;500;500	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	N	500	ENSP00000426917:K500N;ENSP00000237612:K500N	ENSP00000237612:K500N	K	-	3	2	ABCG2	89237776	0.091000	0.21658	0.006000	0.13384	0.084000	0.17831	-0.394000	0.07296	-0.781000	0.04548	-0.252000	0.11476	AAG	.		0.433	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
KRT3	3850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53189250	53189250	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:53189250G>T	ENST00000417996.2	-	1	651	c.577C>A	c.(577-579)Caa>Aaa	p.Q193K	KRT3_ENST00000309505.3_Missense_Mutation_p.Q193K	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	193	Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						GCCTTTACTTGCCCAATCTGG	0.532																																					p.Q193K		.											.	.	.	0			c.C577A						.						77.0	95.0	89.0					12																	53189250		2203	4297	6500	SO:0001583	missense	3850	exon1			TTACTTGCCCAAT		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.577C>A	12.37:g.53189250G>T	ENSP00000413479:p.Gln193Lys	Somatic	117	0		WXS	Illumina HiSeq	.	65	23	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	37	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	g	0.985	-0.695835	0.03279	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	D;D	0.83837	-1.77;-1.77	4.82	1.38	0.22167	.	0.435191	0.17612	N	0.168049	T	0.63212	0.2492	N	0.13235	0.315	0.21064	N	0.999792	B	0.22003	0.063	B	0.15870	0.014	T	0.45160	-0.9280	10	0.07990	T	0.79	.	9.0449	0.36341	0.0:0.1678:0.4769:0.3553	.	193	P12035	K2C3_HUMAN	K	193	ENSP00000413479:Q193K;ENSP00000312206:Q193K	ENSP00000312206:Q193K	Q	-	1	0	KRT3	51475517	0.000000	0.05858	0.988000	0.46212	0.990000	0.78478	0.102000	0.15272	0.492000	0.27815	0.650000	0.86243	CAA	.		0.532	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
MAZ	4150	hgsc.bcm.edu	37	16	29821450	29821450	+	Silent	SNP	A	A	G	rs372438870		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:29821450A>G	ENST00000322945.6	+	5	1497	c.1332A>G	c.(1330-1332)gcA>gcG	p.A444A	PRRT2_ENST00000358758.7_5'Flank|MAZ_ENST00000566906.2_Missense_Mutation_p.S99G|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000563402.1_Missense_Mutation_p.S101G|MAZ_ENST00000545521.1_Silent_p.A421A|PRRT2_ENST00000567659.1_5'Flank|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000562337.1_Silent_p.A139A|MAZ_ENST00000219782.6_3'UTR|MAZ_ENST00000568544.1_Silent_p.A45A|AC009133.20_ENST00000569039.1_RNA|AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000300797.6_5'Flank|AC009133.15_ENST00000566537.1_RNA	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	444	Poly-Ala.			Missing (in Ref. 3). {ECO:0000305}.	positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						cggcagcggcagcagcggcag	0.662																																					p.A444A	Colon(72;875 1167 15364 30899 37091)	.											.	.	.	0			c.A1332G						.	A	,	2,3900		0,2,1949	12.0	17.0	15.0		,1332	-6.5	0.1	16		15	13,8015		0,13,4001	no	utr-3,coding-synonymous	MAZ	NM_001042539.1,NM_002383.2	,	0,15,5950	GG,GA,AA		0.1619,0.0513,0.1257	,	,444/478	29821450	15,11915	1951	4014	5965	SO:0001819	synonymous_variant	4150	exon5			AGCGGCAGCAGCG	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1332A>G	16.37:g.29821450A>G		Somatic	20	0		WXS	Illumina HiSeq	.	24	6	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Silent	SNP	ENST00000322945.6	37	CCDS42143.1																																																																																			.		0.662	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
AKR1C4	1109	hgsc.bcm.edu	37	10	5242162	5242162	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:5242162G>T	ENST00000380448.1	+	4	356	c.103G>T	c.(103-105)Gta>Tta	p.V35L	AKR1C4_ENST00000263126.1_Missense_Mutation_p.V35L|AKR1CL1_ENST00000445191.1_Intron			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	35					androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						GAACAGAGCTGTAGAGGTCAC	0.448																																					p.V35L		.											.	.	.	0			c.G103T						.						108.0	95.0	100.0					10																	5242162		2203	4300	6503	SO:0001583	missense	1109	exon2			AGAGCTGTAGAGG	M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.103G>T	10.37:g.5242162G>T	ENSP00000369814:p.Val35Leu	Somatic	72	0		WXS	Illumina HiSeq	.	65	4	NM_001818	Q5T6A3|Q8WW84|Q9NS54	Missense_Mutation	SNP	ENST00000380448.1	37	CCDS7064.1	.	.	.	.	.	.	.	.	.	.	G	0.430	-0.903904	0.02453	.	.	ENSG00000198610	ENST00000380448;ENST00000263126;ENST00000397357	T;T	0.22336	1.96;1.96	3.46	-3.84	0.04256	NADP-dependent oxidoreductase domain (3);	4.406720	0.01030	N	0.004132	T	0.09905	0.0243	N	0.17838	0.53	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.18085	-1.0348	10	0.06494	T	0.89	.	1.9067	0.03278	0.1476:0.2902:0.3982:0.164	.	35	P17516	AK1C4_HUMAN	L	35	ENSP00000369814:V35L;ENSP00000263126:V35L	ENSP00000263126:V35L	V	+	1	0	AKR1C4	5232162	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.311000	0.02723	-1.236000	0.02542	0.591000	0.81541	GTA	.		0.448	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046543.2	NM_001818	
LVRN	206338	hgsc.bcm.edu	37	5	115351066	115351066	+	Silent	SNP	T	T	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:115351066T>A	ENST00000357872.4	+	17	2692	c.2568T>A	c.(2566-2568)atT>atA	p.I856I	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		856						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AAGAAAAGATTCAACTTGCTT	0.343																																					p.I856I		.											FLJ90650,caecum,carcinoma,0,1	FLJ90650	0	0			c.T2568A						.						91.0	87.0	88.0					5																	115351066		2202	4300	6502	SO:0001819	synonymous_variant	0	exon17			AAAGATTCAACTT																												ENST00000357872.4:c.2568T>A	5.37:g.115351066T>A		Somatic	31	0		WXS	Illumina HiSeq	.	35	2	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																			.		0.343	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
WDR3	10885	hgsc.bcm.edu	37	1	118495209	118495209	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:118495209C>A	ENST00000349139.5	+	19	2122	c.2075C>A	c.(2074-2076)tCa>tAa	p.S692*		NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	692						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S692L(1)		breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TATGTTGTATCATCGTCCCAT	0.423																																					p.S692X		.											WDR3,NS,carcinoma,0,1	WDR3	0	1	Substitution - Missense(1)	breast(1)	c.C2075A						.						100.0	100.0	100.0					1																	118495209		2203	4300	6503	SO:0001587	stop_gained	10885	exon19			TTGTATCATCGTC	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2075C>A	1.37:g.118495209C>A	ENSP00000308179:p.Ser692*	Somatic	61	0		WXS	Illumina HiSeq	.	44	2	NM_006784		Nonsense_Mutation	SNP	ENST00000349139.5	37	CCDS898.1	.	.	.	.	.	.	.	.	.	.	C	39	7.857253	0.98528	.	.	ENSG00000065183	ENST00000349139	.	.	.	6.06	6.06	0.98353	.	0.110725	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0592	20.6397	0.99537	0.0:1.0:0.0:0.0	.	.	.	.	X	692	.	ENSP00000308179:S692X	S	+	2	0	WDR3	118296732	1.000000	0.71417	0.840000	0.33206	0.914000	0.54420	7.678000	0.84035	2.880000	0.98712	0.650000	0.86243	TCA	.		0.423	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033720.2	NM_006784	
LIPF	8513	hgsc.bcm.edu	37	10	90429680	90429680	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:90429680G>T	ENST00000238983.4	+	5	555	c.509G>T	c.(508-510)gGc>gTc	p.G170V	LIPF_ENST00000608620.1_Missense_Mutation_p.G137V|LIPF_ENST00000355843.2_Missense_Mutation_p.G147V|LIPF_ENST00000394375.3_Missense_Mutation_p.G180V	NM_004190.3	NP_004181.1	P07098	LIPG_HUMAN	lipase, gastric	170					lipid catabolic process (GO:0016042)|malate metabolic process (GO:0006108)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)	lipid binding (GO:0008289)|malate dehydrogenase activity (GO:0016615)|triglyceride lipase activity (GO:0004806)			NS(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(6)	13		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)	Orlistat(DB01083)	CACTATGTTGGCCATTCCCAG	0.433																																					p.G180V		.											.	.	.	0			c.G539T						.						220.0	204.0	210.0					10																	90429680		2203	4300	6503	SO:0001583	missense	8513	exon6			ATGTTGGCCATTC	X05997	CCDS7389.1, CCDS55718.1, CCDS55719.1, CCDS65896.1	10q23	2005-10-30			ENSG00000182333	ENSG00000182333	3.1.1.3		6622	protein-coding gene	gene with protein product		601980				3304425, 9186906	Standard	NM_004190		Approved	HGL, HLAL	uc010qmt.2	P07098	OTTHUMG00000018695	ENST00000238983.4:c.509G>T	10.37:g.90429680G>T	ENSP00000238983:p.Gly170Val	Somatic	71	0		WXS	Illumina HiSeq	.	54	3	NM_001198829	B7Z723|F5H1P4|Q2M1P6|Q5VXI7|Q5VXI8|Q658L8	Missense_Mutation	SNP	ENST00000238983.4	37	CCDS7389.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638785	0.67130	.	.	ENSG00000182333	ENST00000394375;ENST00000238983;ENST00000355843	D;D;D	0.93659	-3.26;-3.26;-3.26	5.24	5.24	0.73138	Alpha/beta hydrolase fold-1 (1);	0.000000	0.56097	D	0.000027	D	0.98283	0.9431	H	0.98996	4.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	D	0.99494	1.0951	10	0.87932	D	0	-10.4813	17.7661	0.88478	0.0:0.0:1.0:0.0	.	137;180;147;170	Q5VXI8;F5H1P4;Q658L8;P07098	.;.;.;LIPG_HUMAN	V	180;170;137	ENSP00000377900:G180V;ENSP00000238983:G170V;ENSP00000348101:G137V	ENSP00000238983:G170V	G	+	2	0	LIPF	90419660	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	7.286000	0.78671	2.718000	0.92993	0.650000	0.86243	GGC	.		0.433	LIPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049256.1		
MAN1A2	10905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117957335	117957335	+	Splice_Site	SNP	G	G	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:117957335G>C	ENST00000356554.3	+	4	1391	c.656G>C	c.(655-657)gGa>gCa	p.G219A	MAN1A2_ENST00000482811.1_3'UTR	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	219					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		CCAAATATAGGAAGTTCACAA	0.363																																					p.G219A	Ovarian(33;199 881 8228 13687 31538)	.											.	.	.	0			c.G656C						.						82.0	81.0	81.0					1																	117957335		2203	4300	6503	SO:0001630	splice_region_variant	10905	exon4			ATATAGGAAGTTC	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.656-1G>C	1.37:g.117957335G>C		Somatic	44	0		WXS	Illumina HiSeq	.	43	21	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	37	CCDS895.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724306	0.89298	.	.	ENSG00000198162	ENST00000356554	D	0.84589	-1.87	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.91633	0.7356	M	0.83384	2.64	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.91554	0.5259	9	.	.	.	.	16.9927	0.86358	0.0:0.0:1.0:0.0	.	219	O60476	MA1A2_HUMAN	A	219	ENSP00000348959:G219A	.	G	+	2	0	MAN1A2	117758858	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.312000	0.96287	2.672000	0.90937	0.650000	0.86243	GGA	.		0.363	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	Missense_Mutation
RUSC2	9853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	35546734	35546734	+	Silent	SNP	T	T	A	rs200234823		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr9:35546734T>A	ENST00000455600.1	+	2	785	c.216T>A	c.(214-216)tcT>tcA	p.S72S	RUSC2_ENST00000468041.1_3'UTR	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	72						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GCCTGCACTCTACTCCAGGAG	0.577																																					p.S72S		.											.	.	.	0			c.T216A						.						69.0	64.0	66.0					9																	35546734		2203	4300	6503	SO:0001819	synonymous_variant	9853	exon2			GCACTCTACTCCA	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.216T>A	9.37:g.35546734T>A		Somatic	12	0		WXS	Illumina HiSeq	.	16	8	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	37	CCDS35008.1																																																																																			.		0.577	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
MTHFD2	10797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74435800	74435800	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:74435800A>T	ENST00000394053.2	+	4	594	c.514A>T	c.(514-516)Atg>Ttg	p.M172L	MTHFD2_ENST00000409804.1_Intron|MTHFD2_ENST00000477455.1_3'UTR|MTHFD2_ENST00000264090.4_Missense_Mutation_p.M70L|MTHFD2_ENST00000409601.1_Missense_Mutation_p.M131L|MTHFD2_ENST00000394050.3_Missense_Mutation_p.M8L	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	172					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	TCAGTATTCCATGTTACCGGC	0.393																																					p.M172L		.											.	.	.	0			c.A514T						.						262.0	239.0	246.0					2																	74435800		1920	4132	6052	SO:0001583	missense	10797	exon4			TATTCCATGTTAC	X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.514A>T	2.37:g.74435800A>T	ENSP00000377617:p.Met172Leu	Somatic	76	0		WXS	Illumina HiSeq	.	53	19	NM_006636	Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	ENST00000394053.2	37	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979475	0.53827	.	.	ENSG00000065911	ENST00000394053;ENST00000264090;ENST00000394050;ENST00000409601	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.3	5.3	0.74995	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);	0.034867	0.85682	D	0.000000	T	0.27063	0.0663	N	0.02286	-0.61	0.52099	D	0.999948	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.12915	-1.0529	10	0.21014	T	0.42	.	13.2393	0.59987	1.0:0.0:0.0:0.0	.	131;172	B8ZZU9;P13995	.;MTDC_HUMAN	L	172;70;8;131	ENSP00000377617:M172L;ENSP00000264090:M70L;ENSP00000377614:M8L;ENSP00000386542:M131L	ENSP00000264090:M70L	M	+	1	0	MTHFD2	74289308	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.824000	0.92023	2.015000	0.59207	0.529000	0.55759	ATG	.		0.393	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		
MTFMT	123263	hgsc.bcm.edu	37	15	65295439	65295439	+	Missense_Mutation	SNP	C	C	A	rs374393377		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:65295439C>A	ENST00000220058.4	-	9	1144	c.1131G>T	c.(1129-1131)aaG>aaT	p.K377N		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	377						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TTTTTTTCTGCTTCTTCTTTG	0.348																																					p.K377N		.											MTFMT_ENST00000220058,NS,carcinoma,0,2	MTFMT_ENST00000220058	0	0			c.G1131T						.						115.0	105.0	108.0					15																	65295439		1835	4093	5928	SO:0001583	missense	123263	exon9			TTTCTGCTTCTTC	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.1131G>T	15.37:g.65295439C>A	ENSP00000220058:p.Lys377Asn	Somatic	48	0		WXS	Illumina HiSeq	.	44	3	NM_139242	B7Z734	Missense_Mutation	SNP	ENST00000220058.4	37	CCDS45280.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.395133	0.25205	.	.	ENSG00000103707	ENST00000220058	T	0.66815	-0.23	5.65	-0.953	0.10362	.	1.333030	0.04503	N	0.381507	T	0.50446	0.1616	L	0.29908	0.895	0.09310	N	1	B	0.32245	0.361	B	0.30495	0.116	T	0.44390	-0.9331	10	0.66056	D	0.02	-2.3978	2.4072	0.04415	0.116:0.406:0.1137:0.3644	.	377	Q96DP5	FMT_HUMAN	N	377	ENSP00000220058:K377N	ENSP00000220058:K377N	K	-	3	2	MTFMT	63082492	0.474000	0.25886	0.001000	0.08648	0.632000	0.37999	0.550000	0.23345	-0.054000	0.13266	-0.143000	0.13931	AAG	.		0.348	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
NBPF22P	285622	hgsc.bcm.edu	37	5	85582848	85582848	+	RNA	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:85582848T>C	ENST00000590707.1	+	0	758					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		GTGTGCTGAATATACCTGTTC	0.413																																					.		.											.	.	.	0			.						.																																					285622	.			GCTGAATATACCT	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85582848T>C		Somatic	111	0		WXS	Illumina HiSeq	.	74	23	.		RNA	SNP	ENST00000590707.1	37																																																																																				.		0.413	NBPF22P-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000453100.1	XM_208333	
AGBL2	79841	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	47701557	47701557	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:47701557G>T	ENST00000525123.1	-	13	2269	c.1984C>A	c.(1984-1986)Ctt>Att	p.L662I	AGBL2_ENST00000298861.4_Missense_Mutation_p.L662I|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Missense_Mutation_p.L624I|AGBL2_ENST00000357610.3_Missense_Mutation_p.L662I	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	662						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						AAGTCCAGAAGGGTGTCACAG	0.428																																					p.L662I		.											.	.	.	0			c.C1984A						.						111.0	106.0	107.0					11																	47701557		2201	4298	6499	SO:0001583	missense	79841	exon13			CCAGAAGGGTGTC		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1984C>A	11.37:g.47701557G>T	ENSP00000435582:p.Leu662Ile	Somatic	54	0		WXS	Illumina HiSeq	.	42	4	NM_024783	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936132	0.52972	.	.	ENSG00000165923	ENST00000528609;ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	5.26	3.36	0.38483	.	0.065683	0.56097	N	0.000031	T	0.40498	0.1119	M	0.84585	2.705	0.38098	D	0.937169	P;B;B	0.36065	0.535;0.225;0.351	B;B;B	0.39771	0.309;0.163;0.163	T	0.46992	-0.9151	10	0.52906	T	0.07	-7.2886	3.4245	0.07405	0.2268:0.0:0.5728:0.2004	.	624;624;662	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	I	45;662;662;662;624	ENSP00000435582:L662I;ENSP00000350228:L662I;ENSP00000298861:L662I;ENSP00000436630:L624I	ENSP00000298861:L662I	L	-	1	0	AGBL2	47658133	0.999000	0.42202	0.961000	0.40146	0.958000	0.62258	2.830000	0.48136	1.182000	0.42928	0.555000	0.69702	CTT	.		0.428	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783	
NFE2L3	9603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	26224462	26224462	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr7:26224462T>C	ENST00000056233.3	+	4	1403	c.1144T>C	c.(1144-1146)Tat>Cat	p.Y382H		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	382					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AGACCTACTGTATGACCTTGA	0.383																																					p.Y382H		.											.	.	.	0			c.T1144C						.						84.0	87.0	86.0					7																	26224462		2203	4300	6503	SO:0001583	missense	9603	exon4			CTACTGTATGACC	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1144T>C	7.37:g.26224462T>C	ENSP00000056233:p.Tyr382His	Somatic	73	0		WXS	Illumina HiSeq	.	60	18	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	37	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	T	0.064	-1.217565	0.01542	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.30182	1.54	5.05	1.29	0.21616	.	0.933158	0.09237	N	0.829811	T	0.16685	0.0401	N	0.16066	0.365	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.31943	-0.9925	10	0.16420	T	0.52	-2.6223	9.002	0.36088	0.0:0.298:0.0:0.702	.	382	Q9Y4A8	NF2L3_HUMAN	H	382;88	ENSP00000056233:Y382H	ENSP00000056233:Y382H	Y	+	1	0	NFE2L3	26190987	0.000000	0.05858	0.279000	0.24732	0.145000	0.21501	-0.272000	0.08560	0.323000	0.23307	0.443000	0.29094	TAT	.		0.383	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	129100764	129100764	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:129100764G>T	ENST00000435159.2	+	4	1189	c.1189G>T	c.(1189-1191)Ggg>Tgg	p.G397W	TMEM132C_ENST00000315208.8_Missense_Mutation_p.G13W	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	397						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CAGCCTTTCAGGGACTCAGCC	0.517																																					p.G397W		.											.	.	.	0			c.G1189T						.						96.0	87.0	90.0					12																	129100764		692	1591	2283	SO:0001583	missense	92293	exon4			CTTTCAGGGACTC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1189G>T	12.37:g.129100764G>T	ENSP00000410852:p.Gly397Trp	Somatic	48	0		WXS	Illumina HiSeq	.	38	11	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	G	16.99	3.273449	0.59649	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.14144	2.53;2.53	4.91	4.91	0.64330	.	0.000000	0.56097	D	0.000031	T	0.39009	0.1062	M	0.74258	2.255	0.46874	D	0.999238	D	0.76494	0.999	D	0.70716	0.97	T	0.31194	-0.9952	10	0.66056	D	0.02	.	18.0827	0.89445	0.0:0.0:1.0:0.0	.	397	Q8N3T6	T132C_HUMAN	W	397;13	ENSP00000410852:G397W;ENSP00000324458:G13W	ENSP00000324458:G13W	G	+	1	0	TMEM132C	127666717	1.000000	0.71417	0.145000	0.22337	0.814000	0.46013	4.937000	0.63513	2.263000	0.75096	0.561000	0.74099	GGG	.		0.517	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
PSPH	5723	hgsc.bcm.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr7:56085002C>T	ENST00000395471.3	-	6	1151	c.346G>A	c.(346-348)Gta>Ata	p.V116I	PSPH_ENST00000459834.1_Intron|PSPH_ENST00000275605.3_Missense_Mutation_p.V116I			P78330	SERB_HUMAN	phosphoserine phosphatase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.V116I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																																					p.V116I		.											PSPH,NS,carcinoma,0,2	PSPH	0	1	Substitution - Missense(1)	lung(1)	c.G346A						.						87.0	75.0	79.0					7																	56085002		2203	4300	6503	SO:0001583	missense	5723	exon6			GCTCTACAATACT	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.346G>A	7.37:g.56085002C>T	ENSP00000378854:p.Val116Ile	Somatic	90	0		WXS	Illumina HiSeq	.	69	3	NM_004577	B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432510	0.25813	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.81908	-1.55;-1.55;-1.55	4.85	4.85	0.62838	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.05124	-0.11	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.021	T	0.62992	-0.6736	10	0.02654	T	1	-16.2549	17.1115	0.86676	0.0:1.0:0.0:0.0	.	116;116	Q53EY1;P78330	.;SERB_HUMAN	I	116	ENSP00000275605:V116I;ENSP00000378854:V116I;ENSP00000398653:V116I	ENSP00000275605:V116I	V	-	1	0	PSPH	56052496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.297000	0.77311	0.579000	0.79373	GTA	.		0.393	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343304.1	NM_004577	
HIST3H2BB	128312	hgsc.bcm.edu	37	1	228645919	228645919	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:228645919G>A	ENST00000369160.2	+	1	112	c.89G>A	c.(88-90)cGc>cAc	p.R30H	HIST3H2A_ENST00000366695.2_5'Flank	NM_175055.2	NP_778225.1	Q8N257	H2B3B_HUMAN	histone cluster 3, H2bb	30					chromatin organization (GO:0006325)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			skin(1)	1		Prostate(94;0.183)				GGCAAGAAGCGCAAGCGCGGC	0.577																																					p.R30H		.											.	.	.	0			c.G89A						.						98.0	98.0	98.0					1																	228645919		2203	4300	6503	SO:0001583	missense	128312	exon1			AGAAGCGCAAGCG	AY131981	CCDS1574.1	1q42.13	2011-01-27	2006-10-11		ENSG00000196890	ENSG00000196890		"""Histones / Replication-dependent"""	20514	protein-coding gene	gene with protein product		615046	"""histone 3, H2bb"""			12408966	Standard	NM_175055		Approved		uc001hsz.3	Q8N257	OTTHUMG00000040045	ENST00000369160.2:c.89G>A	1.37:g.228645919G>A	ENSP00000375736:p.Arg30His	Somatic	77	0		WXS	Illumina HiSeq	.	90	3	NM_175055	A4FU05|Q3ZCP6|Q5TA30	Missense_Mutation	SNP	ENST00000369160.2	37	CCDS1574.1	.	.	.	.	.	.	.	.	.	.	.	16.22	3.061409	0.55432	.	.	ENSG00000196890	ENST00000369160	T	0.22945	1.93	3.94	3.94	0.45596	Histone-fold (2);	0.000000	0.48286	D	0.000193	T	0.26085	0.0636	L	0.53729	1.69	0.46499	D	0.999075	B	0.06786	0.001	B	0.04013	0.001	T	0.07233	-1.0783	10	0.45353	T	0.12	.	14.354	0.66724	0.0:0.0:1.0:0.0	.	30	Q8N257	H2B3B_HUMAN	H	30	ENSP00000375736:R30H	ENSP00000375736:R30H	R	+	2	0	HIST3H2BB	226712542	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	3.338000	0.52128	2.491000	0.84063	0.586000	0.80456	CGC	.		0.577	HIST3H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096597.1	NM_175055	
CSMD1	64478	hgsc.bcm.edu	37	8	3063118	3063118	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr8:3063118C>T	ENST00000520002.1	-	32	5450	c.4895G>A	c.(4894-4896)gGa>gAa	p.G1632E	CSMD1_ENST00000602557.1_Missense_Mutation_p.G1632E|CSMD1_ENST00000400186.3_Missense_Mutation_p.G1632E|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000539096.1_Missense_Mutation_p.G1631E|CSMD1_ENST00000537824.1_Missense_Mutation_p.G1631E|CSMD1_ENST00000602723.1_Missense_Mutation_p.G1632E|CSMD1_ENST00000542608.1_Missense_Mutation_p.G1631E			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1632	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.G1631V(1)|p.G1360V(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCCTTCTGATCCCGTGTACTG	0.453																																					p.G1631E		.											CSMD1_ENST00000537824,NS,carcinoma,0,2	CSMD1_ENST00000537824	0	2	Substitution - Missense(2)	lung(2)	c.G4892A						.						52.0	51.0	51.0					8																	3063118		1868	4093	5961	SO:0001583	missense	64478	exon31			TCTGATCCCGTGT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4895G>A	8.37:g.3063118C>T	ENSP00000430733:p.Gly1632Glu	Somatic	38	0		WXS	Illumina HiSeq	.	46	2	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	19.64	3.865603	0.71949	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42	5.28	4.4	0.53042	CUB (5);	0.000000	0.64402	D	0.000001	T	0.36663	0.0975	M	0.62088	1.915	0.80722	D	1	D;D;D	0.89917	1.0;0.966;1.0	D;P;D	0.97110	1.0;0.901;1.0	T	0.07501	-1.0769	10	0.23891	T	0.37	.	14.111	0.65121	0.0:0.9272:0.0:0.0728	.	1632;1632;1632	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	E	1632;1632;1494;1631;1631;1631	ENSP00000383047:G1632E;ENSP00000430733:G1632E;ENSP00000441462:G1631E;ENSP00000446243:G1631E;ENSP00000441675:G1631E	ENSP00000320445:G1494E	G	-	2	0	CSMD1	3050525	1.000000	0.71417	0.536000	0.28039	0.648000	0.38561	7.593000	0.82686	1.357000	0.45904	0.655000	0.94253	GGA	.		0.453	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
LEF1	51176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	109086281	109086281	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:109086281G>A	ENST00000265165.1	-	2	906	c.252C>T	c.(250-252)caC>caT	p.H84H	LEF1_ENST00000510624.1_Silent_p.H16H|LEF1-AS1_ENST00000436413.1_RNA|LEF1_ENST00000512172.1_Silent_p.H16H|LEF1_ENST00000438313.2_Silent_p.H84H|LEF1_ENST00000379951.2_Silent_p.H84H	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	84	Pro-rich.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		TGGCCTTGTCGTGGTAGGGCT	0.443																																					p.H84H		.											.	.	.	0			c.C252T						.						256.0	213.0	227.0					4																	109086281		2203	4300	6503	SO:0001819	synonymous_variant	51176	exon2			CTTGTCGTGGTAG		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.252C>T	4.37:g.109086281G>A		Somatic	112	0		WXS	Illumina HiSeq	.	84	30	NM_001130714	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Silent	SNP	ENST00000265165.1	37	CCDS3679.1																																																																																			.		0.443	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		
GPR123	84435	hgsc.bcm.edu	37	10	134912152	134912152	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:134912152G>A	ENST00000392607.3	+	4	576	c.140G>A	c.(139-141)cGc>cAc	p.R47H	GPR123_ENST00000607359.1_Missense_Mutation_p.R767H	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	47					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R767L(1)|p.R47L(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AGCGCCATCCGCATCAGCCGC	0.662																																					p.R47H		.											GPR123_ENST00000368577,NS,carcinoma,0,2	GPR123_ENST00000368577	0	2	Substitution - Missense(2)	lung(2)	c.G140A						.						57.0	52.0	54.0					10																	134912152		2203	4300	6503	SO:0001583	missense	84435	exon4			CCATCCGCATCAG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.140G>A	10.37:g.134912152G>A	ENSP00000376384:p.Arg47His	Somatic	47	0		WXS	Illumina HiSeq	.	37	2	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	37	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663128	0.67700	.	.	ENSG00000197177	ENST00000368577;ENST00000392609;ENST00000392607	T	0.47528	0.84	4.35	4.35	0.52113	GPCR, family 2-like (1);	0.000000	0.47093	D	0.000248	T	0.59280	0.2182	M	0.67397	2.05	0.80722	D	1	P;P	0.50710	0.938;0.879	P;P	0.54210	0.745;0.553	T	0.63808	-0.6553	10	0.54805	T	0.06	-44.621	14.7362	0.69416	0.0:0.0:1.0:0.0	.	47;767	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	H	767;767;47	ENSP00000376384:R47H	ENSP00000357566:R767H	R	+	2	0	GPR123	134762142	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	4.776000	0.62354	2.143000	0.66587	0.655000	0.94253	CGC	.		0.662	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
HIST1H2AI	8329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27776314	27776314	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr6:27776314G>A	ENST00000358739.3	+	1	416	c.327G>A	c.(325-327)ctG>ctA	p.L109L	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2BL_ENST00000377401.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	109						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						GTGGCGTCCTGCCCAACATCC	0.577																																					p.L109L		.											.	.	.	0			c.G327A						.						74.0	72.0	73.0					6																	27776314		2203	4300	6503	SO:0001819	synonymous_variant	8329	exon1			CGTCCTGCCCAAC	Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.327G>A	6.37:g.27776314G>A		Somatic	65	0		WXS	Illumina HiSeq	.	63	18	NM_003509	P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000358739.3	37	CCDS4626.1																																																																																			.		0.577	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040152.1	NM_003509	
TPR	7175	hgsc.bcm.edu	37	1	186324448	186324448	+	Intron	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:186324448C>A	ENST00000367478.4	-	17	2468				TPR_ENST00000474852.1_Intron	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein						carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ACAAAAAAAGCAACACTATTG	0.294			T	NTRK1	papillary thyroid																																.		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	.	.	0			.						.																																			SO:0001627	intron_variant	100302192	.			AAAAAGCAACACT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2171+93G>T	1.37:g.186324448C>A		Somatic	59	0		WXS	Illumina HiSeq	.	67	4	.	Q15655|Q5SWY0|Q99968	RNA	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																			.		0.294	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
PRKRA	8575	hgsc.bcm.edu	37	2	179306336	179306336	+	Splice_Site	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:179306336C>T	ENST00000325748.4	-	6	810		c.e6+1		PRKRA_ENST00000438687.3_Splice_Site|PRKRA_ENST00000432031.2_Splice_Site|AC009948.5_ENST00000453026.2_RNA|PRKRA_ENST00000487082.1_Splice_Site	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator						cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			ACATTACTCACTAAAGAAATG	0.353																																					.	Melanoma(200;68 3001 23825 48764)	.											PRKRA,NS,carcinoma,0,1	PRKRA	0	1	Unknown(1)	lung(1)	c.534+1G>A						.						70.0	74.0	73.0					2																	179306336		2203	4300	6503	SO:0001630	splice_region_variant	8575	exon7			TACTCACTAAAGA	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.609+1G>A	2.37:g.179306336C>T		Somatic	35	0		WXS	Illumina HiSeq	.	41	3	NM_001139518	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Splice_Site	SNP	ENST00000325748.4	37	CCDS2279.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689950	0.68271	.	.	ENSG00000180228	ENST00000325748;ENST00000438687;ENST00000487082;ENST00000432031	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5111	0.44862	0.0:0.9114:0.0:0.0886	.	.	.	.	.	-1	.	.	.	-	.	.	PRKRA	179014582	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.492000	0.60334	2.618000	0.88619	0.591000	0.81541	.	.		0.353	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	Intron
ROCK1	6093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	18629827	18629827	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr18:18629827T>A	ENST00000399799.2	-	3	1130	c.190A>T	c.(190-192)Aat>Tat	p.N64Y		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	64					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					CTGATTTTATTTATTGTGTCT	0.294																																					p.N64Y		.											.	.	.	0			c.A190T						.						91.0	81.0	85.0					18																	18629827		2203	4299	6502	SO:0001583	missense	6093	exon3			TTTTATTTATTGT		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.190A>T	18.37:g.18629827T>A	ENSP00000382697:p.Asn64Tyr	Somatic	22	0		WXS	Illumina HiSeq	.	30	11	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179006	0.57692	.	.	ENSG00000067900	ENST00000399799	T	0.65732	-0.17	5.53	5.53	0.82687	Protein kinase-like domain (1);	0.184196	0.56097	D	0.000027	T	0.55146	0.1902	L	0.34521	1.04	0.52501	D	0.99995	B	0.26902	0.163	B	0.28849	0.095	T	0.56792	-0.7920	10	0.72032	D	0.01	.	15.9523	0.79850	0.0:0.0:0.0:1.0	.	64	Q13464	ROCK1_HUMAN	Y	64	ENSP00000382697:N64Y	ENSP00000382697:N64Y	N	-	1	0	ROCK1	16883825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.076000	0.64413	2.226000	0.72624	0.533000	0.62120	AAT	.		0.294	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
HCN1	348980	hgsc.bcm.edu	37	5	45262723	45262723	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:45262723G>T	ENST00000303230.4	-	8	2030	c.1973C>A	c.(1972-1974)tCc>tAc	p.S658Y		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	658					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CCTCATGCGGGAGGTCGGGGT	0.552																																					p.S658Y		.											HCN1,NS,malignant_melanoma,0,1	HCN1	0	0			c.C1973A						.						180.0	173.0	175.0					5																	45262723		2203	4300	6503	SO:0001583	missense	348980	exon8			ATGCGGGAGGTCG	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1973C>A	5.37:g.45262723G>T	ENSP00000307342:p.Ser658Tyr	Somatic	61	0		WXS	Illumina HiSeq	.	53	3	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.766871	0.00651	.	.	ENSG00000164588	ENST00000303230	T	0.76448	-1.02	5.52	4.64	0.57946	.	0.123610	0.36815	N	0.002394	T	0.63177	0.2489	L	0.36672	1.1	0.34233	D	0.676799	B	0.26876	0.162	B	0.27887	0.084	T	0.60520	-0.7247	10	0.02654	T	1	.	9.8932	0.41302	0.0721:0.1401:0.7878:0.0	.	658	O60741	HCN1_HUMAN	Y	658	ENSP00000307342:S658Y	ENSP00000307342:S658Y	S	-	2	0	HCN1	45298480	0.988000	0.35896	0.337000	0.25536	0.043000	0.13939	5.529000	0.67135	1.318000	0.45170	0.655000	0.94253	TCC	.		0.552	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
KDM6B	23135	hgsc.bcm.edu	37	17	7750177	7750177	+	Missense_Mutation	SNP	T	T	C	rs375218857|rs61462443		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:7750177T>C	ENST00000448097.2	+	9	1083	c.752T>C	c.(751-753)tTa>tCa	p.L251S	KDM6B_ENST00000254846.5_Missense_Mutation_p.L251S			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	251	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ccaccaccattaccaccacca	0.612																																					p.L251S		.											.,2	.	95	0			c.T752C						.						30.0	27.0	28.0					17																	7750177		2195	4284	6479	SO:0001583	missense	23135	exon9			CACCATTACCACC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.752T>C	17.37:g.7750177T>C	ENSP00000412513:p.Leu251Ser	Somatic	17	0		WXS	Illumina HiSeq	.	11	3	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	T	5.427	0.264015	0.10294	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.36520	1.25;1.25	5.23	3.0	0.34707	.	1.773790	0.04118	U	0.315852	T	0.18383	0.0441	N	0.08118	0	0.09310	N	1	B	0.25609	0.13	B	0.21917	0.037	T	0.25012	-1.0144	10	0.15499	T	0.54	0.3492	3.4931	0.07645	0.1653:0.1862:0.0:0.6486	.	251	O15054-1	.	S	251	ENSP00000254846:L251S;ENSP00000412513:L251S	ENSP00000254846:L251S	L	+	2	0	KDM6B	7690902	0.726000	0.28059	0.844000	0.33320	0.850000	0.48378	0.575000	0.23729	0.410000	0.25675	0.379000	0.24179	TTA	.		0.612	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
ACSM5	54988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20442583	20442583	+	Missense_Mutation	SNP	G	G	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:20442583G>C	ENST00000331849.4	+	10	1395	c.1248G>C	c.(1246-1248)gaG>gaC	p.E416D		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	416					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CTGGAGAAGAGGGGAATGTTG	0.527																																					p.E416D		.											.	.	.	0			c.G1248C						.						185.0	154.0	164.0					16																	20442583		2203	4300	6503	SO:0001583	missense	54988	exon10			AGAAGAGGGGAAT		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1248G>C	16.37:g.20442583G>C	ENSP00000327916:p.Glu416Asp	Somatic	43	0		WXS	Illumina HiSeq	.	30	4	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563519	0.65651	.	.	ENSG00000183549	ENST00000331849	T	0.42900	0.96	4.37	1.26	0.21427	AMP-dependent synthetase/ligase (1);	0.114998	0.38005	N	0.001860	T	0.48187	0.1486	M	0.80028	2.48	0.29766	N	0.835188	B	0.34061	0.436	B	0.43575	0.424	T	0.52465	-0.8572	10	0.72032	D	0.01	-13.6579	6.318	0.21202	0.4827:0.0:0.5173:0.0	.	416	Q6NUN0	ACSM5_HUMAN	D	416	ENSP00000327916:E416D	ENSP00000327916:E416D	E	+	3	2	ACSM5	20350084	1.000000	0.71417	0.985000	0.45067	0.899000	0.52679	0.572000	0.23684	0.392000	0.25172	0.650000	0.86243	GAG	.		0.527	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
VPS54	51542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	64189236	64189236	+	Silent	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:64189236T>C	ENST00000272322.4	-	7	1120	c.966A>G	c.(964-966)acA>acG	p.T322T	VPS54_ENST00000409558.4_Silent_p.T310T|VPS54_ENST00000354504.3_Silent_p.T205T			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	322					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						GAACCTCTTGTGTTGTTGCTA	0.378																																					p.T322T		.											.	.	.	0			c.A966G						.						126.0	125.0	125.0					2																	64189236		2203	4300	6503	SO:0001819	synonymous_variant	51542	exon7			CTCTTGTGTTGTT	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.966A>G	2.37:g.64189236T>C		Somatic	93	0		WXS	Illumina HiSeq	.	66	27	NM_016516	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Silent	SNP	ENST00000272322.4	37	CCDS33208.1																																																																																			.		0.378	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
TUBD1	51174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57944110	57944110	+	Splice_Site	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:57944110C>A	ENST00000592426.1	-	6	935	c.935G>T	c.(934-936)gGt>gTt	p.G312V	TUBD1_ENST00000340993.6_Splice_Site_p.G257V|TUBD1_ENST00000394239.3_Splice_Site_p.G312V|TUBD1_ENST00000346141.6_Splice_Site_p.G58V|TUBD1_ENST00000325752.3_Splice_Site_p.G312V|TUBD1_ENST00000376094.4_Intron|TUBD1_ENST00000539018.1_Splice_Site_p.G96V			Q9UJT1	TBD_HUMAN	tubulin, delta 1	312					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CCTATCAATACCTACCAAAAG	0.393																																					p.G312V		.											.	.	.	0			c.G935T						.						54.0	50.0	51.0					17																	57944110		2203	4300	6503	SO:0001630	splice_region_variant	51174	exon7			TCAATACCTACCA	AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.935-1G>T	17.37:g.57944110C>A		Somatic	70	0		WXS	Illumina HiSeq	.	57	24	NM_016261	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	37	CCDS11620.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.063418	0.55432	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000539018	T;T;T;T	0.80566	-1.13;-0.77;-1.39;-0.8	5.4	5.4	0.78164	Tubulin/FtsZ, C-terminal (1);	0.097701	0.64402	D	0.000001	D	0.91036	0.7180	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.997;0.988;0.996	D;D;D;D;D	0.97110	0.98;1.0;0.964;0.925;0.943	D	0.91161	0.4961	10	0.52906	T	0.07	.	19.5343	0.95242	0.0:1.0:0.0:0.0	.	312;58;257;257;312	E9PCA7;Q9UJT1-3;Q5KU37;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	V	312;257;58;312;96	ENSP00000320797:G312V;ENSP00000342399:G257V;ENSP00000342561:G58V;ENSP00000377785:G312V	ENSP00000320797:G312V	G	-	2	0	TUBD1	55298892	1.000000	0.71417	0.998000	0.56505	0.119000	0.20118	5.048000	0.64238	2.684000	0.91462	0.650000	0.86243	GGT	.		0.393	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261	Missense_Mutation
CAD	790	hgsc.bcm.edu;bcgsc.ca	37	2	27447924	27447924	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:27447924G>A	ENST00000403525.1	+	11	1577	c.1433G>A	c.(1432-1434)gGc>gAc	p.G478D	CAD_ENST00000264705.4_Missense_Mutation_p.G478D			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTTTTGGGGGCCAGACTGCT	0.582																																					p.G478D		.											.	.	.	0			c.G1433A						.						90.0	83.0	85.0					2																	27447924		2203	4300	6503	SO:0001583	missense	790	exon11			TTGGGGGCCAGAC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.1433G>A	2.37:g.27447924G>A	ENSP00000384510:p.Gly478Asp	Somatic	59	0		WXS	Illumina HiSeq	.	54	4	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	G	27.5	4.834421	0.91036	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.99755	-6.64;-6.64	5.54	4.65	0.58169	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	H	0.99922	4.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	D	0.95883	0.8900	10	0.87932	D	0	1.3919	14.9752	0.71267	0.0:0.1437:0.8563:0.0	.	478;478	F8VPD4;P27708	.;PYR1_HUMAN	D	478	ENSP00000264705:G478D;ENSP00000384510:G478D	ENSP00000264705:G478D	G	+	2	0	CAD	27301428	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.229000	0.95273	1.292000	0.44672	0.462000	0.41574	GGC	.		0.582	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
ARFGAP2	84364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47196607	47196607	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:47196607G>T	ENST00000524782.1	-	5	667	c.439C>A	c.(439-441)Cca>Aca	p.P147T	ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000426335.2_Intron|ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000419701.2_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	147	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						TTCTTCTCTGGGGAGTGATTA	0.478																																					p.P147T		.											.	.	.	0			c.C439A						.						307.0	319.0	315.0					11																	47196607		2201	4298	6499	SO:0001583	missense	84364	exon5			TCTCTGGGGAGTG	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.439C>A	11.37:g.47196607G>T	ENSP00000434442:p.Pro147Thr	Somatic	59	0		WXS	Illumina HiSeq	.	49	17	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.712620	0.68730	.	.	ENSG00000149182	ENST00000524782;ENST00000525398;ENST00000525314;ENST00000528444;ENST00000530596	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.52	5.52	0.82312	.	0.165679	0.53938	D	0.000056	T	0.57330	0.2046	M	0.77313	2.365	0.80722	D	1	D;P	0.55172	0.97;0.847	P;B	0.53809	0.735;0.293	T	0.57871	-0.7736	10	0.38643	T	0.18	-12.5506	15.009	0.71536	0.0:0.1418:0.8582:0.0	.	147;147	B7Z6H9;Q8N6H7	.;ARFG2_HUMAN	T	147;147;147;147;140	ENSP00000434442:P147T;ENSP00000431939:P147T;ENSP00000434809:P147T;ENSP00000431684:P147T;ENSP00000435488:P140T	ENSP00000434442:P147T	P	-	1	0	ARFGAP2	47153183	1.000000	0.71417	0.995000	0.50966	0.674000	0.39518	3.621000	0.54210	2.595000	0.87683	0.655000	0.94253	CCA	.		0.478	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
ITGAX	3687	hgsc.bcm.edu	37	16	31372509	31372509	+	Silent	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:31372509G>T	ENST00000268296.4	+	9	1108	c.987G>T	c.(985-987)ctG>ctT	p.L329L	ITGAX_ENST00000562522.1_Silent_p.L329L	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	329	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.L329L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						AAAACCAACTGAAGGAGAAGA	0.453																																					p.L329L		.											ITGAX,NS,carcinoma,0,1	ITGAX	0	1	Substitution - coding silent(1)	lung(1)	c.G987T						.						125.0	133.0	130.0					16																	31372509		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon9			CCAACTGAAGGAG	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.987G>T	16.37:g.31372509G>T		Somatic	71	0		WXS	Illumina HiSeq	.	48	2	NM_000887	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1																																																																																			.		0.453	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
GPR179	440435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36483728	36483728	+	Silent	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:36483728C>T	ENST00000342292.4	-	11	5744	c.5724G>A	c.(5722-5724)ttG>ttA	p.L1908L	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1908					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTGTTGCTTCCAAGGAATGTC	0.517																																					p.L1908L		.											.	.	.	0			c.G5724A						.						82.0	80.0	81.0					17																	36483728		1922	4146	6068	SO:0001819	synonymous_variant	440435	exon11			TGCTTCCAAGGAA		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5724G>A	17.37:g.36483728C>T		Somatic	16	0		WXS	Illumina HiSeq	.	33	10	NM_001004334		Silent	SNP	ENST00000342292.4	37	CCDS42308.1																																																																																			.		0.517	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
KREMEN2	79412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	3016345	3016345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:3016345C>A	ENST00000303746.5	+	4	958	c.381C>A	c.(379-381)tgC>tgA	p.C127*	KREMEN2_ENST00000571007.1_Nonsense_Mutation_p.C127*|KREMEN2_ENST00000572045.1_Nonsense_Mutation_p.C127*|KREMEN2_ENST00000575885.1_Nonsense_Mutation_p.C127*|PAQR4_ENST00000318782.8_5'Flank|PAQR4_ENST00000293978.8_5'Flank|PAQR4_ENST00000576565.1_5'Flank|KREMEN2_ENST00000319500.6_Nonsense_Mutation_p.C127*|KREMEN2_ENST00000575769.1_Nonsense_Mutation_p.C127*|PKMYT1_ENST00000571102.1_5'Flank			Q8NCW0	KREM2_HUMAN	kringle containing transmembrane protein 2	127	WSC. {ECO:0000255|PROSITE- ProRule:PRU00558, ECO:0000305}.				Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|large_intestine(1)	4						ACCTGGGATGCTTTGTGGACT	0.642																																					p.C127X		.											.	.	.	0			c.C381A						.						103.0	115.0	111.0					16																	3016345		2198	4300	6498	SO:0001587	stop_gained	79412	exon4			GGGATGCTTTGTG	BC003533	CCDS10483.1, CCDS10484.1, CCDS58412.1, CCDS58413.1	16p13.11	2008-08-04			ENSG00000131650	ENSG00000131650			18797	protein-coding gene	gene with protein product		609899				12050670	Standard	NM_172229		Approved	MGC10791, KRM2	uc002csg.3	Q8NCW0	OTTHUMG00000128976	ENST00000303746.5:c.381C>A	16.37:g.3016345C>A	ENSP00000304422:p.Cys127*	Somatic	49	0		WXS	Illumina HiSeq	.	36	11	NM_001253725	B4DXF6|I3L2S2|Q8N2J4|Q8NCW1|Q96GL8|Q9BTP9	Nonsense_Mutation	SNP	ENST00000303746.5	37	CCDS10483.1	.	.	.	.	.	.	.	.	.	.	C	39	7.482206	0.98312	.	.	ENSG00000131650	ENST00000303746;ENST00000319500	.	.	.	4.81	3.84	0.44239	.	0.000000	0.48767	D	0.000166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3091	0.49353	0.0:0.907:0.0:0.093	.	.	.	.	X	127	.	ENSP00000304422:C127X	C	+	3	2	KREMEN2	2956346	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	1.445000	0.35079	2.217000	0.71921	0.462000	0.41574	TGC	.		0.642	KREMEN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250964.2	NM_145347	
NFKB2	4791	hgsc.bcm.edu	37	10	104157131	104157131	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:104157131G>T	ENST00000369966.3	+	7	718	c.468G>T	c.(466-468)agG>agT	p.R156S	NFKB2_ENST00000428099.1_Missense_Mutation_p.R156S|NFKB2_ENST00000189444.6_Missense_Mutation_p.R156S	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	156	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	AACTTCAGAGGCAGCGGCTCC	0.567			T	IGH@	B-NHL																																p.R156S		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	.	.	0			c.G468T						.						90.0	93.0	92.0					10																	104157131		1883	4112	5995	SO:0001583	missense	4791	exon7			TCAGAGGCAGCGG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.468G>T	10.37:g.104157131G>T	ENSP00000358983:p.Arg156Ser	Somatic	60	0		WXS	Illumina HiSeq	.	60	4	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173192	0.38413	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.39997	1.05;1.05;1.05	5.4	4.49	0.54785	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.289830	0.38897	N	0.001540	T	0.39200	0.1069	L	0.55990	1.75	0.48288	D	0.999625	B;P;P	0.46142	0.195;0.873;0.638	B;B;B	0.42087	0.083;0.375;0.245	T	0.24621	-1.0155	10	0.45353	T	0.12	.	10.5579	0.45129	0.1484:0.0:0.8516:0.0	.	156;156;156	D3DR86;Q00653;A8K9D9	.;NFKB2_HUMAN;.	S	156	ENSP00000410256:R156S;ENSP00000358983:R156S;ENSP00000189444:R156S	ENSP00000189444:R156S	R	+	3	2	NFKB2	104147121	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.694000	0.47035	1.271000	0.44313	0.561000	0.74099	AGG	.		0.567	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
GGNBP1	449520	hgsc.bcm.edu;bcgsc.ca	37	6	33556722	33556722	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr6:33556722G>T	ENST00000374458.1	+	6	879	c.249G>T	c.(247-249)agG>agT	p.R83S	LINC00336_ENST00000477984.1_RNA			Q5YKI7	GGNB1_HUMAN	gametogenetin binding protein 1 (pseudogene)	83	Interaction with GGN. {ECO:0000250}.				cell differentiation (GO:0030154)|mitochondrial fission (GO:0000266)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)											GAAGACTGAGGCATCTTCCTT	0.597																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	449520	.			ACTGAGGCATCTT			6p21	2012-04-19	2012-04-19		ENSG00000204188	ENSG00000204188			19427	pseudogene	pseudogene		609495	"""gametogenetin binding protein 1"""			15642376	Standard	NR_028361		Approved		uc021ywq.1	Q5YKI7		ENST00000374458.1:c.249G>T	6.37:g.33556722G>T	ENSP00000363582:p.Arg83Ser	Somatic	36	0		WXS	Illumina HiSeq	.	45	4	.	Q5YKI8	RNA	SNP	ENST00000374458.1	37		.	.	.	.	.	.	.	.	.	.	G	15.34	2.804390	0.50315	.	.	ENSG00000204188	ENST00000374458	.	.	.	4.34	-2.29	0.06805	.	.	.	.	.	T	0.03695	0.0105	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37244	-0.9714	5	0.12103	T	0.63	-25.7977	1.4818	0.02438	0.1233:0.3396:0.2365:0.3006	.	.	.	.	S	83	.	ENSP00000363582:R83S	R	+	3	2	GGNBP1	33664700	0.000000	0.05858	0.000000	0.03702	0.147000	0.21601	-0.433000	0.06948	-0.265000	0.09352	0.650000	0.86243	AGG	.		0.597	GGNBP1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
CHEK2	11200	hgsc.bcm.edu	37	22	29083913	29083913	+	Missense_Mutation	SNP	C	C	T	rs544216926	byFrequency	TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr22:29083913C>T	ENST00000405598.1	-	16	1795	c.1604G>A	c.(1603-1605)cGc>cAc	p.R535H	CHEK2_ENST00000382565.1_Missense_Mutation_p.R155H|CHEK2_ENST00000382578.1_Missense_Mutation_p.R444H|CHEK2_ENST00000328354.6_Missense_Mutation_p.R535H|CHEK2_ENST00000402731.1_Missense_Mutation_p.R506H|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000404276.1_Missense_Mutation_p.R535H|CHEK2_ENST00000544772.1_Missense_Mutation_p.R314H|CHEK2_ENST00000382580.2_Missense_Mutation_p.R578H|CHEK2_ENST00000403642.1_Missense_Mutation_p.R444H|CHEK2_ENST00000348295.3_Missense_Mutation_p.R506H			O96017	CHK2_HUMAN	checkpoint kinase 2	535					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CACAGCTGGGCGCTTTGTGGT	0.458			F			breast		Direct reversal of damage;Other conserved DNA damage response genes					C|||	2	0.000399361	0.0	0.0	5008	,	,		18131	0.0		0.0	False		,,,				2504	0.002				p.R578H		.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	CHEK2,NS,carcinoma,0,15	CHEK2	0	0			c.G1733A						.						42.0	44.0	44.0					22																	29083913		1368	2307	3675	SO:0001583	missense	11200	exon16			GCTGGGCGCTTTG	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1604G>A	22.37:g.29083913C>T	ENSP00000386087:p.Arg535His	Somatic	69	1		WXS	Illumina HiSeq	.	38	3	NM_001005735	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	37	CCDS13843.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.39|19.39	3.819005|3.819005	0.71028|0.71028	.|.	.|.	ENSG00000183765|ENSG00000183765	ENST00000434810;ENST00000456369|ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382563;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	.|T;T;T;T;T;T;T;T;T;T	.|0.68331	.|0.76;-0.26;-0.32;-0.26;-0.27;-0.27;-0.27;-0.23;-0.26;0.76	4.76|4.76	2.63|2.63	0.31362|0.31362	.|.	.|0.439613	.|0.22360	.|N	.|0.061096	T|T	0.64349|0.64349	0.2590|0.2590	N|N	0.24115|0.24115	0.695|0.695	0.20926|0.20926	N|N	0.999824|0.999824	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.958;0.999;0.999;0.99;0.998	.|D;B;P;P;P;P	.|0.63703	.|0.917;0.431;0.826;0.897;0.469;0.78	T|T	0.52646|0.52646	-0.8548|-0.8548	5|10	.|0.48119	.|T	.|0.1	-4.4609|-4.4609	7.9154|7.9154	0.29814|0.29814	0.0:0.798:0.0:0.202|0.0:0.798:0.0:0.202	.|.	.|444;314;535;506;535;578	.|O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.|.;.;.;.;CHK2_HUMAN;.	T|H	268;136|506;444;155;218;314;535;535;535;578;444;506	.|ENSP00000329012:R506H;ENSP00000372021:R444H;ENSP00000372006:R155H;ENSP00000442458:R314H;ENSP00000329178:R535H;ENSP00000385747:R535H;ENSP00000386087:R535H;ENSP00000372023:R578H;ENSP00000384919:R444H;ENSP00000384835:R506H	.|ENSP00000329178:R535H	A|R	-|-	1|2	0|0	CHEK2|CHEK2	27413913|27413913	0.360000|0.360000	0.24964|0.24964	0.833000|0.833000	0.33012|0.33012	0.169000|0.169000	0.22640|0.22640	0.471000|0.471000	0.22100|0.22100	1.136000|1.136000	0.42199|0.42199	0.557000|0.557000	0.71058|0.71058	GCC|CGC	.		0.458	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
VPS26A	9559	hgsc.bcm.edu	37	10	70892799	70892799	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:70892799G>T	ENST00000373382.1	+	3	802	c.149G>T	c.(148-150)gGa>gTa	p.G50V	VPS26A_ENST00000395098.1_Missense_Mutation_p.G50V|VPS26A_ENST00000263559.6_Missense_Mutation_p.G50V|VPS26A_ENST00000546041.1_Nonsense_Mutation_p.E8*|VPS26A_ENST00000489794.1_Missense_Mutation_p.G25V|VPS26A_ENST00000541711.1_5'UTR|VPS26A_ENST00000490696.1_3'UTR			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	50					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						TCCGTTTCAGGAAAGGTAAAT	0.328																																					p.G50V	Colon(90;545 1358 4729 6702 16773)	.											.	.	.	0			c.G149T						.						82.0	78.0	80.0					10																	70892799		2203	4300	6503	SO:0001583	missense	9559	exon2			TTTCAGGAAAGGT	AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.149G>T	10.37:g.70892799G>T	ENSP00000362480:p.Gly50Val	Somatic	53	0		WXS	Illumina HiSeq	.	55	4	NM_004896	A8MZ56|B2RDD3|Q8TBH4|Q9H982	Missense_Mutation	SNP	ENST00000373382.1	37	CCDS7286.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.040396|8.040396	0.98624|0.98624	.|.	.|.	ENSG00000122958|ENSG00000122958	ENST00000546041|ENST00000373382;ENST00000263559;ENST00000395098	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.87525	.|0.6199	H|H	0.94620|0.94620	3.56|3.56	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.998;0.999	.|P;D	.|0.85130	.|0.893;0.997	.|D	.|0.90136	.|0.4210	.|9	0.30078|0.62326	T|D	0.28|0.03	-4.3708|-4.3708	19.5924|19.5924	0.95520|0.95520	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|50;50	.|A8MZ56;O75436	.|.;VP26A_HUMAN	X|V	8|50	.|.	ENSP00000446081:E8X|ENSP00000263559:G50V	E|G	+|+	1|2	0|0	VPS26A|VPS26A	70562805|70562805	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	9.763000|9.763000	0.98947|0.98947	2.689000|2.689000	0.91719|0.91719	0.655000|0.655000	0.94253|0.94253	GAA|GGA	.		0.328	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048403.1	NM_004896	
TAS2R41	259287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	143175419	143175419	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr7:143175419A>G	ENST00000408916.1	+	1	454	c.454A>G	c.(454-456)Aac>Gac	p.N152D	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	152					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					TTTTTGGGTGAACTACCCTGT	0.443																																					p.N152D		.											.	.	.	0			c.A454G						.						47.0	47.0	47.0					7																	143175419		1855	4101	5956	SO:0001583	missense	259287	exon1			TGGGTGAACTACC	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.454A>G	7.37:g.143175419A>G	ENSP00000386201:p.Asn152Asp	Somatic	30	0		WXS	Illumina HiSeq	.	29	4	NM_176883	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	37	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790459	0.31685	.	.	ENSG00000221855	ENST00000408916	T	0.37235	1.21	5.7	4.54	0.55810	.	0.372050	0.22816	U	0.055290	T	0.42131	0.1189	M	0.66439	2.03	0.09310	N	1	P	0.41102	0.738	P	0.44921	0.464	T	0.36529	-0.9744	10	0.62326	D	0.03	.	9.8374	0.40977	0.9187:0.0:0.0813:0.0	.	152	P59536	T2R41_HUMAN	D	152	ENSP00000386201:N152D	ENSP00000386201:N152D	N	+	1	0	TAS2R41	142885541	0.057000	0.20700	0.033000	0.17914	0.008000	0.06430	1.759000	0.38420	0.985000	0.38656	0.533000	0.62120	AAC	.		0.443	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
B3GNT6	192134	hgsc.bcm.edu	37	11	76751604	76751604	+	Splice_Site	SNP	T	T	C	rs11292200		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:76751604T>C	ENST00000354301.5	+	5	1094	c.1006T>C	c.(1006-1008)Ttg>Ctg	p.L336L	B3GNT6_ENST00000533140.1_Silent_p.L337L|B3GNT6_ENST00000421061.1_Silent_p.L215L	NM_138706.3	NP_619651.3	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCGTGCAGCTTGCCTGGCGC	0.667																																					.		.											.,6	.	27	0			c.1006+1T>C						.						2.0	2.0	2.0					11																	76751604		1100	2039	3139	SO:0001630	splice_region_variant	192134	exon4			TGCAGCTTGCCTG	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000354301.5:c.1006-1T>C	11.37:g.76751604T>C		Somatic	16	1		WXS	Illumina HiSeq	.	16	3	NM_138706	Q4TTN0	Splice_Site	SNP	ENST00000354301.5	37		.	.	.	.	.	.	.	.	.	.	-	0.001	-71.507872	0.00000	.	.	ENSG00000198488	ENST00000354301	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	B3GNT6	76429252	0.186000	0.23225	0.999000	0.59377	0.794000	0.44872	-0.076000	0.11412	0.000000	0.14550	0.000000	0.15137	.	.		0.667	B3GNT6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138706	Silent
GPR160	26996	hgsc.bcm.edu	37	3	169802126	169802126	+	Silent	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr3:169802126G>T	ENST00000355897.5	+	4	974	c.366G>T	c.(364-366)ctG>ctT	p.L122L		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ATTATTGCCTGAATTTCTCTA	0.294																																					p.L122L		.											GPR160,NS,carcinoma,+1,1	GPR160	+1	0			c.G366T						.						45.0	49.0	47.0					3																	169802126		2203	4299	6502	SO:0001819	synonymous_variant	26996	exon4			TTGCCTGAATTTC	AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.366G>T	3.37:g.169802126G>T		Somatic	31	0		WXS	Illumina HiSeq	.	31	2	NM_014373	D3DNQ2	Silent	SNP	ENST00000355897.5	37	CCDS3211.1																																																																																			.		0.294	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352167.1	NM_014373	
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	48063949	48063949	+	Silent	SNP	A	A	G			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:48063949A>G	ENST00000316364.5	+	19	3628	c.3189A>G	c.(3187-3189)ccA>ccG	p.P1063P	SEMA6D_ENST00000389432.2_Silent_p.P1020P|SEMA6D_ENST00000537942.1_Silent_p.P1001P|SEMA6D_ENST00000389428.3_Silent_p.P988P|SEMA6D_ENST00000358066.4_Silent_p.P1001P|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389433.2_Silent_p.P1044P|SEMA6D_ENST00000558014.1_Silent_p.P1001P|SEMA6D_ENST00000354744.4_Silent_p.P1007P|SEMA6D_ENST00000536845.2_Silent_p.P1063P|SEMA6D_ENST00000558816.1_3'UTR	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	1063					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTCAAACCCCATCTGTCAGAC	0.488																																					p.P1063P		.											.	.	.	0			c.A3189G						.						171.0	170.0	171.0					15																	48063949		2198	4296	6494	SO:0001819	synonymous_variant	80031	exon19			AACCCCATCTGTC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.3189A>G	15.37:g.48063949A>G		Somatic	32	0		WXS	Illumina HiSeq	.	18	8	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																			.		0.488	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
KDM4A	9682	hgsc.bcm.edu	37	1	44133482	44133482	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:44133482G>T	ENST00000372396.3	+	9	1089	c.955G>T	c.(955-957)Gtg>Ttg	p.V319L		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	319					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V319M(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						CTCCATGGATGTGTTTGTGAG	0.502																																					p.V319L		.											KDM4A,NS,carcinoma,0,1	KDM4A	0	1	Substitution - Missense(1)	endometrium(1)	c.G955T						.						113.0	104.0	107.0					1																	44133482		2203	4300	6503	SO:0001583	missense	9682	exon9			ATGGATGTGTTTG	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.955G>T	1.37:g.44133482G>T	ENSP00000361473:p.Val319Leu	Somatic	53	0		WXS	Illumina HiSeq	.	44	2	NM_014663	Q5VVB1	Missense_Mutation	SNP	ENST00000372396.3	37	CCDS491.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897282	0.91962	.	.	ENSG00000066135	ENST00000372396	T	0.71103	-0.54	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.83839	0.5341	M	0.79123	2.44	0.58432	D	0.99999	P;D	0.60160	0.655;0.987	B;D	0.66716	0.139;0.946	T	0.77659	-0.2505	10	0.18276	T	0.48	-15.9843	20.8794	0.99867	0.0:0.0:1.0:0.0	.	319;319	B4DT38;O75164	.;KDM4A_HUMAN	L	319	ENSP00000361473:V319L	ENSP00000361473:V319L	V	+	1	0	KDM4A	43906069	1.000000	0.71417	0.998000	0.56505	0.752000	0.42762	6.631000	0.74277	2.941000	0.99782	0.655000	0.94253	GTG	.		0.502	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
ATP5O	539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35276306	35276306	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr21:35276306A>T	ENST00000290299.2	-	6	677	c.461T>A	c.(460-462)cTc>cAc	p.L154H	AP000304.12_ENST00000429238.1_Intron	NM_001697.2	NP_001688.1	P48047	ATPO_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	154					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	5						TAATTCAGAGAGTGTGGCTTC	0.383																																					p.L154H		.											.	.	.	0			c.T461A						.						96.0	92.0	94.0					21																	35276306		2203	4300	6503	SO:0001583	missense	539	exon6			TCAGAGAGTGTGG	AF088071	CCDS13634.1	21q22	2012-10-12	2008-07-31		ENSG00000241837	ENSG00000241837	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	850	protein-coding gene	gene with protein product	"""oligomycin sensitivity conferring protein"""	600828				7490082	Standard	NM_001697		Approved	OSCP, ATPO		P48047	OTTHUMG00000065186	ENST00000290299.2:c.461T>A	21.37:g.35276306A>T	ENSP00000290299:p.Leu154His	Somatic	150	0		WXS	Illumina HiSeq	.	157	23	NM_001697	B2R4E2|Q5U042|Q6IBI2	Missense_Mutation	SNP	ENST00000290299.2	37	CCDS13634.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981390	0.74474	.	.	ENSG00000241837	ENST00000290299	T	0.48201	0.82	5.68	5.68	0.88126	.	0.054842	0.85682	D	0.000000	T	0.75428	0.3848	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.80432	-0.1385	10	0.46703	T	0.11	-16.3896	15.5825	0.76455	1.0:0.0:0.0:0.0	.	154	P48047	ATPO_HUMAN	H	154	ENSP00000290299:L154H	ENSP00000290299:L154H	L	-	2	0	ATP5O	34198176	1.000000	0.71417	0.087000	0.20705	0.881000	0.50899	7.831000	0.86748	2.156000	0.67533	0.459000	0.35465	CTC	.		0.383	ATP5O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139907.1	NM_001697	
ZNF821	55565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71894451	71894451	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:71894451C>T	ENST00000565601.1	-	7	1116	c.709G>A	c.(709-711)Gtg>Atg	p.V237M	ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000313565.6_Missense_Mutation_p.V195M|ZNF821_ENST00000564134.1_3'UTR|ZNF821_ENST00000446827.2_Missense_Mutation_p.V195M|ZNF821_ENST00000425432.1_Missense_Mutation_p.V237M	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						TTGTTGCACACAAGCAGAATT	0.532																																					p.V237M		.											.	.	.	0			c.G709A						.						121.0	109.0	113.0					16																	71894451		2198	4300	6498	SO:0001583	missense	55565	exon7			TGCACACAAGCAG	AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.709G>A	16.37:g.71894451C>T	ENSP00000455648:p.Val237Met	Somatic	48	0		WXS	Illumina HiSeq	.	29	14	NM_001201553	A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	ENST00000565601.1	37	CCDS56006.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382951	0.82792	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01464	6.45;4.86;4.86	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.07954	0.0199	L	0.42245	1.32	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.80764	0.991;0.994;0.991	T	0.16129	-1.0413	10	0.54805	T	0.06	-14.7095	19.6787	0.95950	0.0:1.0:0.0:0.0	.	237;195;237	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	M	237;195;195	ENSP00000398089:V237M;ENSP00000313822:V195M;ENSP00000405908:V195M	ENSP00000313822:V195M	V	-	1	0	ZNF821	70451952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.294000	0.78760	2.636000	0.89361	0.655000	0.94253	GTG	.		0.532	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	NM_017530	
VPS13A	23230	hgsc.bcm.edu	37	9	79936212	79936212	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr9:79936212G>T	ENST00000360280.3	+	43	5803	c.5543G>T	c.(5542-5544)tGt>tTt	p.C1848F	VPS13A_ENST00000357409.5_Missense_Mutation_p.C1848F|VPS13A_ENST00000376636.3_Missense_Mutation_p.C1809F|VPS13A_ENST00000376634.4_Missense_Mutation_p.C1848F	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1848					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTATCCAAATGTGGTCTTGTA	0.299																																					p.C1848F		.											VPS13A_ENST00000376634,NS,lymphoid_neoplasm,0,3	VPS13A_ENST00000376634	0	0			c.G5543T						.						37.0	37.0	37.0					9																	79936212		2201	4279	6480	SO:0001583	missense	23230	exon43			CCAAATGTGGTCT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5543G>T	9.37:g.79936212G>T	ENSP00000353422:p.Cys1848Phe	Somatic	61	0		WXS	Illumina HiSeq	.	59	2	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.91|18.91	3.724085|3.724085	0.68959|0.68959	.|.	.|.	ENSG00000197969|ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409|ENST00000419472	T;T;T;T|.	0.42513|.	0.97;0.97;0.97;0.97|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.053207|.	0.85682|.	D|.	0.000000|.	T|T	0.75657|0.75657	0.3879|0.3879	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.69078|.	0.997;0.958;0.991;0.981;0.981|.	D;P;P;P;P|.	0.65874|.	0.939;0.837;0.781;0.855;0.855|.	T|T	0.74899|0.74899	-0.3507|-0.3507	10|5	0.62326|.	D|.	0.03|.	.|.	16.3282|16.3282	0.82996|0.82996	0.0:0.0:0.8674:0.1326|0.0:0.0:0.8674:0.1326	.|.	100;1809;1848;1848;1848|.	B1ALW4;Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4|.	.;.;VP13A_HUMAN;.;.|.	F|L	1848;1809;1848;1848|101	ENSP00000365821:C1848F;ENSP00000365823:C1809F;ENSP00000353422:C1848F;ENSP00000349985:C1848F|.	ENSP00000349985:C1848F|.	C|V	+|+	2|1	0|0	VPS13A|VPS13A	79126032|79126032	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.055000|6.055000	0.71103|0.71103	2.743000|2.743000	0.94032|0.94032	0.585000|0.585000	0.79938|0.79938	TGT|GTG	.		0.299	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
MUC7	4589	hgsc.bcm.edu;broad.mit.edu	37	4	71347033	71347033	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:71347033C>A	ENST00000304887.5	+	3	762	c.572C>A	c.(571-573)gCc>gAc	p.A191D	MUC7_ENST00000413702.1_Missense_Mutation_p.A191D|MUC7_ENST00000456088.1_Missense_Mutation_p.A191D	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	191	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A191V(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCACAGCTGCCCCACCCACA	0.587																																					p.A191D		.											MUC7,NS,carcinoma,0,2	MUC7	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C572A						.						359.0	290.0	314.0					4																	71347033		2203	4300	6503	SO:0001583	missense	4589	exon4			CAGCTGCCCCACC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.572C>A	4.37:g.71347033C>A	ENSP00000302021:p.Ala191Asp	Somatic	63	0		WXS	Illumina HiSeq	.	50	4	NM_001145007	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	7.629	0.678450	0.14841	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.60171	0.21;0.21;0.21	1.73	1.73	0.24493	.	.	.	.	.	T	0.52613	0.1745	L	0.27053	0.805	0.09310	N	1	D	0.69078	0.997	P	0.59288	0.855	T	0.36089	-0.9762	8	.	.	.	.	4.1514	0.10240	0.0:0.792:0.0:0.208	.	191	Q8TAX7	MUC7_HUMAN	D	191	ENSP00000407422:A191D;ENSP00000400585:A191D;ENSP00000302021:A191D	.	A	+	2	0	MUC7	71381622	0.000000	0.05858	0.058000	0.19502	0.018000	0.09664	0.323000	0.19593	1.273000	0.44346	0.655000	0.94253	GCC	.		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
CCDC109B	55013	hgsc.bcm.edu	37	4	110605624	110605624	+	Missense_Mutation	SNP	C	C	T	rs149233225	byFrequency	TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:110605624C>T	ENST00000394650.4	+	6	771	c.638C>T	c.(637-639)tCg>tTg	p.S213L		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	213					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		GAAGCTCATTCGGAAGCCAAA	0.493													C|||	3	0.000599042	0.0015	0.0014	5008	,	,		17150	0.0		0.0	False		,,,				2504	0.0				p.S213L		.											CCDC109B_ENST00000394650,NS,carcinoma,0,2	CCDC109B_ENST00000394650	0	0			c.C638T						.	C	LEU/SER	10,4396	17.9+/-39.9	0,10,2193	94.0	89.0	91.0		638	5.6	0.2	4	dbSNP_134	91	0,8600		0,0,4300	yes	missense	CCDC109B	NM_017918.4	145	0,10,6493	TT,TC,CC		0.0,0.227,0.0769	possibly-damaging	213/337	110605624	10,12996	2203	4300	6503	SO:0001583	missense	55013	exon6			CTCATTCGGAAGC	BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.638C>T	4.37:g.110605624C>T	ENSP00000378145:p.Ser213Leu	Somatic	28	0		WXS	Illumina HiSeq	.	28	2	NM_017918	A8K4Y3|Q6IAC1	Missense_Mutation	SNP	ENST00000394650.4	37	CCDS3683.2	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250752	0.39797	0.00227	0.0	ENSG00000005059	ENST00000394650	T	0.28069	1.63	5.57	5.57	0.84162	Coiled-coil domain containing protein 109, C-terminal (1);	0.205895	0.42682	D	0.000678	T	0.48696	0.1514	M	0.80183	2.485	0.09310	N	1	D	0.57257	0.979	P	0.52514	0.701	T	0.52859	-0.8519	10	0.87932	D	0	-8.3825	13.8044	0.63220	0.0:0.9268:0.0:0.0732	.	213	Q9NWR8	C109B_HUMAN	L	213	ENSP00000378145:S213L	ENSP00000378145:S213L	S	+	2	0	CCDC109B	110825073	0.054000	0.20591	0.176000	0.23000	0.071000	0.16799	1.653000	0.37323	2.602000	0.87976	0.591000	0.81541	TCG	0.000		0.493	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254865.1	NM_017918	
IDH2	3418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90631837	90631837	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:90631837C>A	ENST00000330062.3	-	4	629	c.516G>T	c.(514-516)agG>agT	p.R172S	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000540499.2_Missense_Mutation_p.R120S|IDH2_ENST00000539790.1_Missense_Mutation_p.R42S	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	172					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R172S(17)|p.R172N(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CATGGGCGTGCCTGCCAATGG	0.637			M		GBM																																p.R172S		.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	IDH2,NS,haematopoietic_neoplasm,-1,19	IDH2	-1	18	Substitution - Missense(18)	bone(11)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|biliary_tract(1)|large_intestine(1)	c.G516T						.						85.0	80.0	82.0					15																	90631837		2200	4298	6498	SO:0001583	missense	3418	exon4			GGCGTGCCTGCCA		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.516G>T	15.37:g.90631837C>A	ENSP00000331897:p.Arg172Ser	Somatic	38	0		WXS	Illumina HiSeq	.	37	13	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	37	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068847	0.36470	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.86865	-2.18;-2.18;-2.18	5.93	-3.19	0.05171	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	H	0.98487	4.245	0.53005	D	0.99996	D	0.89917	1.0	D	0.91635	0.999	D	0.89382	0.3682	10	0.87932	D	0	.	5.0108	0.14312	0.237:0.2848:0.0:0.4782	.	172	P48735	IDHP_HUMAN	S	172;42;120	ENSP00000331897:R172S;ENSP00000438457:R42S;ENSP00000446147:R120S	ENSP00000331897:R172S	R	-	3	2	IDH2	88432841	0.145000	0.22656	0.004000	0.12327	0.001000	0.01503	-0.449000	0.06812	-0.649000	0.05430	-1.288000	0.01363	AGG	.		0.637	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
LINC01219	104355220	hgsc.bcm.edu;ucsc.edu	37	11	2017341	2017341	+	lincRNA	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:2017341G>A	ENST00000418612.1	+	0	1444				H19_ENST00000390168.4_RNA																							AGCCCAGAGGGCAGCCATAGT	0.602																																					.		.											.	.	.	0			.						.																																					283120	.			CAGAGGGCAGCCA																													11.37:g.2017341G>A		Somatic	109	0		WXS	Illumina HiSeq	.	70	31	.		RNA	SNP	ENST00000418612.1	37																																																																																				.		0.602	AC051649.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000034754.1		
RSPRY1	89970	hgsc.bcm.edu;bcgsc.ca	37	16	57247850	57247850	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:57247850C>A	ENST00000537866.1	+	6	1567	c.694C>A	c.(694-696)Cag>Aag	p.Q232K	RSPRY1_ENST00000394420.4_Missense_Mutation_p.Q232K			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	232						extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						ATACTTGCTACAGTGTCTGGT	0.363																																					p.Q232K		.											.	.	.	0			c.C694A						.						162.0	157.0	158.0					16																	57247850		2198	4300	6498	SO:0001583	missense	89970	exon6			TTGCTACAGTGTC	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.694C>A	16.37:g.57247850C>A	ENSP00000443176:p.Gln232Lys	Somatic	98	0		WXS	Illumina HiSeq	.	86	4	NM_133368	Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	37	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	C	8.966	0.971712	0.18736	.	.	ENSG00000159579	ENST00000394420;ENST00000537866	T;T	0.63096	-0.02;-0.02	5.67	5.67	0.87782	.	0.205923	0.50627	D	0.000114	T	0.42291	0.1196	N	0.12746	0.255	0.44282	D	0.997141	B	0.10296	0.003	B	0.04013	0.001	T	0.34204	-0.9838	10	0.08837	T	0.75	.	15.6065	0.76676	0.0:0.8631:0.1369:0.0	.	232	Q96DX4	RSPRY_HUMAN	K	232	ENSP00000377942:Q232K;ENSP00000443176:Q232K	ENSP00000377942:Q232K	Q	+	1	0	RSPRY1	55805351	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	5.418000	0.66429	2.836000	0.97738	0.655000	0.94253	CAG	.		0.363	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
AP3M2	10947	hgsc.bcm.edu	37	8	42015516	42015516	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr8:42015516G>T	ENST00000518421.1	+	4	622	c.331G>T	c.(331-333)Gag>Tag	p.E111*	AP3M2_ENST00000396926.3_Nonsense_Mutation_p.E111*|AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000174653.3_Nonsense_Mutation_p.E111*|AP3M2_ENST00000517922.1_Nonsense_Mutation_p.E111*	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	111					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)		p.E111Q(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			TGTGGTTTATGAGGTATTGGA	0.403																																					p.E111X		.											AP3M2,NS,carcinoma,0,1	AP3M2	0	1	Substitution - Missense(1)	lung(1)	c.G331T						.						239.0	217.0	224.0					8																	42015516		2203	4300	6503	SO:0001587	stop_gained	10947	exon4			GTTTATGAGGTAT	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.331G>T	8.37:g.42015516G>T	ENSP00000428787:p.Glu111*	Somatic	46	0		WXS	Illumina HiSeq	.	40	2	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Nonsense_Mutation	SNP	ENST00000518421.1	37	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	G	39	7.487403	0.98316	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926;ENST00000522288;ENST00000517922;ENST00000517499	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.1626	18.2325	0.89938	0.0:0.0:1.0:0.0	.	.	.	.	X	111;111;111;111;111;20	.	ENSP00000174653:E111X	E	+	1	0	AP3M2	42134673	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.330000	0.96422	2.363000	0.80096	0.650000	0.86243	GAG	.		0.403	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	33985237	33985237	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:33985237C>A	ENST00000373381.4	-	70	10953	c.10777G>T	c.(10777-10779)Gag>Tag	p.E3593*		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3449						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTGGTGTTCTCGTGGCCAGCA	0.542																																					p.E3449X		.											CSMD2_ENST00000373381,axilla,malignant_melanoma,0,2	CSMD2_ENST00000373381	0	0			c.G10345T						.						299.0	264.0	276.0					1																	33985237		2203	4300	6503	SO:0001587	stop_gained	114784	exon69			TGTTCTCGTGGCC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10777G>T	1.37:g.33985237C>A	ENSP00000362479:p.Glu3593*	Somatic	32	0		WXS	Illumina HiSeq	.	13	6	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Nonsense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	52	19.391776	0.99919	.	.	ENSG00000121904	ENST00000373381	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.5014	0.87733	0.0:1.0:0.0:0.0	.	.	.	.	X	3593	.	ENSP00000241312:E3449X	E	-	1	0	CSMD2	33757824	1.000000	0.71417	0.999000	0.59377	0.667000	0.39255	7.389000	0.79806	2.421000	0.82119	0.561000	0.74099	GAG	.		0.542	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
DSTYK	25778	broad.mit.edu	37	1	205132932	205132932	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:205132932G>A	ENST00000367162.3	-	4	1506	c.1476C>T	c.(1474-1476)gtC>gtT	p.V492V	DSTYK_ENST00000367161.3_Silent_p.V492V|DSTYK_ENST00000367160.4_Intron	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	492					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						CCAGGGTTCCGACGAAGCTTT	0.473																																					p.V492V													.	DSTYK	87	0			c.C1476T						.						127.0	109.0	115.0					1																	205132932		2203	4300	6503	SO:0001819	synonymous_variant	25778	exon4			GGTTCCGACGAAG	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1476C>T	1.37:g.205132932G>A		Somatic	36	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_199462	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	ENST00000367162.3	37	CCDS1451.1																																																																																			.		0.473	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
TRIM67	440730	broad.mit.edu	37	1	231299471	231299473	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:231299471_231299473delGCC	ENST00000366653.5	+	1	756_758	c.756_758delGCC	c.(754-759)cagccg>cag	p.P260del	TRIM67_ENST00000449018.3_Intron|TRIM67_ENST00000444294.3_In_Frame_Del_p.P260del|TRIM67_ENST00000366652.2_In_Frame_Del_p.P260del			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	260					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GCCTGGTGCAgccgccgccgccg	0.759																																					p.252_253del													.	TRIM67	160	0			c.756_758del						.																																			SO:0001651	inframe_deletion	440730	exon1			GGTGCAGCCGCCG	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.756_758delGCC	1.37:g.231299480_231299482delGCC	ENSP00000355613:p.Pro260del	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	In_Frame_Del	DEL	ENST00000366653.5	37	CCDS44333.1																																																																																			.		0.759	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
LOC728715	728715	broad.mit.edu	37	12	9716613	9716613	+	RNA	SNP	A	A	G	rs150525979		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:9716613A>G	ENST00000520314.1	+	0	3808																											ATATATGTGTATATATAAATG	0.214																																					.													.	.	.	0			.						.																																					0	.			ATGTGTATATATA																													12.37:g.9716613A>G		Somatic	40	1		WXS	Illumina GAIIx	Phase_I	49	4	.		RNA	SNP	ENST00000520314.1	37																																																																																				.		0.214	RP11-726G1.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000381543.1		
LOC101927081	101927081	broad.mit.edu	37	14	27378078	27378078	+	lincRNA	DEL	T	T	-	rs202079123		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr14:27378078delT	ENST00000548170.1	+	0	435				RP11-384J4.2_ENST00000552303.1_lincRNA|MIR4307_ENST00000582802.1_RNA																							CTAGGAAGGCTTTTTTTTTTT	0.308																																					.													.	.	.	0			.						.																																					0	.			GAAGGCTTTTTTT																													14.37:g.27378078delT		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000548170.1	37																																																																																				.		0.308	RP11-384J4.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000409121.1		
CYFIP1	23191	broad.mit.edu	37	15	23000152	23000152	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:23000152G>T	ENST00000313077.7	+	30	3631	c.3506G>T	c.(3505-3507)gGg>gTg	p.G1169V	CYFIP1_ENST00000560848.1_Missense_Mutation_p.G1169V|CYFIP1_ENST00000435939.2_Missense_Mutation_p.G738V	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GTACTTCTTGGGCAGCAGCGG	0.453																																					p.G1169V													.	CYFIP1	159	0			c.G3506T						.						186.0	161.0	170.0					15																	23000152		2203	4300	6503	SO:0001583	missense	23191	exon30			TTCTTGGGCAGCA	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.3506G>T	15.37:g.23000152G>T	ENSP00000324549:p.Gly1169Val	Somatic	63	0		WXS	Illumina GAIIx	Phase_I	58	3	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460805	0.84317	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.24723	1.84;1.84	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000007	T	0.56381	0.1981	M	0.85197	2.74	0.80722	D	1	D;P	0.76494	0.999;0.879	D;P	0.68621	0.959;0.865	T	0.65125	-0.6244	10	0.87932	D	0	-34.3153	18.2666	0.90054	0.0:0.0:1.0:0.0	.	738;1169	Q7L576-2;Q7L576	.;CYFP1_HUMAN	V	1169;1171;738	ENSP00000324549:G1169V;ENSP00000405956:G738V	ENSP00000324549:G1169V	G	+	2	0	CYFIP1	20551593	1.000000	0.71417	0.981000	0.43875	0.744000	0.42396	9.807000	0.99171	2.328000	0.79073	0.313000	0.20887	GGG	.		0.453	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
RYR3	6263	broad.mit.edu	37	15	34018689	34018689	+	Silent	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:34018689C>T	ENST00000389232.4	+	46	7085	c.7015C>T	c.(7015-7017)Ctg>Ttg	p.L2339L	RYR3_ENST00000415757.3_Silent_p.L2339L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2339	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCCCTTGAAACTGCCCTCCCT	0.612																																					p.L2339L													.	RYR3	760	0			c.C7015T						.						41.0	44.0	43.0					15																	34018689		2026	4170	6196	SO:0001819	synonymous_variant	6263	exon46			TTGAAACTGCCCT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7015C>T	15.37:g.34018689C>T		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	21	3	NM_001243996	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			.		0.612	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
DNAJA3	9093	broad.mit.edu	37	16	4497003	4497003	+	Silent	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:4497003G>T	ENST00000262375.6	+	8	1190	c.1113G>T	c.(1111-1113)acG>acT	p.T371T	DNAJA3_ENST00000431375.2_Silent_p.T218T|DNAJA3_ENST00000355296.4_Silent_p.T371T	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	371					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						TGTACGAGACGATCAACGTGA	0.522																																					p.T371T													.	DNAJA3	52	0			c.G1113T						.						67.0	68.0	67.0					16																	4497003		2197	4300	6497	SO:0001819	synonymous_variant	9093	exon8			CGAGACGATCAAC	AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1113G>T	16.37:g.4497003G>T		Somatic	31	0		WXS	Illumina GAIIx	Phase_I	22	3	NM_001135110	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Silent	SNP	ENST00000262375.6	37	CCDS10515.1																																																																																			.		0.522	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251633.1		
LRRC37A4P	55073	broad.mit.edu	37	17	43587569	43587569	+	RNA	SNP	G	G	C	rs202189074		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:43587569G>C	ENST00000579913.1	-	0	1444				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		aactccgtctgaaaagaaaag	0.443																																					.													.	.	.	0			.						.																																					0	.			CCGTCTGAAAAGA	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43587569G>C		Somatic	77	1		WXS	Illumina GAIIx	Phase_I	89	4	.		RNA	SNP	ENST00000579913.1	37																																																																																				G|1.000;|0.000		0.443	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000445300.1	NR_002940	
SEC14L1	6397	broad.mit.edu	37	17	75210105	75210105	+	Silent	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr17:75210105G>A	ENST00000413679.2	+	17	2451	c.2148G>A	c.(2146-2148)taG>taA	p.*716*	SEC14L1_ENST00000585618.1_Silent_p.*716*|SEC14L1_ENST00000431431.2_Silent_p.*682*|SEC14L1_ENST00000591437.1_Silent_p.*682*|SEC14L1_ENST00000443798.4_Intron|SEC14L1_ENST00000392476.2_Intron|SEC14L1_ENST00000430767.4_Silent_p.*716*|SEC14L1_ENST00000436233.4_Silent_p.*716*	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	0					transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						TCTCCAGGTAGTGCCGCGCTG	0.672																																					p.X716X													.	SEC14L1	81	0			c.G2148A						.						55.0	50.0	52.0					17																	75210105		2203	4300	6503	SO:0001819	synonymous_variant	6397	exon17			CAGGTAGTGCCGC	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.2148G>A	17.37:g.75210105G>A		Somatic	77	0		WXS	Illumina GAIIx	Phase_I	72	5	NM_001143999	A8K4E8|B4DDI5|D5G3K1|Q99780	Silent	SNP	ENST00000413679.2	37	CCDS11752.1																																																																																			.		0.672	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003	
KLK5	25818	broad.mit.edu	37	19	51453322	51453322	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:51453322C>T	ENST00000336334.3	-	3	476	c.124G>A	c.(124-126)Gtg>Atg	p.V42M	KLK5_ENST00000593428.1_Missense_Mutation_p.V42M|CTB-147C22.8_ENST00000594939.1_RNA|CTB-147C22.8_ENST00000601506.1_RNA|KLK5_ENST00000391809.2_Missense_Mutation_p.V42M	NM_012427.4	NP_036559	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5	42				Missing (in Ref. 3; AAG33358). {ECO:0000305}.	epidermis development (GO:0008544)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	epidermal lamellar body (GO:0097209)|extracellular space (GO:0005615)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		CCAGAGGGCACGGTGTTAGAG	0.617																																					p.V42M													.	KLK5	37	0			c.G124A						.						43.0	42.0	42.0					19																	51453322		2203	4300	6503	SO:0001583	missense	25818	exon3			AGGGCACGGTGTT	AF135028	CCDS12810.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167754		"""Kallikreins"""	6366	protein-coding gene	gene with protein product		605643	"""kallikrein 5"""			10514489, 10608802, 1680072, 4, 16800723, 17012259	Standard	NM_012427		Approved	SCTE, KLK-L2	uc002puf.3	Q9Y337		ENST00000336334.3:c.124G>A	19.37:g.51453322C>T	ENSP00000337733:p.Val42Met	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_012427	Q53ZR3|Q9HBG8	Missense_Mutation	SNP	ENST00000336334.3	37	CCDS12810.1	.	.	.	.	.	.	.	.	.	.	c	9.781	1.175289	0.21704	.	.	ENSG00000167754	ENST00000336334;ENST00000391809	D;D	0.89050	-2.46;-2.46	4.58	-0.518	0.11943	.	2.198380	0.03047	U	0.154118	T	0.72890	0.3517	N	0.08118	0	0.09310	N	1	P	0.36616	0.561	B	0.25759	0.063	T	0.68432	-0.5410	10	0.33940	T	0.23	.	4.3209	0.11016	0.161:0.5432:0.0:0.2958	.	42	Q9Y337	KLK5_HUMAN	M	42	ENSP00000337733:V42M;ENSP00000375685:V42M	ENSP00000337733:V42M	V	-	1	0	KLK5	56145134	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.702000	0.05069	0.352000	0.24053	0.563000	0.77884	GTG	.		0.617	KLK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465057.1	NM_012427	
SLC25A12	8604	broad.mit.edu	37	2	172641829	172641829	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:172641829A>T	ENST00000422440.2	-	18	2029	c.1992T>A	c.(1990-1992)agT>agA	p.S664R	SLC25A12_ENST00000392592.4_Missense_Mutation_p.S557R	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	664					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CCACAGCAACACTAGGAGACT	0.502																																					p.S664R													.	SLC25A12	59	0			c.T1992A						.						104.0	97.0	99.0					2																	172641829		2203	4300	6503	SO:0001583	missense	8604	exon18			AGCAACACTAGGA	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1992T>A	2.37:g.172641829A>T	ENSP00000388658:p.Ser664Arg	Somatic	67	0		WXS	Illumina GAIIx	Phase_I	52	3	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	37	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.955971	0.34471	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.78707	-1.2;-1.16	6.05	2.42	0.29668	.	0.731722	0.13283	N	0.399623	T	0.66839	0.2830	L	0.38175	1.15	0.09310	N	1	B;B	0.17667	0.007;0.023	B;B	0.11329	0.006;0.006	T	0.55958	-0.8058	10	0.42905	T	0.14	0.5277	8.974	0.35924	0.6548:0.0:0.3452:0.0	.	557;664	B3KR64;O75746	.;CMC1_HUMAN	R	664;557	ENSP00000388658:S664R;ENSP00000376371:S557R	ENSP00000376371:S557R	S	-	3	2	SLC25A12	172350075	0.000000	0.05858	0.496000	0.27539	0.961000	0.63080	0.202000	0.17295	0.550000	0.28991	0.528000	0.53228	AGT	.		0.502	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
C4orf29	80167	broad.mit.edu;bcgsc.ca	37	4	128956946	128956946	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:128956946T>C	ENST00000388795.5	+	13	1530	c.1127T>C	c.(1126-1128)tTc>tCc	p.F376S				Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	0						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						TTTGACCGCTTCCTCCATAAA	0.368																																					.													.	.	.	0			.						.																																			SO:0001583	missense	80167	.			ACCGCTTCCTCCA	AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000388795.5:c.1127T>C	4.37:g.128956946T>C	ENSP00000373447:p.Phe376Ser	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	57	5	.	A1A4W8|A1A4W9|Q9H7A7	Missense_Mutation	SNP	ENST00000388795.5	37		.	.	.	.	.	.	.	.	.	.	T	17.57	3.422683	0.62733	.	.	ENSG00000164074	ENST00000454347;ENST00000398961;ENST00000388795;ENST00000545758;ENST00000437077	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.41050	0.1142	.	.	.	0.80722	D	1	P	0.39665	0.682	B	0.37601	0.254	T	0.29027	-1.0025	7	0.29301	T	0.29	-0.1177	10.6956	0.45896	0.1425:0.0:0.0:0.8575	.	376	B7WP89	.	S	424;255;376;342;331	.	ENSP00000373447:F376S	F	+	2	0	C4orf29	129176396	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	3.983000	0.56916	2.143000	0.66587	0.533000	0.62120	TTC	.		0.368	C4orf29-002	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000257099.2	NM_001039717	
OCLN	100506658	broad.mit.edu	37	5	68787616	68787617	+	5'Flank	DEL	AA	AA	-	rs369606588|rs372996251|rs61417711	byFrequency	TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:68787616_68787617delAA	ENST00000355237.2	+	0	0				RP11-241G9.3_ENST00000514270.1_RNA|OCLN_ENST00000380766.2_5'Flank|OCLN_ENST00000396442.2_5'Flank	NM_002538.3	NP_002529.1	Q16625	OCLN_HUMAN	occludin						apoptotic process (GO:0006915)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|protein complex assembly (GO:0006461)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethionine metabolic process (GO:0046500)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|structural molecule activity (GO:0005198)|thiopurine S-methyltransferase activity (GO:0008119)			endometrium(2)|large_intestine(1)|liver(1)|prostate(1)|skin(1)	6		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCGTTTTCTTAAAAAAAAAAAA	0.337														4264	0.851438	0.8843	0.7637	5008	,	,		17967	0.8353		0.83	False		,,,				2504	0.908				.													.	OCLN	22	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			TTTCTTAAAAAAA	U49184	CCDS4006.1, CCDS54864.1	5q13.1	2014-06-13			ENSG00000197822	ENSG00000197822			8104	protein-coding gene	gene with protein product	"""tight junction protein occludin TM4 minus"", ""phosphatase 1, regulatory subunit 115"""	602876				8601611	Standard	NM_002538		Approved	PPP1R115	uc003jwu.3	Q16625	OTTHUMG00000099356		5.37:g.68787626_68787627delAA	Exception_encountered	Somatic	4	0		WXS	Illumina GAIIx	Phase_I	10	5	.	B5BU70|D2DU64|D2DU65|D2IGC0|D2IGC1|E2CYV9|Q5U1V4|Q8N6K1	RNA	DEL	ENST00000355237.2	37	CCDS4006.1																																																																																			AA|0.500;-|0.500		0.337	OCLN-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216794.1	NM_002538	
CCT6P1	643253	broad.mit.edu	37	7	65222951	65222951	+	RNA	DEL	T	T	-	rs564902644	byFrequency	TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr7:65222951delT	ENST00000442266.1	+	0	561				SNORA22_ENST00000383907.1_RNA|SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		TTTCTGTAACTTTTTTTTTTT	0.323													|||unknown(NO_COVERAGE)	42	0.00838658	0.0159	0.0014	5008	,	,		17660	0.004		0.005	False		,,,				2504	0.0112				.													.	.	.	0			.						.																																					0	.			TGTAACTTTTTTT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65222951delT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL	ENST00000442266.1	37																																																																																				.		0.323	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345507.1	NR_003110	
DPY19L2P2	349152	broad.mit.edu	37	7	102825947	102825947	+	RNA	SNP	A	A	G			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr7:102825947A>G	ENST00000312132.4	-	0	3750							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ACAGCTTGACACTTGCCATTG	0.373																																					.													.	.	.	0			.						.																																					0	.			CTTGACACTTGCC	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102825947A>G		Somatic	50	0		WXS	Illumina GAIIx	Phase_I	46	6	.	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																				.		0.373	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347877.1	NM_182634	
EEF1D	1936	broad.mit.edu;bcgsc.ca	37	8	144672086	144672086	+	Intron	SNP	C	C	T	rs370379043		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr8:144672086C>T	ENST00000529272.1	-	2	397				EEF1D_ENST00000442189.2_Missense_Mutation_p.D56N|EEF1D_ENST00000531770.1_5'Flank|EEF1D_ENST00000528610.1_Intron|EEF1D_ENST00000526838.1_Intron|EEF1D_ENST00000317198.6_Intron|EEF1D_ENST00000419152.2_Intron|EEF1D_ENST00000395119.3_Intron|EEF1D_ENST00000423316.2_Missense_Mutation_p.D56N|EEF1D_ENST00000524624.1_Intron|EEF1D_ENST00000531621.1_Intron|EEF1D_ENST00000532400.1_Intron|EEF1D_ENST00000532741.1_Missense_Mutation_p.D106N			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TCCTCAGGGTCGTCCTGGCCG	0.687																																					p.D56N													.	EEF1D	48	0			c.G166A						.	C	ASN/ASP,,,,,,ASN/ASP	0,4392		0,0,2196	14.0	16.0	15.0		166,,,,,,166	3.0	0.9	8		15	1,8585		0,1,4292	no	missense,intron,intron,intron,intron,intron,missense	EEF1D	NM_001130053.2,NM_001130055.2,NM_001130056.2,NM_001130057.2,NM_001195203.1,NM_001960.4,NM_032378.4	23,,,,,,23	0,1,6488	TT,TC,CC		0.0116,0.0,0.0077	benign,,,,,,benign	56/648,,,,,,56/648	144672086	1,12977	2196	4293	6489	SO:0001627	intron_variant	1936	exon3			CAGGGTCGTCCTG	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.4-3067G>A	8.37:g.144672086C>T		Somatic	24	0		WXS	Illumina GAIIx	Phase_I	8	3	NM_001130053	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	37	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	C	7.740	0.700993	0.15172	0.0	1.16E-4	ENSG00000104529	ENST00000532741;ENST00000442189;ENST00000423316;ENST00000356793;ENST00000337369;ENST00000526710;ENST00000531281;ENST00000532596;ENST00000524883;ENST00000531670;ENST00000528519;ENST00000529832;ENST00000530306;ENST00000530545;ENST00000525261;ENST00000534804;ENST00000524900	.	.	.	3.83	2.96	0.34315	.	0.303719	0.25427	N	0.030747	T	0.45518	0.1346	L	0.44542	1.39	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.42632	-0.9440	9	0.48119	T	0.1	.	7.6664	0.28434	0.0:0.8835:0.0:0.1165	.	56;106;56	D3DWK1;E9PRY8;P29692-2	.;.;.	N	106;56;56;8;56;56;56;56;56;56;56;56;56;56;56;56;56	.	ENSP00000338323:D56N	D	-	1	0	EEF1D	144743229	0.006000	0.16342	0.928000	0.36995	0.009000	0.06853	2.090000	0.41682	1.197000	0.43143	-0.439000	0.05793	GAC	.		0.687	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
IPPK	64768	broad.mit.edu	37	9	95396672	95396672	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr9:95396672G>A	ENST00000287996.3	-	11	1442	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	IPPK_ENST00000375522.1_Missense_Mutation_p.T61M	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	389					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						GCCCACCTTCGTTAGCGCGAA	0.418											OREG0019315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T389M													.	IPPK	34	0			c.C1166T						.						88.0	73.0	78.0					9																	95396672		2203	4300	6503	SO:0001583	missense	64768	exon11			ACCTTCGTTAGCG	AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.1166C>T	9.37:g.95396672G>A	ENSP00000287996:p.Thr389Met	Somatic	56	0	1312	WXS	Illumina GAIIx	Phase_I	40	3	NM_022755	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	ENST00000287996.3	37	CCDS6699.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548714	0.27652	.	.	ENSG00000127080	ENST00000287996;ENST00000375522	T;T	0.30981	1.51;1.51	5.71	2.75	0.32379	.	0.218601	0.47455	D	0.000234	T	0.33294	0.0858	L	0.44542	1.39	0.22541	N	0.999008	B;D	0.58620	0.235;0.983	B;P	0.50270	0.086;0.636	T	0.12142	-1.0559	10	0.41790	T	0.15	-11.1042	11.8609	0.52465	0.0:0.1195:0.6321:0.2484	.	389;88	Q9H8X2;B3KVX7	IPPK_HUMAN;.	M	389;61	ENSP00000287996:T389M;ENSP00000364672:T61M	ENSP00000287996:T389M	T	-	2	0	IPPK	94436493	0.996000	0.38824	0.007000	0.13788	0.003000	0.03518	2.504000	0.45416	0.383000	0.24910	-0.314000	0.08810	ACG	.		0.418	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053101.1	NM_022755	
TUBBP5	643224	broad.mit.edu	37	9	141070944	141070944	+	RNA	SNP	C	C	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr9:141070944C>A	ENST00000503395.1	+	0	1719									tubulin, beta pseudogene 5																		GCCACCCTCTCAGTCCACCAG	0.527																																					.													.	.	.	0			.						.																																					0	.			CCCTCTCAGTCCA	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141070944C>A		Somatic	88	0		WXS	Illumina GAIIx	Phase_I	80	3	.		RNA	SNP	ENST00000503395.1	37																																																																																				.		0.527	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156	
MAGEB10	139422	broad.mit.edu	37	X	27840135	27840135	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chrX:27840135C>T	ENST00000356790.2	+	3	957	c.712C>T	c.(712-714)Cac>Tac	p.H238Y		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	238	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.H238N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						CGGAATTGAGCACTTCATGTT	0.463																																					p.H238Y													.	MAGEB10	107	1	Substitution - Missense(1)	kidney(1)	c.C712T						.						54.0	49.0	50.0					X																	27840135		2202	4300	6502	SO:0001583	missense	139422	exon3			ATTGAGCACTTCA		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.712C>T	X.37:g.27840135C>T	ENSP00000368304:p.His238Tyr	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	33	6	NM_182506	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034899	0.35893	.	.	ENSG00000177689	ENST00000356790	T	0.05925	3.37	2.33	1.44	0.22558	.	0.000000	0.85682	U	0.000000	T	0.13243	0.0321	M	0.89095	3.005	0.09310	N	1	D	0.52996	0.957	P	0.46659	0.523	T	0.12142	-1.0559	10	0.87932	D	0	.	5.6025	0.17361	0.3225:0.6775:0.0:0.0	.	238	Q96LZ2	MAGBA_HUMAN	Y	238	ENSP00000368304:H238Y	ENSP00000368304:H238Y	H	+	1	0	MAGEB10	27750056	0.053000	0.20554	0.006000	0.13384	0.037000	0.13140	0.994000	0.29693	0.391000	0.25143	0.422000	0.28245	CAC	.		0.463	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106216.1	NM_182506	
WIPF1	7456	ucsc.edu	37	2	175431867	175431867	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:175431867G>A	ENST00000392547.2	-	7	1486	c.1387C>T	c.(1387-1389)Cca>Tca	p.P463S	WIPF1_ENST00000392546.2_Missense_Mutation_p.P463S|WIPF1_ENST00000467149.1_5'UTR|WIPF1_ENST00000359761.3_Missense_Mutation_p.P463S|WIPF1_ENST00000409891.1_Missense_Mutation_p.P463S|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000272746.5_Missense_Mutation_p.P463S|AC018890.6_ENST00000412835.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	463					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						TCTGGAGGTGGCAAATCGGAA	0.433																																					p.P463S													.	WIPF1	88	0			c.C1387T						.						143.0	142.0	142.0					2																	175431867		2203	4300	6503	SO:0001583	missense	7456	exon7			GAGGTGGCAAATC	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1387C>T	2.37:g.175431867G>A	ENSP00000376330:p.Pro463Ser	Somatic	83	1		WXS	Illumina HiSeq		42	4	NM_003387	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	37	CCDS2260.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010459	0.93346	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891	D;D;D;D;D	0.90955	-1.69;-1.76;-1.69;-1.69;-2.76	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.95974	0.8689	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	D	0.95503	0.8579	10	0.66056	D	0.02	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	463;463;463	O43516-3;O43516-2;O43516	.;.;WIPF1_HUMAN	S	463;319;463;463;463;463	ENSP00000376330:P463S;ENSP00000272746:P463S;ENSP00000352802:P463S;ENSP00000376329:P463S;ENSP00000386431:P463S	ENSP00000272746:P463S	P	-	1	0	WIPF1	175140113	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.875000	0.87205	2.854000	0.98071	0.655000	0.94253	CCA	.		0.433	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387	
SLC7A11	23657	ucsc.edu;bcgsc.ca	37	4	139153507	139153507	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:139153507G>T	ENST00000280612.5	-	3	713	c.434C>A	c.(433-435)gCa>gAa	p.A145E		NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	145					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	GCGTCCAAATGCCAGGGATAT	0.373																																					p.A145E													.	SLC7A11	40	0			c.C434A						.						61.0	60.0	60.0					4																	139153507		2203	4300	6503	SO:0001583	missense	23657	exon3			CCAAATGCCAGGG	AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.434C>A	4.37:g.139153507G>T	ENSP00000280612:p.Ala145Glu	Somatic	54	0		WXS	Illumina HiSeq		42	4	NM_014331	A8K2U4	Missense_Mutation	SNP	ENST00000280612.5	37	CCDS3742.1	.	.	.	.	.	.	.	.	.	.	G	34	5.390688	0.95988	.	.	ENSG00000151012	ENST00000280612	D	0.91792	-2.91	5.64	5.64	0.86602	Amino acid permease domain (1);	0.047167	0.85682	D	0.000000	D	0.95439	0.8519	M	0.82323	2.585	0.80722	D	1	P	0.36909	0.573	P	0.49012	0.598	D	0.95356	0.8451	10	0.87932	D	0	.	19.703	0.96063	0.0:0.0:1.0:0.0	.	145	Q9UPY5	XCT_HUMAN	E	145	ENSP00000280612:A145E	ENSP00000280612:A145E	A	-	2	0	SLC7A11	139372957	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.566000	0.98157	2.671000	0.90904	0.655000	0.94253	GCA	.		0.373	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257251.2		
TSPAN14	81619	ucsc.edu;bcgsc.ca	37	10	82280581	82280581	+	3'UTR	SNP	A	A	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:82280581A>C	ENST00000429989.3	+	0	3885				TSPAN14_ENST00000372164.3_3'UTR	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14						establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			CAGCCTCTGTAGCACCAGACA	0.552																																					.													.	TSPAN14	29	0			.						.						176.0	164.0	167.0					10																	82280581		876	1991	2867	SO:0001624	3_prime_UTR_variant	81619	.			CTCTGTAGCACCA	AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.*2849A>C	10.37:g.82280581A>C		Somatic	29	0		WXS	Illumina HiSeq		19	6	.	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Missense_Mutation	SNP	ENST00000429989.3	37	CCDS7369.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.599329	0.46318	.	.	ENSG00000108219	ENST00000372160	.	.	.	2.92	-2.45	0.06481	.	.	.	.	.	T	0.34048	0.0884	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40739	-0.9547	5	0.87932	D	0	.	3.2827	0.06921	0.3697:0.0:0.4197:0.2106	.	.	.	.	R	143	.	ENSP00000361233:S143R	S	+	1	0	TSPAN14	82270561	0.000000	0.05858	0.000000	0.03702	0.182000	0.23217	-0.132000	0.10467	-0.551000	0.06175	0.533000	0.62120	AGC	.		0.552	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049081.2	NM_030927	
GRK5	2869	ucsc.edu	37	10	121184542	121184542	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr10:121184542G>T	ENST00000392870.2	+	6	807	c.478G>T	c.(478-480)Gaa>Taa	p.E160*	GRK5_ENST00000369108.3_Nonsense_Mutation_p.E55*	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	160	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		ACCATTCCACGAATATCTGGA	0.498																																					p.E160X													.	GRK5	58	0			c.G478T						.						205.0	160.0	175.0					10																	121184542		2203	4300	6503	SO:0001587	stop_gained	2869	exon6			TTCCACGAATATC	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.478G>T	10.37:g.121184542G>T	ENSP00000376609:p.Glu160*	Somatic	68	0		WXS	Illumina HiSeq		38	4	NM_005308	D3DRD0|Q5T059	Nonsense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	g	37	6.158722	0.97334	.	.	ENSG00000198873	ENST00000392870;ENST00000457057;ENST00000369108	.	.	.	5.17	1.23	0.21249	.	0.512122	0.18047	N	0.153423	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	0.424	2.4826	0.04591	0.2108:0.1276:0.5298:0.1318	.	.	.	.	X	160;55;55	.	ENSP00000358104:E55X	E	+	1	0	GRK5	121174532	0.998000	0.40836	0.576000	0.28549	0.940000	0.58332	2.821000	0.48065	-0.017000	0.14103	-0.194000	0.12790	GAA	.		0.498	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308	
KRTAP5-5	439915	ucsc.edu	37	11	1651645	1651645	+	Missense_Mutation	SNP	A	A	G	rs77039648		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr11:1651645A>G	ENST00000399676.2	+	1	613	c.575A>G	c.(574-576)tAc>tGc	p.Y192C		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	192	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGTAAGCCCTACTGCTGCCAG	0.602																																					p.Y192C													.	KRTAP5-5	86	0			c.A575G						.						78.0	86.0	83.0					11																	1651645		2200	4299	6499	SO:0001583	missense	439915	exon1			AGCCCTACTGCTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.575A>G	11.37:g.1651645A>G	ENSP00000382584:p.Tyr192Cys	Somatic	38	8		WXS	Illumina HiSeq		40	8	NM_001001480	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	a	0.016	-1.537048	0.00942	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01323	5.01	2.94	0.953	0.19590	.	.	.	.	.	T	0.00468	0.0015	N	0.00186	-1.895	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.42413	-0.9453	8	0.37606	T	0.19	.	4.0328	0.09716	0.1469:0.2455:0.6076:0.0	.	192	Q701N2	KRA55_HUMAN	C	192;163	ENSP00000382584:Y192C	ENSP00000382584:Y192C	Y	+	2	0	KRTAP5-5	1608221	0.002000	0.14202	0.035000	0.18076	0.003000	0.03518	0.006000	0.13152	0.009000	0.14813	-1.591000	0.00844	TAC	A|0.999;G|0.001		0.602	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SP7	121340	ucsc.edu;bcgsc.ca	37	12	53722690	53722690	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr12:53722690T>C	ENST00000536324.2	-	3	819	c.536A>G	c.(535-537)cAa>cGa	p.Q179R	SP7_ENST00000537210.2_Missense_Mutation_p.Q161R|SP7_ENST00000303846.3_Missense_Mutation_p.Q179R	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	179					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						CAGTGTCCCTTGCAGCCCATC	0.622																																					p.Q179R													.	SP7	30	0			c.A536G						.						32.0	38.0	36.0					12																	53722690		2051	4184	6235	SO:0001583	missense	121340	exon2			GTCCCTTGCAGCC	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.536A>G	12.37:g.53722690T>C	ENSP00000443827:p.Gln179Arg	Somatic	26	0		WXS	Illumina HiSeq		28	4	NM_152860	B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	ENST00000536324.2	37	CCDS44897.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.005036	0.35415	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210;ENST00000547755	T;T;T;T	0.50548	3.19;3.19;3.17;0.74	3.47	2.3	0.28687	.	0.152208	0.43919	D	0.000502	T	0.33673	0.0871	L	0.48642	1.525	0.29843	N	0.829093	P	0.41524	0.753	B	0.37451	0.25	T	0.24012	-1.0172	10	0.14252	T	0.57	.	8.9083	0.35537	0.0:0.0:0.363:0.637	.	179	Q8TDD2	SP7_HUMAN	R	179;179;161;161	ENSP00000443827:Q179R;ENSP00000302812:Q179R;ENSP00000441367:Q161R;ENSP00000449355:Q161R	ENSP00000302812:Q179R	Q	-	2	0	SP7	52008957	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	3.615000	0.54167	0.686000	0.31488	0.260000	0.18958	CAA	.		0.622	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1		
KIAA0586	9786	ucsc.edu;bcgsc.ca	37	14	58955379	58955379	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr14:58955379G>T	ENST00000556134.1	+	25	3797	c.3523G>T	c.(3523-3525)Gat>Tat	p.D1175Y	KIAA0586_ENST00000354386.6_Missense_Mutation_p.D1243Y|KIAA0586_ENST00000261244.5_Missense_Mutation_p.D1114Y|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.D1146Y	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1175					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGAGAGTATGGATTTCCCTGC	0.483																																					p.D1243Y													.	KIAA0586	180	0			c.G3727T						.						122.0	128.0	126.0					14																	58955379		1962	4148	6110	SO:0001583	missense	9786	exon26			AGTATGGATTTCC	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.3523G>T	14.37:g.58955379G>T	ENSP00000452351:p.Asp1175Tyr	Somatic	50	0		WXS	Illumina HiSeq		40	4	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269605	0.40095	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.38	3.52	0.40303	.	0.287036	0.30890	N	0.008671	T	0.51770	0.1694	.	.	.	0.09310	N	1	P;P;D;P;P	0.65815	0.753;0.935;0.995;0.85;0.919	B;P;P;B;B	0.61201	0.329;0.545;0.885;0.329;0.42	T	0.34825	-0.9813	9	0.28530	T	0.3	.	5.8736	0.18816	0.1993:0.1754:0.6253:0.0	.	1050;1243;1114;1175;1146	B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;K0586_HUMAN;.	Y	1243;1175;1146;1114	ENSP00000346359:D1243Y;ENSP00000452351:D1175Y;ENSP00000399427:D1146Y;ENSP00000261244:D1114Y	ENSP00000261244:D1114Y	D	+	1	0	KIAA0586	58025132	0.044000	0.20184	0.005000	0.12908	0.971000	0.66376	0.743000	0.26231	1.399000	0.46721	0.585000	0.79938	GAT	.		0.483	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
C15orf54	400360	ucsc.edu;bcgsc.ca	37	15	39544794	39544794	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:39544794C>T	ENST00000318578.3	+	2	826	c.458C>T	c.(457-459)gCt>gTt	p.A153V	RP11-624L4.1_ENST00000560484.1_RNA|RP11-624L4.1_ENST00000558209.1_RNA|RP11-624L4.1_ENST00000561058.1_RNA|C15orf54_ENST00000561223.1_Missense_Mutation_p.A153V	NM_207445.2	NP_997328.1	Q8N8G6	CO054_HUMAN	chromosome 15 open reading frame 54	153										NS(1)|haematopoietic_and_lymphoid_tissue(2)|lung(2)	5		all_cancers(109;5.39e-14)|all_epithelial(112;3.14e-12)|Lung NSC(122;9.74e-10)|all_lung(180;2.23e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;1.19e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0706)		GCTCATGCTGCTGACAGGGGA	0.453																																					p.A153V													.	C15orf54	18	0			c.C458T						.						107.0	92.0	97.0					15																	39544794		2200	4297	6497	SO:0001583	missense	400360	exon2			ATGCTGCTGACAG		CCDS10049.1	15q14	2014-09-10			ENSG00000175746	ENSG00000175746			33797	protein-coding gene	gene with protein product							Standard	NM_207445		Approved	FLJ39531	uc001zkg.2	Q8N8G6	OTTHUMG00000129843	ENST00000318578.3:c.458C>T	15.37:g.39544794C>T	ENSP00000323686:p.Ala153Val	Somatic	42	0		WXS	Illumina HiSeq		36	4	NM_207445	B7ZVZ9	Missense_Mutation	SNP	ENST00000318578.3	37	CCDS10049.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853612	0.32791	.	.	ENSG00000175746	ENST00000318578	T	0.38560	1.13	4.41	-0.147	0.13428	.	.	.	.	.	T	0.19604	0.0471	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.18999	-1.0319	9	0.87932	D	0	.	3.3119	0.07020	0.3326:0.4513:0.0:0.2161	.	153	Q8N8G6	CO054_HUMAN	V	153	ENSP00000323686:A153V	ENSP00000323686:A153V	A	+	2	0	C15orf54	37332086	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.030000	0.13688	-0.096000	0.12329	-1.106000	0.02097	GCT	.		0.453	C15orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252083.1	NM_207445	
EXOC3L1	283849	ucsc.edu;bcgsc.ca	37	16	67220210	67220210	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:67220210T>C	ENST00000314586.6	-	9	1666	c.1426A>G	c.(1426-1428)Agg>Ggg	p.R476G	KIAA0895L_ENST00000563831.2_5'Flank|KIAA0895L_ENST00000563902.1_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	476					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						GATTTCCCCCTGAAGTGGTCT	0.597											OREG0023874	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R476G													.	EXOC3L1	52	0			c.A1426G						.						67.0	51.0	57.0					16																	67220210		2195	4288	6483	SO:0001583	missense	283849	exon9			TCCCCCTGAAGTG	AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1426A>G	16.37:g.67220210T>C	ENSP00000325674:p.Arg476Gly	Somatic	46	0	1097	WXS	Illumina HiSeq		33	4	NM_178516	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	ENST00000314586.6	37	CCDS10832.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.612087	0.46631	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	T;T	0.07800	3.16;3.16	5.58	4.46	0.54185	.	0.251482	0.46145	D	0.000312	T	0.11665	0.0284	M	0.65975	2.015	0.34467	D	0.702363	P;P;B	0.39576	0.628;0.679;0.27	B;B;B	0.39217	0.194;0.294;0.192	T	0.14839	-1.0458	10	0.42905	T	0.14	-4.1194	10.388	0.44152	0.0:0.0:0.1645:0.8355	.	373;373;476	F5H4W1;B7Z6U0;Q86VI1	.;.;EX3L1_HUMAN	G	476;373;378	ENSP00000325674:R476G;ENSP00000439910:R373G	ENSP00000325008:R378G	R	-	1	2	EXOC3L1	65777711	0.159000	0.22864	0.861000	0.33841	0.127000	0.20565	1.814000	0.38972	0.922000	0.37019	0.379000	0.24179	AGG	.		0.597	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516	
GZF1	64412	ucsc.edu;bcgsc.ca	37	20	23345860	23345860	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr20:23345860G>T	ENST00000338121.5	+	2	917	c.840G>T	c.(838-840)gaG>gaT	p.E280D	GZF1_ENST00000461789.1_3'UTR|GZF1_ENST00000377051.2_Missense_Mutation_p.E280D|GZF1_ENST00000542987.1_Intron|GZF1_ENST00000544236.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	280					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CCAAAAATGAGGGTTGCCAGG	0.572																																					p.E280D													.	GZF1	61	0			c.G840T						.						59.0	67.0	64.0					20																	23345860		2203	4300	6503	SO:0001583	missense	64412	exon1			AAATGAGGGTTGC	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.840G>T	20.37:g.23345860G>T	ENSP00000338290:p.Glu280Asp	Somatic	28	0		WXS	Illumina HiSeq		29	4	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	37	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	G	7.679	0.688558	0.14973	.	.	ENSG00000125812	ENST00000338121;ENST00000377051	T;T	0.10668	2.85;2.85	4.0	1.96	0.26148	.	0.215491	0.30356	N	0.009804	T	0.08088	0.0202	L	0.34521	1.04	0.80722	D	1	B	0.21606	0.058	B	0.15052	0.012	T	0.18777	-1.0326	10	0.54805	T	0.06	.	8.3827	0.32481	0.0873:0.1558:0.7568:0.0	.	280	Q9H116	GZF1_HUMAN	D	280	ENSP00000338290:E280D;ENSP00000366250:E280D	ENSP00000338290:E280D	E	+	3	2	GZF1	23293860	0.501000	0.26099	0.046000	0.18839	0.071000	0.16799	1.862000	0.39448	0.443000	0.26582	0.552000	0.68991	GAG	.		0.572	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
VSIG1	340547	ucsc.edu;bcgsc.ca	37	X	107319375	107319375	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chrX:107319375G>T	ENST00000217957.5	+	6	874	c.757G>T	c.(757-759)Gtt>Ttt	p.V253F	VSIG1_ENST00000415430.3_Missense_Mutation_p.V289F	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	253						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						CATCATCTCTGTTGTGTGCTT	0.433																																					p.V289F													.	VSIG1	126	0			c.G865T						.						188.0	162.0	171.0					X																	107319375		2203	4300	6503	SO:0001583	missense	340547	exon7			ATCTCTGTTGTGT	BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.757G>T	X.37:g.107319375G>T	ENSP00000217957:p.Val253Phe	Somatic	50	0		WXS	Illumina HiSeq		35	4	NM_001170553	C9J4P2|Q6MZS4	Missense_Mutation	SNP	ENST00000217957.5	37	CCDS14535.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729295	0.30684	.	.	ENSG00000101842	ENST00000415430;ENST00000217957	T;T	0.77489	-1.1;-0.87	4.91	0.91	0.19337	.	1.231730	0.05971	N	0.642419	T	0.74481	0.3722	L	0.56769	1.78	0.09310	N	1	P;P	0.51653	0.947;0.933	P;P	0.48141	0.568;0.564	T	0.58289	-0.7662	10	0.09084	T	0.74	.	6.231	0.20734	0.5904:0.0:0.4096:0.0	.	289;253	C9J4P2;Q86XK7	.;VSIG1_HUMAN	F	289;253	ENSP00000402219:V289F;ENSP00000217957:V253F	ENSP00000217957:V253F	V	+	1	0	VSIG1	107206031	0.042000	0.20092	0.001000	0.08648	0.243000	0.25628	0.420000	0.21263	0.156000	0.19299	-0.192000	0.12808	GTT	.		0.433	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057858.1	NM_182607	
RNPEP	6051	bcgsc.ca	37	1	201965299	201965299	+	Silent	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr1:201965299C>T	ENST00000295640.4	+	4	805	c.762C>T	c.(760-762)tgC>tgT	p.C254C	RP11-465N4.5_ENST00000608886.1_RNA|RNPEP_ENST00000367286.3_Intron|RNPEP_ENST00000471105.1_3'UTR	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	254					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		CTGAGCCCTGCCTGATTGATG	0.498																																					p.C254C	GBM(19;39 479 7473 13131 19462)												.	RNPEP	39	0			c.C762T						.						163.0	151.0	155.0					1																	201965299		2203	4300	6503	SO:0001819	synonymous_variant	6051	exon4			GCCCTGCCTGATT	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.762C>T	1.37:g.201965299C>T		Somatic	107	0		WXS	Illumina HiSeq	Phase_1	110	5	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Silent	SNP	ENST00000295640.4	37	CCDS1418.1																																																																																			.		0.498	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
ANKRD36C	400986	bcgsc.ca	37	2	96525702	96525702	+	Missense_Mutation	SNP	C	C	T	rs113412941		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:96525702C>T	ENST00000456556.1	-	61	3887	c.3803G>A	c.(3802-3804)aGt>aAt	p.S1268N	ANKRD36C_ENST00000420871.2_Missense_Mutation_p.S519N|ANKRD36C_ENST00000419039.2_Missense_Mutation_p.S295N			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1268							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TTGTAGTACACTAGCCTTATT	0.289																																					.													.	.	.	0			.						.																																			SO:0001583	missense	400986	.			AGTACACTAGCCT	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3803G>A	2.37:g.96525702C>T	ENSP00000403302:p.Ser1268Asn	Somatic	204	3		WXS	Illumina HiSeq	Phase_1	422	20	.	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	c	0.387	-0.925448	0.02377	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.22743	1.94;1.94;1.94	1.85	0.951	0.19579	.	.	.	.	.	T	0.11239	0.0274	L	0.31752	0.955	0.09310	N	1	P	0.38110	0.618	B	0.34652	0.187	T	0.22243	-1.0222	9	0.18710	T	0.47	.	4.0869	0.09951	0.0:0.6192:0.0:0.3808	.	1268	Q5JPF3	AN36C_HUMAN	N	519;1268;295	ENSP00000415231:S519N;ENSP00000403302:S1268N;ENSP00000407838:S295N	ENSP00000407838:S295N	S	-	2	0	AC073995.2	95889429	0.000000	0.05858	0.005000	0.12908	0.009000	0.06853	0.067000	0.14510	0.346000	0.23899	0.297000	0.19635	AGT	C|0.500;T|0.500		0.289	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338799.2	NM_001010914	
NCAPH	23397	bcgsc.ca	37	2	97020038	97020038	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr2:97020038G>T	ENST00000240423.4	+	9	1163	c.1120G>T	c.(1120-1122)Gat>Tat	p.D374Y	NCAPH_ENST00000455200.1_Missense_Mutation_p.D363Y|NCAPH_ENST00000427946.1_Missense_Mutation_p.D238Y	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	374					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GGATGACTTTGATGCCAACGA	0.517																																					p.D374Y													.	NCAPH	67	0			c.G1120T						.						158.0	153.0	155.0					2																	97020038		2203	4300	6503	SO:0001583	missense	23397	exon9			GACTTTGATGCCA	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1120G>T	2.37:g.97020038G>T	ENSP00000240423:p.Asp374Tyr	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	48	4	NM_015341	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.803556	0.31869	.	.	ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000435975;ENST00000455200	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.38	3.53	0.40419	.	0.090132	0.85682	N	0.000000	T	0.45458	0.1343	M	0.80746	2.51	0.48901	D	0.999727	B;B;P;P	0.39157	0.414;0.414;0.662;0.662	B;B;B;B	0.39094	0.202;0.202;0.272;0.29	T	0.38564	-0.9655	10	0.23891	T	0.37	-4.8165	12.9187	0.58220	0.0:0.0:0.7448:0.2552	.	350;363;363;374	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	Y	374;238;363;363	ENSP00000240423:D374Y;ENSP00000400774:D238Y;ENSP00000405237:D363Y;ENSP00000407308:D363Y	ENSP00000240423:D374Y	D	+	1	0	NCAPH	96383765	1.000000	0.71417	0.981000	0.43875	0.458000	0.32498	2.866000	0.48420	0.616000	0.30141	0.561000	0.74099	GAT	.		0.517	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
PXK	54899	bcgsc.ca	37	3	58395275	58395275	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr3:58395275G>T	ENST00000356151.2	+	15	1434	c.1325G>T	c.(1324-1326)aGa>aTa	p.R442I	PXK_ENST00000484288.1_Missense_Mutation_p.R442I|PXK_ENST00000383715.4_Missense_Mutation_p.R425I|PXK_ENST00000536660.1_Missense_Mutation_p.R305I|PXK_ENST00000463280.1_Missense_Mutation_p.R409I|PXK_ENST00000383716.3_Missense_Mutation_p.R409I|PXK_ENST00000479241.1_Missense_Mutation_p.R425I|PXK_ENST00000302779.5_Missense_Mutation_p.R425I	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		CAGCATCGAAGACTGACAAGA	0.423																																					p.R442I													.	PXK	89	0			c.G1325T						.						66.0	66.0	66.0					3																	58395275		2203	4300	6503	SO:0001583	missense	54899	exon15			ATCGAAGACTGAC	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.1325G>T	3.37:g.58395275G>T	ENSP00000348472:p.Arg442Ile	Somatic	34	0		WXS	Illumina HiSeq	Phase_1	23	3	NM_017771		Missense_Mutation	SNP	ENST00000356151.2	37	CCDS2889.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.1|27.1	4.799475|4.799475	0.90538|0.90538	.|.	.|.	ENSG00000168297|ENSG00000168297	ENST00000479134;ENST00000495557|ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000536660;ENST00000536750	.|T;T;T;T;T;T;T;T	.|0.51071	.|2.95;2.95;2.95;0.88;0.82;0.85;0.72;2.95	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69931|0.69931	0.3166|0.3166	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.81914	.|0.993;0.994;0.989;0.995;0.988;0.988	T|T	0.69727|0.69727	-0.5067|-0.5067	5|10	.|0.54805	.|T	.|0.06	-18.4633|-18.4633	18.4824|18.4824	0.90817|0.90817	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|409;409;409;442;425;442	.|E9PD56;Q7Z7A4-6;B4DID9;Q7Z7A4;Q7Z7A4-4;Q7Z7A4-2	.|.;.;.;PXK_HUMAN;.;.	Y|I	197;14|442;425;409;409;425;442;425;305;305	.|ENSP00000348472:R442I;ENSP00000305045:R425I;ENSP00000373222:R409I;ENSP00000417903:R409I;ENSP00000373221:R425I;ENSP00000417915:R442I;ENSP00000419049:R425I;ENSP00000438356:R305I	.|ENSP00000305045:R425I	D|R	+|+	1|2	0|0	PXK|PXK	58370315|58370315	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.296000|7.296000	0.78790|0.78790	2.871000|2.871000	0.98454|0.98454	0.637000|0.637000	0.83480|0.83480	GAC|AGA	.		0.423	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771	
PBX2P1	5088	bcgsc.ca	37	3	142897153	142897153	+	RNA	SNP	T	T	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr3:142897153T>A	ENST00000560287.1	+	0	2027									pre-B-cell leukemia homeobox 2 pseudogene 1																		tttttttttttAAAGAAAGAA	0.348																																					.													.	.	.	0			.						.																																					5088	.			TTTTTTTAAAGAA			3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897153T>A		Somatic	97	4		WXS	Illumina HiSeq	Phase_1	78	8	.		RNA	SNP	ENST00000560287.1	37																																																																																				.		0.348	PBX2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417717.1	NG_002434	
SPON2	10417	bcgsc.ca	37	4	1161434	1161434	+	Silent	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:1161434C>T	ENST00000290902.5	-	6	1154	c.822G>A	c.(820-822)acG>acA	p.T274T	RP11-20I20.4_ENST00000609548.1_RNA|SPON2_ENST00000431380.1_Silent_p.T274T	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	274					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		AGTCCAGCGGCGTTTCTGGAA	0.632											OREG0016030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T274T													.	SPON2	22	0			c.G822A						.						50.0	54.0	53.0					4																	1161434		2203	4300	6503	SO:0001819	synonymous_variant	10417	exon8			CAGCGGCGTTTCT	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.822G>A	4.37:g.1161434C>T		Somatic	85	0	593	WXS	Illumina HiSeq	Phase_1	83	5	NM_001199021	D3DVN9|Q4W5N4|Q9ULW1	Silent	SNP	ENST00000290902.5	37	CCDS3347.1																																																																																			.		0.632	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
ANAPC4	29945	bcgsc.ca	37	4	25419867	25419867	+	Missense_Mutation	SNP	G	G	A	rs561331536	byFrequency	TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:25419867G>A	ENST00000315368.3	+	29	2432	c.2290G>A	c.(2290-2292)Gcc>Acc	p.A764T	ANAPC4_ENST00000510092.1_Missense_Mutation_p.A765T	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	764					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				AGAGGAGGAGGCCAGTAATAA	0.428													G|||	3	0.000599042	0.0023	0.0	5008	,	,		16465	0.0		0.0	False		,,,				2504	0.0				p.A764T													.	ANAPC4	61	0			c.G2290A						.						153.0	166.0	162.0					4																	25419867		2203	4300	6503	SO:0001583	missense	29945	exon29			GAGGAGGCCAGTA	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.2290G>A	4.37:g.25419867G>A	ENSP00000318775:p.Ala764Thr	Somatic	77	0		WXS	Illumina HiSeq	Phase_1	51	4	NM_013367	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	ENST00000315368.3	37	CCDS3434.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582726	0.46006	.	.	ENSG00000053900	ENST00000315368;ENST00000510092	T;T	0.32753	1.44;1.45	5.74	5.74	0.90152	.	0.520282	0.22795	N	0.055546	T	0.20820	0.0501	N	0.14661	0.345	0.49915	D	0.999835	B	0.33694	0.421	B	0.29785	0.107	T	0.05007	-1.0912	10	0.29301	T	0.29	-15.4791	18.471	0.90774	0.0:0.0:1.0:0.0	.	764	Q9UJX5	APC4_HUMAN	T	764;765	ENSP00000318775:A764T;ENSP00000426654:A765T	ENSP00000318775:A764T	A	+	1	0	ANAPC4	25028965	1.000000	0.71417	0.998000	0.56505	0.651000	0.38670	4.740000	0.62087	2.861000	0.98227	0.643000	0.83706	GCC	.		0.428	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367	
N4BP2	55728	bcgsc.ca	37	4	40154490	40154490	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:40154490C>T	ENST00000261435.6	+	17	5650	c.5234C>T	c.(5233-5235)gCt>gTt	p.A1745V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1745	Smr. {ECO:0000255|PROSITE- ProRule:PRU00321}.				nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ATCAAACCAGCTGTCATTAAG	0.428																																					p.A1745V													.	N4BP2	166	0			c.C5234T						.						164.0	144.0	151.0					4																	40154490		2203	4300	6503	SO:0001583	missense	55728	exon17			AACCAGCTGTCAT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.5234C>T	4.37:g.40154490C>T	ENSP00000261435:p.Ala1745Val	Somatic	76	0		WXS	Illumina HiSeq	Phase_1	69	4	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064742	0.76187	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.29917	1.55	5.83	5.83	0.93111	Smr protein/MutS2 C-terminal (2);	0.125580	0.52532	D	0.000072	T	0.60663	0.2286	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.62435	-0.6855	10	0.87932	D	0	-12.7053	20.1338	0.98010	0.0:1.0:0.0:0.0	.	1728;1745	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	V	1745;1665	ENSP00000261435:A1745V	ENSP00000261435:A1745V	A	+	2	0	N4BP2	39830885	1.000000	0.71417	0.974000	0.42286	0.116000	0.19942	7.174000	0.77620	2.770000	0.95276	0.655000	0.94253	GCT	.		0.428	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
KRT18P51	391703	bcgsc.ca	37	4	145493772	145493772	+	IGR	SNP	G	G	A			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr4:145493772G>A								RP11-361D14.2 (63619 upstream) : HHIP-AS1 (70301 downstream)																							TTTGGAGATCGACCTGGACTC	0.567																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	391703	.			GAGATCGACCTGG																													4.37:g.145493772G>A		Somatic	22	0		WXS	Illumina HiSeq	Phase_1	11	6	.		RNA	SNP		37																																																																																				.	0	0.567								
CYFIP1	23191	bcgsc.ca	37	15	22925822	22925822	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr15:22925822G>T	ENST00000313077.7	+	2	165	c.40G>T	c.(40-42)Gtg>Ttg	p.V14L	CYFIP1_ENST00000560848.1_Missense_Mutation_p.V14L	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCTGTCCAACGTGGACCTCCT	0.662																																					p.V14L													.	CYFIP1	159	0			c.G40T						.						41.0	40.0	40.0					15																	22925822		2203	4300	6503	SO:0001583	missense	23191	exon2			TCCAACGTGGACC	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.40G>T	15.37:g.22925822G>T	ENSP00000324549:p.Val14Leu	Somatic	28	0		WXS	Illumina HiSeq	Phase_1	20	3	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	G	32	5.133082	0.94517	.	.	ENSG00000068793	ENST00000313077;ENST00000412127	T	0.40476	1.03	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000002	T	0.66915	0.2838	M	0.81497	2.545	0.80722	D	1	D;P	0.55605	0.972;0.761	D;B	0.65773	0.938;0.426	T	0.65747	-0.6093	10	0.40728	T	0.16	-39.3067	19.6223	0.95663	0.0:0.0:1.0:0.0	.	72;14	E7EQ04;Q7L576	.;CYFP1_HUMAN	L	14;72	ENSP00000324549:V14L	ENSP00000324549:V14L	V	+	1	0	CYFIP1	20477263	1.000000	0.71417	0.966000	0.40874	0.746000	0.42486	9.592000	0.98245	2.712000	0.92718	0.561000	0.74099	GTG	.		0.662	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
Unknown	0	bcgsc.ca	37	16	52689891	52689891	+	IGR	SNP	T	T	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr16:52689891T>C								RP11-297L17.4 (26621 upstream) : RP11-467J12.2 (286801 downstream)																							TAAACTGAAATGCACCAAAGA	0.498																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CTGAAATGCACCA																													16.37:g.52689891T>C		Somatic	84	1		WXS	Illumina HiSeq	Phase_1	73	9	.		RNA	SNP		37																																																																																				.	0	0.498								
ATP8B3	148229	bcgsc.ca	37	19	1783099	1783099	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:1783099G>T	ENST00000310127.6	-	29	4069	c.3831C>A	c.(3829-3831)agC>agA	p.S1277R	ATP8B3_ENST00000525591.1_Missense_Mutation_p.S1240R|ATP8B3_ENST00000539485.1_Missense_Mutation_p.S1287R	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1277					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTATGTCACTGCTGACCCCTG	0.552																																					p.S1277R													.	ATP8B3	108	0			c.C3831A						.						75.0	75.0	75.0					19																	1783099		2068	4209	6277	SO:0001583	missense	148229	exon29			GTCACTGCTGACC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3831C>A	19.37:g.1783099G>T	ENSP00000311336:p.Ser1277Arg	Somatic	30	0		WXS	Illumina HiSeq	Phase_1	18	3	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	G	6.912	0.537965	0.13188	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.57907	0.37;0.49;0.46	4.29	-1.1	0.09872	.	1.012940	0.07929	U	0.977259	T	0.32704	0.0838	L	0.40543	1.245	0.09310	N	1	B;P	0.34462	0.244;0.454	B;B	0.27380	0.075;0.079	T	0.16041	-1.0416	10	0.16420	T	0.52	.	3.0929	0.06299	0.0929:0.1494:0.4518:0.3059	.	1277;1240	O60423;Q7Z485	AT8B3_HUMAN;.	R	1277;1287;1240	ENSP00000311336:S1277R;ENSP00000443574:S1287R;ENSP00000437115:S1240R	ENSP00000311336:S1277R	S	-	3	2	ATP8B3	1734099	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	0.591000	0.23969	0.027000	0.15297	0.561000	0.74099	AGC	.		0.552	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
MUC16	94025	bcgsc.ca	37	19	9070320	9070320	+	Missense_Mutation	SNP	G	G	C			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:9070320G>C	ENST00000397910.4	-	3	17329	c.17126C>G	c.(17125-17127)gCc>gGc	p.A5709G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5711	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCATGCATGGCTTCTGTGTG	0.512																																					p.A5709G													.	MUC16	4315	0			c.C17126G						.						169.0	163.0	165.0					19																	9070320		2099	4216	6315	SO:0001583	missense	94025	exon3			TGCATGGCTTCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17126C>G	19.37:g.9070320G>C	ENSP00000381008:p.Ala5709Gly	Somatic	59	0		WXS	Illumina HiSeq	Phase_1	37	4	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.573	-0.840234	0.02692	.	.	ENSG00000181143	ENST00000397910	T	0.22134	1.97	1.54	-3.09	0.05331	.	.	.	.	.	T	0.12603	0.0306	L	0.36672	1.1	.	.	.	B	0.17667	0.023	B	0.14023	0.01	T	0.29458	-1.0011	8	0.87932	D	0	.	0.7916	0.01058	0.1509:0.1894:0.2779:0.3817	.	5709	B5ME49	.	G	5709	ENSP00000381008:A5709G	ENSP00000381008:A5709G	A	-	2	0	MUC16	8931320	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.540000	0.00937	-1.850000	0.01169	-2.151000	0.00333	GCC	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
Unknown	0	bcgsc.ca	37	X	55661142	55661142	+	IGR	SNP	A	A	T			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chrX:55661142A>T								FOXR2 (8521 upstream) : RP11-167P23.2 (20011 downstream)																							CTGCACCCTGATCTCTCTCCT	0.522																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACCCTGATCTCTC																													X.37:g.55661142A>T		Somatic	95	0		WXS	Illumina HiSeq	Phase_1	45	22	.		RNA	SNP		37																																																																																				.	0	0.522								
PDGFRB	5159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149500517	149500518	+	Missense_Mutation	DNP	GA	GA	TT	rs371399585		TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr5:149500517_149500518GA>TT	ENST00000261799.4	-	18	2988_2989	c.2519_2520TC>AA	c.(2518-2520)gTC>gAA	p.V840E		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	840	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CACAGATCTTGACCAGCTTGCC	0.584			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.V840E		.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.	.	0			c.T2519A						.																																			SO:0001583	missense	5159	exon18			ATCTTGACCAGCT	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2519_2520delinsTT	5.37:g.149500517_149500518delinsTT	ENSP00000261799:p.Val840Glu	Somatic	28	0		WXS	Illumina HiSeq	.	27	9	NM_002609	B5A957|Q8N5L4	Missense_Mutation	DNP	ENST00000261799.4	37	CCDS4303.1																																																																																			.		0.584	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
RELB	5971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45532159	45532159	+	Silent	SNP	A	A	G			TCGA-3X-AAVA-01A-11D-A417-09	TCGA-3X-AAVA-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0d1d86aa-d72b-441f-9db7-c8abdba61a42	db714f8e-6bbe-4713-a252-2f38ae5c7d6a	g.chr19:45532159A>G	ENST00000221452.8	+	8	1050	c.900A>G	c.(898-900)acA>acG	p.T300T	RELB_ENST00000540120.1_Silent_p.T300T|RELB_ENST00000505236.1_Silent_p.T297T	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	300	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		CCACAAACACATCAGAGCTGC	0.527																																					.		.											.	.	.	0			.						.						28.0	28.0	28.0					19																	45532159		1893	4097	5990	SO:0001819	synonymous_variant	5971	p.T300T			AAACACATCAGAG	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.900A>G	19.37:g.45532159A>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	38	15	.	Q6GTX7|Q9UEI7	Silent	SNP	ENST00000221452.8	37	CCDS46110.1																																																																																			.		0.527	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2		
