#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HTATSF1	27336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	135593803	135593803	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:135593803delA	ENST00000218364.4	+	9	2073	c.1899delA	c.(1897-1899)acafs	p.T633fs	HTATSF1_ENST00000535601.1_Frame_Shift_Del_p.T633fs	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	633	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AGGAGGATACATATGAAAAAG	0.408																																					p.T633fs		.											.	.	.	0			c.1898delC						.						109.0	109.0	109.0					X																	135593803		2203	4300	6503	SO:0001589	frameshift_variant	27336	exon10			GGATACATATGAA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1899delA	X.37:g.135593803delA	ENSP00000218364:p.Thr633fs	Somatic	118	0		WXS	Illumina HiSeq	.	65	17	NM_001163280	D3DWG9|Q59G06|Q99730	Frame_Shift_Del	DEL	ENST00000218364.4	37	CCDS14657.1																																																																																			.		0.408	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
SELP	6403	hgsc.bcm.edu	37	1	169564103	169564103	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:169564103G>T	ENST00000263686.6	-	13	2151	c.2114C>A	c.(2113-2115)tCa>tAa	p.S705*	SELP_ENST00000367793.2_Nonsense_Mutation_p.S643*|SELP_ENST00000367788.2_Nonsense_Mutation_p.S643*|SELP_ENST00000367792.2_Nonsense_Mutation_p.S521*|SELP_ENST00000458599.2_Nonsense_Mutation_p.S521*|SELP_ENST00000367791.2_Nonsense_Mutation_p.S519*|SELP_ENST00000367794.2_Nonsense_Mutation_p.S643*|SELP_ENST00000367786.2_Nonsense_Mutation_p.S643*	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	705	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.S705*(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	ATGTAGTTCTGAGCATTTCAC	0.398																																					p.S705X		.											SELP,NS,carcinoma,0,1	SELP	0	1	Substitution - Nonsense(1)	lung(1)	c.C2114A						.						103.0	93.0	97.0					1																	169564103		2203	4300	6503	SO:0001587	stop_gained	6403	exon13			AGTTCTGAGCATT	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.2114C>A	1.37:g.169564103G>T	ENSP00000263686:p.Ser705*	Somatic	107	0		WXS	Illumina HiSeq	.	35	2	NM_003005	Q5R344|Q8IVD1	Nonsense_Mutation	SNP	ENST00000263686.6	37	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	G	36	5.602469	0.96614	.	.	ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367788;ENST00000367786;ENST00000458599	.	.	.	5.22	3.35	0.38373	.	1.070140	0.07273	N	0.869436	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-0.0435	8.7049	0.34349	0.1781:0.0:0.8219:0.0	.	.	.	.	X	519;705;704;521;705;705;643;643;521;519;643;643;628	.	ENSP00000263686:S705X	S	-	2	0	SELP	167830727	0.227000	0.23707	0.001000	0.08648	0.130000	0.20726	1.714000	0.37961	0.699000	0.31761	-0.222000	0.12452	TCA	.		0.398	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005	
ITK	3702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156670696	156670696	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:156670696G>T	ENST00000422843.3	+	12	1276	c.1124G>T	c.(1123-1125)gGg>gTg	p.G375V	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	375	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	GGGCAATTTGGGTTGGTGCAT	0.517			T	SYK	peripheral T-cell lymphoma																																p.G375V	Esophageal Squamous(70;1378 1469 8785 19883)	.		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	.	.	0			c.G1124T						.						165.0	164.0	164.0					5																	156670696		2203	4300	6503	SO:0001583	missense	3702	exon12			AATTTGGGTTGGT	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1124G>T	5.37:g.156670696G>T	ENSP00000398655:p.Gly375Val	Somatic	68	0		WXS	Illumina HiSeq	.	53	19	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124049	0.94429	.	.	ENSG00000113263	ENST00000422843	T	0.79749	-1.3	5.79	5.79	0.91817	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94843	0.8334	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96636	0.9470	10	0.87932	D	0	.	20.0263	0.97523	0.0:0.0:1.0:0.0	.	375	Q08881	ITK_HUMAN	V	375	ENSP00000398655:G375V	ENSP00000398655:G375V	G	+	2	0	ITK	156603274	1.000000	0.71417	0.981000	0.43875	0.994000	0.84299	9.676000	0.98643	2.735000	0.93741	0.655000	0.94253	GGG	.		0.517	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
MYBL2	4605	hgsc.bcm.edu	37	20	42315650	42315650	+	Silent	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr20:42315650C>A	ENST00000217026.4	+	5	565	c.438C>A	c.(436-438)atC>atA	p.I146I	MYBL2_ENST00000396863.4_Silent_p.I122I	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	146	HTH myb-type 3. {ECO:0000255|PROSITE- ProRule:PRU00625}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I146I(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ACCGCATCATCTGCGAGGCCC	0.627																																					p.I146I		.											MYBL2,NS,carcinoma,0,1	MYBL2	0	1	Substitution - coding silent(1)	lung(1)	c.C438A						.						47.0	40.0	42.0					20																	42315650		2203	4300	6503	SO:0001819	synonymous_variant	4605	exon5			CATCATCTGCGAG		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.438C>A	20.37:g.42315650C>A		Somatic	59	0		WXS	Illumina HiSeq	.	40	2	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	37	CCDS13322.1																																																																																			.		0.627	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
TTC8	123016	hgsc.bcm.edu	37	14	89338781	89338781	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:89338781G>T	ENST00000345383.5	+	12	1386	c.1302G>T	c.(1300-1302)aaG>aaT	p.K434N	TTC8_ENST00000358622.5_Missense_Mutation_p.K246N|TTC8_ENST00000346301.4_Missense_Mutation_p.K404N|TTC8_ENST00000536576.1_Missense_Mutation_p.K205N|TTC8_ENST00000338104.6_Missense_Mutation_p.K460N|TTC8_ENST00000380656.2_Missense_Mutation_p.K444N|TTC8_ENST00000354441.6_Missense_Mutation_p.K179N	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	470					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						AGATGCGGAAGGGCCACGTTG	0.527																																					p.K444N		.											TTC8,colon,carcinoma,0,1	TTC8	0	0			c.G1332T						.						135.0	113.0	120.0					14																	89338781		2203	4300	6503	SO:0001583	missense	123016	exon13			GCGGAAGGGCCAC	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1302G>T	14.37:g.89338781G>T	ENSP00000339486:p.Lys434Asn	Somatic	77	0		WXS	Illumina HiSeq	.	44	2	NM_144596	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	CCDS9885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.20|15.20|15.20	2.764018|2.764018|2.764018	0.49574|0.49574|0.49574	.|.|.	.|.|.	ENSG00000165533|ENSG00000165533|ENSG00000165533	ENST00000557580|ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000554686	.|T;T;T;T;T;T;T|.	.|0.59638|.	.|0.25;0.25;0.25;0.25;0.25;0.25;0.25|.	5.59|5.59|5.59	5.59|5.59|5.59	0.84812|0.84812|0.84812	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	.|0.091515|.	.|0.64402|.	.|D|.	.|0.000001|.	T|T|T	0.67382|0.67382|0.67382	0.2887|0.2887|0.2887	M|M|M	0.77820|0.77820|0.77820	2.39|2.39|2.39	0.58432|0.58432|0.58432	D|D|D	0.999997|0.999997|0.999997	.|B;B;B;B;B|.	.|0.32467|.	.|0.372;0.007;0.22;0.002;0.005|.	.|B;B;B;B;B|.	.|0.30716|.	.|0.065;0.031;0.119;0.012;0.018|.	T|T|T	0.68655|0.68655|0.68655	-0.5351|-0.5351|-0.5351	5|10|5	.|0.23302|.	.|T|.	.|0.38|.	-13.9832|-13.9832|-13.9832	7.6284|7.6284|7.6284	0.28226|0.28226|0.28226	0.1954:0.0:0.8046:0.0|0.1954:0.0:0.8046:0.0|0.1954:0.0:0.8046:0.0	.|.|.	.|179;205;470;414;444|.	.|Q8TAM2-2;B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4|.	.|.;.;TTC8_HUMAN;.;.|.	W|N|M	233|434;205;404;460;179;444;246|394	.|ENSP00000339486:K434N;ENSP00000445067:K205N;ENSP00000298324:K404N;ENSP00000337653:K460N;ENSP00000346427:K179N;ENSP00000370031:K444N;ENSP00000351439:K246N|.	.|ENSP00000337653:K460N|.	G|K|R	+|+|+	1|3|2	0|2|0	TTC8|TTC8|TTC8	88408534|88408534|88408534	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	2.383000|2.383000|2.383000	0.44354|0.44354|0.44354	2.793000|2.793000|2.793000	0.96121|0.96121|0.96121	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GGG|AAG|AGG	.		0.527	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
SNX13	23161	hgsc.bcm.edu	37	7	17836491	17836491	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:17836491G>T	ENST00000409389.1	-	25	2790	c.2618C>A	c.(2617-2619)aCa>aAa	p.T873K	SNX13_ENST00000496855.1_5'UTR|SNX13_ENST00000428135.3_Missense_Mutation_p.T862K			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	873					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TGCTACTCTTGTTCTCATTCG	0.333																																					p.T862K		.											SNX13,caecum,carcinoma,0,1	SNX13	0	0			c.C2585A						.						209.0	189.0	195.0					7																	17836491		1837	4097	5934	SO:0001583	missense	23161	exon25			ACTCTTGTTCTCA	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.2618C>A	7.37:g.17836491G>T	ENSP00000386705:p.Thr873Lys	Somatic	91	0		WXS	Illumina HiSeq	.	43	2	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	G	29.0	4.965744	0.92855	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.33654	1.4;1.4	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.994	T	0.69595	-0.5103	10	0.44086	T	0.13	-13.1594	19.214	0.93768	0.0:0.0:1.0:0.0	.	659;873;862	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	K	873;862;910	ENSP00000386705:T873K;ENSP00000398789:T862K	ENSP00000242044:T910K	T	-	2	0	SNX13	17803016	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.529000	0.85273	0.557000	0.71058	ACA	.		0.333	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
HSD17B7	51478	hgsc.bcm.edu	37	1	162769603	162769603	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:162769603G>A	ENST00000254521.3	+	5	573	c.518G>A	c.(517-519)aGt>aAt	p.S173N	HSD17B7_ENST00000485405.1_3'UTR|HSD17B7_ENST00000367917.3_Missense_Mutation_p.S173N	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	173					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)	p.S173N(4)		endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TCATCTCGCAGTGCAAGGAAA	0.458																																					p.S173N		.											HSD17B7,NS,carcinoma,0,5	HSD17B7	0	4	Substitution - Missense(4)	kidney(2)|endometrium(2)	c.G518A						.						76.0	70.0	72.0					1																	162769603		2203	4300	6503	SO:0001583	missense	51478	exon5			CTCGCAGTGCAAG	AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.518G>A	1.37:g.162769603G>A	ENSP00000254521:p.Ser173Asn	Somatic	72	0		WXS	Illumina HiSeq	.	25	2	NM_016371	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Missense_Mutation	SNP	ENST00000254521.3	37	CCDS1242.1	.	.	.	.	.	.	.	.	.	.	A	0.896	-0.723912	0.03158	.	.	ENSG00000132196	ENST00000367917;ENST00000254521;ENST00000413934	T;T;T	0.76578	2.88;-1.03;2.88	4.44	3.31	0.37934	NAD(P)-binding domain (1);	0.000000	0.85682	N	0.000000	T	0.27205	0.0667	N	0.04705	-0.18	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.06917	-1.0800	9	0.05833	T	0.94	-30.7352	7.9369	0.29935	0.8252:0.0:0.1748:0.0	.	173	P56937	DHB7_HUMAN	N	173;173;26	ENSP00000356894:S173N;ENSP00000254521:S173N;ENSP00000412146:S26N	ENSP00000254521:S173N	S	+	2	0	HSD17B7	161036227	1.000000	0.71417	0.991000	0.47740	0.478000	0.33099	4.183000	0.58317	0.241000	0.21283	-1.007000	0.02485	AGT	.		0.458	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371	
FOLH1	2346	hgsc.bcm.edu	37	11	49175427	49175427	+	Silent	SNP	A	A	G	rs199517010		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:49175427A>G	ENST00000256999.2	-	17	2201	c.1941T>C	c.(1939-1941)agT>agC	p.S647S	FOLH1_ENST00000340334.7_Silent_p.S632S|FOLH1_ENST00000356696.3_Silent_p.S647S|FOLH1_ENST00000343844.4_Silent_p.S339S|FOLH1_ENST00000533034.1_Silent_p.S632S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	647					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.S647S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GGAGTCTCTCACTGAACTTGG	0.294																																					p.S647S		.											FOLH1,mouth,carcinoma,0,1	FOLH1	0	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.T1941C						.						83.0	85.0	84.0					11																	49175427		2201	4296	6497	SO:0001819	synonymous_variant	2346	exon17			TCTCTCACTGAAC	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1941T>C	11.37:g.49175427A>G		Somatic	68	0		WXS	Illumina HiSeq	.	50	2	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																			0.001		0.294	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
ERMP1	79956	hgsc.bcm.edu	37	9	5825098	5825098	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:5825098G>T	ENST00000339450.5	-	3	851	c.762C>A	c.(760-762)gtC>gtA	p.V254V	ERMP1_ENST00000214893.5_Intron|ERMP1_ENST00000381506.3_Silent_p.V30V	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	254						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TCACTTGCAAGACATTTTCCT	0.338																																					p.V254V		.											.	.	.	0			c.C762A						.						65.0	61.0	62.0					9																	5825098		2203	4300	6503	SO:0001819	synonymous_variant	79956	exon3			TTGCAAGACATTT	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.762C>A	9.37:g.5825098G>T		Somatic	126	0		WXS	Illumina HiSeq	.	71	4	NM_024896	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			.		0.338	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
OR2L8	391190	hgsc.bcm.edu	37	1	248112794	248112794	+	Missense_Mutation	SNP	G	G	C	rs200574966		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:248112794G>C	ENST00000357191.3	+	1	635	c.635G>C	c.(634-636)gGt>gCt	p.G212A	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G212A(2)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCCTTCATTGGTATTTCATGT	0.498																																					p.G212A		.											OR2L8,NS,carcinoma,0,2	OR2L8	0	2	Substitution - Missense(2)	prostate(1)|skin(1)	c.G635C						.						176.0	87.0	117.0					1																	248112794		2203	4300	6503	SO:0001583	missense	391190	exon1			TCATTGGTATTTC	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.635G>C	1.37:g.248112794G>C	ENSP00000349719:p.Gly212Ala	Somatic	90	1		WXS	Illumina HiSeq	.	42	2	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.747988	0.00669	.	.	ENSG00000196936	ENST00000357191	T	0.35973	1.28	1.8	-3.61	0.04556	GPCR, rhodopsin-like superfamily (1);	0.592578	0.12695	U	0.446818	T	0.14657	0.0354	N	0.05012	-0.13	0.09310	N	1	B	0.06786	0.001	B	0.18263	0.021	T	0.11817	-1.0572	10	0.46703	T	0.11	.	5.6462	0.17590	0.0:0.2703:0.1902:0.5394	.	212	Q8NGY9	OR2L8_HUMAN	A	212	ENSP00000349719:G212A	ENSP00000349719:G212A	G	+	2	0	OR2L8	246179417	0.000000	0.05858	0.006000	0.13384	0.165000	0.22458	-1.473000	0.02339	-1.273000	0.02424	-0.515000	0.04445	GGT	.		0.498	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
ARHGEF40	55701	hgsc.bcm.edu	37	14	21542360	21542360	+	Silent	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:21542360G>A	ENST00000298694.4	+	3	598	c.471G>A	c.(469-471)cgG>cgA	p.R157R	ARHGEF40_ENST00000298693.3_Silent_p.R157R			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	157						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R157R(1)		large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						ACAAGGACCGGCCAACAGGTC	0.607																																					p.R157R		.											ARHGEF40_ENST00000298694,colon,carcinoma,+1,1	ARHGEF40_ENST00000298694	+1	1	Substitution - coding silent(1)	prostate(1)	c.G471A						.						58.0	61.0	60.0					14																	21542360		2203	4300	6503	SO:0001819	synonymous_variant	55701	exon3			GGACCGGCCAACA		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.471G>A	14.37:g.21542360G>A		Somatic	53	0		WXS	Illumina HiSeq	.	39	2	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	ENST00000298694.4	37	CCDS32041.1																																																																																			.		0.607	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248W	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,+1,704	TP53_ENST00000545858	+1	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	c.C742T	GRCh37	CM010465|CM900211	TP53	M	rs121912651	.						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCCTCCGGTTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic	48	0		WXS	Illumina HiSeq	.	10	5	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SLC22A5	6584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131729481	131729481	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:131729481G>A	ENST00000245407.3	+	9	1785	c.1564G>A	c.(1564-1566)Gac>Aac	p.D522N	SLC22A5_ENST00000435065.2_Missense_Mutation_p.D546N	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5	522					carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	AGACACCATTGACCAGATGCT	0.542																																					p.D522N		.											.	.	.	0			c.G1564A						.						234.0	218.0	223.0					5																	131729481		2203	4300	6503	SO:0001583	missense	6584	exon9			ACCATTGACCAGA	AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.1564G>A	5.37:g.131729481G>A	ENSP00000245407:p.Asp522Asn	Somatic	59	0		WXS	Illumina HiSeq	.	31	5	NM_003060	A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Missense_Mutation	SNP	ENST00000245407.3	37	CCDS4154.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095433	0.76870	.	.	ENSG00000197375	ENST00000245407;ENST00000435065	T;T	0.75050	-0.85;-0.9	5.87	5.87	0.94306	.	0.325278	0.36268	N	0.002684	T	0.71896	0.3394	L	0.41027	1.25	0.47547	D	0.999452	B;B	0.20550	0.046;0.026	B;B	0.26310	0.068;0.038	T	0.66670	-0.5865	10	0.66056	D	0.02	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	546;522	A2Q0V1;O76082	.;S22A5_HUMAN	N	522;546	ENSP00000245407:D522N;ENSP00000402760:D546N	ENSP00000245407:D522N	D	+	1	0	SLC22A5	131757380	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.931000	0.70113	2.941000	0.99782	0.655000	0.94253	GAC	.		0.542	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132631.1	NM_003060	
PDE7B	27115	hgsc.bcm.edu	37	6	136512843	136512843	+	Silent	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:136512843C>A	ENST00000308191.6	+	13	1521	c.1218C>A	c.(1216-1218)ctC>ctA	p.L406L	RP13-143G15.4_ENST00000591521.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000417643.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	406	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TGGGCCACCTCGCACACAACA	0.617																																					p.L406L		.											PDE7B,NS,malignant_melanoma,+2,1	PDE7B	+2	0			c.C1218A						.						49.0	42.0	44.0					6																	136512843		2203	4300	6503	SO:0001819	synonymous_variant	27115	exon13			CCACCTCGCACAC	AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.1218C>A	6.37:g.136512843C>A		Somatic	59	0		WXS	Illumina HiSeq	.	32	2	NM_018945	Q5W154	Silent	SNP	ENST00000308191.6	37	CCDS5175.1																																																																																			.		0.617	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042371.1		
ZMPSTE24	10269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40724003	40724003	+	Silent	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:40724003C>T	ENST00000372759.3	+	1	225	c.60C>T	c.(58-60)ttC>ttT	p.F20F	RP1-39G22.7_ENST00000567508.1_RNA|ZMPSTE24_ENST00000479131.1_3'UTR	NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	20					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AGCGTATCTTCGGGGCCGTGC	0.632																																					p.F20F		.											.	.	.	0			c.C60T						.						123.0	107.0	112.0					1																	40724003		2203	4300	6503	SO:0001819	synonymous_variant	10269	exon1			TATCTTCGGGGCC	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.60C>T	1.37:g.40724003C>T		Somatic	26	0		WXS	Illumina HiSeq	.	32	5	NM_005857	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	ENST00000372759.3	37	CCDS449.1																																																																																			.		0.632	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
ABCB5	340273	hgsc.bcm.edu	37	7	20778674	20778674	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:20778674C>A	ENST00000404938.2	+	24	3588	c.2936C>A	c.(2935-2937)tCc>tAc	p.S979Y	ABCB5_ENST00000258738.6_Missense_Mutation_p.S534Y	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	979	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CCTGAATATTCCAAAGCCAAA	0.428																																					p.S979Y		.											ABCB5_ENST00000404938,right_upper_lobe,carcinoma,0,2	ABCB5_ENST00000404938	0	0			c.C2936A						.						59.0	57.0	58.0					7																	20778674		2203	4300	6503	SO:0001583	missense	340273	exon24			AATATTCCAAAGC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2936C>A	7.37:g.20778674C>A	ENSP00000384881:p.Ser979Tyr	Somatic	75	0		WXS	Illumina HiSeq	.	53	3	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732524	0.89482	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.72394	-0.65;-0.65	4.99	4.99	0.66335	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.64402	D	0.000016	T	0.76695	0.4023	L	0.43152	1.355	0.48696	D	0.999691	D;D	0.65815	0.995;0.975	P;P	0.59703	0.862;0.805	T	0.78768	-0.2075	10	0.87932	D	0	.	16.1633	0.81734	0.0:1.0:0.0:0.0	.	979;534	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	Y	979;534	ENSP00000384881:S979Y;ENSP00000258738:S534Y	ENSP00000258738:S534Y	S	+	2	0	ABCB5	20745199	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.709000	0.54853	2.774000	0.95407	0.484000	0.47621	TCC	.		0.428	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
TUBGCP3	10426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113200144	113200144	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr13:113200144C>T	ENST00000261965.3	-	11	1390	c.1204G>A	c.(1204-1206)Gcc>Acc	p.A402T	TUBGCP3_ENST00000462580.1_5'UTR|TUBGCP3_ENST00000375669.3_Missense_Mutation_p.A402T	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	402					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TTTGTGTAGGCGTGGACAGCT	0.498																																					p.A402T		.											TUBGCP3,NS,carcinoma,0,2	TUBGCP3	0	0			c.G1204A						.						156.0	153.0	154.0					13																	113200144		2203	4300	6503	SO:0001583	missense	10426	exon11			TGTAGGCGTGGAC	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.1204G>A	13.37:g.113200144C>T	ENSP00000261965:p.Ala402Thr	Somatic	48	0		WXS	Illumina HiSeq	.	29	4	NM_006322	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	ENST00000261965.3	37	CCDS9525.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147480	0.57151	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.07908	3.15;3.15	5.28	5.28	0.74379	.	0.104462	0.64402	D	0.000004	T	0.06050	0.0157	N	0.12182	0.205	0.52501	D	0.999958	B;B;B	0.26809	0.074;0.018;0.16	B;B;B	0.19946	0.027;0.016;0.027	T	0.46762	-0.9168	10	0.19590	T	0.45	-23.2422	18.9596	0.92673	0.0:1.0:0.0:0.0	.	392;402;402	B4DYP7;Q96CW5-2;Q96CW5	.;.;GCP3_HUMAN	T	402	ENSP00000261965:A402T;ENSP00000364821:A402T	ENSP00000261965:A402T	A	-	1	0	TUBGCP3	112248145	1.000000	0.71417	0.958000	0.39756	0.963000	0.63663	4.269000	0.58890	2.476000	0.83614	0.549000	0.68633	GCC	.		0.498	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	NM_006322	
HAUS4	54930	hgsc.bcm.edu	37	14	23424312	23424312	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:23424312G>T	ENST00000206474.7	-	2	304	c.52C>A	c.(52-54)Caa>Aaa	p.Q18K	HAUS4_ENST00000541587.1_Missense_Mutation_p.Q18K|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000490506.1_5'UTR|HAUS4_ENST00000555986.1_Missense_Mutation_p.Q18K|RP11-298I3.5_ENST00000555074.1_Intron|HAUS4_ENST00000342454.8_Missense_Mutation_p.Q18K|HAUS4_ENST00000554446.1_5'UTR|HAUS4_ENST00000347758.2_Missense_Mutation_p.Q18K|RP11-298I3.1_ENST00000548322.1_RNA|MIR4707_ENST00000579686.1_RNA|HAUS4_ENST00000397409.4_Missense_Mutation_p.Q18K|HAUS4_ENST00000555367.1_Missense_Mutation_p.Q18K			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	18					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)		p.Q18*(1)		breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						CTCTTACCTTGTTGAAGTATT	0.408																																					p.Q18K		.											HAUS4,NS,carcinoma,0,1	HAUS4	0	1	Substitution - Nonsense(1)	lung(1)	c.C52A						.						142.0	133.0	136.0					14																	23424312		2203	4300	6503	SO:0001583	missense	54930	exon2			TACCTTGTTGAAG	AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.52C>A	14.37:g.23424312G>T	ENSP00000206474:p.Gln18Lys	Somatic	54	0		WXS	Illumina HiSeq	.	47	3	NM_001166270	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Missense_Mutation	SNP	ENST00000206474.7	37	CCDS9580.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386901	0.42308	.	.	ENSG00000092036	ENST00000206474;ENST00000541587;ENST00000342454;ENST00000347758;ENST00000397409;ENST00000555367;ENST00000555986;ENST00000555040;ENST00000556915;ENST00000554516;ENST00000557591	.	.	.	5.47	4.52	0.55395	.	0.218947	0.48767	D	0.000175	T	0.36026	0.0952	L	0.34521	1.04	0.19775	N	0.999957	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.004;0.003;0.003	T	0.27606	-1.0069	9	0.59425	D	0.04	.	10.7047	0.45948	0.0:0.0:0.8098:0.1902	.	18;18;18	Q9H6D7-4;Q9H6D7-2;Q9H6D7	.;.;HAUS4_HUMAN	K	18	.	ENSP00000206474:Q18K	Q	-	1	0	HAUS4	22494152	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	1.889000	0.39718	2.575000	0.86900	0.561000	0.74099	CAA	.		0.408	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3		
PTCHD1	139411	hgsc.bcm.edu;bcgsc.ca	37	X	23411591	23411591	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:23411591G>T	ENST00000379361.4	+	3	2816	c.1956G>T	c.(1954-1956)aaG>aaT	p.K652N		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	652					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TGGTGGCCAAGACCATGGAAA	0.428																																					p.K652N		.											.	.	.	0			c.G1956T						.						69.0	66.0	67.0					X																	23411591		2203	4300	6503	SO:0001583	missense	139411	exon3			GGCCAAGACCATG	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1956G>T	X.37:g.23411591G>T	ENSP00000368666:p.Lys652Asn	Somatic	114	0		WXS	Illumina HiSeq	.	75	4	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851665	0.51270	.	.	ENSG00000165186	ENST00000379361	D	0.85339	-1.97	5.48	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.86573	0.5965	L	0.58810	1.83	0.48288	D	0.999629	P	0.47106	0.89	P	0.51918	0.684	D	0.84752	0.0757	10	0.29301	T	0.29	.	13.7385	0.62833	0.0776:0.0:0.9224:0.0	.	652	Q96NR3	PTHD1_HUMAN	N	652	ENSP00000368666:K652N	ENSP00000368666:K652N	K	+	3	2	PTCHD1	23321512	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.630000	0.61297	2.269000	0.75478	0.600000	0.82982	AAG	.		0.428	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
STAG2	10735	hgsc.bcm.edu	37	X	123220534	123220534	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:123220534G>A	ENST00000371160.1	+	30	3481	c.3191G>A	c.(3190-3192)aGc>aAc	p.S1064N	STAG2_ENST00000354548.5_Missense_Mutation_p.S995N|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.S1064N|STAG2_ENST00000371157.3_Missense_Mutation_p.S1064N|STAG2_ENST00000371145.3_Missense_Mutation_p.S1064N|STAG2_ENST00000371144.3_Missense_Mutation_p.S1064N	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	1064					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AGTGGAATCAGCAGCCGGGGG	0.453																																					p.S1064N		.											.	.	.	0			c.G3191A						.						146.0	124.0	131.0					X																	123220534		2203	4300	6503	SO:0001583	missense	10735	exon30			GAATCAGCAGCCG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.3191G>A	X.37:g.123220534G>A	ENSP00000360202:p.Ser1064Asn	Somatic	92	0		WXS	Illumina HiSeq	.	80	4	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630916	0.46944	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.33438	1.81;1.43;1.41;1.41;1.81;1.41	4.93	4.93	0.64822	.	0.233528	0.45867	D	0.000340	T	0.35248	0.0925	M	0.63428	1.95	0.45194	D	0.998207	B;B	0.11235	0.004;0.003	B;B	0.17979	0.02;0.013	T	0.13335	-1.0513	10	0.38643	T	0.18	-5.8954	17.6226	0.88086	0.0:0.0:1.0:0.0	.	1064;1064	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	N	1064;995;1064;1064;1064;1064	ENSP00000218089:S1064N;ENSP00000346555:S995N;ENSP00000360202:S1064N;ENSP00000360199:S1064N;ENSP00000360187:S1064N;ENSP00000360186:S1064N	ENSP00000218089:S1064N	S	+	2	0	STAG2	123048215	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.249000	0.65427	2.177000	0.69029	0.436000	0.28706	AGC	.		0.453	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651251	1651251	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:1651251G>A	ENST00000399676.2	+	1	219	c.181G>A	c.(181-183)Ggc>Agc	p.G61S		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	61						keratin filament (GO:0045095)		p.G61S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		atgtggctccggctgCTGTGT	0.682																																					p.G61S		.											KRTAP5-5,NS,carcinoma,0,2	KRTAP5-5	0	1	Substitution - Missense(1)	prostate(1)	c.G181A						.						57.0	70.0	66.0					11																	1651251		2196	4292	6488	SO:0001583	missense	439915	exon1			GGCTCCGGCTGCT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.181G>A	11.37:g.1651251G>A	ENSP00000382584:p.Gly61Ser	Somatic	77	1		WXS	Illumina HiSeq	.	38	2	NM_001001480	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	-	0.150	-1.092370	0.01858	.	.	ENSG00000185940	ENST00000399676	T	0.00691	5.84	3.73	1.09	0.20402	.	.	.	.	.	T	0.00328	0.0010	N	0.01352	-0.895	0.18873	N	0.999988	B	0.10296	0.003	B	0.04013	0.001	T	0.41360	-0.9513	9	0.07990	T	0.79	.	3.0968	0.06312	0.4645:0.0:0.3441:0.1915	.	61	Q701N2	KRA55_HUMAN	S	61	ENSP00000382584:G61S	ENSP00000382584:G61S	G	+	1	0	KRTAP5-5	1607827	0.509000	0.26163	0.989000	0.46669	0.064000	0.16182	-0.215000	0.09279	-0.039000	0.13602	-1.322000	0.01289	GGC	.		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
HEG1	57493	hgsc.bcm.edu	37	3	124732804	124732804	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:124732804C>T	ENST00000311127.4	-	6	1686	c.1619G>A	c.(1618-1620)gGc>gAc	p.G540D	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	540	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						AATAGCTGTGCCACGCACTTG	0.443																																					p.G540D		.											HEG1,colon,carcinoma,0,1	HEG1	0	0			c.G1619A						.						109.0	100.0	102.0					3																	124732804		1949	4145	6094	SO:0001583	missense	57493	exon6			GCTGTGCCACGCA	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.1619G>A	3.37:g.124732804C>T	ENSP00000311502:p.Gly540Asp	Somatic	48	0		WXS	Illumina HiSeq	.	28	2	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156558	0.57259	.	.	ENSG00000173706	ENST00000311127	D	0.89123	-2.47	5.53	1.34	0.21922	.	.	.	.	.	D	0.82751	0.5105	L	0.50333	1.59	0.09310	N	1	B;B	0.28178	0.202;0.128	B;B	0.26202	0.067;0.018	T	0.69577	-0.5108	9	0.39692	T	0.17	.	4.8214	0.13392	0.0:0.5666:0.1508:0.2826	.	540;540	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	D	540	ENSP00000311502:G540D	ENSP00000311502:G540D	G	-	2	0	HEG1	126215494	0.288000	0.24324	0.016000	0.15963	0.408000	0.30992	0.457000	0.21875	0.049000	0.15920	0.650000	0.86243	GGC	.		0.443	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
ANKRD34A	284615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145473924	145473924	+	Missense_Mutation	SNP	T	T	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:145473924T>G	ENST00000323397.4	+	4	1889	c.596T>G	c.(595-597)aTg>aGg	p.M199R	RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	199						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGCGTGGGATGTTATCCCCT	0.642																																					p.M199R		.											.	.	.	0			c.T596G						.						64.0	69.0	67.0					1																	145473924		2203	4300	6503	SO:0001583	missense	284615	exon4			GTGGGATGTTATC	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.596T>G	1.37:g.145473924T>G	ENSP00000314103:p.Met199Arg	Somatic	50	0		WXS	Illumina HiSeq	.	28	7	NM_001039888	B3KSU3	Missense_Mutation	SNP	ENST00000323397.4	37	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	T	6.321	0.427378	0.11987	.	.	ENSG00000181039	ENST00000323397	T	0.71461	-0.57	5.23	4.11	0.48088	.	1.163710	0.06704	N	0.771999	T	0.28001	0.0690	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.25572	-1.0128	10	0.23302	T	0.38	-0.3877	7.6776	0.28494	0.0:0.0936:0.0:0.9064	.	199	Q69YU3	AN34A_HUMAN	R	199	ENSP00000314103:M199R	ENSP00000314103:M199R	M	+	2	0	ANKRD34A	144185281	0.003000	0.15002	0.737000	0.30932	0.980000	0.70556	1.230000	0.32612	1.015000	0.39444	0.477000	0.44152	ATG	.		0.642	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
WASF1	8936	hgsc.bcm.edu	37	6	110423269	110423269	+	Silent	SNP	A	A	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:110423269A>G	ENST00000392589.1	-	10	1880	c.1044T>C	c.(1042-1044)ccT>ccC	p.P348P	WASF1_ENST00000392587.2_Silent_p.P348P|WASF1_ENST00000359451.2_Silent_p.P348P|WASF1_ENST00000392588.1_Silent_p.P348P|WASF1_ENST00000392586.1_Silent_p.P348P	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	348	Poly-Pro.				actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CTGGAGGGGGAGGAGTTGAAG	0.567																																					p.P348P		.											WASF1,colon,carcinoma,0,1	WASF1	0	0			c.T1044C						.						104.0	103.0	103.0					6																	110423269		2203	4300	6503	SO:0001819	synonymous_variant	8936	exon9			AGGGGGAGGAGTT	D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.1044T>C	6.37:g.110423269A>G		Somatic	32	1		WXS	Illumina HiSeq	.	22	4	NM_001024935	E1P5F2|Q5SZK7	Silent	SNP	ENST00000392589.1	37	CCDS5080.1																																																																																			.		0.567	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041784.3	NM_003931	
LRRC9	341883	hgsc.bcm.edu;bcgsc.ca	37	14	60398337	60398337	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:60398337G>T	ENST00000445360.1	+	5	613	c.409G>T	c.(409-411)Ggt>Tgt	p.G137C	LRRC9_ENST00000454474.2_3'UTR			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9	137																	AAATTTTTAGGGTTTGCAAAC	0.294																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	341883	.			TTTTAGGGTTTGC	AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.409-1G>T	14.37:g.60398337G>T		Somatic	130	0		WXS	Illumina HiSeq	.	87	4	.		RNA	SNP	ENST00000445360.1	37																																																																																				.		0.294	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000072281.3		Missense_Mutation
DAGLB	221955	hgsc.bcm.edu;bcgsc.ca	37	7	6487440	6487440	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:6487440C>T	ENST00000297056.6	-	1	203	c.34G>A	c.(34-36)Gcc>Acc	p.A12T	DAGLB_ENST00000425398.2_Missense_Mutation_p.A12T|DAGLB_ENST00000436575.1_Intron|DAGLB_ENST00000421761.2_5'UTR|DAGLB_ENST00000479922.2_5'UTR|KDELR2_ENST00000463747.1_Intron|DAGLB_ENST00000428902.2_5'UTR	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	12					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CTGGCGATGGCCCAGCGCCGG	0.672																																					p.A12T		.											.	.	.	0			c.G34A						.						32.0	34.0	33.0					7																	6487440		2201	4300	6501	SO:0001583	missense	221955	exon1			CGATGGCCCAGCG	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.34G>A	7.37:g.6487440C>T	ENSP00000297056:p.Ala12Thr	Somatic	96	0		WXS	Illumina HiSeq	.	75	4	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	C	36	5.787531	0.96945	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000471132;ENST00000432248	T;T	0.42900	0.97;0.96	5.27	4.36	0.52297	.	0.268520	0.36740	N	0.002432	T	0.39860	0.1094	M	0.63428	1.95	0.80722	D	1	P;P	0.35077	0.483;0.483	B;B	0.33339	0.162;0.058	T	0.19257	-1.0311	10	0.23302	T	0.38	.	14.4524	0.67394	0.1534:0.8466:0.0:0.0	.	12;12	B4DQU0;Q8NCG7	.;DGLB_HUMAN	T	12	ENSP00000297056:A12T;ENSP00000391171:A12T	ENSP00000297056:A12T	A	-	1	0	DAGLB	6453965	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	4.794000	0.62482	1.173000	0.42796	0.555000	0.69702	GCC	.		0.672	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
CALN1	83698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	71868298	71868298	+	Intron	SNP	G	G	A	rs376303075		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:71868298G>A	ENST00000395276.2	-	2	238				CALN1_ENST00000395275.2_Silent_p.D19D|CALN1_ENST00000431984.1_Intron|CALN1_ENST00000412588.1_Silent_p.D19D			Q9BXU9	CABP8_HUMAN	calneuron 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GGGCTCCTCCGTCCCCCTTTT	0.627																																					p.D19D		.											.	.	.	0			c.C57T						.	G		2,3398		0,2,1698	12.0	12.0	12.0		57	0.8	0.0	7		12	1,7565		0,1,3782	no	coding-synonymous	CALN1	NM_031468.3		0,3,5480	AA,AG,GG		0.0132,0.0588,0.0274		19/262	71868298	3,10963	1700	3783	5483	SO:0001627	intron_variant	83698	exon2			TCCTCCGTCCCCC	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000395276.2:c.6+8744C>T	7.37:g.71868298G>A		Somatic	156	0		WXS	Illumina HiSeq	.	97	35	NM_031468	J3KQA7	Silent	SNP	ENST00000395276.2	37	CCDS5541.1																																																																																			.		0.627	CALN1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252013.3	NM_031468	
MCAM	4162	hgsc.bcm.edu	37	11	119181068	119181068	+	Silent	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:119181068C>T	ENST00000264036.4	-	15	1916	c.1902G>A	c.(1900-1902)ccG>ccA	p.P634P	MCAM_ENST00000392814.1_3'UTR	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	634					anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCTGGTCTCCCGGAGCCCTCT	0.587																																					p.P634P		.											MCAM,caecum,carcinoma,0,1	MCAM	0	0			c.G1902A						.						56.0	58.0	57.0					11																	119181068		2199	4295	6494	SO:0001819	synonymous_variant	4162	exon15			GTCTCCCGGAGCC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1902G>A	11.37:g.119181068C>T		Somatic	54	0		WXS	Illumina HiSeq	.	42	2	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Silent	SNP	ENST00000264036.4	37	CCDS31690.1																																																																																			.		0.587	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
DNAJC11	55735	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	6713011	6713011	+	Splice_Site	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:6713011C>T	ENST00000377577.5	-	6	631	c.508G>A	c.(508-510)Gca>Aca	p.A170T	DNAJC11_ENST00000349363.6_Splice_Site_p.A132T|DNAJC11_ENST00000542246.1_Splice_Site_p.A132T|DNAJC11_ENST00000294401.7_Splice_Site_p.A170T|DNAJC11_ENST00000377573.5_Splice_Site_p.A80T	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	170						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		GTCAAGGGTGCCTAAAAATGG	0.488																																					p.A170T		.											.	.	.	0			c.G508A						.						99.0	91.0	94.0					1																	6713011		2203	4300	6503	SO:0001630	splice_region_variant	55735	exon6			AGGGTGCCTAAAA	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.508-1G>A	1.37:g.6713011C>T		Somatic	58	0		WXS	Illumina HiSeq	.	34	4	NM_018198	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	ENST00000377577.5	37	CCDS87.1	.	.	.	.	.	.	.	.	.	.	C	34	5.371958	0.95923	.	.	ENSG00000007923	ENST00000377577;ENST00000451196;ENST00000349363;ENST00000294401;ENST00000542246;ENST00000377573;ENST00000426784	T;T;T;T;T;T;T	0.31510	2.52;1.89;1.49;2.53;2.27;1.92;2.54	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.49864	0.1582	M	0.61703	1.905	0.80722	D	1	D;B;P;P	0.71674	0.998;0.264;0.702;0.812	P;B;B;B	0.61940	0.896;0.074;0.421;0.343	T	0.25745	-1.0123	10	0.18710	T	0.47	-24.4276	18.7482	0.91802	0.0:1.0:0.0:0.0	.	80;146;170;170	B4DGD5;Q5TH61;Q9NVH1-3;Q9NVH1	.;.;.;DJC11_HUMAN	T	170;146;132;170;132;80;170	ENSP00000366800:A170T;ENSP00000415871:A146T;ENSP00000326304:A132T;ENSP00000294401:A170T;ENSP00000444020:A132T;ENSP00000366796:A80T;ENSP00000410194:A170T	ENSP00000294401:A170T	A	-	1	0	DNAJC11	6635598	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.416000	0.80143	2.666000	0.90696	0.655000	0.94253	GCA	.		0.488	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198	Missense_Mutation
PTMA	5757	hgsc.bcm.edu	37	2	232577559	232577559	+	Nonstop_Mutation	SNP	T	T	C			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr2:232577559T>C	ENST00000341369.7	+	5	525	c.334T>C	c.(334-336)Tag>Cag	p.*112Q	PTMA_ENST00000409321.1_Nonstop_Mutation_p.*132Q|PTMA_ENST00000409115.3_Nonstop_Mutation_p.*111Q|PTMA_ENST00000409683.1_Nonstop_Mutation_p.*108Q|PTMA_ENST00000410064.1_Nonstop_Mutation_p.*137Q|PTMA_ENST00000466801.1_3'UTR	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	0					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.*111Q(1)		lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		CGAGGATGACTAGACAGCAAA	0.488																																					p.X112Q		.											PTMA,NS,carcinoma,0,2	PTMA	0	1	Nonstop extension(1)	lung(1)	c.T334C						.						31.0	33.0	32.0					2																	232577559		1827	4058	5885	SO:0001578	stop_lost	5757	exon5			GATGACTAGACAG		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.334T>C	2.37:g.232577559T>C	ENSP00000344547:p.*112Glnext*9	Somatic	86	1		WXS	Illumina HiSeq	.	45	2	NM_001099285	Q15249|Q15592	Missense_Mutation	SNP	ENST00000341369.7	37	CCDS42833.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.401486	0.62288	.	.	ENSG00000187514	ENST00000409321;ENST00000409115;ENST00000341369;ENST00000409683;ENST00000410064;ENST00000358839	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5441	0.61693	0.0:0.0:0.0:1.0	.	.	.	.	Q	132;111;112;108;137;136	.	.	X	+	1	0	PTMA	232285803	0.998000	0.40836	1.000000	0.80357	0.978000	0.69477	5.170000	0.64990	1.855000	0.53841	0.448000	0.29417	TAG	.		0.488	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332553.1		
CEACAM5	1048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42222257	42222257	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:42222257C>T	ENST00000221992.6	+	6	1562	c.1448C>T	c.(1447-1449)gCc>gTc	p.A483V	CEACAM5_ENST00000398599.4_Missense_Mutation_p.A482V|CEACAM5_ENST00000405816.1_Missense_Mutation_p.A483V|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	483	Ig-like 5.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AATAACTCAGCCAGTGGCCAC	0.488																																					p.A483V		.											.	.	.	0			c.C1448T						.						76.0	65.0	69.0					19																	42222257		2203	4300	6503	SO:0001583	missense	1048	exon6			ACTCAGCCAGTGG	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1448C>T	19.37:g.42222257C>T	ENSP00000221992:p.Ala483Val	Somatic	59	0		WXS	Illumina HiSeq	.	33	4	NM_004363	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	C	6.569	0.473351	0.12461	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.12147	2.71;2.71	2.39	-4.7	0.03288	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09992	0.0245	N	0.20766	0.605	0.09310	N	1	B;P	0.38551	0.032;0.636	B;P	0.46049	0.292;0.502	T	0.30736	-0.9968	9	0.22109	T	0.4	.	8.0969	0.30833	0.0:0.5496:0.0:0.4504	.	483;483	P06731;Q53G30	CEAM5_HUMAN;.	V	483;483;201	ENSP00000221992:A483V;ENSP00000385072:A483V	ENSP00000221992:A483V	A	+	2	0	CEACAM5	46914097	0.000000	0.05858	0.002000	0.10522	0.057000	0.15508	-0.754000	0.04787	-1.107000	0.03004	-0.347000	0.07816	GCC	.		0.488	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
FLNA	2316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153595859	153595859	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:153595859C>A	ENST00000369850.3	-	5	1010	c.774G>T	c.(772-774)atG>atT	p.M258I	FLNA_ENST00000360319.4_Missense_Mutation_p.M258I|FLNA_ENST00000422373.1_Missense_Mutation_p.M258I|FLNA_ENST00000344736.4_Missense_Mutation_p.M258I	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	258	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACAGGTAGGTCATGACAGAGT	0.622																																					p.M258I		.											.	.	.	0			c.G774T						.						78.0	84.0	82.0					X																	153595859		2198	4300	6498	SO:0001583	missense	2316	exon5			GTAGGTCATGACA	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.774G>T	X.37:g.153595859C>A	ENSP00000358866:p.Met258Ile	Somatic	114	0		WXS	Illumina HiSeq	.	87	22	NM_001456	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156071	0.57259	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.23	5.23	0.72850	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.96430	0.8835	L	0.54908	1.71	0.80722	D	1	D;D	0.67145	0.985;0.996	D;D	0.81914	0.98;0.995	D	0.97131	0.9818	10	0.87932	D	0	.	17.9131	0.88940	0.0:1.0:0.0:0.0	.	258;258	P21333-2;P21333	.;FLNA_HUMAN	I	258;231;258;258;258	ENSP00000353467:M258I;ENSP00000416926:M258I;ENSP00000358866:M258I;ENSP00000358863:M258I	ENSP00000358863:M258I	M	-	3	0	FLNA	153249053	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.809000	0.86057	2.163000	0.67991	0.597000	0.82753	ATG	.		0.622	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
ZP4	57829	hgsc.bcm.edu;broad.mit.edu	37	1	238048735	238048735	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:238048735G>T	ENST00000366570.4	-	8	1274	c.1116C>A	c.(1114-1116)agC>agA	p.S372R	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	372	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGGGGTCAGTGCTGGGTGTTG	0.532																																					p.S372R	NSCLC(166;160 2029 11600 18754 19936)	.											ZP4,right_lower_lobe,carcinoma,0,1	ZP4	0	0			c.C1116A						.						66.0	69.0	68.0					1																	238048735		2203	4300	6503	SO:0001583	missense	57829	exon8			GTCAGTGCTGGGT	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1116C>A	1.37:g.238048735G>T	ENSP00000355529:p.Ser372Arg	Somatic	68	0		WXS	Illumina HiSeq	.	42	3	NM_021186	B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	G	6.959	0.546929	0.13312	.	.	ENSG00000116996	ENST00000366570	D	0.83419	-1.72	4.98	0.304	0.15796	Endoglin/CD105 antigen conserved site (1);Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	1.033030	0.07654	N	0.932404	T	0.81931	0.4927	L	0.61218	1.895	0.09310	N	1	B	0.24675	0.109	B	0.37387	0.248	T	0.71965	-0.4433	10	0.59425	D	0.04	-2.4395	4.9862	0.14190	0.378:0.1713:0.4507:0.0	.	372	Q12836	ZP4_HUMAN	R	372	ENSP00000355529:S372R	ENSP00000355529:S372R	S	-	3	2	ZP4	236115358	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.150000	0.10189	0.148000	0.19059	0.655000	0.94253	AGC	.		0.532	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
C7orf33	202865	hgsc.bcm.edu	37	7	148288051	148288051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:148288051G>T	ENST00000307003.2	+	1	395	c.34G>T	c.(34-36)Gag>Tag	p.E12*		NM_145304.2	NP_660347.1	Q8WU49	CG033_HUMAN	chromosome 7 open reading frame 33	12										central_nervous_system(1)|large_intestine(4)|lung(7)|prostate(2)	14	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGCCTTGAAGAGTGTCCCTG	0.547																																					p.E12X		.											C7orf33,colon,carcinoma,0,1	C7orf33	0	0			c.G34T						.						59.0	59.0	59.0					7																	148288051		2203	4300	6503	SO:0001587	stop_gained	202865	exon1			CTTGAAGAGTGTC	BC021251	CCDS5890.1	7q36.1	2011-11-24			ENSG00000170279	ENSG00000170279			21724	protein-coding gene	gene with protein product							Standard	NM_145304		Approved		uc003wew.3	Q8WU49	OTTHUMG00000152756	ENST00000307003.2:c.34G>T	7.37:g.148288051G>T	ENSP00000304071:p.Glu12*	Somatic	73	0		WXS	Illumina HiSeq	.	37	2	NM_145304		Nonsense_Mutation	SNP	ENST00000307003.2	37	CCDS5890.1	.	.	.	.	.	.	.	.	.	.	G	36	5.600563	0.96614	.	.	ENSG00000170279	ENST00000307003	.	.	.	3.98	0.125	0.14718	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.7821	0.23652	0.4:0.0:0.6:0.0	.	.	.	.	X	12	.	ENSP00000304071:E12X	E	+	1	0	C7orf33	147918984	0.080000	0.21391	0.000000	0.03702	0.002000	0.02628	1.062000	0.30555	-0.079000	0.12707	-0.253000	0.11424	GAG	.		0.547	C7orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327684.1	NM_145304	
CADPS	8618	hgsc.bcm.edu	37	3	62477973	62477973	+	Missense_Mutation	SNP	C	C	T	rs376315928		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:62477973C>T	ENST00000383710.4	-	20	3225	c.2876G>A	c.(2875-2877)cGt>cAt	p.R959H	CADPS_ENST00000357948.3_Missense_Mutation_p.R929H|CADPS_ENST00000283269.9_Missense_Mutation_p.R969H	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	959	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACAGTCAGTACGGAGAAAATC	0.428																																					p.R969H		.											CADPS_ENST00000383710,NS,carcinoma,0,2	CADPS_ENST00000383710	0	0			c.G2906A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	217.0	208.0	211.0		2876,2786,2906	6.2	1.0	3		211	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	CADPS	NM_003716.3,NM_183393.2,NM_183394.2	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	959/1354,929/1275,969/1315	62477973	2,13004	2203	4300	6503	SO:0001583	missense	8618	exon19			TCAGTACGGAGAA	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2876G>A	3.37:g.62477973C>T	ENSP00000373215:p.Arg959His	Somatic	72	0		WXS	Illumina HiSeq	.	37	2	NM_183394	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847336	0.91277	0.0	2.33E-4	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	T;T;T	0.37584	1.19;1.19;1.19	6.17	6.17	0.99709	Munc13 homology 1 (1);	0.000000	0.85682	D	0.000000	T	0.64216	0.2578	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.995	D;D;P;D	0.79784	0.969;0.993;0.791;0.923	T	0.63220	-0.6686	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	929;969;959;959	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.;.;CAPS1_HUMAN;.	H	959;959;929;969	ENSP00000373215:R959H;ENSP00000350632:R929H;ENSP00000283269:R969H	ENSP00000283269:R969H	R	-	2	0	CADPS	62453013	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGT	.		0.428	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
IQCK	124152	hgsc.bcm.edu	37	16	19745076	19745076	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr16:19745076G>T	ENST00000320394.6	+	4	1002	c.303G>T	c.(301-303)ccG>ccT	p.P101P	IQCK_ENST00000541926.1_Silent_p.P101P|IQCK_ENST00000433597.2_Silent_p.P13P|IQCK_ENST00000564186.1_Silent_p.P101P	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	101										kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						ACTATTTTCCGGTTTCCCATT	0.448																																					p.P101P		.											IQCK,colon,carcinoma,0,1	IQCK	0	0			c.G303T						.						143.0	133.0	136.0					16																	19745076		2197	4300	6497	SO:0001819	synonymous_variant	124152	exon4			TTTTCCGGTTTCC	AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.303G>T	16.37:g.19745076G>T		Somatic	88	0		WXS	Illumina HiSeq	.	52	3	NM_153208	B2RDU0|O43327|Q8NFF4	Silent	SNP	ENST00000320394.6	37	CCDS10580.1																																																																																			.		0.448	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254273.2	NM_153208	
CCDC136	64753	hgsc.bcm.edu	37	7	128446399	128446399	+	Silent	SNP	C	C	A	rs368845976		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:128446399C>A	ENST00000297788.4	+	8	1565	c.1198C>A	c.(1198-1200)Cgg>Agg	p.R400R	CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000464832.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	400						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R400W(2)|p.R516W(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GACTGAGCTCCGGCAGCTCAA	0.483																																					p.R400R		.											CCDC136,NS,carcinoma,0,1	CCDC136	0	3	Substitution - Missense(3)	lung(3)	c.C1198A						.						32.0	32.0	32.0					7																	128446399		1965	4160	6125	SO:0001819	synonymous_variant	64753	exon8			GAGCTCCGGCAGC		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1198C>A	7.37:g.128446399C>A		Somatic	27	0		WXS	Illumina HiSeq	.	16	2	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Silent	SNP	ENST00000297788.4	37	CCDS47704.1																																																																																			.		0.483	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
ATAD3A	55210	hgsc.bcm.edu;broad.mit.edu	37	1	1458913	1458913	+	Missense_Mutation	SNP	G	G	A	rs551101347		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:1458913G>A	ENST00000378755.5	+	9	1167	c.1073G>A	c.(1072-1074)cGa>cAa	p.R358Q	ATAD3A_ENST00000536055.1_Missense_Mutation_p.R231Q|ATAD3A_ENST00000378756.3_Missense_Mutation_p.R310Q	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	358					cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		CTCCTCAGTCGACCCCAGGAC	0.701													g|||	1	0.000199681	0.0008	0.0	5008	,	,		12006	0.0		0.0	False		,,,				2504	0.0				p.R358Q		.											.	.	.	0			c.G1073A						.						47.0	46.0	46.0					1																	1458913		2203	4300	6503	SO:0001583	missense	55210	exon9			TCAGTCGACCCCA	AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.1073G>A	1.37:g.1458913G>A	ENSP00000368030:p.Arg358Gln	Somatic	95	0		WXS	Illumina HiSeq	.	55	4	NM_018188	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Missense_Mutation	SNP	ENST00000378755.5	37	CCDS31.1	.	.	.	.	.	.	.	.	.	.	g	11.85	1.762310	0.31228	.	.	ENSG00000197785	ENST00000378756;ENST00000378755;ENST00000536055	D;D;D	0.94417	-3.15;-3.04;-3.42	4.8	3.74	0.42951	.	0.150598	0.64402	D	0.000017	D	0.84234	0.5427	N	0.21373	0.66	0.27335	N	0.956672	B;P	0.43231	0.308;0.801	B;B	0.26614	0.07;0.071	T	0.78089	-0.2340	10	0.41790	T	0.15	.	5.4224	0.16407	0.8366:0.0:0.1634:0.0	.	310;358	D2K8Q1;Q9NVI7	.;ATD3A_HUMAN	Q	310;358;231	ENSP00000368031:R310Q;ENSP00000368030:R358Q;ENSP00000439290:R231Q	ENSP00000368030:R358Q	R	+	2	0	ATAD3A	1448776	1.000000	0.71417	0.525000	0.27900	0.055000	0.15305	3.381000	0.52455	0.817000	0.34445	0.556000	0.70494	CGA	.		0.701	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	NM_018188	
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	114426604	114426604	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:114426604G>A	ENST00000424776.3	+	1	2642	c.2600G>A	c.(2599-2601)cGc>cAc	p.R867H	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	867	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						TACCGAGGCCGCTCGCACGAC	0.647																																					p.R867H		.											.	.	.	0			c.G2600A						.						44.0	44.0	44.0					X																	114426604		692	1591	2283	SO:0001583	missense	139804	exon1			GAGGCCGCTCGCA	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2600G>A	X.37:g.114426604G>A	ENSP00000417451:p.Arg867His	Somatic	115	0		WXS	Illumina HiSeq	.	82	20	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849719	0.32699	.	.	ENSG00000175718	ENST00000424776	T	0.05996	3.36	0.95	-1.58	0.08479	.	.	.	.	.	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	D	0.60160	0.987	P	0.44673	0.457	T	0.43589	-0.9382	9	0.87932	D	0	.	5.612	0.17410	1.0E-4:0.3431:0.6569:0.0	.	867	Q8N7X1	RMXL3_HUMAN	H	867	ENSP00000417451:R867H	ENSP00000417451:R867H	R	+	2	0	RBMXL3	114332860	0.000000	0.05858	0.044000	0.18714	0.044000	0.14063	-2.359000	0.01085	0.177000	0.19895	0.179000	0.17066	CGC	.		0.647	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
ELMO1	9844	hgsc.bcm.edu	37	7	36910057	36910057	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:36910057C>A	ENST00000310758.4	-	20	2493	c.1846G>T	c.(1846-1848)Gtg>Ttg	p.V616L	ELMO1_ENST00000396040.2_Missense_Mutation_p.V136L|ELMO1_ENST00000341056.3_Missense_Mutation_p.V318L|ELMO1_ENST00000442504.1_Missense_Mutation_p.V616L|ELMO1_ENST00000396045.3_Missense_Mutation_p.V136L|ELMO1_ENST00000448602.1_Missense_Mutation_p.V616L	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	616	PH.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CCCGTCACCACGGCTTTGATA	0.398																																					p.V616L		.											ELMO1,NS,carcinoma,0,2	ELMO1	0	0			c.G1846T						.						148.0	135.0	139.0					7																	36910057		2203	4300	6503	SO:0001583	missense	9844	exon20			TCACCACGGCTTT	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1846G>T	7.37:g.36910057C>A	ENSP00000312185:p.Val616Leu	Somatic	38	0		WXS	Illumina HiSeq	.	42	2	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	C	7.771	0.707396	0.15239	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.6	4.67	0.58626	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.063724	0.64402	D	0.000008	T	0.43478	0.1249	N	0.11255	0.115	0.44719	D	0.997714	B	0.02656	0.0	B	0.01281	0.0	T	0.40059	-0.9583	10	0.06757	T	0.87	.	7.1448	0.25577	0.0:0.7094:0.1467:0.1439	.	616	Q92556	ELMO1_HUMAN	L	318;136;616;520;136;616;616	ENSP00000342142:V318L;ENSP00000379360:V136L;ENSP00000312185:V616L;ENSP00000379355:V136L;ENSP00000406952:V616L;ENSP00000394458:V616L	ENSP00000312185:V616L	V	-	1	0	ELMO1	36876582	0.978000	0.34361	0.995000	0.50966	0.991000	0.79684	2.443000	0.44881	2.814000	0.96858	0.655000	0.94253	GTG	.		0.398	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
NSUN5	55695	hgsc.bcm.edu;bcgsc.ca	37	7	72722459	72722459	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:72722459G>T	ENST00000252594.6	-	2	200	c.185C>A	c.(184-186)gCg>gAg	p.A62E	NSUN5_ENST00000428206.1_Missense_Mutation_p.A62E|NSUN5_ENST00000310326.8_Missense_Mutation_p.A62E|NSUN5_ENST00000438747.2_Missense_Mutation_p.A62E			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	62					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				CTTCTTCTCCGCACGGAGGAG	0.657																																					p.A62E		.											.	.	.	0			c.C185A						.						37.0	43.0	41.0					7																	72722459		2201	4289	6490	SO:0001583	missense	55695	exon2			TTCTCCGCACGGA	AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.185C>A	7.37:g.72722459G>T	ENSP00000252594:p.Ala62Glu	Somatic	70	0		WXS	Illumina HiSeq	.	46	4	NM_148956	B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Missense_Mutation	SNP	ENST00000252594.6	37	CCDS5547.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950462	0.92660	.	.	ENSG00000130305	ENST00000428206;ENST00000252594;ENST00000438747;ENST00000310326	T;T;T;T	0.13196	2.62;2.61;2.83;2.83	4.08	3.2	0.36748	.	0.365820	0.28624	N	0.014696	T	0.07999	0.0200	L	0.37630	1.12	0.09310	N	1	B;B;P;B	0.46220	0.395;0.288;0.874;0.216	B;B;B;B	0.41202	0.063;0.067;0.35;0.064	T	0.11421	-1.0588	10	0.02654	T	1	.	5.5485	0.17078	0.1878:0.1653:0.6469:0.0	.	62;62;62;62	B4DP79;G3V0G9;Q96P11;Q96P11-2	.;.;NSUN5_HUMAN;.	E	62	ENSP00000393081:A62E;ENSP00000252594:A62E;ENSP00000388464:A62E;ENSP00000309126:A62E	ENSP00000252594:A62E	A	-	2	0	NSUN5	72360395	0.749000	0.28305	0.972000	0.41901	0.916000	0.54674	1.794000	0.38774	0.932000	0.37266	0.485000	0.47835	GCG	.		0.657	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252113.1	NM_148956	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151891214	151891214	+	Splice_Site	SNP	C	C	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:151891214C>G	ENST00000262189.6	-	31	4759		c.e31-1		KMT2C_ENST00000355193.2_Splice_Site	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C						histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCGCCAAGCTCTAGGAGATAA	0.418																																					.		.											MLL3_ENST00000355193,bladder,carcinoma,0,2	MLL3_ENST00000355193	0	0			c.4541-1G>C						.						82.0	80.0	81.0					7																	151891214		2203	4300	6503	SO:0001630	splice_region_variant	58508	exon32			CAAGCTCTAGGAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4541-1G>C	7.37:g.151891214C>G		Somatic	88	0		WXS	Illumina HiSeq	.	50	9	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Splice_Site	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024206	0.35701	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.01	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8392	0.63428	0.0:0.9251:0.0:0.0749	.	.	.	.	.	-1	.	.	.	-	.	.	MLL3	151522147	1.000000	0.71417	0.996000	0.52242	0.312000	0.27988	3.565000	0.53798	2.592000	0.87571	0.650000	0.86243	.	.		0.418	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		Intron
WWOX	51741	hgsc.bcm.edu	37	16	78420808	78420808	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr16:78420808G>T	ENST00000566780.1	+	6	934	c.568G>T	c.(568-570)Gtg>Ttg	p.V190L	WWOX_ENST00000539474.2_Intron|WWOX_ENST00000402655.2_Intron|WWOX_ENST00000406884.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.V190L	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	190	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)	p.V33L(1)|p.V190M(1)|p.V190L(1)		large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		GCTCCGTAGCGTGCAGCATTT	0.398																																					p.V190L		.											WWOX_ENST00000408984,NS,carcinoma,0,3	WWOX_ENST00000408984	0	3	Substitution - Missense(3)	endometrium(2)|upper_aerodigestive_tract(1)	c.G568T						.						118.0	116.0	117.0					16																	78420808		1956	4143	6099	SO:0001583	missense	51741	exon6			CGTAGCGTGCAGC	AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.568G>T	16.37:g.78420808G>T	ENSP00000457230:p.Val190Leu	Somatic	32	0		WXS	Illumina HiSeq	.	28	2	NM_016373	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	CCDS42196.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005026	0.74932	.	.	ENSG00000186153	ENST00000408984;ENST00000299644	T	0.25414	1.8	5.52	5.52	0.82312	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.49457	0.1558	M	0.89715	3.055	0.50813	D	0.999892	P	0.49635	0.926	P	0.52109	0.69	T	0.59600	-0.7424	10	0.87932	D	0	.	13.6991	0.62597	0.0733:0.0:0.9267:0.0	.	190	Q9NZC7	WWOX_HUMAN	L	190;33	ENSP00000386161:V190L	ENSP00000299644:V33L	V	+	1	0	WWOX	76978309	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.321000	0.72881	2.597000	0.87782	0.655000	0.94253	GTG	.		0.398	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1		
ANKRD16	54522	hgsc.bcm.edu	37	10	5925099	5925099	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr10:5925099G>A	ENST00000380094.5	-	5	1262	c.719C>T	c.(718-720)gCc>gTc	p.A240V	ANKRD16_ENST00000380092.4_Missense_Mutation_p.A240V|ANKRD16_ENST00000191063.8_Missense_Mutation_p.A240V	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	240								p.A240V(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						CAGAGCCTGGGCACCCAGGCT	0.542																																					p.A240V		.											ANKRD16,caecum,carcinoma,0,1	ANKRD16	0	1	Substitution - Missense(1)	large_intestine(1)	c.C719T						.						76.0	60.0	65.0					10																	5925099		2203	4300	6503	SO:0001583	missense	54522	exon5			GCCTGGGCACCCA	AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.719C>T	10.37:g.5925099G>A	ENSP00000369436:p.Ala240Val	Somatic	16	0		WXS	Illumina HiSeq	.	16	2	NM_001009943	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	ENST00000380094.5	37	CCDS31136.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697811	0.68386	.	.	ENSG00000134461	ENST00000380094;ENST00000380092;ENST00000191063	T;T;T	0.60548	2.47;2.47;0.18	5.03	5.03	0.67393	Ankyrin repeat-containing domain (3);	0.106709	0.64402	D	0.000006	T	0.56731	0.2005	N	0.13299	0.325	0.58432	D	0.999999	P;P;D	0.65815	0.913;0.912;0.995	P;P;P	0.60286	0.548;0.773;0.872	T	0.53265	-0.8463	10	0.18710	T	0.47	-1.9265	18.3598	0.90371	0.0:0.0:1.0:0.0	.	240;240;240	Q6P6B7;C9JP28;F8WEI4	ANR16_HUMAN;.;.	V	240	ENSP00000369436:A240V;ENSP00000369434:A240V;ENSP00000352361:A240V	ENSP00000352361:A240V	A	-	2	0	ANKRD16	5965105	1.000000	0.71417	0.999000	0.59377	0.864000	0.49448	5.421000	0.66447	2.513000	0.84729	0.558000	0.71614	GCC	.		0.542	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046611.2	XM_166138	
GABRA1	2554	hgsc.bcm.edu	37	5	161324315	161324315	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:161324315G>T	ENST00000428797.2	+	11	1613	c.1258G>T	c.(1258-1260)Gac>Tac	p.D420Y	GABRA1_ENST00000420560.1_Missense_Mutation_p.D420Y|GABRA1_ENST00000437025.2_Missense_Mutation_p.D420Y|GABRA1_ENST00000444819.1_Missense_Mutation_p.D420Y|GABRA1_ENST00000023897.6_Missense_Mutation_p.D420Y|GABRA1_ENST00000393943.4_Missense_Mutation_p.D420Y	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	420					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.D420Y(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CAGCAAAATTGACCGACTGTC	0.443																																					p.D420Y		.											GABRA1,NS,carcinoma,0,1	GABRA1	0	1	Substitution - Missense(1)	lung(1)	c.G1258T						.						149.0	149.0	149.0					5																	161324315		2203	4300	6503	SO:0001583	missense	2554	exon11			AAAATTGACCGAC		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.1258G>T	5.37:g.161324315G>T	ENSP00000393097:p.Asp420Tyr	Somatic	67	0		WXS	Illumina HiSeq	.	41	3	NM_001127643	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581305	0.86748	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93;-4.93;-4.93	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.049362	0.85682	D	0.000000	D	0.99130	0.9700	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99589	1.0975	10	0.87932	D	0	.	19.3564	0.94416	0.0:0.0:1.0:0.0	.	420	P14867	GBRA1_HUMAN	Y	420	ENSP00000023897:D420Y;ENSP00000393097:D420Y;ENSP00000377517:D420Y;ENSP00000415441:D420Y;ENSP00000408041:D420Y;ENSP00000414232:D420Y	ENSP00000023897:D420Y	D	+	1	0	GABRA1	161256893	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.695000	0.98691	2.642000	0.89623	0.563000	0.77884	GAC	.		0.443	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
ZNF334	55713	hgsc.bcm.edu	37	20	45130856	45130856	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr20:45130856C>A	ENST00000347606.4	-	5	1304	c.1122G>T	c.(1120-1122)gaG>gaT	p.E374D	ZNF334_ENST00000593880.1_Missense_Mutation_p.E397D|ZNF334_ENST00000457685.2_Missense_Mutation_p.E336D	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CATTTGGCTTCTCTCCTCTGT	0.443																																					p.E374D		.											ZNF334,NS,carcinoma,0,1	ZNF334	0	0			c.G1122T						.						174.0	174.0	174.0					20																	45130856		2203	4300	6503	SO:0001583	missense	55713	exon5			TGGCTTCTCTCCT	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1122G>T	20.37:g.45130856C>A	ENSP00000255129:p.Glu374Asp	Somatic	51	0		WXS	Illumina HiSeq	.	38	2	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195280	0.38806	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.26810	1.71;1.71	3.18	2.23	0.28157	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33177	0.0854	L	0.58302	1.8	0.31745	N	0.63535	D;D;D	0.60575	0.988;0.988;0.988	P;P;P	0.51777	0.679;0.679;0.679	T	0.42699	-0.9436	9	0.87932	D	0	.	8.152	0.31145	0.0:0.8747:0.0:0.1252	.	336;374;397	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	D	336;374	ENSP00000402582:E336D;ENSP00000255129:E374D	ENSP00000255129:E374D	E	-	3	2	ZNF334	44564263	0.803000	0.28956	0.999000	0.59377	0.654000	0.38779	-0.019000	0.12546	0.660000	0.30964	-0.218000	0.12543	GAG	.		0.443	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
KDM2B	84678	hgsc.bcm.edu	37	12	121881589	121881589	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr12:121881589G>A	ENST00000377071.4	-	17	2531	c.2459C>T	c.(2458-2460)tCg>tTg	p.S820L	KDM2B_ENST00000542973.1_Missense_Mutation_p.S188L|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000377069.4_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	820					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)	p.S459L(1)|p.S820L(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CGTTTGAAGCGATGAGGCCTA	0.607											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S820L		.											KDM2B_ENST00000377071,rectum,carcinoma,0,2	KDM2B_ENST00000377071	0	2	Substitution - Missense(2)	large_intestine(2)	c.C2459T						.						36.0	42.0	40.0					12																	121881589		1972	4154	6126	SO:0001583	missense	84678	exon17			TGAAGCGATGAGG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2459C>T	12.37:g.121881589G>A	ENSP00000366271:p.Ser820Leu	Somatic	44	0	1514	WXS	Illumina HiSeq	.	24	2	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.201087	0.38905	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377071;ENST00000540043;ENST00000261824	T;T	0.22945	2.24;1.93	4.86	3.9	0.45041	.	0.357803	0.20448	N	0.092149	T	0.10981	0.0268	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.18310	0.009;0.027;0.027	B;B;B	0.12156	0.007;0.007;0.007	T	0.12502	-1.0545	10	0.30854	T	0.27	-12.2278	9.8788	0.41220	0.0:0.0:0.7966:0.2034	.	260;820;263	B7ZB05;Q8NHM5;B4DSN4	.;KDM2B_HUMAN;.	L	820;188;820;263;823	ENSP00000437821:S188L;ENSP00000366271:S820L	ENSP00000261824:S823L	S	-	2	0	KDM2B	120365972	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.385000	0.52485	2.698000	0.92095	0.561000	0.74099	TCG	.		0.607	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
EFCAB5	374786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28268848	28268848	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr17:28268848C>A	ENST00000394835.3	+	1	226	c.34C>A	c.(34-36)Cct>Act	p.P12T	EFCAB5_ENST00000378738.3_Missense_Mutation_p.P12T|EFCAB5_ENST00000536908.2_Intron|EFCAB5_ENST00000394832.2_Missense_Mutation_p.P12T|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000320856.5_Missense_Mutation_p.P12T|EFCAB5_ENST00000534836.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	12							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GGAACTCAGACCTGCTCAGGT	0.348																																					p.P12T		.											.	.	.	0			c.C34A						.						75.0	80.0	78.0					17																	28268848		1865	4117	5982	SO:0001583	missense	374786	exon1			CTCAGACCTGCTC	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.34C>A	17.37:g.28268848C>A	ENSP00000378312:p.Pro12Thr	Somatic	55	0		WXS	Illumina HiSeq	.	30	7	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	37	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	C	9.211	1.030837	0.19590	.	.	ENSG00000176927	ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738	T;T;T;T	0.33654	2.57;2.5;1.77;1.4	4.12	-1.01	0.10169	.	.	.	.	.	T	0.23094	0.0558	N	0.22421	0.69	0.09310	N	0.999994	B	0.25904	0.137	B	0.29942	0.109	T	0.28996	-1.0026	9	0.45353	T	0.12	-0.3738	7.1311	0.25502	0.0:0.4489:0.0:0.5511	.	12	A4FU69	EFCB5_HUMAN	T	12	ENSP00000378312:P12T;ENSP00000322003:P12T;ENSP00000378309:P12T;ENSP00000368012:P12T	ENSP00000322003:P12T	P	+	1	0	EFCAB5	25292974	0.014000	0.17966	0.039000	0.18376	0.007000	0.05969	-0.190000	0.09615	-0.133000	0.11537	0.650000	0.86243	CCT	.		0.348	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
MT-CO2	4513	hgsc.bcm.edu;bcgsc.ca	37	M	7827	7827	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrM:7827T>C	ENST00000361739.1	+	1	242	c.242T>C	c.(241-243)cTa>cCa	p.L81P	MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TD_ENST00000387419.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	81					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CCTCCCATCCCTACGCATCCT	0.478																																					p.L81P		.											.	.	.	0			c.T242C						.																																			SO:0001583	missense	5743	exon1			CATCCCTACGCAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.242T>C	M.37:g.7827T>C	ENSP00000354876:p.Leu81Pro	Somatic	2160	2		WXS	Illumina HiSeq	.	437	51	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	37																																																																																				.		0.478	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
ERMP1	79956	hgsc.bcm.edu	37	9	5810057	5810057	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:5810057G>T	ENST00000339450.5	-	8	1591	c.1502C>A	c.(1501-1503)gCc>gAc	p.A501D	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_Missense_Mutation_p.A277D|ERMP1_ENST00000543230.1_Missense_Mutation_p.A79D	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	501						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TATTATTTTGGCTACAGTTGC	0.368																																					p.A501D		.											ERMP1,colon,carcinoma,0,1	ERMP1	0	0			c.C1502A						.						120.0	115.0	117.0					9																	5810057		2203	4300	6503	SO:0001583	missense	79956	exon8			ATTTTGGCTACAG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.1502C>A	9.37:g.5810057G>T	ENSP00000340427:p.Ala501Asp	Somatic	64	1		WXS	Illumina HiSeq	.	38	2	NM_024896	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501918	0.64298	.	.	ENSG00000099219	ENST00000339450;ENST00000543230;ENST00000381506	T	0.51325	0.71	5.77	3.95	0.45737	.	0.172615	0.52532	D	0.000077	T	0.46502	0.1396	L	0.36672	1.1	0.42527	D	0.99302	D	0.57257	0.979	P	0.51806	0.68	T	0.35051	-0.9804	10	0.36615	T	0.2	-3.0367	11.6672	0.51381	0.1976:0.0:0.8024:0.0	.	501	Q7Z2K6	ERMP1_HUMAN	D	501;79;277	ENSP00000340427:A501D	ENSP00000340427:A501D	A	-	2	0	ERMP1	5800057	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	4.637000	0.61346	0.906000	0.36621	0.655000	0.94253	GCC	.		0.368	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
OTUD6B	51633	hgsc.bcm.edu	37	8	92096314	92096314	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr8:92096314G>T	ENST00000285420.4	+	6	958	c.859G>T	c.(859-861)Gaa>Taa	p.E287*	OTUD6B_ENST00000404789.3_Nonsense_Mutation_p.E156*	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	257				VNIVTENCS -> GKHSY (in Ref. 1; AAD34073). {ECO:0000305}.			cysteine-type peptidase activity (GO:0008234)	p.E257*(1)|p.E287*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AGTTGGTGAAGAATATTCAAA	0.284																																					p.E287X		.											OTUD6B,colon,carcinoma,0,2	OTUD6B	0	2	Substitution - Nonsense(2)	large_intestine(2)	c.G859T						.						50.0	45.0	47.0					8																	92096314		2200	4294	6494	SO:0001587	stop_gained	51633	exon6			GGTGAAGAATATT		CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.859G>T	8.37:g.92096314G>T	ENSP00000285420:p.Glu287*	Somatic	68	0		WXS	Illumina HiSeq	.	49	2	NM_016023	A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Nonsense_Mutation	SNP	ENST00000285420.4	37	CCDS6253.2	.	.	.	.	.	.	.	.	.	.	G	37	6.499811	0.97616	.	.	ENSG00000155100	ENST00000285420;ENST00000404789	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-20.3371	20.1162	0.97934	0.0:0.0:1.0:0.0	.	.	.	.	X	287;156	.	ENSP00000285420:E287X	E	+	1	0	OTUD6B	92165490	1.000000	0.71417	1.000000	0.80357	0.250000	0.25880	8.599000	0.90856	2.757000	0.94681	0.563000	0.77884	GAA	.		0.284	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000319968.1	NM_016023	
RP11-383I23.2	0	hgsc.bcm.edu	37	3	99524505	99524505	+	lincRNA	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:99524505C>T	ENST00000608028.1	-	0	397																											ttagaagcagccaggccacat	0.383																																					.		.											.	.	.	0			.						.						38.0	33.0	34.0					3																	99524505		692	1591	2283			100313938	.			AAGCAGCCAGGCC																													3.37:g.99524505C>T		Somatic	18	0		WXS	Illumina HiSeq	.	21	4	.		RNA	SNP	ENST00000608028.1	37																																																																																				.		0.383	RP11-383I23.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000471535.1		
RAN	5901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	131359125	131359125	+	Silent	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr12:131359125G>A	ENST00000543796.1	+	5	540	c.282G>A	c.(280-282)tcG>tcA	p.S94S	RAN_ENST00000392369.2_Silent_p.S94S|RAN_ENST00000392367.3_Silent_p.S111S|RAN_ENST00000541630.1_Silent_p.S6S|RAN_ENST00000254675.3_Silent_p.S6S			P62826	RAN_HUMAN	RAN, member RAS oncogene family	94					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.S94S(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		ATGTAACATCGAGAGTTACTT	0.408																																					p.S94S		.											RAN,NS,carcinoma,0,1	RAN	0	1	Substitution - coding silent(1)	lung(1)	c.G282A						.						126.0	106.0	113.0					12																	131359125		2203	4300	6503	SO:0001819	synonymous_variant	5901	exon5			AACATCGAGAGTT	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.282G>A	12.37:g.131359125G>A		Somatic	95	1		WXS	Illumina HiSeq	.	38	13	NM_006325	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Silent	SNP	ENST00000543796.1	37	CCDS9271.1																																																																																			.		0.408	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
NOTCH3	4854	hgsc.bcm.edu	37	19	15272347	15272347	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:15272347C>T	ENST00000263388.2	-	33	6167	c.6092G>A	c.(6091-6093)cGc>cAc	p.R2031H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2031					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R2031H(2)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGGGGGGCTGCGGGGCCCACT	0.687																																					p.R2031H		.											NOTCH3_ENST00000263388,NS,carcinoma,0,2	NOTCH3_ENST00000263388	0	2	Substitution - Missense(2)	endometrium(2)	c.G6092A						.						15.0	17.0	16.0					19																	15272347		2193	4291	6484	SO:0001583	missense	4854	exon33			GGGCTGCGGGGCC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6092G>A	19.37:g.15272347C>T	ENSP00000263388:p.Arg2031His	Somatic	16	0		WXS	Illumina HiSeq	.	15	2	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259951	0.59321	.	.	ENSG00000074181	ENST00000263388	D	0.82526	-1.62	3.92	3.92	0.45320	.	.	.	.	.	T	0.74665	0.3746	L	0.31207	0.915	0.58432	D	0.999992	B	0.14805	0.011	B	0.06405	0.002	T	0.70905	-0.4745	9	0.37606	T	0.19	.	15.2654	0.73657	0.0:1.0:0.0:0.0	.	2031	Q9UM47	NOTC3_HUMAN	H	2031	ENSP00000263388:R2031H	ENSP00000263388:R2031H	R	-	2	0	NOTCH3	15133347	0.800000	0.28916	0.955000	0.39395	0.978000	0.69477	1.654000	0.37334	2.203000	0.70933	0.650000	0.86243	CGC	.		0.687	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
EML5	161436	hgsc.bcm.edu	37	14	89171303	89171303	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:89171303G>T	ENST00000380664.5	-	13	1951	c.1952C>A	c.(1951-1953)cCt>cAt	p.P651H	EML5_ENST00000352093.5_Missense_Mutation_p.P651H|EML5_ENST00000554922.1_Missense_Mutation_p.P651H			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	651						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TTTAAGCTGAGGTAGATCTTC	0.333																																					p.P651H		.											.	.	.	0			c.C1952A						.						131.0	113.0	118.0					14																	89171303		1793	4067	5860	SO:0001583	missense	161436	exon13			AGCTGAGGTAGAT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.1952C>A	14.37:g.89171303G>T	ENSP00000370039:p.Pro651His	Somatic	79	0		WXS	Illumina HiSeq	.	60	4	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325442	0.60743	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.50548	0.97;0.74;1.01	5.14	5.14	0.70334	.	0.273076	0.35805	N	0.002968	T	0.63593	0.2524	L	0.47716	1.5	0.58432	D	0.999999	D	0.89917	1.0	D	0.70227	0.968	T	0.65344	-0.6191	10	0.72032	D	0.01	-13.965	18.7877	0.91961	0.0:0.0:1.0:0.0	.	651	Q05BV3	EMAL5_HUMAN	H	651	ENSP00000451998:P651H;ENSP00000298315:P651H;ENSP00000370039:P651H	ENSP00000298315:P651H	P	-	2	0	EML5	88241056	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.263000	0.95617	2.668000	0.90789	0.460000	0.39030	CCT	.		0.333	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
NAA35	60560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88631517	88631517	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:88631517A>T	ENST00000361671.5	+	18	1765	c.1632A>T	c.(1630-1632)caA>caT	p.Q544H		NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	544					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						ATGGCTCTCAAATGGCAGAGG	0.373																																					p.Q544H		.											.	.	.	0			c.A1632T						.						102.0	95.0	97.0					9																	88631517		2203	4300	6503	SO:0001583	missense	60560	exon18			CTCTCAAATGGCA	AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.1632A>T	9.37:g.88631517A>T	ENSP00000354972:p.Gln544His	Somatic	60	0		WXS	Illumina HiSeq	.	27	18	NM_024635	Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.397482	0.62177	.	.	ENSG00000135040	ENST00000361671	.	.	.	5.4	-4.22	0.03800	.	0.000000	0.85682	D	0.000000	T	0.36220	0.0959	L	0.29908	0.895	0.80722	D	1	P	0.46784	0.884	P	0.45577	0.486	T	0.44081	-0.9351	9	0.12430	T	0.62	-12.1945	11.8616	0.52469	0.5419:0.0:0.4581:0.0	.	544	Q5VZE5	NAA35_HUMAN	H	544	.	ENSP00000354972:Q544H	Q	+	3	2	NAA35	87821337	1.000000	0.71417	0.947000	0.38551	0.981000	0.71138	0.914000	0.28624	-1.139000	0.02881	0.402000	0.26972	CAA	.		0.373	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1	NM_024635	
CAST	831	hgsc.bcm.edu	37	5	96073607	96073607	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:96073607G>T	ENST00000341926.3	+	9	667	c.505G>T	c.(505-507)Gaa>Taa	p.E169*	CAST_ENST00000359176.4_Nonsense_Mutation_p.E233*|CAST_ENST00000395813.1_Nonsense_Mutation_p.E252*|CAST_ENST00000508608.1_Nonsense_Mutation_p.E215*|CAST_ENST00000338252.3_Nonsense_Mutation_p.E169*|CAST_ENST00000509903.1_Nonsense_Mutation_p.E147*|CAST_ENST00000325674.7_Nonsense_Mutation_p.E230*|CAST_ENST00000395812.2_Nonsense_Mutation_p.E211*|CAST_ENST00000511049.1_Nonsense_Mutation_p.E155*|CAST_ENST00000309190.5_Nonsense_Mutation_p.E147*|CAST_ENST00000510756.1_Nonsense_Mutation_p.E230*|CAST_ENST00000511782.1_Nonsense_Mutation_p.E155*|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000504465.1_Nonsense_Mutation_p.E97*|CAST_ENST00000508830.1_Nonsense_Mutation_p.E252*			P20810	ICAL_HUMAN	calpastatin	169					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		AGGACCTGAAGAAACTGAAGA	0.338																																					p.E211X		.											CAST,NS,carcinoma,0,1	CAST	0	0			c.G631T						.						129.0	138.0	135.0					5																	96073607		2203	4300	6503	SO:0001587	stop_gained	831	exon9			CCTGAAGAAACTG	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.505G>T	5.37:g.96073607G>T	ENSP00000339914:p.Glu169*	Somatic	67	0		WXS	Illumina HiSeq	.	39	2	NM_001042440	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Nonsense_Mutation	SNP	ENST00000341926.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.747055|4.747055	0.89663|0.89663	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000505143;ENST00000338252;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000421689;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508197|ENST00000512620	.|.	.|.	.|.	5.29|5.29	4.42|4.42	0.53409|0.53409	.|.	0.360006|.	0.26262|.	N|.	0.025399|.	.|T	.|0.54935	.|0.1889	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64483	.|-0.6397	.|3	0.28530|.	T|.	0.3|.	-3.5461|-3.5461	11.1998|11.1998	0.48734|0.48734	0.0869:0.0:0.9131:0.0|0.0869:0.0:0.9131:0.0	.|.	.|.	.|.	.|.	X|N	247;169;252;230;252;233;230;211;233;230;215;169;155;147;169;97;147;155;120|185	.|.	ENSP00000312523:E147X|.	E|K	+|+	1|3	0|2	CAST|CAST	96099363|96099363	1.000000|1.000000	0.71417|0.71417	0.132000|0.132000	0.22025|0.22025	0.525000|0.525000	0.34531|0.34531	3.999000|3.999000	0.57031|0.57031	1.237000|1.237000	0.43756|0.43756	0.655000|0.655000	0.94253|0.94253	GAA|AAG	.		0.338	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062	
SYT9	143425	hgsc.bcm.edu	37	11	7334708	7334708	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:7334708G>T	ENST00000318881.6	+	3	817	c.580G>T	c.(580-582)Gga>Tga	p.G194*	SYT9_ENST00000396716.2_Nonsense_Mutation_p.G162*	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	194					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ACAGTTGACTGGAATTGGTAG	0.413																																					p.G194X		.											.,1	.	91	0			c.G580T						.						83.0	83.0	83.0					11																	7334708		2201	4296	6497	SO:0001587	stop_gained	143425	exon3			TTGACTGGAATTG	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.580G>T	11.37:g.7334708G>T	ENSP00000324419:p.Gly194*	Somatic	60	0		WXS	Illumina HiSeq	.	47	2	NM_175733		Nonsense_Mutation	SNP	ENST00000318881.6	37	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357656	0.82243	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	.	.	.	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	18.0311	0.89285	0.0:0.0:1.0:0.0	.	.	.	.	X	162;194	.	ENSP00000324419:G194X	G	+	1	0	SYT9	7291284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.916000	0.92745	2.932000	0.99384	0.643000	0.83706	GGA	.		0.413	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
BACE1	23621	hgsc.bcm.edu	37	11	117186290	117186290	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:117186290G>T	ENST00000313005.6	-	1	682	c.222C>A	c.(220-222)ggC>ggA	p.G74G	BACE1_ENST00000428381.2_Silent_p.G74G|BACE1_ENST00000514464.1_5'UTR|AP000892.4_ENST00000504906.1_RNA|BACE1_ENST00000528053.1_Silent_p.G74G|BACE1_ENST00000513780.1_Silent_p.G74G|BACE1_ENST00000445823.2_Silent_p.G74G	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	74					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		CCACGTAGTAGCCCTGCCCCG	0.682																																					p.G74G		.											BACE1,right_upper_lobe,carcinoma,0,1	BACE1	0	0			c.C222A						.						47.0	45.0	45.0					11																	117186290		2201	4296	6497	SO:0001819	synonymous_variant	23621	exon1			GTAGTAGCCCTGC	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.222C>A	11.37:g.117186290G>T		Somatic	84	0		WXS	Illumina HiSeq	.	56	3	NM_138972	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Silent	SNP	ENST00000313005.6	37	CCDS8383.1																																																																																			.		0.682	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1		
SLC25A17	10478	hgsc.bcm.edu	37	22	41173096	41173096	+	Missense_Mutation	SNP	G	G	A	rs371543259		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr22:41173096G>A	ENST00000435456.2	-	7	774	c.641C>T	c.(640-642)gCg>gTg	p.A214V	SLC25A17_ENST00000542412.1_Missense_Mutation_p.A141V|SLC25A17_ENST00000544408.1_Missense_Mutation_p.A177V|SLC25A17_ENST00000402844.3_Missense_Mutation_p.A132V|SLC25A17_ENST00000491545.1_5'UTR	NM_006358.2	NP_006349.1	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17	214					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|cellular lipid metabolic process (GO:0044255)|coenzyme A transmembrane transport (GO:0035349)|FAD transmembrane transport (GO:0035350)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|fatty acid transport (GO:0015908)|NAD transport (GO:0043132)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|chaperone binding (GO:0051087)|coenzyme A transmembrane transporter activity (GO:0015228)|FAD transmembrane transporter activity (GO:0015230)|FMN transmembrane transporter activity (GO:0044610)|NAD transporter activity (GO:0051724)	p.A214V(1)		central_nervous_system(1)|large_intestine(4)|lung(2)|skin(1)	8						GGTGGCAATCGCTTTGGCTAC	0.463																																					p.A214V		.											SLC25A17,caecum,carcinoma,0,1	SLC25A17	0	1	Substitution - Missense(1)	large_intestine(1)	c.C641T						.	G	VAL/ALA	3,4403	6.2+/-15.9	0,3,2200	96.0	80.0	85.0		641	5.7	1.0	22		85	0,8600		0,0,4300	no	missense	SLC25A17	NM_006358.2	64	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	214/308	41173096	3,13003	2203	4300	6503	SO:0001583	missense	10478	exon7			GCAATCGCTTTGG	Y12860	CCDS14005.1, CCDS74868.1	22q13.2	2013-05-22	2002-08-29		ENSG00000100372	ENSG00000100372		"""Solute carriers"""	10987	protein-coding gene	gene with protein product	"""peroxisomal membrane protein (34kD)"""	606795	"""solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kD), member 17"""			9874197	Standard	NM_006358		Approved	PMP34	uc003azc.3	O43808	OTTHUMG00000151139	ENST00000435456.2:c.641C>T	22.37:g.41173096G>A	ENSP00000390722:p.Ala214Val	Somatic	41	0		WXS	Illumina HiSeq	.	40	2	NM_006358	A8KA59|Q5TFL0|Q9UGW8|Q9UGY7	Missense_Mutation	SNP	ENST00000435456.2	37	CCDS14005.1	.	.	.	.	.	.	.	.	.	.	G	37	6.053083	0.97241	6.81E-4	0.0	ENSG00000100372	ENST00000435456;ENST00000402844;ENST00000544408;ENST00000542412	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.65	5.65	0.86999	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	L	0.56340	1.77	0.80722	D	1	D;D;D	0.69078	0.986;0.997;0.978	P;P;P	0.57720	0.761;0.826;0.746	T	0.81134	-0.1071	10	0.23302	T	0.38	-8.876	20.1057	0.97893	0.0:0.0:1.0:0.0	.	141;177;214	F5GYD1;B4DU97;O43808	.;.;PM34_HUMAN	V	214;132;177;141	ENSP00000390722:A214V;ENSP00000385303:A132V;ENSP00000438355:A177V;ENSP00000446471:A141V	ENSP00000385303:A132V	A	-	2	0	SLC25A17	39503042	1.000000	0.71417	0.973000	0.42090	0.961000	0.63080	7.660000	0.83776	2.827000	0.97445	0.650000	0.86243	GCG	.		0.463	SLC25A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321487.1	NM_006358	
RNF38	152006	hgsc.bcm.edu	37	9	36376031	36376031	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:36376031G>T	ENST00000259605.6	-	3	363	c.256C>A	c.(256-258)Cca>Aca	p.P86T	RNF38_ENST00000377885.2_Missense_Mutation_p.P3T|RNF38_ENST00000377877.4_5'UTR|RNF38_ENST00000350199.4_Missense_Mutation_p.P3T|RNF38_ENST00000357058.3_Missense_Mutation_p.P3T|RNF38_ENST00000353739.4_Missense_Mutation_p.P36T|RNF38_ENST00000491349.1_5'UTR	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	86					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			ATCTCCCATGGTCGCATTGGT	0.502																																					p.P86T		.											RNF38,NS,carcinoma,0,1	RNF38	0	0			c.C256A						.						236.0	179.0	198.0					9																	36376031		2203	4300	6503	SO:0001583	missense	152006	exon3			CCCATGGTCGCAT		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.256C>A	9.37:g.36376031G>T	ENSP00000259605:p.Pro86Thr	Somatic	92	0		WXS	Illumina HiSeq	.	45	2	NM_022781	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	37	CCDS6603.1	.	.	.	.	.	.	.	.	.	.	G	32	5.139467	0.94560	.	.	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.87220	0.6123	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86947	0.2083	10	0.72032	D	0.01	-9.7107	18.3732	0.90420	0.0:0.0:1.0:0.0	.	36;86	Q9H0F5-2;Q9H0F5	.;RNF38_HUMAN	T	86;36;3;3;3	ENSP00000259605:P86T;ENSP00000335239:P36T;ENSP00000367117:P3T;ENSP00000349566:P3T;ENSP00000343947:P3T	ENSP00000259605:P86T	P	-	1	0	RNF38	36366031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.941000	0.99782	0.655000	0.94253	CCA	.		0.502	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	NM_022781	
KIAA0368	23392	hgsc.bcm.edu	37	9	114133913	114133913	+	Silent	SNP	C	C	T	rs372133962		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:114133913C>T	ENST00000338205.5	-	42	4944	c.4725G>A	c.(4723-4725)acG>acA	p.T1575T	KIAA0368_ENST00000259335.4_Silent_p.T1753T|KIAA0368_ENST00000465499.1_5'Flank|KIAA0368_ENST00000374378.3_Silent_p.T39T			Q5VYK3	ECM29_HUMAN	KIAA0368	1581					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.T1753T(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TTCCTGCCCACGTTCTTCCAG	0.428													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21476	0.0		0.0	False		,,,				2504	0.0				p.T1753T		.											KIAA0368,NS,carcinoma,0,1	KIAA0368	0	1	Substitution - coding silent(1)	endometrium(1)	c.G5259A						.						196.0	185.0	188.0					9																	114133913		1923	4132	6055	SO:0001819	synonymous_variant	23392	exon44			TGCCCACGTTCTT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.4725G>A	9.37:g.114133913C>T		Somatic	81	0		WXS	Illumina HiSeq	.	44	2	NM_001080398	O15074|Q8WU82	Silent	SNP	ENST00000338205.5	37																																																																																				.		0.428	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	63511084	63511084	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr18:63511084C>T	ENST00000397968.2	+	7	1444	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	CDH7_ENST00000323011.3_Missense_Mutation_p.R340W|CDH7_ENST00000536984.2_Missense_Mutation_p.R340W	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	340	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				TTACACGCTACGGATAGAAGC	0.423																																					p.R340W		.											.	.	.	0			c.C1018T						.						106.0	102.0	103.0					18																	63511084		2203	4300	6503	SO:0001583	missense	1005	exon7			ACGCTACGGATAG	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1018C>T	18.37:g.63511084C>T	ENSP00000381058:p.Arg340Trp	Somatic	60	0		WXS	Illumina HiSeq	.	43	16	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338222	0.60963	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.52526	0.66;0.66;0.66	5.04	3.16	0.36331	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	M	0.78049	2.395	0.22779	N	0.998744	D;D	0.89917	0.999;1.0	D;D	0.74348	0.963;0.983	T	0.61372	-0.7076	10	0.87932	D	0	.	12.8624	0.57922	0.6112:0.3888:0.0:0.0	.	340;340	F5H5X9;Q9ULB5	.;CADH7_HUMAN	W	340	ENSP00000319166:R340W;ENSP00000443030:R340W;ENSP00000381058:R340W	ENSP00000319166:R340W	R	+	1	2	CDH7	61662064	1.000000	0.71417	0.218000	0.23776	0.988000	0.76386	3.255000	0.51484	0.748000	0.32831	0.655000	0.94253	CGG	.		0.423	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
C9orf135	138255	hgsc.bcm.edu;bcgsc.ca	37	9	72501779	72501779	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:72501779G>T	ENST00000377197.3	+	5	562	c.475G>T	c.(475-477)Gat>Tat	p.D159Y	C9orf135_ENST00000527647.1_Intron|C9orf135_ENST00000466872.2_3'UTR|RN7SL570P_ENST00000484405.2_RNA	NM_001010940.1	NP_001010940.1	Q5VTT2	CI135_HUMAN	chromosome 9 open reading frame 135	159						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7						GTACTCAGAAGATTATGTTCC	0.338																																					p.D159Y		.											.	.	.	0			c.G475T						.						128.0	109.0	116.0					9																	72501779		2203	4299	6502	SO:0001583	missense	138255	exon5			TCAGAAGATTATG		CCDS35041.1	9q21.11	2013-06-07	2013-06-07	2013-06-07	ENSG00000204711	ENSG00000204711			31422	protein-coding gene	gene with protein product							Standard	XM_005251705		Approved		uc004ahl.3	Q5VTT2	OTTHUMG00000019985	ENST00000377197.3:c.475G>T	9.37:g.72501779G>T	ENSP00000366402:p.Asp159Tyr	Somatic	97	0		WXS	Illumina HiSeq	.	42	4	NM_001010940	A7E2U4|B2RN61	Missense_Mutation	SNP	ENST00000377197.3	37	CCDS35041.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262310	0.23051	.	.	ENSG00000204711	ENST00000377197	.	.	.	4.9	2.93	0.34026	.	1.182760	0.06135	N	0.671303	T	0.55924	0.1951	L	0.34521	1.04	0.36861	D	0.888404	D	0.54964	0.969	P	0.55999	0.789	T	0.50491	-0.8822	9	0.87932	D	0	-12.6425	6.8469	0.23992	0.2294:0.0:0.7706:0.0	.	159	Q5VTT2	CI135_HUMAN	Y	159	.	ENSP00000366402:D159Y	D	+	1	0	C9orf135	71691599	0.878000	0.30173	0.548000	0.28192	0.005000	0.04900	1.918000	0.40006	0.676000	0.31285	-0.225000	0.12378	GAT	.		0.338	C9orf135-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052591.1	NM_001010940	
LMLN	89782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	197703534	197703534	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:197703534G>T	ENST00000330198.4	+	5	519	c.497G>T	c.(496-498)tGt>tTt	p.C166F	LMLN_ENST00000482695.1_Missense_Mutation_p.C114F|LMLN_ENST00000420910.2_Missense_Mutation_p.C166F|LMLN_ENST00000332636.5_Missense_Mutation_p.C114F	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	166					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		ACCGGGGAGTGTGCCGCACAC	0.473																																					p.C166F		.											.	.	.	0			c.G497T						.						105.0	108.0	107.0					3																	197703534		2203	4300	6503	SO:0001583	missense	89782	exon5			GGGAGTGTGCCGC	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.497G>T	3.37:g.197703534G>T	ENSP00000328829:p.Cys166Phe	Somatic	97	0		WXS	Illumina HiSeq	.	50	4	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	37	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.397056	0.42512	.	.	ENSG00000185621	ENST00000482695;ENST00000330198;ENST00000419117;ENST00000420910;ENST00000332636	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.61	4.73	0.59995	.	0.048523	0.85682	N	0.000000	T	0.57315	0.2045	M	0.84511	2.7	0.80722	D	1	B;B;B;B	0.29886	0.229;0.26;0.069;0.192	B;B;B;B	0.43301	0.415;0.356;0.082;0.291	T	0.61912	-0.6965	10	0.59425	D	0.04	-12.7891	11.6093	0.51049	0.0:0.0:0.811:0.189	.	166;114;166;114	Q96KR4;F8WCE5;F8WB28;Q96KR4-2	LMLN_HUMAN;.;.;.	F	114;166;94;166;114	ENSP00000418324:C114F;ENSP00000328829:C166F;ENSP00000390872:C94F;ENSP00000410926:C166F;ENSP00000328611:C114F	ENSP00000328829:C166F	C	+	2	0	LMLN	199187931	1.000000	0.71417	0.979000	0.43373	0.517000	0.34286	6.665000	0.74442	1.579000	0.49836	0.650000	0.86243	TGT	.		0.473	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
HFM1	164045	hgsc.bcm.edu	37	1	91784927	91784927	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:91784927C>A	ENST00000370425.3	-	24	2701	c.2603G>T	c.(2602-2604)gGa>gTa	p.G868V	HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000370424.3_Missense_Mutation_p.G547V|HFM1_ENST00000294696.5_Missense_Mutation_p.G100V	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	868	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		GGGAATGCATCCTAGTTGAGC	0.373																																					p.G868V		.											HFM1,NS,carcinoma,0,1	HFM1	0	0			c.G2603T						.						102.0	98.0	100.0					1																	91784927		2203	4300	6503	SO:0001583	missense	164045	exon24			ATGCATCCTAGTT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2603G>T	1.37:g.91784927C>A	ENSP00000359454:p.Gly868Val	Somatic	133	0		WXS	Illumina HiSeq	.	69	3	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.626797|4.626797	0.87560|0.87560	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000430465|ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421	.|T;T;T	.|0.61158	.|0.13;0.13;0.13	5.0|5.0	5.0|5.0	0.66597|0.66597	.|Sec63 domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77811|0.77811	0.4186|0.4186	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.997;0.999;0.998	T|T	0.82596|0.82596	-0.0379|-0.0379	5|10	.|0.87932	.|D	.|0	.|.	18.6527|18.6527	0.91437|0.91437	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|547;123;868	.|A6NGI5;B1B0B5;A2PYH4	.|.;.;HFM1_HUMAN	Y|V	124|868;100;547;552	.|ENSP00000359454:G868V;ENSP00000294696:G100V;ENSP00000359453:G547V	.|ENSP00000294696:G100V	D|G	-|-	1|2	0|0	HFM1|HFM1	91557515|91557515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.776000|7.776000	0.85560|0.85560	2.467000|2.467000	0.83353|0.83353	0.650000|0.650000	0.86243|0.86243	GAT|GGA	.		0.373	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
LAMA2	3908	hgsc.bcm.edu	37	6	129777488	129777488	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:129777488G>T	ENST00000421865.2	+	48	6765	c.6716G>T	c.(6715-6717)aGa>aTa	p.R2239I		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2239	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AGAACTGGGAGAAATGGAACT	0.438																																					p.R2239I		.											.	.	.	0			c.G6716T						.						132.0	120.0	124.0					6																	129777488		2203	4300	6503	SO:0001583	missense	3908	exon48			CTGGGAGAAATGG	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6716G>T	6.37:g.129777488G>T	ENSP00000400365:p.Arg2239Ile	Somatic	74	0		WXS	Illumina HiSeq	.	45	4	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771757	0.49680	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.47177	0.85	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.123960	0.64402	D	0.000017	T	0.23171	0.0560	L	0.48362	1.52	0.47374	D	0.9994	B;B	0.26902	0.163;0.163	B;B	0.26310	0.068;0.068	T	0.09618	-1.0666	9	.	.	.	.	8.2498	0.31710	0.0842:0.0:0.7586:0.1572	.	2240;2239	A6NF00;P24043	.;LAMA2_HUMAN	I	2239;2238;2239;257	ENSP00000400365:R2239I	.	R	+	2	0	LAMA2	129819181	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.158000	0.58150	2.596000	0.87737	0.557000	0.71058	AGA	.		0.438	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
FLG	2312	hgsc.bcm.edu;bcgsc.ca	37	1	152281163	152281163	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:152281163G>A	ENST00000368799.1	-	3	6234	c.6199C>T	c.(6199-6201)Ccc>Tcc	p.P2067S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2067	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGATGGGGCCCAGCTTTT	0.562									Ichthyosis																												p.P2067S		.											FLG,NS,carcinoma,0,1	FLG	0	0			c.C6199T						.						364.0	295.0	319.0					1																	152281163		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GATGGGGCCCAGC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6199C>T	1.37:g.152281163G>A	ENSP00000357789:p.Pro2067Ser	Somatic	121	0		WXS	Illumina HiSeq	.	67	4	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	3.522	-0.097502	0.07010	.	.	ENSG00000143631	ENST00000368799	T	0.00986	5.47	2.13	-4.26	0.03755	.	.	.	.	.	T	0.00144	0.0004	N	0.05383	-0.06	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.40720	-0.9548	9	0.02654	T	1	.	4.3265	0.11043	0.2738:0.2934:0.4328:0.0	.	2067	P20930	FILA_HUMAN	S	2067	ENSP00000357789:P2067S	ENSP00000357789:P2067S	P	-	1	0	FLG	150547787	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.961000	0.03845	-1.282000	0.02396	0.485000	0.47835	CCC	.		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
AP2A1	160	hgsc.bcm.edu	37	19	50303257	50303257	+	Silent	SNP	C	C	T	rs201906388		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:50303257C>T	ENST00000359032.5	+	11	1305	c.1305C>T	c.(1303-1305)taC>taT	p.Y435Y	AP2A1_ENST00000354293.5_Silent_p.Y435Y	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	435					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.Y435Y(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCGAGAAGTACGCCGTGGACT	0.617																																					p.Y435Y		.											AP2A1,colon,carcinoma,0,1	AP2A1	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C1305T						.						84.0	91.0	89.0					19																	50303257		2135	4239	6374	SO:0001819	synonymous_variant	160	exon11			GAAGTACGCCGTG	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1305C>T	19.37:g.50303257C>T		Somatic	62	0		WXS	Illumina HiSeq	.	41	2	NM_130787	Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	37	CCDS46148.1																																																																																			0.002		0.617	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
NEURL4	84461	hgsc.bcm.edu;broad.mit.edu	37	17	7232439	7232439	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr17:7232439G>A	ENST00000399464.2	-	1	208	c.193C>T	c.(193-195)Cag>Tag	p.Q65*	NEURL4_ENST00000315614.7_Nonsense_Mutation_p.Q65*|NEURL4_ENST00000570460.1_Nonsense_Mutation_p.Q65*	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	65	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGGCCCGGCTGCTGCCGCCGC	0.706																																					p.Q65X		.											.	.	.	0			c.C193T						.						15.0	21.0	19.0					17																	7232439		1937	4127	6064	SO:0001587	stop_gained	84461	exon1			CCGGCTGCTGCCG		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.193C>T	17.37:g.7232439G>A	ENSP00000382390:p.Gln65*	Somatic	25	0		WXS	Illumina HiSeq	.	10	5	NM_001005408	Q6GPI8|Q96IU9|Q9H0B0	Nonsense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	G	38	6.857370	0.97889	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	.	.	.	5.21	4.17	0.49024	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-15.0996	12.1075	0.53820	0.0:0.0:0.8284:0.1716	.	.	.	.	X	65	.	ENSP00000319826:Q65X	Q	-	1	0	NEURL4	7173163	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.392000	0.73213	2.594000	0.87642	0.462000	0.41574	CAG	.		0.706	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
DLG5	9231	hgsc.bcm.edu	37	10	79613209	79613209	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr10:79613209C>T	ENST00000372391.2	-	5	772	c.767G>A	c.(766-768)cGg>cAg	p.R256Q	DLG5_ENST00000372388.2_Missense_Mutation_p.R256Q	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	256					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.R256L(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GTTTCGCTCCCGCAGCAGCTG	0.622																																					p.R256Q		.											DLG5,NS,carcinoma,0,1	DLG5	0	1	Substitution - Missense(1)	lung(1)	c.G767A						.						58.0	42.0	48.0					10																	79613209		2203	4299	6502	SO:0001583	missense	9231	exon5			CGCTCCCGCAGCA	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.767G>A	10.37:g.79613209C>T	ENSP00000361467:p.Arg256Gln	Somatic	60	0		WXS	Illumina HiSeq	.	28	2	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	C	32	5.138262	0.94560	.	.	ENSG00000151208	ENST00000372391;ENST00000372388	T;T	0.04654	3.58;3.61	4.6	4.6	0.57074	.	0.213520	0.23534	N	0.047147	T	0.12008	0.0292	L	0.44542	1.39	0.39510	D	0.968344	D;P	0.63046	0.992;0.927	P;B	0.54544	0.755;0.325	T	0.03545	-1.1026	10	0.56958	D	0.05	.	17.7962	0.88572	0.0:1.0:0.0:0.0	.	256;256	Q8TDM6;Q8TDM6-2	DLG5_HUMAN;.	Q	256	ENSP00000361467:R256Q;ENSP00000361464:R256Q	ENSP00000361464:R256Q	R	-	2	0	DLG5	79283215	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.252000	0.78309	2.266000	0.75297	0.655000	0.94253	CGG	.		0.622	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
JAK3	3718	hgsc.bcm.edu	37	19	17951082	17951082	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:17951082C>T	ENST00000527670.1	-	8	1240	c.1211G>A	c.(1210-1212)aGc>aAc	p.S404N	JAK3_ENST00000458235.1_Missense_Mutation_p.S404N|JAK3_ENST00000526008.1_5'UTR|JAK3_ENST00000534444.1_Missense_Mutation_p.S404N			P52333	JAK3_HUMAN	Janus kinase 3	404	SH2; atypical.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GTCCTGGGGGCTGCGGCGGAG	0.592		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.S404N		.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	JAK3_ENST00000458235,colon,carcinoma,0,2	JAK3_ENST00000458235	0	0			c.G1211A						.						50.0	45.0	47.0					19																	17951082		2203	4300	6503	SO:0001583	missense	3718	exon9			TGGGGGCTGCGGC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1211G>A	19.37:g.17951082C>T	ENSP00000432511:p.Ser404Asn	Somatic	28	0		WXS	Illumina HiSeq	.	24	2	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013353	0.75161	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.72394	-0.65;-0.65;-0.65	4.5	4.5	0.54988	SH2 motif (2);	0.000000	0.85682	D	0.000000	D	0.83362	0.5238	M	0.82193	2.58	0.49915	D	0.999839	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.999	D	0.85483	0.1180	10	0.87932	D	0	-24.8509	10.7416	0.46156	0.0:0.8063:0.1937:0.0	.	404;404;404	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	N	404	ENSP00000391676:S404N;ENSP00000432511:S404N;ENSP00000436421:S404N	ENSP00000413248:S404N	S	-	2	0	JAK3	17812082	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	5.269000	0.65542	2.073000	0.62155	0.557000	0.71058	AGC	.		0.592	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	21468306	21468306	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:21468306G>A	ENST00000222584.3	+	2	237	c.19G>A	c.(19-21)Gag>Aag	p.E7K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	7	Poly-Glu.				regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAGAAGAAGGAGGAGGAGGA	0.512																																					p.E7K		.											SP4,colon,carcinoma,0,1	SP4	0	0			c.G19A						.						20.0	20.0	20.0					7																	21468306		2171	4251	6422	SO:0001583	missense	6671	exon2			AAGAAGGAGGAGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.19G>A	7.37:g.21468306G>A	ENSP00000222584:p.Glu7Lys	Somatic	67	1		WXS	Illumina HiSeq	.	39	5	NM_003112	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318989	0.41096	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.09911	2.93	4.5	4.5	0.54988	.	0.061123	0.64402	N	0.000005	T	0.10937	0.0267	L	0.36672	1.1	0.44142	D	0.996934	P	0.34587	0.458	B	0.39152	0.292	T	0.20907	-1.0261	10	0.23891	T	0.37	.	12.5742	0.56355	0.0:0.0:1.0:0.0	.	7	Q02446	SP4_HUMAN	K	7	ENSP00000222584:E7K	ENSP00000222584:E7K	E	+	1	0	SP4	21434831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.345000	0.79718	0.563000	0.77884	GAG	.		0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
FRG1	2483	hgsc.bcm.edu	37	4	190884267	190884267	+	Missense_Mutation	SNP	G	G	A	rs373037319		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr4:190884267G>A	ENST00000226798.4	+	9	982	c.760G>A	c.(760-762)Gac>Aac	p.D254N		NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	254					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATTGAAAGCCGACAGATACTG	0.299																																					p.D254N		.											FRG1,middle_lobe,carcinoma,0,1	FRG1	0	0			c.G760A						.						99.0	111.0	107.0					4																	190884267		2203	4300	6503	SO:0001583	missense	2483	exon9			AAAGCCGACAGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.760G>A	4.37:g.190884267G>A	ENSP00000226798:p.Asp254Asn	Somatic	77	1		WXS	Illumina HiSeq	.	34	3	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.9	4.222509	0.79464	.	.	ENSG00000109536	ENST00000226798	T	0.65916	-0.18	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.80994	0.4731	M	0.89715	3.055	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.85581	0.1240	10	0.72032	D	0.01	-19.8783	14.0213	0.64558	0.0:0.0:1.0:0.0	.	254	Q14331	FRG1_HUMAN	N	254	ENSP00000226798:D254N	ENSP00000226798:D254N	D	+	1	0	FRG1	191121261	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.201000	0.95017	1.976000	0.57569	0.479000	0.44913	GAC	.		0.299	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12R	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,+1,6023	KRAS_ENST00000256078	+1	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34C	GRCh37	CM076251	KRAS	M	rs121913530	.						93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CGCCACCAGCTCC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	12.37:g.25398285C>G	ENSP00000256078:p.Gly12Arg	Somatic	56	0		WXS	Illumina HiSeq	.	45	9	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ITGA6	3655	hgsc.bcm.edu	37	2	173349546	173349546	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr2:173349546G>T	ENST00000264106.6	+	13	1906	c.1703G>T	c.(1702-1704)aGa>aTa	p.R568I	ITGA6_ENST00000409532.1_Missense_Mutation_p.R410I|ITGA6_ENST00000409080.1_Missense_Mutation_p.R529I|ITGA6_ENST00000343713.4_Missense_Mutation_p.R524I|ITGA6_ENST00000264107.7_Missense_Mutation_p.R529I|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000375221.2_Missense_Mutation_p.R568I			P23229	ITA6_HUMAN	integrin, alpha 6	568					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AAAGAAAGAAGAAAATCTGGG	0.388																																					p.R529I		.											ITGA6_ENST00000409080,NS,carcinoma,0,2	ITGA6_ENST00000409080	0	0			c.G1586T						.						59.0	61.0	60.0					2																	173349546		2203	4300	6503	SO:0001583	missense	3655	exon12			AAAGAAGAAAATC		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1703G>T	2.37:g.173349546G>T	ENSP00000264106:p.Arg568Ile	Somatic	102	0		WXS	Illumina HiSeq	.	39	2	NM_000210	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	37		.	.	.	.	.	.	.	.	.	.	G	34	5.299053	0.95574	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.73837	0.3638	M	0.87456	2.885	0.80722	D	1	P;D;D;D	0.89917	0.732;1.0;0.996;0.998	P;D;D;D	0.80764	0.458;0.994;0.972;0.981	T	0.78003	-0.2374	10	0.87932	D	0	.	17.7714	0.88494	0.0:0.0:1.0:0.0	.	524;568;529;529	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	I	410;529;568;568;524;529;568;524	ENSP00000386614:R410I;ENSP00000264107:R529I;ENSP00000264106:R568I;ENSP00000364369:R568I;ENSP00000341078:R524I;ENSP00000386896:R529I;ENSP00000406694:R568I;ENSP00000394169:R524I	ENSP00000264106:R568I	R	+	2	0	ITGA6	173057792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.554000	0.82212	2.724000	0.93272	0.561000	0.74099	AGA	.		0.388	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
RPL10A	4736	hgsc.bcm.edu	37	6	35438392	35438392	+	Missense_Mutation	SNP	G	G	T	rs1061530		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:35438392G>T	ENST00000322203.6	+	6	546	c.519G>T	c.(517-519)aaG>aaT	p.K173N	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	173					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						GTCACGTGAAGATGACAGACG	0.483																																					p.K173N		.											RPL10A,colon,carcinoma,0,1	RPL10A	0	0			c.G519T						.						166.0	150.0	156.0					6																	35438392		2203	4300	6503	SO:0001583	missense	4736	exon6			CGTGAAGATGACA	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.519G>T	6.37:g.35438392G>T	ENSP00000363018:p.Lys173Asn	Somatic	122	0		WXS	Illumina HiSeq	.	53	2	NM_007104	B2R801|P52859|P53025|Q5TZT6|Q8J013	Missense_Mutation	SNP	ENST00000322203.6	37	CCDS4806.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175845	0.57692	.	.	ENSG00000198755	ENST00000322203	T	0.41065	1.01	4.67	4.67	0.58626	Ribosomal protein L1, 2-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	N	0.13043	0.29	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.04635	-1.0937	10	0.23302	T	0.38	.	16.1695	0.81793	0.0:0.0:1.0:0.0	.	173	P62906	RL10A_HUMAN	N	173	ENSP00000363018:K173N	ENSP00000363018:K173N	K	+	3	2	RPL10A	35546370	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.048000	0.57390	2.139000	0.66308	0.561000	0.74099	AAG	.		0.483	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
FAM118B	79607	hgsc.bcm.edu;bcgsc.ca	37	11	126131328	126131328	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:126131328G>T	ENST00000533050.1	+	8	1484	c.991G>T	c.(991-993)Gtg>Ttg	p.V331L	FAM118B_ENST00000360194.4_Missense_Mutation_p.V330L|FAM118B_ENST00000529731.1_Missense_Mutation_p.V255L	NM_024556.3	NP_078832.1	Q9BPY3	F118B_HUMAN	family with sequence similarity 118, member B	331										breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)	13	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0784)		AGCAGGGATGGTGAGAGAAGG	0.378																																					p.V331L		.											.	.	.	0			c.G991T						.						166.0	162.0	164.0					11																	126131328		2201	4299	6500	SO:0001583	missense	79607	exon8			GGGATGGTGAGAG	BC001340	CCDS8470.1	11q24.2	2014-03-13				ENSG00000197798			26110	protein-coding gene	gene with protein product						24569877	Standard	NM_024556		Approved	FLJ21103	uc001qdf.3	Q9BPY3		ENST00000533050.1:c.991G>T	11.37:g.126131328G>T	ENSP00000433343:p.Val331Leu	Somatic	81	0		WXS	Illumina HiSeq	.	69	4	NM_024556	Q9H7B0	Missense_Mutation	SNP	ENST00000533050.1	37	CCDS8470.1	.	.	.	.	.	.	.	.	.	.	G	7.648	0.682376	0.14907	.	.	ENSG00000197798	ENST00000533050;ENST00000528985;ENST00000529731;ENST00000360194	T;T;T;T	0.42900	1.52;1.55;0.96;1.54	5.04	4.13	0.48395	.	0.906234	0.09472	N	0.797566	T	0.22781	0.0550	N	0.08118	0	0.19775	N	0.999952	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.16276	-1.0408	10	0.24483	T	0.36	-4.2023	7.7096	0.28669	0.0889:0.2087:0.7024:0.0	.	255;330;331	G3V179;E9PMJ2;Q9BPY3	.;.;F118B_HUMAN	L	331;330;255;330	ENSP00000433343:V331L;ENSP00000434952:V330L;ENSP00000432712:V255L;ENSP00000353321:V330L	ENSP00000353321:V330L	V	+	1	0	FAM118B	125636538	0.956000	0.32656	0.963000	0.40424	0.993000	0.82548	2.427000	0.44740	1.491000	0.48482	0.603000	0.83216	GTG	.		0.378	FAM118B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386346.1	NM_024556	
CKS1B	1163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154950570	154950570	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:154950570A>T	ENST00000308987.5	+	2	214	c.167A>T	c.(166-168)cAt>cTt	p.H56L	CKS1B_ENST00000471245.1_3'UTR|CKS1B_ENST00000368436.1_Missense_Mutation_p.H56L|MIR4258_ENST00000580920.1_RNA|CKS1B_ENST00000368439.1_Missense_Mutation_p.H40L	NM_001826.2	NP_001817.1	P61024	CKS1_HUMAN	CDC28 protein kinase regulatory subunit 1B	56					cell division (GO:0051301)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|large_intestine(1)|lung(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGATGGGTCCATTATATGATC	0.438																																					p.H56L		.											.	.	.	0			c.A167T						.						51.0	46.0	47.0					1																	154950570		2203	4300	6503	SO:0001583	missense	1163	exon2			GGGTCCATTATAT	BC007751	CCDS1077.1	1q21.2	2011-04-28	2002-10-07		ENSG00000173207	ENSG00000173207			19083	protein-coding gene	gene with protein product		116900	"""CDC28 protein kinase 1B"""			2227411	Standard	NM_001826		Approved	ckshs1, CKS1	uc001fgb.3	P61024	OTTHUMG00000037413	ENST00000308987.5:c.167A>T	1.37:g.154950570A>T	ENSP00000311083:p.His56Leu	Somatic	148	0		WXS	Illumina HiSeq	.	73	15	NM_001826	P33551	Missense_Mutation	SNP	ENST00000308987.5	37	CCDS1077.1	.	.	.	.	.	.	.	.	.	.	A	35	5.433974	0.96150	.	.	ENSG00000173207	ENST00000368439;ENST00000368436;ENST00000308987	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.74298	0.3698	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.66351	0.943	T	0.78529	-0.2169	8	0.87932	D	0	.	15.8048	0.78491	1.0:0.0:0.0:0.0	.	56	P61024	CKS1_HUMAN	L	40;56;56	.	ENSP00000311083:H56L	H	+	2	0	CKS1B	153217194	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.755000	0.91646	2.371000	0.80710	0.533000	0.62120	CAT	.		0.438	CKS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091078.1	NM_001826	
TNFRSF21	27242	hgsc.bcm.edu	37	6	47251781	47251781	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:47251781T>C	ENST00000296861.2	-	3	1529	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	379					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCGGGGCCCCTTTTTCAGAGT	0.512																																					p.K379R		.											TNFRSF21,right_lower_lobe,carcinoma,0,1	TNFRSF21	0	0			c.A1136G						.						98.0	104.0	102.0					6																	47251781		2203	4300	6503	SO:0001583	missense	27242	exon3			GGCCCCTTTTTCA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1136A>G	6.37:g.47251781T>C	ENSP00000296861:p.Lys379Arg	Somatic	55	0		WXS	Illumina HiSeq	.	29	2	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.960173	0.92791	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.70631	-0.5	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79753	0.4500	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82068	-0.0640	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	O75509	TNR21_HUMAN	R	379;68	ENSP00000296861:K379R	ENSP00000296861:K379R	K	-	2	0	TNFRSF21	47359740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.708000	0.68377	2.371000	0.80710	0.533000	0.62120	AAG	.		0.512	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
A1CF	29974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	52601740	52601740	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr10:52601740A>G	ENST00000373993.1	-	3	291	c.247T>C	c.(247-249)Tat>Cat	p.Y83H	A1CF_ENST00000374001.2_Missense_Mutation_p.Y83H|A1CF_ENST00000395495.1_Missense_Mutation_p.Y83H|A1CF_ENST00000373995.3_Missense_Mutation_p.Y91H|A1CF_ENST00000395489.2_Missense_Mutation_p.Y76H|A1CF_ENST00000373997.3_Missense_Mutation_p.Y83H|A1CF_ENST00000282641.2_Missense_Mutation_p.Y83H			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	83	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						CTCATTTCATAAATTTTACCG	0.318																																					p.Y91H		.											.	.	.	0			c.T271C						.						107.0	103.0	105.0					10																	52601740		2202	4299	6501	SO:0001583	missense	29974	exon6			TTTCATAAATTTT	AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.247T>C	10.37:g.52601740A>G	ENSP00000363105:p.Tyr83His	Somatic	88	0		WXS	Illumina HiSeq	.	41	17	NM_001198820	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	ENST00000373993.1	37	CCDS7242.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.505852	0.85282	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	M	0.67625	2.065	0.80722	D	1	P;P;D;P	0.89917	0.93;0.872;1.0;0.936	P;P;D;P	0.71656	0.644;0.674;0.974;0.535	T	0.17837	-1.0356	10	0.66056	D	0.02	-4.7153	14.0338	0.64632	1.0:0.0:0.0:0.0	.	76;83;83;91	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	H	83;83;83;91;83;83;66;76;83	ENSP00000363113:Y83H;ENSP00000363105:Y83H;ENSP00000363109:Y83H;ENSP00000363107:Y91H;ENSP00000282641:Y83H;ENSP00000378873:Y83H;ENSP00000378868:Y76H;ENSP00000397953:Y83H	ENSP00000282641:Y83H	Y	-	1	0	A1CF	52271746	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.866000	0.92307	2.206000	0.71126	0.383000	0.25322	TAT	.		0.318	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048086.2	NM_014576	
PLK3	1263	broad.mit.edu	37	1	45266806	45266806	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:45266806G>T	ENST00000372201.4	+	3	656	c.417G>T	c.(415-417)ttG>ttT	p.L139F	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	139	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					ACATTTTCTTGGAGCTCTGCA	0.458																																					p.L139F													.	PLK3	41	0			c.G417T						.						65.0	62.0	63.0					1																	45266806		2203	4300	6503	SO:0001583	missense	1263	exon3			TTTCTTGGAGCTC	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.417G>T	1.37:g.45266806G>T	ENSP00000361275:p.Leu139Phe	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	25	3	NM_004073	Q15767|Q5JR99|Q96CV1	Missense_Mutation	SNP	ENST00000372201.4	37	CCDS515.1	.	.	.	.	.	.	.	.	.	.	g	21.6	4.167095	0.78339	.	.	ENSG00000173846	ENST00000372201;ENST00000543983	T	0.26067	1.76	4.86	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.46814	0.1412	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.46076	-0.9217	9	0.87932	D	0	-4.0659	12.1679	0.54141	0.0:0.0:0.8293:0.1706	.	139	Q9H4B4	PLK3_HUMAN	F	139;114	ENSP00000361275:L139F	ENSP00000361275:L139F	L	+	3	2	PLK3	45039393	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.537000	0.45702	2.270000	0.75569	0.550000	0.68814	TTG	.		0.458	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023429.1	NM_004073	
MIER1	57708	hgsc.bcm.edu	37	1	67411833	67411833	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr1:67411833G>T	ENST00000355356.3	+	3	184	c.35G>T	c.(34-36)gGa>gTa	p.G12V	MIER1_ENST00000357692.2_Splice_Site_p.G29V|MIER1_ENST00000401041.1_Splice_Site_p.G65V|MIER1_ENST00000371016.1_Splice_Site_p.G29V|MIER1_ENST00000371012.2_Splice_Site_p.G29V|MIER1_ENST00000355977.6_Intron|MIER1_ENST00000479067.1_3'UTR|MIER1_ENST00000371014.1_Splice_Site_p.G65V|MIER1_ENST00000371018.3_Splice_Site_p.G29V|MIER1_ENST00000401042.3_Splice_Site_p.G12V	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	12					positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.?(2)|p.G12V(1)|p.G65V(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						TCCTTACCAGGAGGTTCAGCA	0.323																																					p.G65V		.											MIER1_ENST00000401041,bladder,carcinoma,0,2	MIER1_ENST00000401041	0	4	Substitution - Missense(2)|Unknown(2)	urinary_tract(4)	c.G194T						.						95.0	85.0	88.0					1																	67411833		1827	4080	5907	SO:0001630	splice_region_variant	57708	exon4			TACCAGGAGGTTC		CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.35-1G>T	1.37:g.67411833G>T		Somatic	133	0		WXS	Illumina HiSeq	.	62	3	NM_001077700	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Missense_Mutation	SNP	ENST00000355356.3	37	CCDS41348.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178373	0.57692	.	.	ENSG00000198160	ENST00000371017;ENST00000371018;ENST00000357692;ENST00000401041;ENST00000371016;ENST00000371014;ENST00000371012;ENST00000401042;ENST00000355356	T;T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.24	5.24	0.73138	.	0.326738	0.32015	N	0.006701	T	0.19208	0.0461	N	0.11154	0.105	0.80722	D	1	B;D;D;D;D;B;P	0.89917	0.349;1.0;0.999;1.0;0.999;0.184;0.473	B;D;D;D;D;B;B	0.87578	0.056;0.973;0.998;0.998;0.982;0.061;0.056	T	0.23440	-1.0188	9	.	.	.	.	19.2207	0.93795	0.0:0.0:1.0:0.0	.	29;29;12;12;29;65;65	Q5TAD2;Q32NC4;Q8N108-3;Q8N108-6;Q8N108-10;Q5TAD5;Q5TAD4	.;.;.;.;.;.;.	V	33;29;29;65;29;65;29;12;12	ENSP00000360057:G29V;ENSP00000350321:G29V;ENSP00000383820:G65V;ENSP00000360055:G29V;ENSP00000360053:G65V;ENSP00000360051:G29V;ENSP00000383821:G12V;ENSP00000347514:G12V	.	G	+	2	0	MIER1	67184421	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.043000	0.71004	2.621000	0.88768	0.655000	0.94253	GGA	.		0.323	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2	NM_020948	Missense_Mutation
WDFY4	57705	broad.mit.edu	37	10	49982677	49982677	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr10:49982677G>T	ENST00000325239.5	+	13	2755	c.2728G>T	c.(2728-2730)Gag>Tag	p.E910*	WDFY4_ENST00000413659.2_Nonsense_Mutation_p.E910*	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	910						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CAGGATCTTTGAGAAGCTCGC	0.602																																					p.E910X													.	WDFY4	205	0			c.G2728T						.						41.0	47.0	45.0					10																	49982677		692	1591	2283	SO:0001587	stop_gained	57705	exon14			ATCTTTGAGAAGC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2728G>T	10.37:g.49982677G>T	ENSP00000320563:p.Glu910*	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	27	9	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	G	42	9.411117	0.99163	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2153	0.89884	0.0:0.0:1.0:0.0	.	.	.	.	X	919;910;910;910	.	.	E	+	1	0	WDFY4	49652683	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	9.459000	0.97638	2.521000	0.84997	0.655000	0.94253	GAG	.		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
PTPN21	11099	broad.mit.edu;bcgsc.ca	37	14	88946343	88946343	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:88946343C>T	ENST00000556564.1	-	13	1716	c.1432G>A	c.(1432-1434)Ggc>Agc	p.G478S	PTPN21_ENST00000328736.3_Missense_Mutation_p.G478S	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	478					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TACGAGCTGCCGATGTTGAGG	0.667																																					p.G478S													.	PTPN21	113	0			c.G1432A						.						36.0	37.0	37.0					14																	88946343		2203	4300	6503	SO:0001583	missense	11099	exon13			AGCTGCCGATGTT	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1432G>A	14.37:g.88946343C>T	ENSP00000452414:p.Gly478Ser	Somatic	21	0		WXS	Illumina GAIIx	Phase_I	13	4	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	37	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502634	0.44455	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.72051	-0.62;-0.62	5.38	4.48	0.54585	.	0.111045	0.64402	D	0.000007	T	0.50000	0.1590	L	0.27053	0.805	0.47621	D	0.999473	P	0.41214	0.742	B	0.31946	0.138	T	0.49428	-0.8941	10	0.21014	T	0.42	.	10.7907	0.46432	0.0:0.8548:0.0:0.1452	.	478	Q16825	PTN21_HUMAN	S	478	ENSP00000330276:G478S;ENSP00000452414:G478S	ENSP00000330276:G478S	G	-	1	0	PTPN21	88016096	0.997000	0.39634	0.667000	0.29798	0.960000	0.62799	3.056000	0.49923	2.528000	0.85240	0.561000	0.74099	GGC	.		0.667	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
CHD2	1106	broad.mit.edu	37	15	93552420	93552420	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr15:93552420G>T	ENST00000394196.4	+	35	5527	c.4459G>T	c.(4459-4461)Gac>Tac	p.D1487Y	CHD2_ENST00000557381.1_Missense_Mutation_p.D1487Y	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1487					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GAAACAGCTCGACAAACCTGA	0.493																																					p.D1487Y													.	CHD2	280	0			c.G4459T						.						121.0	96.0	105.0					15																	93552420		2197	4298	6495	SO:0001583	missense	1106	exon35			CAGCTCGACAAAC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4459G>T	15.37:g.93552420G>T	ENSP00000377747:p.Asp1487Tyr	Somatic	62	0		WXS	Illumina GAIIx	Phase_I	37	3	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004410	0.93287	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000557759	D;D;T	0.90900	-2.7;-2.75;0.67	5.88	5.88	0.94601	.	0.000000	0.34802	U	0.003668	D	0.94732	0.8300	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94496	0.7705	10	0.72032	D	0.01	-26.451	20.2187	0.98312	0.0:0.0:1.0:0.0	.	1487;1487	O14647;O14647-2	CHD2_HUMAN;.	Y	1487;1487;12	ENSP00000377747:D1487Y;ENSP00000451366:D1487Y;ENSP00000451539:D12Y	ENSP00000377747:D1487Y	D	+	1	0	CHD2	91353424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.780000	0.95670	0.655000	0.94253	GAC	.		0.493	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
HERC2P4	100289574	broad.mit.edu	37	16	32126964	32126964	+	IGR	DEL	T	T	-	rs77063499		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr16:32126964delT								RP11-1166P10.6 (30858 upstream) : HERC2P4 (54340 downstream)																							TTGCCCCCCCTGCCGCCGCGG	0.692																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CCCCCCTGCCGCC																													16.37:g.32126964delT		Somatic	4	0		WXS	Illumina GAIIx	Phase_I	6	2	.		RNA	DEL		37																																																																																				.	0	0.692								
PLIN4	729359	broad.mit.edu	37	19	4510665	4510665	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:4510665G>T	ENST00000301286.3	-	3	3264	c.3265C>A	c.(3265-3267)Ccg>Acg	p.P1089T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	1089						cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GCAGGCTCCGGGCCTACACTG	0.677																																					p.P1089T													.	PLIN4	191	0			c.C3265A						.						18.0	22.0	20.0					19																	4510665		2119	4209	6328	SO:0001583	missense	729359	exon3			GCTCCGGGCCTAC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.3265C>A	19.37:g.4510665G>T	ENSP00000301286:p.Pro1089Thr	Somatic	76	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	g	0.139	-1.104753	0.01828	.	.	ENSG00000167676	ENST00000301286	T	0.03242	4.0	3.2	-0.299	0.12808	.	1.775850	0.04256	U	0.339449	T	0.02848	0.0085	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.46527	-0.9185	10	0.22109	T	0.4	2.1084	5.3157	0.15854	0.4413:0.0:0.5587:0.0	.	1089	Q96Q06	PLIN4_HUMAN	T	1089	ENSP00000301286:P1089T	ENSP00000301286:P1089T	P	-	1	0	PLIN4	4461665	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.469000	0.06648	-0.177000	0.10690	-0.420000	0.06012	CCG	.		0.677	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ZNF837	116412	broad.mit.edu	37	19	58879979	58879979	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:58879979delG	ENST00000427624.2	-	3	1043	c.721delC	c.(721-723)cagfs	p.Q241fs	ZNF837_ENST00000597582.1_Frame_Shift_Del_p.Q241fs|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	241					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						TTGCCCGCCTGCTGCTGCTGG	0.711																																					p.Q241fs													.	ZNF837	16	0			c.721delC						.						3.0	5.0	5.0					19																	58879979		643	1511	2154	SO:0001589	frameshift_variant	116412	exon3			CCGCCTGCTGCTG	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.721delC	19.37:g.58879979delG	ENSP00000405699:p.Gln241fs	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	7	2	NM_138466		Frame_Shift_Del	DEL	ENST00000427624.2	37	CCDS46216.1																																																																																			.		0.711	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
SULT4A1	25830	broad.mit.edu	37	22	44229568	44229568	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr22:44229568G>T	ENST00000330884.4	-	5	675	c.555C>A	c.(553-555)caC>caA	p.H185Q	SULT4A1_ENST00000540422.1_Missense_Mutation_p.H72Q|SULT4A1_ENST00000249130.5_Missense_Mutation_p.H185Q	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	185					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		AGTCCATGCGGTGCTCCCAGA	0.637																																					p.H185Q													.	SULT4A1	26	0			c.C555A						.						44.0	33.0	37.0					22																	44229568		2202	4299	6501	SO:0001583	missense	25830	exon5			CATGCGGTGCTCC	AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.555C>A	22.37:g.44229568G>T	ENSP00000332565:p.His185Gln	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	17	3	NM_014351	B2R7N3|O43728	Missense_Mutation	SNP	ENST00000330884.4	37	CCDS14051.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426147	0.25726	.	.	ENSG00000130540	ENST00000330884;ENST00000540422;ENST00000249130	D;T;D	0.81659	-1.52;2.72;-1.52	5.01	-0.264	0.12950	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.82231	0.4992	L	0.48935	1.535	0.80722	D	1	P;D	0.69078	0.492;0.997	B;D	0.81914	0.324;0.995	T	0.76745	-0.2846	10	0.25751	T	0.34	.	10.0145	0.42006	0.5126:0.0:0.4874:0.0	.	72;185	B7Z2E1;Q9BR01	.;ST4A1_HUMAN	Q	185;72;185	ENSP00000332565:H185Q;ENSP00000439141:H72Q;ENSP00000249130:H185Q	ENSP00000249130:H185Q	H	-	3	2	SULT4A1	42560901	0.994000	0.37717	0.999000	0.59377	0.982000	0.71751	0.421000	0.21280	0.113000	0.18004	-0.355000	0.07637	CAC	.		0.637	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280660.2	NM_014351	
CPNE9	151835	broad.mit.edu;bcgsc.ca	37	3	9746275	9746275	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:9746275C>G	ENST00000383832.3	+	2	263	c.73C>G	c.(73-75)Ctg>Gtg	p.L25V	CPNE9_ENST00000383831.3_Missense_Mutation_p.L25V	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	25	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CTCTAGGAACCTGCTAGACCT	0.642																																					.													.	CPNE9	45	0			.						.						115.0	111.0	112.0					3																	9746275		1906	4105	6011	SO:0001583	missense	151835	.			AGGAACCTGCTAG		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.73C>G	3.37:g.9746275C>G	ENSP00000373343:p.Leu25Val	Somatic	49	0		WXS	Illumina GAIIx	Phase_I	19	8	.	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	ENST00000383832.3	37	CCDS2574.2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816413	0.90790	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	T;T	0.71461	-0.57;-0.57	4.84	4.84	0.62591	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.095311	0.44902	D	0.000420	D	0.89420	0.6710	H	0.98507	4.25	0.49483	D	0.999797	D	0.64830	0.994	D	0.64595	0.927	D	0.93345	0.6713	10	0.87932	D	0	.	14.6789	0.69001	0.0:1.0:0.0:0.0	.	25	Q8IYJ1	CPNE9_HUMAN	V	25	ENSP00000373343:L25V;ENSP00000373342:L25V	ENSP00000373342:L25V	L	+	1	2	CPNE9	9721275	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	3.684000	0.54671	2.233000	0.73108	0.455000	0.32223	CTG	.		0.642	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	
C5orf60	285679	broad.mit.edu	37	5	179069979	179069979	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:179069979G>T	ENST00000448248.2	-	4	599	c.574C>A	c.(574-576)Ctg>Atg	p.L192M	C5orf60_ENST00000506142.1_5'UTR	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	192	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						GAGGAGCTCAGGGATGATGGA	0.622																																					p.L192M													.	C5orf60	24	0			c.C574A						.						62.0	66.0	65.0					5																	179069979		692	1591	2283	SO:0001583	missense	285679	exon4			AGCTCAGGGATGA	BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.574C>A	5.37:g.179069979G>T	ENSP00000404583:p.Leu192Met	Somatic	71	0		WXS	Illumina GAIIx	Phase_I	39	3	NM_001142306	A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	ENST00000448248.2	37	CCDS47353.1	.	.	.	.	.	.	.	.	.	.	g	6.521	0.464391	0.12402	.	.	ENSG00000204661	ENST00000448248	T	0.52295	0.67	0.436	-0.871	0.10642	.	.	.	.	.	T	0.50650	0.1628	L	0.46157	1.445	0.09310	N	1	D;D	0.62365	0.991;0.991	D;D	0.65323	0.934;0.934	T	0.47649	-0.9101	8	0.72032	D	0.01	.	.	.	.	.	192;192	A6NFR6-2;A6NFR6-4	.;.	M	192	ENSP00000404583:L192M	ENSP00000404583:L192M	L	-	1	2	C5orf60	179002585	0.016000	0.18221	0.001000	0.08648	0.004000	0.04260	0.479000	0.22228	-1.729000	0.01364	-0.974000	0.02594	CTG	.		0.622	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2	NM_001142306	
HSP90AB1	3326	broad.mit.edu	37	6	44221231	44221231	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:44221231G>T	ENST00000371554.1	+	12	2285	c.2071G>T	c.(2071-2073)Gat>Tat	p.D691Y	HSP90AB1_ENST00000353801.3_Missense_Mutation_p.D691Y|SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.D691Y|MIR4647_ENST00000583964.1_RNA			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	691					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCAGGTATTGATGAAGATGA	0.478											OREG0017471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D691Y													HSP90AB1,colon,carcinoma,-1,1	HSP90AB1	83	0			c.G2071T						.						76.0	78.0	77.0					6																	44221231		2203	4300	6503	SO:0001583	missense	3326	exon12			GGTATTGATGAAG	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.2071G>T	6.37:g.44221231G>T	ENSP00000360609:p.Asp691Tyr	Somatic	38	0	922	WXS	Illumina GAIIx	Phase_I	34	3	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	37	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280267	0.80692	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.13901	2.55;2.55;2.55	4.43	4.43	0.53597	.	0.000000	0.64402	U	0.000001	T	0.45276	0.1334	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	0.999;0.985;1.0	D;D;D	0.79108	0.976;0.967;0.992	T	0.66424	-0.5927	10	0.87932	D	0	-29.3188	17.4037	0.87467	0.0:0.0:1.0:0.0	.	653;681;691	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	Y	691	ENSP00000360709:D691Y;ENSP00000325875:D691Y;ENSP00000360609:D691Y	ENSP00000325875:D691Y	D	+	1	0	HSP90AB1	44329209	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	9.817000	0.99352	2.188000	0.69820	0.609000	0.83330	GAT	.		0.478	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
ACHE	43	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100490325	100490325	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:100490325G>A	ENST00000412389.1	-	2	1338	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	ACHE_ENST00000419336.2_Intron|ACHE_ENST00000241069.5_Missense_Mutation_p.R395W|UFSP1_ENST00000388761.2_5'Flank|ACHE_ENST00000428317.1_Missense_Mutation_p.R395W|ACHE_ENST00000411582.1_Missense_Mutation_p.R395W|ACHE_ENST00000302913.4_Missense_Mutation_p.R395W			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	395					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	ACCCCGACCCGCACCCCGGCC	0.637																																					p.R395W													.	ACHE	80	0			c.C1183T						.						25.0	27.0	26.0					7																	100490325		2203	4300	6503	SO:0001583	missense	43	exon3			CGACCCGCACCCC		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1183C>T	7.37:g.100490325G>A	ENSP00000394976:p.Arg395Trp	Somatic	102	1		WXS	Illumina GAIIx	Phase_I	116	16	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	37	CCDS5709.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427224	0.62733	.	.	ENSG00000087085	ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000411582;ENST00000422451	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	4.12	4.12	0.48240	Carboxylesterase, type B (1);	0.130494	0.49916	D	0.000133	T	0.72407	0.3456	L	0.55481	1.735	0.40165	D	0.977104	D;D	0.89917	1.0;0.999	P;P	0.61070	0.883;0.812	T	0.75587	-0.3266	10	0.87932	D	0	.	9.1666	0.37054	0.0:0.0:0.7827:0.2172	.	395;395	P22303-2;P22303	.;ACES_HUMAN	W	395	ENSP00000241069:R395W;ENSP00000414858:R395W;ENSP00000303211:R395W;ENSP00000394976:R395W;ENSP00000404865:R395W	ENSP00000241069:R395W	R	-	1	2	ACHE	100328261	0.015000	0.18098	1.000000	0.80357	0.989000	0.77384	2.032000	0.41127	2.143000	0.66587	0.491000	0.48974	CGG	.		0.637	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
GAGE12J	729396	broad.mit.edu	37	X	49179682	49179682	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:49179682C>T	ENST00000442437.2	+	2	106	c.10C>T	c.(10-12)Cga>Tga	p.R4*		NM_001098406.1	NP_001091876.1	A6NER3	GG12J_HUMAN	G antigen 12J	4										kidney(2)|large_intestine(2)|lung(1)|prostate(1)	6	Ovarian(276;0.236)					TATGAGTTGGCGAGGAAGATC	0.463																																					p.R4X													.	GAGE12J	6	0			c.C10T						.						202.0	135.0	160.0					X																	49179682		1468	2541	4009	SO:0001587	stop_gained	729396	exon2			AGTTGGCGAGGAA		CCDS43939.1	Xp11.23	2008-02-05	2007-07-23	2007-07-23	ENSG00000224659	ENSG00000224659			17778	protein-coding gene	gene with protein product		300733	"""G antigen 11"""	GAGE11			Standard	NM_001098406		Approved	OTTHUMG00000024137		A6NER3	OTTHUMG00000024137	ENST00000442437.2:c.10C>T	X.37:g.49179682C>T	ENSP00000409832:p.Arg4*	Somatic	888	0		WXS	Illumina GAIIx	Phase_I	597	8	NM_001098406		Nonsense_Mutation	SNP	ENST00000442437.2	37	CCDS43939.1	.	.	.	.	.	.	.	.	.	.	.	13.68	2.308079	0.40895	.	.	ENSG00000224659	ENST00000442437	.	.	.	0.955	-1.91	0.07641	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.7989	0.05409	0.31:0.4164:0.2735:0.0	.	.	.	.	X	4	.	ENSP00000409832:R4X	R	+	1	2	GAGE12J	49066626	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-0.591000	0.05753	-1.219000	0.02597	0.181000	0.17075	CGA	.		0.463	GAGE12J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060817.1	NM_001098406	
FLNB	2317	ucsc.edu	37	3	58090844	58090844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr3:58090844C>T	ENST00000295956.4	+	11	1813	c.1648C>T	c.(1648-1650)Cag>Tag	p.Q550*	FLNB_ENST00000429972.2_Nonsense_Mutation_p.Q550*|FLNB_ENST00000493452.1_Nonsense_Mutation_p.Q381*|FLNB_ENST00000419752.2_Nonsense_Mutation_p.Q381*|FLNB_ENST00000358537.3_Nonsense_Mutation_p.Q550*|FLNB_ENST00000357272.4_Nonsense_Mutation_p.Q550*|FLNB_ENST00000348383.5_Nonsense_Mutation_p.Q550*|FLNB_ENST00000490882.1_Nonsense_Mutation_p.Q550*	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	550					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		AGCGGGTATGCAGAAAGTCCG	0.527																																					p.Q550X													.	FLNB	430	0			c.C1648T						.						126.0	125.0	125.0					3																	58090844		2203	4300	6503	SO:0001587	stop_gained	2317	exon11			GGTATGCAGAAAG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1648C>T	3.37:g.58090844C>T	ENSP00000295956:p.Gln550*	Somatic	70	0		WXS	Illumina HiSeq		40	4	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Nonsense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	42	9.245549	0.99113	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	.	.	.	X	550;550;550;550;550;550;381;381	.	ENSP00000295956:Q550X	Q	+	1	0	FLNB	58065884	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	CAG	.		0.527	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
NAMPT	10135	ucsc.edu;bcgsc.ca	37	7	105894816	105894816	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:105894816G>T	ENST00000222553.3	-	9	1531	c.1224C>A	c.(1222-1224)ggC>ggA	p.G408G		NM_005746.2	NP_005737.1	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	408					cell-cell signaling (GO:0007267)|circadian regulation of gene expression (GO:0032922)|NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|nicotinamide metabolic process (GO:0006769)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|nicotinamide phosphoribosyltransferase activity (GO:0047280)|nicotinate-nucleotide diphosphorylase (carboxylating) activity (GO:0004514)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						ATACCCCAAGGCCATTAGTTA	0.383																																					p.G408G													.	NAMPT	37	0			c.C1224A						.						128.0	109.0	116.0					7																	105894816		2203	4300	6503	SO:0001819	synonymous_variant	10135	exon9			CCCAAGGCCATTA	U02020	CCDS5737.1	7q22.3	2012-10-02	2008-03-27	2008-03-27	ENSG00000105835	ENSG00000105835			30092	protein-coding gene	gene with protein product	"""visfatin"""	608764	"""pre-B-cell colony enhancing factor 1"""	PBEF1		8289818	Standard	NM_005746		Approved	PBEF	uc003vdq.3	P43490	OTTHUMG00000140388	ENST00000222553.3:c.1224C>A	7.37:g.105894816G>T		Somatic	70	0		WXS	Illumina HiSeq		36	4	NM_005746	A4D0Q9|A4D0R0|Q3KQV0|Q8WW95	Silent	SNP	ENST00000222553.3	37	CCDS5737.1																																																																																			.		0.383	NAMPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277146.1	NM_182790	
STAT6	6778	ucsc.edu;bcgsc.ca	37	12	57498569	57498569	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr12:57498569G>T	ENST00000300134.3	-	10	1354	c.1029C>A	c.(1027-1029)aaC>aaA	p.N343K	STAT6_ENST00000556155.1_Missense_Mutation_p.N343K|STAT6_ENST00000538913.2_Missense_Mutation_p.N233K|STAT6_ENST00000537215.2_Missense_Mutation_p.N233K|STAT6_ENST00000454075.3_Missense_Mutation_p.N343K|STAT6_ENST00000543873.2_Missense_Mutation_p.N343K	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	343					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						AGGGCACAGTGTTGTTGATGA	0.567																																					p.N343K													.	STAT6	69	0			c.C1029A						.						151.0	115.0	127.0					12																	57498569		2203	4300	6503	SO:0001583	missense	6778	exon10			CACAGTGTTGTTG	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1029C>A	12.37:g.57498569G>T	ENSP00000300134:p.Asn343Lys	Somatic	25	0		WXS	Illumina HiSeq		12	4	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.60|18.60	3.658438|3.658438	0.67586|0.67586	.|.	.|.	ENSG00000166888|ENSG00000166888	ENST00000553533|ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	.|T;T;T;T;T;T	.|0.78707	.|-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	4.79|4.79	2.89|2.89	0.33648|0.33648	.|STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	.|0.239777	.|0.42682	.|D	.|0.000678	D|D	0.83626|0.83626	0.5295|0.5295	M|M	0.76574|0.76574	2.34|2.34	0.41786|0.41786	D|D	0.989843|0.989843	.|D;D	.|0.64830	.|0.994;0.99	.|D;D	.|0.64042	.|0.921;0.921	D|D	0.83842|0.83842	0.0258|0.0258	5|10	.|0.87932	.|D	.|0	-14.0692|-14.0692	7.2585|7.2585	0.26189|0.26189	0.2771:0.0:0.7229:0.0|0.2771:0.0:0.7229:0.0	.|.	.|343;343	.|A8K4S9;P42226	.|.;STAT6_HUMAN	N|K	44|343;233;233;343;343;233;343;233;343	.|ENSP00000300134:N343K;ENSP00000445409:N233K;ENSP00000438451:N343K;ENSP00000451742:N343K;ENSP00000444530:N233K;ENSP00000401486:N343K	.|ENSP00000300134:N343K	H|N	-|-	1|3	0|2	STAT6|STAT6	55784836|55784836	0.882000|0.882000	0.30256|0.30256	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	1.178000|1.178000	0.31981|0.31981	1.204000|1.204000	0.43247|0.43247	0.655000|0.655000	0.94253|0.94253	CAC|AAC	.		0.567	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
ARG2	384	ucsc.edu;bcgsc.ca	37	14	68114848	68114848	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr14:68114848G>T	ENST00000261783.3	+	7	987	c.807G>T	c.(805-807)ggG>ggT	p.G269G	VTI1B_ENST00000554659.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	269					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	CTGTTGTCGGGGGACTAACCT	0.433																																					p.G269G													.	ARG2	20	0			c.G807T						.						86.0	79.0	82.0					14																	68114848		2203	4300	6503	SO:0001819	synonymous_variant	384	exon7			TGTCGGGGGACTA	D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.807G>T	14.37:g.68114848G>T		Somatic	53	0		WXS	Illumina HiSeq		43	4	NM_001172	B2R690|Q6FHY8	Silent	SNP	ENST00000261783.3	37	CCDS9785.1																																																																																			.		0.433	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415190.2	NM_001172	
ISLR2	57611	ucsc.edu	37	15	74427081	74427081	+	Silent	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr15:74427081C>T	ENST00000361742.3	+	4	2755	c.1986C>T	c.(1984-1986)ggC>ggT	p.G662G	ISLR2_ENST00000453268.2_Silent_p.G662G|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000435464.1_Silent_p.G662G|ISLR2_ENST00000565159.1_Silent_p.G662G|ISLR2_ENST00000419208.1_Silent_p.G662G|ISLR2_ENST00000445793.1_Silent_p.G662G|ISLR2_ENST00000565540.1_Silent_p.G662G	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	662					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						CGGCAGGCGGCGAGGCGGGCG	0.677											OREG0023277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G662G													.	ISLR2	78	0			c.C1986T						.						28.0	34.0	32.0					15																	74427081		2193	4294	6487	SO:0001819	synonymous_variant	57611	exon4			AGGCGGCGAGGCG		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1986C>T	15.37:g.74427081C>T		Somatic	88	0	1152	WXS	Illumina HiSeq		34	4	NM_001130138	A8K352|Q9P263	Silent	SNP	ENST00000361742.3	37	CCDS10259.1																																																																																			.		0.677	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851	
CYP2A6	1548	ucsc.edu	37	19	41355849	41355849	+	Silent	SNP	A	A	G	rs2302990		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:41355849A>G	ENST00000301141.5	-	2	237	c.217T>C	c.(217-219)Ttg>Ctg	p.L73L	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	73					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CGGGGCCCCAAGTGAATGGTG	0.642																																					p.L73L													.	CYP2A6	69	0			c.T217C						.						63.0	61.0	62.0					19																	41355849		2203	4300	6503	SO:0001819	synonymous_variant	1548	exon2			GCCCCAAGTGAAT	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.217T>C	19.37:g.41355849A>G		Somatic	64	5		WXS	Illumina HiSeq		52	8	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Silent	SNP	ENST00000301141.5	37	CCDS12568.1																																																																																			.		0.642	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
SNRNP200	23020	bcgsc.ca	37	2	96962808	96962808	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr2:96962808G>T	ENST00000323853.5	-	12	1455	c.1378C>A	c.(1378-1380)Caa>Aaa	p.Q460K	SNRNP200_ENST00000349783.5_Splice_Site_p.Q460K	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	460					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GGAAGCAGTTGCTAGAAGAAA	0.478																																					p.Q460K													.	SNRNP200	195	0			c.C1378A						.						55.0	57.0	56.0					2																	96962808		2203	4300	6503	SO:0001630	splice_region_variant	23020	exon12			GCAGTTGCTAGAA	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.1378-1C>A	2.37:g.96962808G>T		Somatic	34	0		WXS	Illumina HiSeq	Phase_1	21	3	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	G	4.619	0.115112	0.08831	.	.	ENSG00000144028	ENST00000323853;ENST00000349783;ENST00000540328	T;T	0.35789	1.29;1.29	5.74	5.74	0.90152	.	0.178529	0.51477	D	0.000099	T	0.10551	0.0258	N	0.00263	-1.745	0.48571	D	0.999677	B	0.02656	0.0	B	0.01281	0.0	T	0.41215	-0.9521	10	0.02654	T	1	-8.9925	18.6945	0.91596	0.0:0.0:1.0:0.0	.	460	O75643	U520_HUMAN	K	460;460;135	ENSP00000317123:Q460K;ENSP00000326937:Q460K	ENSP00000317123:Q460K	Q	-	1	0	SNRNP200	96326535	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	4.919000	0.63383	2.717000	0.92951	0.655000	0.94253	CAA	.		0.478	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	Missense_Mutation
NMUR1	10316	bcgsc.ca	37	2	232393062	232393062	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr2:232393062G>T	ENST00000305141.4	-	2	803	c.670C>A	c.(670-672)Cca>Aca	p.P224T		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	224					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		AGGGCCCGTGGGCGGACCAGC	0.652																																					p.P224T													.	NMUR1	46	0			c.C670A						.						38.0	37.0	38.0					2																	232393062		2203	4300	6503	SO:0001583	missense	10316	exon2			CCCGTGGGCGGAC	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.670C>A	2.37:g.232393062G>T	ENSP00000305877:p.Pro224Thr	Somatic	34	0		WXS	Illumina HiSeq	Phase_1	12	3	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	.	12.97	2.098360	0.37048	.	.	ENSG00000171596	ENST00000305141	T	0.36699	1.24	5.08	1.24	0.21308	GPCR, rhodopsin-like superfamily (1);	0.288644	0.39274	N	0.001404	T	0.57740	0.2074	M	0.85099	2.735	0.24712	N	0.99319	D	0.63046	0.992	D	0.70487	0.969	T	0.51601	-0.8685	10	0.66056	D	0.02	-16.2871	8.977	0.35941	0.3063:0.0:0.6937:0.0	.	224	Q9HB89	NMUR1_HUMAN	T	224	ENSP00000305877:P224T	ENSP00000305877:P224T	P	-	1	0	NMUR1	232101306	1.000000	0.71417	0.000000	0.03702	0.452000	0.32318	2.894000	0.48640	-0.042000	0.13535	0.456000	0.33151	CCA	.		0.652	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
COPS7B	64708	bcgsc.ca	37	2	232653436	232653436	+	Silent	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr2:232653436G>T	ENST00000350033.3	+	2	297	c.156G>T	c.(154-156)gtG>gtT	p.V52V	COPS7B_ENST00000410024.1_Silent_p.V52V|COPS7B_ENST00000409091.1_Intron|COPS7B_ENST00000410017.1_Silent_p.V52V|COPS7B_ENST00000409295.1_Intron|COPS7B_ENST00000373608.3_Silent_p.V52V	NM_001282949.1|NM_022730.1	NP_001269878.1|NP_073567.1	Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B	52	PCI.				cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		TGGCCAACGTGCAGGAGGTAA	0.468																																					p.V52V													.	COPS7B	14	0			c.G156T						.						70.0	72.0	71.0					2																	232653436		2203	4300	6503	SO:0001819	synonymous_variant	64708	exon2			CAACGTGCAGGAG	AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000350033.3:c.156G>T	2.37:g.232653436G>T		Somatic	107	0		WXS	Illumina HiSeq	Phase_1	64	4	NM_022730	Q53S22|Q5BJG3|Q9H7V6	Silent	SNP	ENST00000350033.3	37	CCDS2488.1																																																																																			.		0.468	COPS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256964.2	NM_022730	
DMXL1	1657	bcgsc.ca	37	5	118580098	118580098	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:118580098C>A	ENST00000311085.8	+	42	8766	c.8686C>A	c.(8686-8688)Cca>Aca	p.P2896T	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_Missense_Mutation_p.P2917T	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2896										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AGCATATGCTCCAAAACATCA	0.358																																					p.P2896T													.	DMXL1	268	0			c.C8686A						.						84.0	79.0	80.0					5																	118580098		2202	4300	6502	SO:0001583	missense	1657	exon42			TATGCTCCAAAAC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8686C>A	5.37:g.118580098C>A	ENSP00000309690:p.Pro2896Thr	Somatic	92	0		WXS	Illumina HiSeq	Phase_1	61	4	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006512	0.54361	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.02197	4.4;4.4	5.4	4.52	0.55395	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.117129	0.64402	D	0.000017	T	0.05044	0.0135	L	0.55990	1.75	0.58432	D	0.999997	P;P	0.41929	0.765;0.759	B;B	0.43331	0.416;0.415	T	0.33471	-0.9867	10	0.66056	D	0.02	-5.8672	16.2405	0.82405	0.0:0.8671:0.1329:0.0	.	2917;2896	F5H269;Q9Y485	.;DMXL1_HUMAN	T	2896;2917	ENSP00000309690:P2896T;ENSP00000439479:P2917T	ENSP00000309690:P2896T	P	+	1	0	DMXL1	118607997	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.232000	0.51302	1.259000	0.44117	0.585000	0.79938	CCA	.		0.358	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
TMCO6	55374	bcgsc.ca	37	5	140024571	140024571	+	Splice_Site	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr5:140024571C>T	ENST00000394671.3	+	12	1471	c.1370C>T	c.(1369-1371)gCt>gTt	p.A457V	TMCO6_ENST00000537378.1_Splice_Site_p.A217V|MIR3655_ENST00000581765.1_RNA|IK_ENST00000417647.2_5'Flank|TMCO6_ENST00000252100.6_Splice_Site_p.A463V|NDUFA2_ENST00000510680.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	457					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCCCTAGGCTGTTCAGGTC	0.562																																					p.A457V													.	TMCO6	30	0			c.C1370T						.						85.0	84.0	84.0					5																	140024571		1913	4136	6049	SO:0001630	splice_region_variant	55374	exon12			CCTAGGCTGTTCA	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.1369-1C>T	5.37:g.140024571C>T		Somatic	19	0		WXS	Illumina HiSeq	Phase_1	13	3	NM_018502	Q9BUU0|Q9P198	Missense_Mutation	SNP	ENST00000394671.3	37	CCDS4233.2	.	.	.	.	.	.	.	.	.	.	C	11.14	1.550537	0.27739	.	.	ENSG00000113119	ENST00000394671;ENST00000537378;ENST00000252100	T;T;T	0.70986	-0.53;-0.53;-0.53	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.186769	0.35349	N	0.003268	T	0.51601	0.1684	N	0.12746	0.255	0.30918	N	0.728348	B;B	0.20261	0.043;0.011	B;B	0.21546	0.035;0.014	T	0.52586	-0.8556	10	0.33141	T	0.24	-6.1129	10.4824	0.44702	0.0:0.9112:0.0:0.0888	.	463;457	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	V	457;217;463	ENSP00000378166:A457V;ENSP00000444474:A217V;ENSP00000252100:A463V	ENSP00000252100:A463V	A	+	2	0	TMCO6	140004755	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	2.060000	0.41394	2.575000	0.86900	0.655000	0.94253	GCT	.		0.562	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251666.2	NM_018502	Missense_Mutation
XPO5	57510	bcgsc.ca	37	6	43501688	43501688	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:43501688G>T	ENST00000265351.7	-	21	2609	c.2399C>A	c.(2398-2400)aCc>aAc	p.T800N		NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	800					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			CAGAGCCTTGGTGAAAGGCTC	0.398																																					p.T800N													.	XPO5	79	0			c.C2399A						.						143.0	135.0	138.0					6																	43501688		1832	4078	5910	SO:0001583	missense	57510	exon21			GCCTTGGTGAAAG	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.2399C>A	6.37:g.43501688G>T	ENSP00000265351:p.Thr800Asn	Somatic	33	0		WXS	Illumina HiSeq	Phase_1	22	3	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	37	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	G	9.108	1.005906	0.19199	.	.	ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000372258;ENST00000439465	T	0.66995	-0.24	5.62	4.76	0.60689	Armadillo-like helical (1);Armadillo-type fold (1);	0.919846	0.09427	N	0.803655	T	0.33265	0.0857	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.22906	-1.0203	10	0.21014	T	0.42	-0.6326	10.3225	0.43775	0.0707:0.1342:0.7951:0.0	.	800	Q9HAV4	XPO5_HUMAN	N	800;505;340;428	ENSP00000265351:T800N	ENSP00000265351:T800N	T	-	2	0	XPO5	43609666	0.905000	0.30787	0.050000	0.19076	0.846000	0.48090	2.769000	0.47654	1.378000	0.46305	-0.254000	0.11334	ACC	.		0.398	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
SGK1	6446	bcgsc.ca	37	6	134492266	134492266	+	Missense_Mutation	SNP	G	G	T	rs78176488		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr6:134492266G>T	ENST00000237305.7	-	10	1021	c.933C>A	c.(931-933)aaC>aaA	p.N311K	SGK1_ENST00000528577.1_Missense_Mutation_p.N339K|SGK1_ENST00000367857.5_Missense_Mutation_p.N301K|SGK1_ENST00000367858.5_Missense_Mutation_p.N406K|SGK1_ENST00000475719.2_Missense_Mutation_p.N267K|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000413996.3_Missense_Mutation_p.N325K	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	311	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GGAGAGGCTTGTTCAGAATGT	0.468																																					p.N406K													SGK1_ENST00000528577,NS,carcinoma,0,5	SGK1	387	0			c.C1218A						.						116.0	117.0	117.0					6																	134492266		2203	4300	6503	SO:0001583	missense	6446	exon12			AGGCTTGTTCAGA	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.933C>A	6.37:g.134492266G>T	ENSP00000237305:p.Asn311Lys	Somatic	53	1		WXS	Illumina HiSeq	Phase_1	37	15	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754712	0.69648	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.63580	3.2;3.2;3.2;3.2;3.2;-0.05	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	N	0.05608	-0.01	0.80722	D	1	P;P;P;P;P;P	0.47034	0.799;0.647;0.578;0.581;0.889;0.784	B;B;P;B;P;B	0.49597	0.361;0.191;0.491;0.264;0.616;0.383	T	0.51973	-0.8637	10	0.40728	T	0.16	.	19.9827	0.97334	0.0:0.0:1.0:0.0	.	339;325;267;301;406;311	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	K	406;325;311;301;339;267	ENSP00000356832:N406K;ENSP00000396242:N325K;ENSP00000237305:N311K;ENSP00000356831:N301K;ENSP00000434450:N339K;ENSP00000434302:N267K	ENSP00000237305:N311K	N	-	3	2	SGK1	134533959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.728000	0.93425	0.655000	0.94253	AAC	.		0.468	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
TBX20	57057	bcgsc.ca	37	7	35242184	35242184	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:35242184G>A	ENST00000408931.3	-	8	1728	c.1202C>T	c.(1201-1203)gCc>gTc	p.A401V		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	401					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						GCTGGCAATGGCCGATGGTGT	0.557																																					p.A401V													.	TBX20	96	0			c.C1202T						.						79.0	78.0	78.0					7																	35242184		1997	4185	6182	SO:0001583	missense	57057	exon8			GCAATGGCCGATG	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.1202C>T	7.37:g.35242184G>A	ENSP00000386170:p.Ala401Val	Somatic	77	0		WXS	Illumina HiSeq	Phase_1	47	4	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740315	0.89573	.	.	ENSG00000164532	ENST00000408931	D	0.88046	-2.33	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.88603	0.6481	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	D	0.87035	0.2137	10	0.29301	T	0.29	.	19.7407	0.96230	0.0:0.0:1.0:0.0	.	401	Q9UMR3	TBX20_HUMAN	V	401	ENSP00000386170:A401V	ENSP00000386170:A401V	A	-	2	0	TBX20	35208709	1.000000	0.71417	0.999000	0.59377	0.793000	0.44817	9.476000	0.97823	2.654000	0.90174	0.609000	0.83330	GCC	.		0.557	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
POLM	27434	bcgsc.ca	37	7	44113248	44113248	+	Silent	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr7:44113248G>A	ENST00000242248.5	-	10	1475	c.1374C>T	c.(1372-1374)agC>agT	p.S458S	POLM_ENST00000395831.3_Silent_p.S378S|POLM_ENST00000492971.1_5'Flank|POLM_ENST00000335195.6_Silent_p.S421S	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	458					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						ACAGCCCATGGCTGTTCAGCC	0.617								DNA polymerases (catalytic subunits)																													p.S458S													.	POLM	50	0			c.C1374T						.						62.0	67.0	65.0					7																	44113248		2203	4300	6503	SO:0001819	synonymous_variant	27434	exon10			CCCATGGCTGTTC	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.1374C>T	7.37:g.44113248G>A		Somatic	64	0		WXS	Illumina HiSeq	Phase_1	33	4	NM_013284	D3DVK4|Q6P5X8|Q86WQ9	Silent	SNP	ENST00000242248.5	37	CCDS34625.1																																																																																			.		0.617	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
Unknown	0	bcgsc.ca	37	9	90038777	90038777	+	IGR	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr9:90038777G>A								SNORA26 (163277 upstream) : DAPK1 (73365 downstream)																							GTGGATTACAGCAAACTGAAG	0.393																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ATTACAGCAAACT																													9.37:g.90038777G>A		Somatic	30	0		WXS	Illumina HiSeq	Phase_1	12	3	.		RNA	SNP		37																																																																																				.	0	0.393								
MUC2	4583	bcgsc.ca	37	11	1093312	1093312	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:1093312C>G	ENST00000441003.2	+	30	5158	c.5131C>G	c.(5131-5133)Cca>Gca	p.P1711A	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1678A	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccaacacccac	0.637																																					p.P1711A													.	MUC2	614	0			c.C5131G						.						145.0	191.0	175.0					11																	1093312		1907	3560	5467	SO:0001583	missense	4583	exon30			CCAACCCCAACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5131C>G	11.37:g.1093312C>G	ENSP00000415183:p.Pro1711Ala	Somatic	487	17		WXS	Illumina HiSeq	Phase_1	279	18	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.304	-0.972196	0.02215	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08458	3.09;3.11	1.4	-2.79	0.05841	.	0.190326	0.20108	U	0.099085	T	0.02533	0.0077	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.41106	-0.9527	9	0.08179	T	0.78	.	2.4144	0.04432	0.4935:0.3028:0.0:0.2036	.	1711	E7EUV1	.	A	1711;1678	ENSP00000415183:P1711A;ENSP00000351956:P1678A	ENSP00000351956:P1678A	P	+	1	0	MUC2	1083312	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-5.838000	0.00095	-0.673000	0.05259	-1.098000	0.02139	CCA	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
PHF21A	51317	bcgsc.ca	37	11	45986887	45986887	+	Missense_Mutation	SNP	G	G	T	rs188195248		TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr11:45986887G>T	ENST00000418153.2	-	9	1171	c.972C>A	c.(970-972)agC>agA	p.S324R	PHF21A_ENST00000527753.1_5'UTR|PHF21A_ENST00000323180.6_Missense_Mutation_p.S325R|PHF21A_ENST00000257821.4_Missense_Mutation_p.S325R			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	324					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						GACTTGGCTTGCTAAGCTGTA	0.512											OREG0020936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S325R													.	PHF21A	107	0			c.C975A						.						62.0	52.0	55.0					11																	45986887		2202	4299	6501	SO:0001583	missense	51317	exon9			TGGCTTGCTAAGC	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.972C>A	11.37:g.45986887G>T	ENSP00000398824:p.Ser324Arg	Somatic	55	6	935	WXS	Illumina HiSeq	Phase_1	43	13	NM_016621	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	ENST00000418153.2	37	CCDS44578.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021758	0.75275	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	T;T;T	0.53206	0.63;0.63;0.63	6.17	6.17	0.99709	.	0.300523	0.43260	D	0.000596	T	0.52901	0.1763	L	0.56769	1.78	0.49915	D	0.999839	D;D;D	0.56968	0.978;0.967;0.958	P;P;P	0.53689	0.719;0.732;0.663	T	0.43653	-0.9378	10	0.22706	T	0.39	-6.987	10.4929	0.44760	0.0688:0.1344:0.7967:0.0	.	324;325;325	Q96BD5;Q96BD5-2;Q96BD5-3	PF21A_HUMAN;.;.	R	325;325;324	ENSP00000257821:S325R;ENSP00000323152:S325R;ENSP00000398824:S324R	ENSP00000257821:S325R	S	-	3	2	PHF21A	45943463	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.058000	0.57463	2.941000	0.99782	0.655000	0.94253	AGC	G|0.999;T|0.001		0.512	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
TRPM1	4308	bcgsc.ca	37	15	31355481	31355481	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr15:31355481C>T	ENST00000256552.6	-	8	952	c.805G>A	c.(805-807)Gtg>Atg	p.V269M	MIR211_ENST00000384969.1_RNA|TRPM1_ENST00000542188.1_Missense_Mutation_p.V286M|TRPM1_ENST00000397795.2_Missense_Mutation_p.V247M	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		ACGAGGGGCACGCCCTGCCCC	0.577																																					p.V286M													.	TRPM1	183	0			c.G856A						.						85.0	98.0	94.0					15																	31355481		2031	4166	6197	SO:0001583	missense	4308	exon7			GGGGCACGCCCTG	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.805G>A	15.37:g.31355481C>T	ENSP00000256552:p.Val269Met	Somatic	27	0		WXS	Illumina HiSeq	Phase_1	22	3	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	C	32	5.178173	0.94846	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.38560	1.13;1.13;1.13	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.975;0.999	T	0.77284	-0.2645	10	0.87932	D	0	-34.5273	19.7652	0.96335	0.0:1.0:0.0:0.0	.	247;247	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	M	247;286;269;247	ENSP00000380897:V247M;ENSP00000437849:V286M;ENSP00000256552:V269M	ENSP00000256552:V269M	V	-	1	0	TRPM1	29142773	1.000000	0.71417	0.993000	0.49108	0.953000	0.61014	7.776000	0.85560	2.668000	0.90789	0.650000	0.86243	GTG	.		0.577	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
CTDSPL2	51496	bcgsc.ca	37	15	44807020	44807020	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr15:44807020G>T	ENST00000260327.4	+	10	1653	c.1090G>T	c.(1090-1092)Gac>Tac	p.D364Y	CTDSPL2_ENST00000558966.1_Missense_Mutation_p.D364Y|CTDSPL2_ENST00000558373.1_Missense_Mutation_p.D292Y|CTDSPL2_ENST00000396780.1_Missense_Mutation_p.D292Y|CTD-2329K10.1_ENST00000561324.1_RNA	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	364	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GAACATACTAGACCCTAAAAA	0.318																																					p.D364Y													.	CTDSPL2	31	0			c.G1090T						.						51.0	51.0	51.0					15																	44807020		2198	4290	6488	SO:0001583	missense	51496	exon10			ATACTAGACCCTA	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.1090G>T	15.37:g.44807020G>T	ENSP00000260327:p.Asp364Tyr	Somatic	102	0		WXS	Illumina HiSeq	Phase_1	45	4	NM_016396	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Missense_Mutation	SNP	ENST00000260327.4	37	CCDS10110.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352474	0.82132	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	T;T	0.26067	1.76;1.76	5.57	5.57	0.84162	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.71879	0.3392	H	0.99074	4.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84793	0.0780	10	0.87932	D	0	-7.9807	19.5486	0.95309	0.0:0.0:1.0:0.0	.	292;364	Q05D32-2;Q05D32	.;CTSL2_HUMAN	Y	364;292	ENSP00000260327:D364Y;ENSP00000380000:D292Y	ENSP00000260327:D364Y	D	+	1	0	CTDSPL2	42594312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.841000	0.99482	2.609000	0.88269	0.591000	0.81541	GAC	.		0.318	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396	
FAM20A	54757	bcgsc.ca	37	17	66538202	66538202	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr17:66538202G>T	ENST00000592554.1	-	7	1755	c.1033C>A	c.(1033-1035)Ccg>Acg	p.P345T	PRKAR1A_ENST00000588188.2_Intron|AC079210.1_ENST00000600820.1_5'Flank|FAM20A_ENST00000226094.5_5'UTR	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	345					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					TTGAGGGACGGCAGGAAGGCA	0.597																																					p.P345T													.	FAM20A	35	0			c.C1033A						.						111.0	89.0	97.0					17																	66538202		2203	4300	6503	SO:0001583	missense	54757	exon7			GGGACGGCAGGAA	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.1033C>A	17.37:g.66538202G>T	ENSP00000468308:p.Pro345Thr	Somatic	56	0		WXS	Illumina HiSeq	Phase_1	24	3	NM_017565	B2RN47|B2RN49|Q9UF95	Missense_Mutation	SNP	ENST00000592554.1	37	CCDS11679.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956083	0.92726	.	.	ENSG00000108950	ENST00000226094	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.86744	0.6006	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88419	0.3027	9	0.87932	D	0	-31.6456	20.4301	0.99081	0.0:0.0:1.0:0.0	.	345	Q96MK3	FA20A_HUMAN	T	345	.	ENSP00000226094:P345T	P	-	1	0	FAM20A	64049797	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.476000	0.97823	2.834000	0.97654	0.557000	0.71058	CCG	.		0.597	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
RPTOR	57521	bcgsc.ca	37	17	78811735	78811735	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr17:78811735C>A	ENST00000306801.3	+	10	1512	c.1150C>A	c.(1150-1152)Ctg>Atg	p.L384M	RPTOR_ENST00000537330.1_Missense_Mutation_p.L199M|RPTOR_ENST00000544334.2_Missense_Mutation_p.L384M|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	384					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						AGCCTGGGACCTGGCTGTTGA	0.617																																					p.L384M													.	RPTOR	122	0			c.C1150A						.						111.0	77.0	89.0					17																	78811735		2203	4300	6503	SO:0001583	missense	57521	exon10			TGGGACCTGGCTG		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1150C>A	17.37:g.78811735C>A	ENSP00000307272:p.Leu384Met	Somatic	37	0		WXS	Illumina HiSeq	Phase_1	22	3	NM_001163034	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203264	0.58234	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T	0.54866	0.6;0.55	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	T	0.66761	0.2822	L	0.52206	1.635	0.80722	D	1	D;P;P	0.69078	0.997;0.717;0.816	D;B;B	0.75484	0.986;0.243;0.406	T	0.64041	-0.6500	10	0.36615	T	0.2	.	16.3867	0.83507	0.0:1.0:0.0:0.0	.	384;199;384	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	M	199;384;384	ENSP00000307272:L384M;ENSP00000442479:L384M	ENSP00000307272:L384M	L	+	1	2	RPTOR	76426330	1.000000	0.71417	0.995000	0.50966	0.907000	0.53573	4.003000	0.57061	2.459000	0.83118	0.557000	0.71058	CTG	.		0.617	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
KDM4B	23030	bcgsc.ca	37	19	5041222	5041222	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:5041222C>A	ENST00000159111.4	+	5	610	c.392C>A	c.(391-393)cCg>cAg	p.P131Q	KDM4B_ENST00000536461.1_Missense_Mutation_p.P131Q|KDM4B_ENST00000381759.4_Missense_Mutation_p.P131Q	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	131					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)	p.P131L(2)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TTTGTCTCCCCGATCTACGGG	0.552																																					p.P131Q													KDM4B_ENST00000381759,NS,carcinoma,0,2	KDM4B	120	2	Substitution - Missense(2)	endometrium(2)	c.C392A						.						126.0	117.0	120.0					19																	5041222		2203	4300	6503	SO:0001583	missense	23030	exon5			TCTCCCCGATCTA	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.392C>A	19.37:g.5041222C>A	ENSP00000159111:p.Pro131Gln	Somatic	43	0		WXS	Illumina HiSeq	Phase_1	43	4	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	37	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315573	0.81469	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.69806	-0.43;-0.43;-0.43	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.87309	0.6145	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	0.989;1.0;1.0	D;D;D	0.91635	0.948;0.999;0.995	D	0.91456	0.5185	10	0.87932	D	0	-36.1813	17.6411	0.88137	0.0:1.0:0.0:0.0	.	131;131;131	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	Q	131	ENSP00000159111:P131Q;ENSP00000371178:P131Q;ENSP00000440495:P131Q	ENSP00000159111:P131Q	P	+	2	0	KDM4B	4992222	1.000000	0.71417	0.989000	0.46669	0.650000	0.38633	7.517000	0.81783	2.401000	0.81631	0.561000	0.74099	CCG	.		0.552	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
ZNF208	7757	bcgsc.ca	37	19	22154193	22154193	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chr19:22154193G>T	ENST00000397126.4	-	4	3791	c.3643C>A	c.(3643-3645)Cac>Aac	p.H1215N	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTTTCTTGTGATATCTAAGG	0.378																																					p.H1215N													ZNF208_ENST00000428290,NS,carcinoma,+2,3	ZNF208	817	0			c.C3643A						.						38.0	41.0	40.0					19																	22154193		2105	4247	6352	SO:0001583	missense	7757	exon4			TCTTGTGATATCT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3643C>A	19.37:g.22154193G>T	ENSP00000380315:p.His1215Asn	Somatic	46	0		WXS	Illumina HiSeq	Phase_1	29	3	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268118	0.40095	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.86865	-2.18	2.93	2.93	0.34026	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92489	0.7615	.	.	.	0.26239	N	0.97891	D	0.89917	1.0	D	0.91635	0.999	D	0.84795	0.0781	8	0.87932	D	0	.	12.591	0.56443	0.0:0.0:1.0:0.0	.	1087	O43345	ZN208_HUMAN	N	1215;1087	ENSP00000380315:H1215N	ENSP00000380315:H1215N	H	-	1	0	ZNF208	21946033	1.000000	0.71417	0.006000	0.13384	0.062000	0.15995	6.793000	0.75130	1.212000	0.43366	0.298000	0.19748	CAC	.		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
SHC1P1	6465	bcgsc.ca	37	X	63652534	63652534	+	IGR	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:63652534G>A								MTMR8 (37201 upstream) : ZC4H2 (483715 downstream)														p.0?(1)									GGGGAGCCAGGAAGGGCAGCC	0.602																																					.													.	.	.	1	Whole gene deletion(1)	ovary(1)	.						.																																			SO:0001628	intergenic_variant	6465	.			AGCCAGGAAGGGC																													X.37:g.63652534G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_1	11	4	.		RNA	SNP		37																																																																																				.	0	0.602								
API5P1	642812	bcgsc.ca	37	X	115238617	115238617	+	IGR	SNP	G	G	A			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:115238617G>A								RN7SL712P (129517 upstream) : AGTR2 (63357 downstream)																							TAAGAAATCTGGATGTTTTCG	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	642812	.			AAATCTGGATGTT																													X.37:g.115238617G>A		Somatic	139	0		WXS	Illumina HiSeq	Phase_1	68	18	.		RNA	SNP		37																																																																																				.	0	0.398								
ELF4	2000	bcgsc.ca	37	X	129205393	129205393	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVB-01A-31D-A417-09	TCGA-3X-AAVB-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3b4557a5-53c5-475e-81e1-945411375b6f	d7040563-8449-489d-9155-a19f0819a6c7	g.chrX:129205393G>T	ENST00000308167.5	-	6	913	c.534C>A	c.(532-534)atC>atA	p.I178I	ELF4_ENST00000335997.7_Splice_Site_p.I178I	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGGTCTTCCGGACTATGAGGG	0.557			T	ERG	AML																																p.I178I				Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4	67	0			c.C534A						.						124.0	88.0	100.0					X																	129205393		2203	4300	6503	SO:0001630	splice_region_variant	2000	exon6			CTTCCGGACTATG	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.533-1C>A	X.37:g.129205393G>T		Somatic	19	0		WXS	Illumina HiSeq	Phase_1	8	3	NM_001421		Silent	SNP	ENST00000308167.5	37	CCDS14617.1																																																																																			.		0.557	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	Silent
