#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1016412	1016414	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:1016412_1016414delGAG	ENST00000421673.2	-	31	6437_6439	c.6387_6389delCTC	c.(6385-6390)tcctca>tca	p.2129_2130SS>S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2129	Ser-rich.|Thr-rich.			S -> F (in Ref. 6; BAC04860). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.S2130delS(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGAGAAAATGAGGAGGACAGCT	0.522																																					p.2130_2130del		.											.	.	.	1	Deletion - In frame(1)	stomach(1)	c.6388_6390del						.			1,3949		0,1,1974						2.9	0.0			96	0,8040		0,0,4020	no	coding	MUC6	NM_005961.2		0,1,5994	A1A1,A1R,RR		0.0,0.0253,0.0083				1,11989				SO:0001651	inframe_deletion	4588	exon31			GAAAATGAGGAGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6387_6389delCTC	11.37:g.1016415_1016417delGAG	ENSP00000406861:p.Ser2130del	Somatic	27	0		WXS	Illumina HiSeq	.	43	14	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	In_Frame_Del	DEL	ENST00000421673.2	37	CCDS44513.1																																																																																			.		0.522	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MAP7D2	256714	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	20030593	20030593	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:20030593delG	ENST00000379651.3	-	14	1841	c.1823delC	c.(1822-1824)actfs	p.T608fs	MAP7D2_ENST00000379643.5_Frame_Shift_Del_p.T649fs|MAP7D2_ENST00000543767.1_Frame_Shift_Del_p.T493fs|MAP7D2_ENST00000443379.3_Frame_Shift_Del_p.T563fs|MAP7D2_ENST00000452324.3_Frame_Shift_Del_p.T556fs	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	608					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						TTGGGGATAAGTTTCTGGGGC	0.438																																					p.T649fs		.											.	.	.	0			c.1947delT						.						142.0	128.0	133.0					X																	20030593		2203	4300	6503	SO:0001589	frameshift_variant	256714	exon15			GGATAAGTTTCTG	BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.1823delC	X.37:g.20030593delG	ENSP00000368972:p.Thr608fs	Somatic	70	0		WXS	Illumina HiSeq	.	72	23	NM_001168465	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Frame_Shift_Del	DEL	ENST00000379651.3	37	CCDS14195.1																																																																																			.		0.438	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056001.1	NM_152780	
ONECUT2	9480	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	55103945	55103947	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr18:55103945_55103947delATC	ENST00000491143.2	+	1	1029_1031	c.997_999delATC	c.(997-999)atcdel	p.I333del	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	333					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GCTGGAAGAAATCAACACCAAAG	0.655																																					p.332_333del		.											.	.	.	0			c.996_998del						.																																			SO:0001651	inframe_deletion	9480	exon1			GAAGAAATCAACA	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.997_999delATC	18.37:g.55103945_55103947delATC	ENSP00000419185:p.Ile333del	Somatic	38	0		WXS	Illumina HiSeq	.	28	15	NM_004852		In_Frame_Del	DEL	ENST00000491143.2	37	CCDS42440.1																																																																																			.		0.655	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3		
ENC1	8507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	73931139	73931139	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:73931139delT	ENST00000302351.4	-	2	2302	c.1172delA	c.(1171-1173)tatfs	p.Y391fs	ENC1_ENST00000510316.1_Frame_Shift_Del_p.Y318fs|ENC1_ENST00000537006.1_Frame_Shift_Del_p.Y391fs	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	391					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		CCCAACCACATACAGGCAGTG	0.582																																					p.Y391X		.											.	.	.	0			c.1173delT						.						50.0	53.0	52.0					5																	73931139		2203	4300	6503	SO:0001589	frameshift_variant	8507	exon3			ACCACATACAGGC	AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.1172delA	5.37:g.73931139delT	ENSP00000306356:p.Tyr391fs	Somatic	20	0		WXS	Illumina HiSeq	.	19	12	NM_001256575	B4DHJ1|E9PFU0|O75464|Q9UPG9	Frame_Shift_Del	DEL	ENST00000302351.4	37	CCDS4021.1																																																																																			.		0.582	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	NM_003633	
KIF1B	23095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10434992	10434992	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:10434992G>A	ENST00000377086.1	+	47	5379	c.5177G>A	c.(5176-5178)cGt>cAt	p.R1726H	KIF1B_ENST00000377081.1_Missense_Mutation_p.R1726H|KIF1B_ENST00000263934.6_Missense_Mutation_p.R1680H			O60333	KIF1B_HUMAN	kinesin family member 1B	1726	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GTTGTCGTCCGTCGGCCTTAT	0.453																																					p.R1680H		.											.	.	.	0			c.G5039A						.						134.0	116.0	122.0					1																	10434992		2203	4300	6503	SO:0001583	missense	23095	exon45			TCGTCCGTCGGCC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.5177G>A	1.37:g.10434992G>A	ENSP00000366290:p.Arg1726His	Somatic	63	0		WXS	Illumina HiSeq	.	53	27	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	34	5.335717	0.95758	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.76578	-1.03;-1.03;-1.03	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;0.999;0.989	D	0.92360	0.5896	10	0.87932	D	0	.	19.1358	0.93428	0.0:0.0:1.0:0.0	.	1712;1686;1726;1700;1726;1680	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	H	1726;1680;1726;1726	ENSP00000263934:R1680H;ENSP00000366290:R1726H;ENSP00000366284:R1726H	ENSP00000263934:R1680H	R	+	2	0	KIF1B	10357579	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	9.864000	0.99589	2.501000	0.84356	0.655000	0.94253	CGT	.		0.453	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
ICAM1	3383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10385609	10385609	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:10385609A>G	ENST00000264832.3	+	2	561	c.236A>G	c.(235-237)tAt>tGt	p.Y79C	ICAM1_ENST00000423829.2_Intron|CTD-2369P2.5_ENST00000592893.1_RNA	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	79	Ig-like C2-type 1.				adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	CGGAAGGTGTATGAACTGAGC	0.512																																					p.Y79C		.											.	.	.	0			c.A236G						.						140.0	130.0	133.0					19																	10385609		2203	4300	6503	SO:0001583	missense	3383	exon2			AGGTGTATGAACT		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.236A>G	19.37:g.10385609A>G	ENSP00000264832:p.Tyr79Cys	Somatic	29	0		WXS	Illumina HiSeq	.	33	8	NM_000201	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	37	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.999676	0.35320	.	.	ENSG00000090339	ENST00000264832	T	0.20069	2.1	4.46	-0.601	0.11638	Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	0.463445	0.18074	N	0.152516	T	0.35451	0.0932	L	0.54323	1.7	0.09310	N	0.999998	D	0.89917	1.0	D	0.76071	0.987	T	0.14337	-1.0476	10	0.62326	D	0.03	-5.3233	9.7686	0.40576	0.687:0.0:0.0:0.313	.	79	P05362	ICAM1_HUMAN	C	79	ENSP00000264832:Y79C	ENSP00000264832:Y79C	Y	+	2	0	ICAM1	10246609	0.016000	0.18221	0.000000	0.03702	0.001000	0.01503	0.351000	0.20096	-0.335000	0.08451	-1.405000	0.01134	TAT	.		0.512	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
PRUNE2	158471	hgsc.bcm.edu	37	9	79270373	79270373	+	Silent	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr9:79270373G>T	ENST00000376718.3	-	10	8445	c.8322C>A	c.(8320-8322)ggC>ggA	p.G2774G	PRUNE2_ENST00000223609.6_Silent_p.G38G|PRUNE2_ENST00000443509.2_Silent_p.G23G|PRUNE2_ENST00000428286.1_Silent_p.G2415G|PRUNE2_ENST00000466266.2_5'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2774					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.G2774G(2)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GACTCAGCACGCCCTCTTCAA	0.458																																					p.G2774G		.											PRUNE2_ENST00000376718,colon,carcinoma,0,4	PRUNE2_ENST00000376718	0	2	Substitution - coding silent(2)	large_intestine(1)|pancreas(1)	c.C8322A						.						75.0	67.0	69.0					9																	79270373		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon10			CAGCACGCCCTCT	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.8322C>A	9.37:g.79270373G>T		Somatic	33	0		WXS	Illumina HiSeq	.	23	3	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	G	8.030	0.761602	0.15914	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.74	-1.01	0.10169	.	.	.	.	.	T	0.39358	0.1075	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25572	-1.0128	4	.	.	.	-27.9261	0.7209	0.00940	0.1527:0.2162:0.2224:0.4087	.	.	.	.	S	2096	.	.	R	-	1	0	PRUNE2	78460193	0.016000	0.18221	0.838000	0.33150	0.781000	0.44180	-0.091000	0.11146	-0.312000	0.08741	-1.463000	0.01021	CGT	.		0.458	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
OR1S1	219959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57982413	57982413	+	Missense_Mutation	SNP	C	C	T	rs386753888|rs140365237		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:57982413C>T	ENST00000309433.6	+	1	197	c.197C>T	c.(196-198)aCg>aTg	p.T66M		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T66M(2)		breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				AGCTTGGATACGTACCTTCAT	0.448																																					p.T66M		.											OR1S1,NS,carcinoma,-1,3	OR1S1	-1	2	Substitution - Missense(2)	urinary_tract(1)|endometrium(1)	c.C197T						.						331.0	303.0	313.0					11																	57982413		2201	4296	6497	SO:0001583	missense	219959	exon1			TGGATACGTACCT	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.197C>T	11.37:g.57982413C>T	ENSP00000311688:p.Thr66Met	Somatic	89	0		WXS	Illumina HiSeq	.	62	35	NM_001004458	Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	37	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	C	0.652	-0.809268	0.02798	.	.	ENSG00000172774	ENST00000309433	T	0.01099	5.34	3.45	0.0887	0.14455	GPCR, rhodopsin-like superfamily (1);	0.804300	0.10727	N	0.641081	T	0.01523	0.0049	L	0.55834	1.745	0.09310	N	1	B	0.20550	0.046	B	0.12837	0.008	T	0.41716	-0.9493	10	0.72032	D	0.01	.	5.9969	0.19499	0.464:0.4385:0.0:0.0974	.	66	Q8NH92	OR1S1_HUMAN	M	66	ENSP00000311688:T66M	ENSP00000311688:T66M	T	+	2	0	OR1S1	57738989	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.633000	0.05483	-0.185000	0.10550	-0.532000	0.04303	ACG	0.000		0.448	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
MOV10	4343	hgsc.bcm.edu	37	1	113241378	113241378	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:113241378G>T	ENST00000413052.2	+	17	2940	c.2550G>T	c.(2548-2550)gaG>gaT	p.E850D	MOV10_ENST00000369645.1_Missense_Mutation_p.E850D|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369644.1_Missense_Mutation_p.E794D|MOV10_ENST00000357443.2_Missense_Mutation_p.E850D|MOV10_ENST00000468624.1_3'UTR	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	850					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		TTGACAGGGAGCTTCGAGGAC	0.537																																					p.E850D		.											.	.	.	0			c.G2550T						.						305.0	273.0	284.0					1																	113241378		2203	4300	6503	SO:0001583	missense	4343	exon17			CAGGGAGCTTCGA	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.2550G>T	1.37:g.113241378G>T	ENSP00000399797:p.Glu850Asp	Somatic	27	0		WXS	Illumina HiSeq	.	24	3	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	ENST00000413052.2	37	CCDS853.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848246	0.32699	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	4.85	-1.58	0.08479	.	1.149140	0.06086	N	0.662685	T	0.62122	0.2402	N	0.04387	-0.21	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.53704	-0.8401	10	0.13108	T	0.6	-12.6985	4.6835	0.12747	0.5357:0.1729:0.2914:0.0	.	850	Q9HCE1	MOV10_HUMAN	D	850;850;794;850;788	ENSP00000399797:E850D;ENSP00000358659:E850D;ENSP00000358658:E794D;ENSP00000350028:E850D	ENSP00000350028:E850D	E	+	3	2	MOV10	113042901	0.600000	0.26899	0.999000	0.59377	0.981000	0.71138	-0.508000	0.06344	0.095000	0.17434	0.313000	0.20887	GAG	.		0.537	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
SLC6A12	6539	hgsc.bcm.edu	37	12	307123	307123	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:307123C>T	ENST00000428720.1	-	9	1636	c.893G>A	c.(892-894)tGc>tAc	p.C298Y	SLC6A12_ENST00000397296.2_Missense_Mutation_p.C298Y|SLC6A12_ENST00000424061.2_Missense_Mutation_p.C298Y|SLC6A12_ENST00000536824.1_Missense_Mutation_p.C298Y|SLC6A12_ENST00000359674.4_Missense_Mutation_p.C298Y|SLC6A12_ENST00000538272.1_5'UTR	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	298					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GCACCCCTGGCAGATGGCAAA	0.597																																					p.C298Y		.											SLC6A12,NS,carcinoma,0,1	SLC6A12	0	0			c.G893A						.						72.0	81.0	78.0					12																	307123		2203	4300	6503	SO:0001583	missense	6539	exon9			CCCTGGCAGATGG	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.893G>A	12.37:g.307123C>T	ENSP00000388184:p.Cys298Tyr	Somatic	34	0		WXS	Illumina HiSeq	.	34	2	NM_001122848	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	37	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236941	0.79800	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	3.95	3.95	0.45737	.	0.056774	0.64402	D	0.000001	D	0.91071	0.7190	H	0.97918	4.105	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.94533	0.7738	10	0.66056	D	0.02	.	16.2044	0.82114	0.0:1.0:0.0:0.0	.	298	P48065	S6A12_HUMAN	Y	298	ENSP00000352702:C298Y;ENSP00000380464:C298Y;ENSP00000388184:C298Y;ENSP00000399136:C298Y;ENSP00000444268:C298Y	ENSP00000352702:C298Y	C	-	2	0	SLC6A12	177384	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.543000	0.82106	2.041000	0.60428	0.561000	0.74099	TGC	.		0.597	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2	NM_003044	
ZKSCAN2	342357	hgsc.bcm.edu	37	16	25258433	25258433	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:25258433C>A	ENST00000328086.7	-	5	1887	c.1084G>T	c.(1084-1086)Gaa>Taa	p.E362*		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	362					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		TGAAGTGTTTCATAAAAGCGA	0.473																																					p.E362X		.											.	.	.	0			c.G1084T						.						112.0	107.0	109.0					16																	25258433		2197	4300	6497	SO:0001587	stop_gained	342357	exon5			GTGTTTCATAAAA	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1084G>T	16.37:g.25258433C>A	ENSP00000331626:p.Glu362*	Somatic	66	0		WXS	Illumina HiSeq	.	66	4	NM_001012981	A1L3B4|Q6ZN77	Nonsense_Mutation	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	45	11.421438	0.99559	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	.	.	.	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-24.2485	15.8146	0.78589	0.0:1.0:0.0:0.0	.	.	.	.	X	362	.	ENSP00000331626:E362X	E	-	1	0	ZKSCAN2	25165934	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.957000	0.56730	2.882000	0.98803	0.655000	0.94253	GAA	.		0.473	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
SKA3	221150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21742376	21742376	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:21742376C>T	ENST00000314759.5	-	4	618	c.494G>A	c.(493-495)cGg>cAg	p.R165Q	SKA3_ENST00000400018.3_Missense_Mutation_p.R165Q	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	165					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)		p.R165Q(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						TACGATGTACCGCTCAAGTCC	0.443																																					p.R165Q		.											SKA3,NS,carcinoma,0,1	SKA3	0	2	Substitution - Missense(2)	endometrium(2)	c.G494A						.						146.0	150.0	148.0					13																	21742376		2203	4300	6503	SO:0001583	missense	221150	exon4			ATGTACCGCTCAA	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.494G>A	13.37:g.21742376C>T	ENSP00000319417:p.Arg165Gln	Somatic	60	0		WXS	Illumina HiSeq	.	58	18	NM_145061	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Missense_Mutation	SNP	ENST00000314759.5	37	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543876	0.86022	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	T;T	0.22945	1.93;1.93	5.88	4.86	0.63082	.	0.426709	0.25851	N	0.027900	T	0.39600	0.1084	L	0.60455	1.87	0.23809	N	0.996787	D;D	0.76494	0.999;0.999	D;D	0.63192	0.912;0.912	T	0.17561	-1.0365	10	0.33141	T	0.24	-10.2206	9.3154	0.37930	0.0:0.862:0.0:0.138	.	165;165	Q8IX90-3;Q8IX90	.;SKA3_HUMAN	Q	165	ENSP00000319417:R165Q;ENSP00000382896:R165Q	ENSP00000319417:R165Q	R	-	2	0	SKA3	20640376	0.977000	0.34250	1.000000	0.80357	0.996000	0.88848	2.160000	0.42348	2.780000	0.95670	0.655000	0.94253	CGG	.		0.443	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	
RXRG	6258	hgsc.bcm.edu;bcgsc.ca	37	1	165414094	165414094	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:165414094C>T	ENST00000359842.5	-	1	339	c.37G>A	c.(37-39)Gca>Aca	p.A13T		NM_001256570.1|NM_006917.4	NP_001243499.1|NP_008848.1	P48443	RXRG_HUMAN	retinoid X receptor, gamma	13	Modulating. {ECO:0000250}.				gene expression (GO:0010467)|heart development (GO:0007507)|neuron differentiation (GO:0030182)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|skeletal muscle tissue development (GO:0007519)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	9-cis retinoic acid receptor activity (GO:0004886)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(6)|lung(22)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	38	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tretinoin(DB00755)	CCATAGCCTGCGGGAAACTTC	0.443																																					p.A13T		.											.	.	.	0			c.G37A						.						150.0	129.0	136.0					1																	165414094		2203	4300	6503	SO:0001583	missense	6258	exon1			AGCCTGCGGGAAA	U38480	CCDS1248.1, CCDS72970.1	1q22-q23	2013-01-16			ENSG00000143171	ENSG00000143171		"""Nuclear hormone receptors"""	10479	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 3"""	180247				8034312	Standard	NR_033824		Approved	NR2B3	uc001gda.3	P48443	OTTHUMG00000034626	ENST00000359842.5:c.37G>A	1.37:g.165414094C>T	ENSP00000352900:p.Ala13Thr	Somatic	84	0		WXS	Illumina HiSeq	.	77	4	NM_006917	A6NIP1|Q6IBU7	Missense_Mutation	SNP	ENST00000359842.5	37	CCDS1248.1	.	.	.	.	.	.	.	.	.	.	C	4.062	0.009369	0.07912	.	.	ENSG00000143171	ENST00000359842	D	0.92348	-3.02	5.3	-2.46	0.06461	.	1.785420	0.02385	N	0.079181	T	0.60248	0.2254	N	0.11560	0.145	0.25868	N	0.983744	B;B	0.14805	0.011;0.0	B;B	0.06405	0.002;0.0	T	0.67612	-0.5626	9	0.02654	T	1	.	6.2582	0.20885	0.1708:0.5935:0.0:0.2357	.	13;13	B2R7C0;P48443	.;RXRG_HUMAN	T	13	ENSP00000352900:A13T	ENSP00000352900:A13T	A	-	1	0	RXRG	163680718	0.999000	0.42202	0.705000	0.30386	0.970000	0.65996	0.416000	0.21198	-0.314000	0.08716	0.561000	0.74099	GCA	.		0.443	RXRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083794.2	NM_006917	
SUPT6H	6830	hgsc.bcm.edu	37	17	27001323	27001323	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:27001323C>T	ENST00000314616.6	+	3	415	c.132C>T	c.(130-132)aaC>aaT	p.N44N	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_Silent_p.N44N	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	44	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGGAGGAGAACCTAGATGATC	0.458																																					p.N44N		.											SUPT6H,NS,carcinoma,0,1	SUPT6H	0	0			c.C132T						.						132.0	102.0	112.0					17																	27001323		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon3			GGAGAACCTAGAT	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.132C>T	17.37:g.27001323C>T		Somatic	59	0		WXS	Illumina HiSeq	.	40	2	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																			.		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
PRCC	5546	hgsc.bcm.edu;bcgsc.ca	37	1	156756845	156756845	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:156756845T>A	ENST00000271526.4	+	3	1234	c.962T>A	c.(961-963)cTt>cAt	p.L321H	PRCC_ENST00000491853.1_3'UTR|PRCC_ENST00000353233.3_Missense_Mutation_p.L321H	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	321					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AATGCCCCCCTTGAATTCAAG	0.567			T	TFE3	papillary renal																																p.L321H		.		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	.	.	0			c.T962A						.						109.0	117.0	114.0					1																	156756845		2203	4300	6503	SO:0001583	missense	5546	exon3			CCCCCCTTGAATT	X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.962T>A	1.37:g.156756845T>A	ENSP00000271526:p.Leu321His	Somatic	36	0		WXS	Illumina HiSeq	.	65	4	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	37	CCDS1157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.6|23.6	4.438976|4.438976	0.83885|0.83885	.|.	.|.	ENSG00000143294|ENSG00000143294	ENST00000271526;ENST00000353233;ENST00000368201;ENST00000526188|ENST00000454659	T;T|.	0.57436|.	0.4;0.99|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.46151|0.46151	0.1378|0.1378	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.987;0.998|.	T|T	0.47649|0.47649	-0.9101|-0.9101	10|7	0.62326|0.37606	D|T	0.03|0.19	-15.1937|-15.1937	14.9249|14.9249	0.70868|0.70868	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	321;321|.	A6NG79;Q92733|.	.;PRCC_HUMAN|.	H|M	321;321;265;60|55	ENSP00000271526:L321H;ENSP00000339300:L321H|.	ENSP00000271526:L321H|ENSP00000403560:L55M	L|L	+|+	2|1	0|2	PRCC|PRCC	155023469|155023469	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.993000|0.993000	0.82548|0.82548	6.726000|6.726000	0.74758|0.74758	2.203000|2.203000	0.70933|0.70933	0.533000|0.533000	0.62120|0.62120	CTT|TTG	.		0.567	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
SH3GL1	6455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	4362634	4362634	+	Silent	SNP	G	G	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:4362634G>C	ENST00000269886.3	-	8	1006	c.828C>G	c.(826-828)ccC>ccG	p.P276P	SH3GL1_ENST00000417295.2_Silent_p.P228P|AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000598564.1_Silent_p.P212P	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	276					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CTGTGGTGCAGGGGAAGCCCC	0.652			T	MLL	AL																																p.P276P	NSCLC(94;1152 2133 30346 33362)	.		Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	.	.	.	0			c.C828G						.						42.0	43.0	43.0					19																	4362634		2203	4300	6503	SO:0001819	synonymous_variant	6455	exon8			GGTGCAGGGGAAG		CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.828C>G	19.37:g.4362634G>C		Somatic	42	0		WXS	Illumina HiSeq	.	42	24	NM_003025	B4DRA1|E7EVZ4|M0QZV5|Q99668	Silent	SNP	ENST00000269886.3	37	CCDS32874.1																																																																																			.		0.652	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	NM_003025	
LNX2	222484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	28122525	28122525	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:28122525G>A	ENST00000316334.3	-	10	2149	c.2020C>T	c.(2020-2022)Cag>Tag	p.Q674*		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	674	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TTGTTCCTCTGCTCCTTCAAC	0.453																																					p.Q674X		.											.	.	.	0			c.C2020T						.						104.0	82.0	90.0					13																	28122525		2203	4300	6503	SO:0001587	stop_gained	222484	exon10			TCCTCTGCTCCTT	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.2020C>T	13.37:g.28122525G>A	ENSP00000325929:p.Gln674*	Somatic	41	0		WXS	Illumina HiSeq	.	41	9	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Nonsense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	.	.	.	.	.	.	.	.	.	.	G	40	8.230804	0.98717	.	.	ENSG00000139517	ENST00000316334	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	20.4379	0.99098	0.0:0.0:1.0:0.0	.	.	.	.	X	674	.	ENSP00000325929:Q674X	Q	-	1	0	LNX2	27020525	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.011000	0.88624	2.838000	0.97847	0.585000	0.79938	CAG	.		0.453	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
SMARCD2	6603	hgsc.bcm.edu	37	17	61914839	61914839	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:61914839C>T	ENST00000448276.2	-	2	628	c.363G>A	c.(361-363)gtG>gtA	p.V121V	SMARCD2_ENST00000225742.9_Silent_p.V46V|SMARCD2_ENST00000323347.10_Silent_p.V73V|RN7SL805P_ENST00000581353.1_RNA	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	121	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						GCGCCTGGGGCACAAGCAGGC	0.627																																					p.V121V		.											.	.	.	0			c.G363A						.						58.0	66.0	63.0					17																	61914839		1964	4157	6121	SO:0001819	synonymous_variant	6603	exon2			CTGGGGCACAAGC	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.363G>A	17.37:g.61914839C>T		Somatic	82	0		WXS	Illumina HiSeq	.	72	4	NM_001098426	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Silent	SNP	ENST00000448276.2	37	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	10.02	1.236689	0.22711	.	.	ENSG00000108604	ENST00000225742	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.54598	0.1868	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43442	-0.9391	5	0.18276	T	0.48	-0.5858	11.9997	0.53224	0.0:0.8261:0.1739:0.0	.	.	.	.	T	65	.	ENSP00000225742:A65T	A	-	1	0	SMARCD2	59268571	0.975000	0.34042	1.000000	0.80357	0.968000	0.65278	0.154000	0.16343	2.749000	0.94314	0.491000	0.48974	GCC	.		0.627	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426	
DLEC1	9940	hgsc.bcm.edu	37	3	38135138	38135138	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:38135138G>T	ENST00000308059.6	+	12	1820	c.1799G>T	c.(1798-1800)gGt>gTt	p.G600V	DLEC1_ENST00000346219.3_Missense_Mutation_p.G600V|DLEC1_ENST00000452631.2_Missense_Mutation_p.G600V					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TATATTTCTGGTGAAAAAAGC	0.488																																					p.G600V		.											DLEC1_ENST00000346219,NS,carcinoma,-1,2	DLEC1_ENST00000346219	-1	0			c.G1799T						.						111.0	110.0	111.0					3																	38135138		1916	4140	6056	SO:0001583	missense	9940	exon12			TTTCTGGTGAAAA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1799G>T	3.37:g.38135138G>T	ENSP00000308597:p.Gly600Val	Somatic	73	0		WXS	Illumina HiSeq	.	40	2	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670293	0.67814	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.06294	3.33;3.32;3.55	5.08	5.08	0.68730	.	0.172827	0.51477	D	0.000098	T	0.22859	0.0552	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.988;0.996	T	0.11792	-1.0573	10	0.11485	T	0.65	-17.5899	15.4156	0.74966	0.0:0.0:1.0:0.0	.	600;600;600	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	V	600	ENSP00000308597:G600V;ENSP00000315914:G600V;ENSP00000410427:G600V	ENSP00000308597:G600V	G	+	2	0	DLEC1	38110142	1.000000	0.71417	0.806000	0.32338	0.989000	0.77384	4.515000	0.60489	2.347000	0.79759	0.655000	0.94253	GGT	.		0.488	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
EPYC	1833	hgsc.bcm.edu	37	12	91371911	91371911	+	Silent	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:91371911G>T	ENST00000261172.3	-	3	386	c.294C>A	c.(292-294)ccC>ccA	p.P98P		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	98					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						CAGGCTCCTGGGGAGAAGAGC	0.527											OREG0022019	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P98P		.											EPYC,NS,carcinoma,0,1	EPYC	0	0			c.C294A						.						125.0	122.0	123.0					12																	91371911		2203	4300	6503	SO:0001819	synonymous_variant	1833	exon3			CTCCTGGGGAGAA	AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.294C>A	12.37:g.91371911G>T		Somatic	49	0	1282	WXS	Illumina HiSeq	.	53	2	NM_004950	A8K3M7|Q8NEJ5	Silent	SNP	ENST00000261172.3	37	CCDS31870.1																																																																																			.		0.527	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407146.2	NM_004950	
HECTD4	283450	hgsc.bcm.edu	37	12	112605160	112605160	+	Silent	SNP	C	C	A	rs201036210		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:112605160C>A	ENST00000430131.2	-	71	12374	c.11229G>T	c.(11227-11229)gcG>gcT	p.A3743A	HECTD4_ENST00000377560.5_Silent_p.A3993A|HECTD4_ENST00000550722.1_Silent_p.A4019A			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3743	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGAGGATATCCGCTTCCTGCA	0.617																																					p.A4031A		.											C12orf51_ENST00000377560,right_lower_lobe,carcinoma,0,2	C12orf51_ENST00000377560	0	0			c.G12093T						.						84.0	91.0	89.0					12																	112605160		2052	4176	6228	SO:0001819	synonymous_variant	283450	exon72			GATATCCGCTTCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11229G>T	12.37:g.112605160C>A		Somatic	49	0		WXS	Illumina HiSeq	.	39	2	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.		0.617	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
CCDC138	165055	hgsc.bcm.edu	37	2	109463227	109463227	+	Missense_Mutation	SNP	G	G	A	rs145643143		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:109463227G>A	ENST00000295124.4	+	12	1417	c.1357G>A	c.(1357-1359)Ggt>Agt	p.G453S	CCDC138_ENST00000412964.2_Missense_Mutation_p.G453S	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	453										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						GAGGAGATTGGGTGAAGACAT	0.328																																					p.G453S		.											.	.	.	0			c.G1357A						.	G	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	91.0	94.0	93.0		1357	5.9	1.0	2	dbSNP_134	93	0,8600		0,0,4300	no	missense	CCDC138	NM_144978.1	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	453/666	109463227	1,13005	2203	4300	6503	SO:0001583	missense	165055	exon12			AGATTGGGTGAAG	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1357G>A	2.37:g.109463227G>A	ENSP00000295124:p.Gly453Ser	Somatic	44	0		WXS	Illumina HiSeq	.	44	4	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	ENST00000295124.4	37	CCDS2080.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.345373|5.345373	0.95807|0.95807	2.27E-4|2.27E-4	0.0|0.0	ENSG00000163006|ENSG00000163006	ENST00000412964;ENST00000295124|ENST00000456512	T;T|.	0.56776|.	0.44;0.53|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73768|.	0.3629|.	L|L	0.60455|0.60455	1.87|1.87	0.50813|0.50813	D|D	0.999896|0.999896	D;D|.	0.89917|.	1.0;0.995|.	D;D|.	0.97110|.	1.0;0.942|.	T|.	0.69239|.	-0.5197|.	10|.	0.52906|.	T|.	0.07|.	-6.1916|-6.1916	19.8989|19.8989	0.96978|0.96978	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	453;453|.	Q96M89-2;Q96M89|.	.;CC138_HUMAN|.	S|X	453|349	ENSP00000411800:G453S;ENSP00000295124:G453S|.	ENSP00000295124:G453S|.	G|W	+|+	1|3	0|0	CCDC138|CCDC138	108829659|108829659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	6.839000|6.839000	0.75364|0.75364	2.791000|2.791000	0.96007|0.96007	0.650000|0.650000	0.86243|0.86243	GGT|TGG	0.000		0.328	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
TAF2	6873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	120795791	120795791	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:120795791T>C	ENST00000378164.2	-	16	2240	c.1942A>G	c.(1942-1944)Atg>Gtg	p.M648V		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	648					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TACTGCCACATAAAATCAGCT	0.433																																					p.M648V		.											.	.	.	0			c.A1942G						.						95.0	89.0	91.0					8																	120795791		2203	4300	6503	SO:0001583	missense	6873	exon16			GCCACATAAAATC	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.1942A>G	8.37:g.120795791T>C	ENSP00000367406:p.Met648Val	Somatic	35	0		WXS	Illumina HiSeq	.	39	28	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.099746	0.76983	.	.	ENSG00000064313	ENST00000378164	T	0.41400	1.0	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	M	0.82193	2.58	0.80722	D	1	P	0.50710	0.938	P	0.46885	0.53	T	0.63862	-0.6541	10	0.62326	D	0.03	-32.2034	16.6407	0.85098	0.0:0.0:0.0:1.0	.	648	Q6P1X5	TAF2_HUMAN	V	648	ENSP00000367406:M648V	ENSP00000367406:M648V	M	-	1	0	TAF2	120864972	1.000000	0.71417	0.976000	0.42696	0.992000	0.81027	6.274000	0.72587	2.326000	0.78906	0.533000	0.62120	ATG	.		0.433	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
GNA12	2768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	2771312	2771312	+	Missense_Mutation	SNP	C	C	T	rs201475988		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:2771312C>T	ENST00000275364.3	-	4	811	c.649G>A	c.(649-651)Gtt>Att	p.V217I	GNA12_ENST00000491117.1_5'UTR|GNA12_ENST00000396960.3_Missense_Mutation_p.V69I|GNA12_ENST00000407904.3_Missense_Mutation_p.V158I|GNA12_ENST00000544127.1_Missense_Mutation_p.V124I|AMZ1_ENST00000489665.1_Intron|GNA12_ENST00000407653.1_Missense_Mutation_p.V141I	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	217					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		TTCTTAATAACGAAGTCATGC	0.488																																					p.V217I		.											.	.	.	0			c.G649A						.	C	ILE/VAL	0,4406		0,0,2203	66.0	56.0	59.0		649	0.3	0.4	7		59	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GNA12	NM_007353.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	217/382	2771312	1,13005	2203	4300	6503	SO:0001583	missense	2768	exon4			TAATAACGAAGTC	L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.649G>A	7.37:g.2771312C>T	ENSP00000275364:p.Val217Ile	Somatic	49	0		WXS	Illumina HiSeq	.	39	18	NM_007353	A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Missense_Mutation	SNP	ENST00000275364.3	37	CCDS5335.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065961	0.36470	0.0	1.16E-4	ENSG00000146535	ENST00000275364;ENST00000407904;ENST00000407653;ENST00000396960;ENST00000544127	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	6.17	0.311	0.15831	.	0.239980	0.42682	N	0.000676	T	0.81673	0.4872	L	0.37897	1.145	0.43381	D	0.995487	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.73981	-0.3811	10	0.72032	D	0.01	.	10.1899	0.43019	0.0:0.5015:0.0:0.4985	.	217;217;158	Q5PPR5;Q03113;B3KXS2	.;GNA12_HUMAN;.	I	217;158;141;69;124	ENSP00000275364:V217I;ENSP00000385935:V158I;ENSP00000386054:V141I;ENSP00000380160:V69I;ENSP00000437469:V124I	ENSP00000275364:V217I	V	-	1	0	GNA12	2737838	0.998000	0.40836	0.371000	0.25978	0.990000	0.78478	1.472000	0.35376	0.199000	0.20427	0.655000	0.94253	GTT	.		0.488	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241608.1	NM_007353	
HRNR	388697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152191793	152191793	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:152191793C>G	ENST00000368801.2	-	3	2387	c.2312G>C	c.(2311-2313)gGa>gCa	p.G771A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	771					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGCCAGATCCAGACCCTTG	0.587																																					p.G771A		.											.	.	.	0			c.G2312C						.						85.0	88.0	87.0					1																	152191793		2203	4300	6503	SO:0001583	missense	388697	exon3			CCAGATCCAGACC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2312G>C	1.37:g.152191793C>G	ENSP00000357791:p.Gly771Ala	Somatic	41	0		WXS	Illumina HiSeq	.	55	27	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	7.562	0.664844	0.14710	.	.	ENSG00000197915	ENST00000368801	T	0.06294	3.32	2.84	2.84	0.33178	.	.	.	.	.	T	0.04634	0.0126	L	0.58101	1.795	0.09310	N	1	D	0.56968	0.978	P	0.55011	0.766	T	0.18745	-1.0327	9	0.08599	T	0.76	.	9.3025	0.37853	0.0:1.0:0.0:0.0	.	771	Q86YZ3	HORN_HUMAN	A	771	ENSP00000357791:G771A	ENSP00000357791:G771A	G	-	2	0	HRNR	150458417	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	0.407000	0.21049	1.592000	0.50018	0.508000	0.49915	GGA	.		0.587	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
RFESD	317671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	94991955	94991955	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:94991955A>G	ENST00000311364.4	+	5	1833	c.416A>G	c.(415-417)aAg>aGg	p.K139R	RFESD_ENST00000458310.1_Missense_Mutation_p.K192R|RFESD_ENST00000380005.4_Missense_Mutation_p.K192R|SPATA9_ENST00000477047.2_Intron|RFESD_ENST00000513950.2_3'UTR	NM_173362.3	NP_775498.1	Q8TAC1	RFESD_HUMAN	Rieske (Fe-S) domain containing	139							2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			autonomic_ganglia(2)|endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	6		all_cancers(142;0.000215)|all_epithelial(76;7.43e-07)|all_lung(232;0.0318)|Lung NSC(167;0.041)|Ovarian(225;0.051)|Colorectal(57;0.162)		all cancers(79;5.94e-17)		GAACCTTTTAAGTGTGACTCT	0.338																																					p.K192R		.											.	.	.	0			c.A575G						.						66.0	76.0	72.0					5																	94991955		2203	4300	6503	SO:0001583	missense	317671	exon6			CTTTTAAGTGTGA	BC035110	CCDS4075.1, CCDS47248.1	5q15	2010-12-07			ENSG00000175449	ENSG00000175449			29587	protein-coding gene	gene with protein product						12477932	Standard	NM_173362		Approved		uc003klg.3	Q8TAC1	OTTHUMG00000121168	ENST00000311364.4:c.416A>G	5.37:g.94991955A>G	ENSP00000309229:p.Lys139Arg	Somatic	53	0		WXS	Illumina HiSeq	.	47	9	NM_001131066	J3KPH1	Missense_Mutation	SNP	ENST00000311364.4	37	CCDS4075.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.074668	0.36566	.	.	ENSG00000175449	ENST00000380005;ENST00000311364;ENST00000458310	.	.	.	5.44	1.81	0.25067	.	0.636591	0.17333	N	0.178042	T	0.37625	0.1010	N	0.21448	0.665	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07986	-1.0744	8	.	.	.	-0.9583	8.2467	0.31693	0.6213:0.0:0.3787:0.0	.	139	Q8TAC1	RFESD_HUMAN	R	192;139;192	.	.	K	+	2	0	RFESD	95017711	0.929000	0.31497	0.997000	0.53966	0.913000	0.54294	1.835000	0.39181	0.376000	0.24707	0.383000	0.25322	AAG	.		0.338	RFESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241654.1	NM_173362	
TSGA10	80705	hgsc.bcm.edu	37	2	99636892	99636892	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:99636892C>A	ENST00000393483.3	-	18	2512	c.1668G>T	c.(1666-1668)caG>caT	p.Q556H	TSGA10_ENST00000355053.4_Missense_Mutation_p.Q556H|TSGA10_ENST00000539964.1_Missense_Mutation_p.Q556H|TSGA10_ENST00000410001.1_Missense_Mutation_p.Q556H	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	556	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q556H(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CATTTGCCATCTGACTCCTCA	0.383																																					p.Q556H		.											TSGA10,NS,carcinoma,0,1	TSGA10	0	1	Substitution - Missense(1)	lung(1)	c.G1668T						.						62.0	62.0	62.0					2																	99636892		2203	4300	6503	SO:0001583	missense	80705	exon17			TGCCATCTGACTC	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1668G>T	2.37:g.99636892C>A	ENSP00000377123:p.Gln556His	Somatic	17	0		WXS	Illumina HiSeq	.	26	2	NM_182911	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349095	0.61183	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.78364	2.49;2.49;2.49;2.49;-1.17;2.49	5.49	2.64	0.31445	.	0.000000	0.64402	D	0.000001	T	0.80407	0.4617	L	0.43923	1.385	0.80722	D	1	D	0.64830	0.994	D	0.75484	0.986	T	0.76727	-0.2853	10	0.49607	T	0.09	-12.4125	7.0166	0.24890	0.0:0.5357:0.0:0.4643	.	556	Q9BZW7	TSG10_HUMAN	H	556;556;556;556;486;556	ENSP00000377123:Q556H;ENSP00000386956:Q556H;ENSP00000347161:Q556H;ENSP00000444419:Q556H;ENSP00000386508:Q486H;ENSP00000377122:Q556H	ENSP00000347161:Q556H	Q	-	3	2	TSGA10	99003324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.777000	0.26718	0.388000	0.25054	0.650000	0.86243	CAG	.		0.383	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
KCNB1	3745	hgsc.bcm.edu	37	20	47990628	47990628	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr20:47990628C>A	ENST00000371741.4	-	2	1635	c.1469G>T	c.(1468-1470)tGg>tTg	p.W490L		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	490					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	CCTCTTTGTCCATTTCCATTT	0.428																																					p.W490L		.											KCNB1,colon,carcinoma,0,1	KCNB1	0	0			c.G1469T						.						225.0	207.0	213.0					20																	47990628		2203	4300	6503	SO:0001583	missense	3745	exon2			TTTGTCCATTTCC	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1469G>T	20.37:g.47990628C>A	ENSP00000360806:p.Trp490Leu	Somatic	41	0		WXS	Illumina HiSeq	.	62	2	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.758679	0.69763	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.50548	0.74	6.07	6.07	0.98685	.	0.346395	0.30311	N	0.009919	T	0.54886	0.1886	M	0.71581	2.175	0.80722	D	1	P	0.44281	0.831	B	0.44315	0.446	T	0.48080	-0.9066	10	0.20046	T	0.44	.	20.2543	0.98414	0.0:1.0:0.0:0.0	.	490	Q14721	KCNB1_HUMAN	L	490;445	ENSP00000360806:W490L	ENSP00000360806:W490L	W	-	2	0	KCNB1	47424035	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.876000	0.63079	2.884000	0.98904	0.655000	0.94253	TGG	.		0.428	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
USP29	57663	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57642416	57642416	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:57642416C>A	ENST00000254181.4	+	4	2827	c.2373C>A	c.(2371-2373)aaC>aaA	p.N791K	USP29_ENST00000598197.1_Missense_Mutation_p.N791K	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	791	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTTCTGACAACCCAGGAAACA	0.468																																					p.N791K		.											.	.	.	0			c.C2373A						.						51.0	44.0	46.0					19																	57642416		2203	4300	6503	SO:0001583	missense	57663	exon4			TGACAACCCAGGA		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2373C>A	19.37:g.57642416C>A	ENSP00000254181:p.Asn791Lys	Somatic	54	0		WXS	Illumina HiSeq	.	46	5	NM_020903		Missense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	C	6.201	0.405285	0.11754	.	.	ENSG00000131864	ENST00000254181	T	0.74421	-0.84	1.51	0.458	0.16670	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.60650	0.2285	L	0.40543	1.245	0.09310	N	1	B	0.33171	0.4	B	0.34873	0.191	T	0.49725	-0.8909	9	0.35671	T	0.21	-2.2652	3.7552	0.08582	0.0:0.757:0.0:0.243	.	791	Q9HBJ7	UBP29_HUMAN	K	791	ENSP00000254181:N791K	ENSP00000254181:N791K	N	+	3	2	USP29	62334228	1.000000	0.71417	0.001000	0.08648	0.008000	0.06430	0.864000	0.27926	0.190000	0.20209	0.467000	0.42956	AAC	.		0.468	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54556494	54556494	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr15:54556494T>C	ENST00000260323.11	+	8	3577	c.3577T>C	c.(3577-3579)Ttt>Ctt	p.F1193L	UNC13C_ENST00000537900.1_Missense_Mutation_p.F1191L|UNC13C_ENST00000545554.1_Missense_Mutation_p.F1193L	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1193					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CCAGGAAATGTTTCAGATTTC	0.398																																					p.F1193L		.											.	.	.	0			c.T3577C						.						49.0	47.0	47.0					15																	54556494		1809	4064	5873	SO:0001583	missense	440279	exon7			GAAATGTTTCAGA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3577T>C	15.37:g.54556494T>C	ENSP00000260323:p.Phe1193Leu	Somatic	111	0		WXS	Illumina HiSeq	.	99	42	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	33	5.237662	0.95240	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.81163	-1.45;-1.46;-1.45	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.90058	0.6895	M	0.84585	2.705	0.58432	D	0.999998	P;D	0.69078	0.938;0.997	P;D	0.70716	0.804;0.97	D	0.91595	0.5290	10	0.72032	D	0.01	.	14.8873	0.70579	0.0:0.0:0.0:1.0	.	1193;1193	F5H090;Q8NB66	.;UN13C_HUMAN	L	1193;1193;1191	ENSP00000260323:F1193L;ENSP00000438156:F1193L;ENSP00000442569:F1191L	ENSP00000260323:F1193L	F	+	1	0	UNC13C	52343786	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.168000	0.68352	0.533000	0.62120	TTT	.		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651115	1651115	+	Silent	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:1651115A>G	ENST00000399676.2	+	1	83	c.45A>G	c.(43-45)ggA>ggG	p.G15G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	15						keratin filament (GO:0045095)		p.G15G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggccgtggct	0.692																																					p.G15G		.											KRTAP5-5,NS,carcinoma,0,1	KRTAP5-5	0	1	Substitution - coding silent(1)	endometrium(1)	c.A45G						.						28.0	34.0	32.0					11																	1651115		2115	4104	6219	SO:0001819	synonymous_variant	439915	exon1			CTGTGGAGGCCGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.45A>G	11.37:g.1651115A>G		Somatic	71	0		WXS	Illumina HiSeq	.	69	4	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
BNC1	646	hgsc.bcm.edu	37	15	83935682	83935682	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr15:83935682C>T	ENST00000345382.2	-	3	426	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.R107Q	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	114					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R114Q(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						ACTGAAGAGCCGGTCCAGTAG	0.502																																					p.R114Q		.											BNC1,NS,carcinoma,0,2	BNC1	0	1	Substitution - Missense(1)	kidney(1)	c.G341A						.						125.0	117.0	119.0					15																	83935682		2203	4300	6503	SO:0001583	missense	646	exon3			AAGAGCCGGTCCA	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.341G>A	15.37:g.83935682C>T	ENSP00000307041:p.Arg114Gln	Somatic	54	0		WXS	Illumina HiSeq	.	50	2	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	C	36	5.872996	0.97049	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03635	3.86	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.00036	-1.2257	10	0.87932	D	0	-26.078	19.614	0.95622	0.0:1.0:0.0:0.0	.	107;114	F5GY04;Q01954	.;BNC1_HUMAN	Q	114;107	ENSP00000307041:R114Q	ENSP00000307041:R114Q	R	-	2	0	BNC1	81726686	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.573000	0.82421	2.873000	0.98535	0.561000	0.74099	CGG	.		0.502	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
LRRCC1	85444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	86057705	86057705	+	Missense_Mutation	SNP	C	C	A	rs372350812		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:86057705C>A	ENST00000360375.3	+	19	3207	c.3058C>A	c.(3058-3060)Caa>Aaa	p.Q1020K	LRRCC1_ENST00000414626.2_Missense_Mutation_p.Q1000K	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	1020					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AAAAATTAAGCAACTTGCTTT	0.299																																					p.Q1020K		.											.	.	.	0			c.C3058A						.						55.0	52.0	53.0					8																	86057705		1809	4063	5872	SO:0001583	missense	85444	exon19			ATTAAGCAACTTG	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.3058C>A	8.37:g.86057705C>A	ENSP00000353538:p.Gln1020Lys	Somatic	68	0		WXS	Illumina HiSeq	.	172	103	NM_033402	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026513	0.54683	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.28069	1.63;1.63	5.12	5.12	0.69794	.	.	.	.	.	T	0.26159	0.0638	L	0.41236	1.265	0.40726	D	0.982703	P;B;B	0.39022	0.655;0.264;0.214	B;B;B	0.35039	0.194;0.077;0.056	T	0.04796	-1.0926	9	0.18710	T	0.47	-9.5736	18.7286	0.91724	0.0:1.0:0.0:0.0	.	1000;927;1020	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	K	1020;1000	ENSP00000353538:Q1020K;ENSP00000394695:Q1000K	ENSP00000353538:Q1020K	Q	+	1	0	LRRCC1	86244957	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.356000	0.52269	2.647000	0.89833	0.491000	0.48974	CAA	.		0.299	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
TRIM9	114088	hgsc.bcm.edu	37	14	51492033	51492033	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:51492033C>A	ENST00000298355.3	-	2	1989	c.868G>T	c.(868-870)Gaa>Taa	p.E290*	TRIM9_ENST00000360392.4_Nonsense_Mutation_p.E290*|TRIM9_ENST00000338969.5_Nonsense_Mutation_p.E290*	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	290					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TCCTTGGCTTCTTTGGCCCTG	0.532																																					p.E290X		.											.	.	.	0			c.G868T						.						208.0	180.0	189.0					14																	51492033		2203	4300	6503	SO:0001587	stop_gained	114088	exon2			TGGCTTCTTTGGC	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.868G>T	14.37:g.51492033C>A	ENSP00000298355:p.Glu290*	Somatic	60	0		WXS	Illumina HiSeq	.	62	4	NM_052978	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Nonsense_Mutation	SNP	ENST00000298355.3	37	CCDS9703.1	.	.	.	.	.	.	.	.	.	.	C	48	14.652988	0.99804	.	.	ENSG00000100505	ENST00000298355;ENST00000338969;ENST00000360392	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	19.5705	0.95413	0.0:1.0:0.0:0.0	.	.	.	.	X	290	.	ENSP00000298355:E290X	E	-	1	0	TRIM9	50561783	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.436000	0.80404	2.941000	0.99782	0.655000	0.94253	GAA	.		0.532	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276874.1	NM_015163	
ZBTB24	9841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	109787628	109787628	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:109787628G>A	ENST00000230122.3	-	7	1687	c.1520C>T	c.(1519-1521)gCt>gTt	p.A507V	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	507					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TTTCAAGTGAGCCTTCAAGTT	0.453																																					p.A507V		.											.	.	.	0			c.C1520T						.						104.0	100.0	101.0					6																	109787628		2203	4300	6503	SO:0001583	missense	9841	exon7			AAGTGAGCCTTCA	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1520C>T	6.37:g.109787628G>A	ENSP00000230122:p.Ala507Val	Somatic	38	0		WXS	Illumina HiSeq	.	47	8	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	37	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536330	0.65085	.	.	ENSG00000112365	ENST00000230122	T	0.27557	1.66	6.06	6.06	0.98353	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.161489	0.56097	D	0.000033	T	0.10508	0.0257	L	0.27053	0.805	0.42283	D	0.992104	P	0.48911	0.917	B	0.30716	0.119	T	0.09292	-1.0681	10	0.18710	T	0.47	-18.695	20.6208	0.99490	0.0:0.0:1.0:0.0	.	507	O43167	ZBT24_HUMAN	V	507	ENSP00000230122:A507V	ENSP00000230122:A507V	A	-	2	0	ZBTB24	109894321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.329000	0.65892	2.882000	0.98803	0.655000	0.94253	GCT	.		0.453	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
LMNA	4000	hgsc.bcm.edu;broad.mit.edu	37	1	156106775	156106775	+	Missense_Mutation	SNP	C	C	T	rs57920071		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:156106775C>T	ENST00000368300.4	+	8	1656	c.1444C>T	c.(1444-1446)Cgg>Tgg	p.R482W	LMNA_ENST00000361308.4_Missense_Mutation_p.R482W|LMNA_ENST00000368299.3_Missense_Mutation_p.R482W|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Missense_Mutation_p.R383W|LMNA_ENST00000347559.2_Missense_Mutation_p.R482W|LMNA_ENST00000448611.2_Missense_Mutation_p.R370W|LMNA_ENST00000392353.3_Missense_Mutation_p.R401W|LMNA_ENST00000368297.1_Missense_Mutation_p.R401W|LMNA_ENST00000368301.2_Missense_Mutation_p.R482W	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	482	LTD.|Tail.		R -> L (in FPLD2). {ECO:0000269|PubMed:10655060}.|R -> Q (in FPLD2; interacts with itself and with wild-type LMNA and LMNB1; no decrease in the stability compared with wild-type; dbSNP:rs11575937). {ECO:0000269|PubMed:10587585, ECO:0000269|PubMed:10739751}.|R -> W (in FPLD2; interacts with itself and with wild-type LMNA and LMNB1; no decrease in the stability compared with wild-type; decreases binding affinity for DNA; increases sensitivity to oxidative stress). {ECO:0000269|PubMed:10655060, ECO:0000269|PubMed:10739751}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)	p.R482W(1)		NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					GCTGACTTACCGGTTCCCACC	0.617									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.R482W		.											LMNA,NS,carcinoma,0,1	LMNA	0	1	Substitution - Missense(1)	kidney(1)	c.C1444T	GRCh37	CM000520	LMNA	M	rs57920071	.						55.0	53.0	53.0					1																	156106775		2203	4300	6503	SO:0001583	missense	4000	exon8	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	ACTTACCGGTTCC	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1444C>T	1.37:g.156106775C>T	ENSP00000357283:p.Arg482Trp	Somatic	35	0		WXS	Illumina HiSeq	.	52	3	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	ENST00000368300.4	37	CCDS1129.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416421	0.83449	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000448611;ENST00000368297;ENST00000473598;ENST00000392353;ENST00000508500	D;D;D;D;D;D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91	5.4	4.46	0.54185	Intermediate filament, C-terminal (1);	0.000000	0.50627	D	0.000101	D	0.97164	0.9073	L	0.41492	1.28	0.51012	A	0.999907	D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.997;0.998;0.999;0.997;0.999;0.998	D;D;P;D;P;P;P;P	0.63957	0.92;0.914;0.832;0.914;0.867;0.832;0.791;0.741	D	0.98132	1.0431	9	0.87932	D	0	.	10.8566	0.46802	0.3429:0.6571:0.0:0.0	rs57920071	138;370;482;383;401;482;482;482	B4DFR3;E7EUI9;Q6UYC3;D6RAQ3;Q5TCI8;P02545;P02545-3;P02545-2	.;.;.;.;.;LMNA_HUMAN;.;.	W	482;482;482;482;482;370;401;383;401;108	ENSP00000357284:R482W;ENSP00000292304:R482W;ENSP00000355292:R482W;ENSP00000357283:R482W;ENSP00000357282:R482W;ENSP00000395597:R370W;ENSP00000357280:R401W;ENSP00000421821:R383W;ENSP00000376164:R401W;ENSP00000424977:R108W	ENSP00000292304:R482W	R	+	1	2	LMNA	154373399	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.923000	0.56469	1.438000	0.47492	0.655000	0.94253	CGG	.		0.617	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
PCDHGA3	56112	hgsc.bcm.edu	37	5	140725274	140725274	+	Silent	SNP	C	C	T	rs200612120		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:140725274C>T	ENST00000253812.6	+	1	1674	c.1674C>T	c.(1672-1674)aaC>aaT	p.N558N	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCCGAGA	0.632																																					p.N558N		.											PCDHGA3_ENST00000253812,NS,carcinoma,0,3	PCDHGA3_ENST00000253812	0	0			c.C1674T						.						129.0	141.0	137.0					5																	140725274		2203	4300	6503	SO:0001819	synonymous_variant	56112	exon1			CGACAACGCGCCC	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1674C>T	5.37:g.140725274C>T		Somatic	59	2		WXS	Illumina HiSeq	.	45	3	NM_032011	Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			0.001		0.632	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
BEND7	222389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13541852	13541852	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr10:13541852C>G	ENST00000396900.2	-	3	373	c.374G>C	c.(373-375)gGa>gCa	p.G125A	BEND7_ENST00000341083.3_Missense_Mutation_p.G73A|BEND7_ENST00000378605.3_Missense_Mutation_p.G73A|BEND7_ENST00000396898.2_Missense_Mutation_p.G125A			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	125						extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						TGAGAACTGTCCACTCTGGGG	0.552																																					p.G73A		.											.	.	.	0			c.G218C						.						84.0	88.0	86.0					10																	13541852		2203	4300	6503	SO:0001583	missense	222389	exon2			AACTGTCCACTCT	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.374G>C	10.37:g.13541852C>G	ENSP00000380108:p.Gly125Ala	Somatic	51	0		WXS	Illumina HiSeq	.	43	16	NM_001100912	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	ENST00000396900.2	37		.	.	.	.	.	.	.	.	.	.	C	14.51	2.558132	0.45590	.	.	ENSG00000165626	ENST00000396900;ENST00000341083;ENST00000396898;ENST00000378605	T;T;T;T	0.52057	0.68;0.68;0.71;0.71	6.0	5.1	0.69264	.	0.412825	0.29493	N	0.011989	T	0.40119	0.1104	L	0.50333	1.59	0.25448	N	0.988031	B;B	0.33171	0.044;0.4	B;B	0.30855	0.024;0.121	T	0.44667	-0.9313	10	0.66056	D	0.02	-8.6725	8.8138	0.34983	0.0:0.7425:0.1238:0.1337	.	125;73	E5RFC0;Q8N7W2-3	.;.	A	125;73;125;73	ENSP00000380108:G125A;ENSP00000345773:G73A;ENSP00000380107:G125A;ENSP00000367868:G73A	ENSP00000345773:G73A	G	-	2	0	BEND7	13581858	0.986000	0.35501	0.989000	0.46669	0.940000	0.58332	1.512000	0.35812	1.552000	0.49463	0.650000	0.86243	GGA	.		0.552	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
EDNRB	1910	hgsc.bcm.edu	37	13	78492579	78492579	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:78492579C>A	ENST00000334286.5	-	1	366	c.130G>T	c.(130-132)Gag>Tag	p.E44*	EDNRB_ENST00000377211.4_Nonsense_Mutation_p.E134*|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Nonsense_Mutation_p.E44*|EDNRB_ENST00000475537.1_5'UTR	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	44					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GTCATTATCTCTGCGGTTTGC	0.627																																					p.E134X		.											EDNRB_ENST00000446573,NS,malignant_melanoma,0,3	EDNRB_ENST00000446573	0	0			c.G400T						.						67.0	71.0	70.0					13																	78492579		2203	4300	6503	SO:0001587	stop_gained	1910	exon2			TTATCTCTGCGGT	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.130G>T	13.37:g.78492579C>A	ENSP00000335311:p.Glu44*	Somatic	49	0		WXS	Illumina HiSeq	.	43	3	NM_001201397	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Nonsense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718668	0.89205	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	.	.	.	4.04	3.19	0.36642	.	0.471479	0.23273	N	0.049995	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-9.2155	7.7686	0.28995	0.0:0.8831:0.0:0.1169	.	.	.	.	X	134;44;44	.	ENSP00000335311:E44X	E	-	1	0	EDNRB	77390580	0.017000	0.18338	0.170000	0.22879	0.541000	0.35023	1.191000	0.32138	1.041000	0.40125	0.591000	0.81541	GAG	.		0.627	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
ABCA13	154664	hgsc.bcm.edu	37	7	48284188	48284188	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:48284188G>T	ENST00000435803.1	+	11	1302	c.1278G>T	c.(1276-1278)tgG>tgT	p.W426C		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	426					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.W426*(1)|p.W371*(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AGCATCTGTGGAAATTGCAAA	0.393																																					p.W426C		.											ABCA13,bladder,carcinoma,0,1	ABCA13	0	2	Substitution - Nonsense(2)	urinary_tract(2)	c.G1278T						.						49.0	47.0	48.0					7																	48284188		1817	4075	5892	SO:0001583	missense	154664	exon11			TCTGTGGAAATTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1278G>T	7.37:g.48284188G>T	ENSP00000411096:p.Trp426Cys	Somatic	39	0		WXS	Illumina HiSeq	.	43	2	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	3.609	-0.079950	0.07141	.	.	ENSG00000179869	ENST00000435803	D	0.88741	-2.42	5.05	2.9	0.33743	.	2.188540	0.02025	N	0.048069	T	0.79281	0.4419	N	0.08118	0	0.09310	N	0.999996	B	0.27679	0.185	B	0.28232	0.087	T	0.70547	-0.4842	10	0.59425	D	0.04	.	3.8381	0.08903	0.1632:0.2749:0.5619:0.0	.	426	Q86UQ4	ABCAD_HUMAN	C	426	ENSP00000411096:W426C	ENSP00000411096:W426C	W	+	3	0	ABCA13	48254734	0.037000	0.19845	0.004000	0.12327	0.458000	0.32498	0.997000	0.29731	1.072000	0.40860	0.650000	0.86243	TGG	.		0.393	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZCWPW2	152098	hgsc.bcm.edu	37	3	28562602	28562602	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:28562602G>T	ENST00000383768.2	+	9	1092	c.904G>T	c.(904-906)Gaa>Taa	p.E302*	ZCWPW2_ENST00000421010.1_Nonsense_Mutation_p.E302*			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	302							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						AAATATGGGAGAAAAGGTAAT	0.338																																					p.E302X		.											ZCWPW2,caecum,carcinoma,0,1	ZCWPW2	0	0			c.G904T						.						64.0	60.0	61.0					3																	28562602		2203	4300	6503	SO:0001587	stop_gained	152098	exon8			ATGGGAGAAAAGG	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.904G>T	3.37:g.28562602G>T	ENSP00000373278:p.Glu302*	Somatic	61	0		WXS	Illumina HiSeq	.	39	2	NM_001040432		Nonsense_Mutation	SNP	ENST00000383768.2	37	CCDS33723.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.54|16.54|16.54	3.152894|3.152894|3.152894	0.57259|0.57259|0.57259	.|.|.	.|.|.	ENSG00000206559|ENSG00000206559|ENSG00000206559	ENST00000457897|ENST00000383768;ENST00000421010|ENST00000419130	.|.|.	.|.|.	.|.|.	5.25|5.25|5.25	2.45|2.45|2.45	0.29901|0.29901|0.29901	.|.|.	0.356262|0.356262|.	0.24461|0.24461|.	N|N|.	0.038338|0.038338|.	T|.|T	0.55321|.|0.55321	0.1913|.|0.1913	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|.|T	0.50701|.|0.50701	-0.8797|.|-0.8797	5|.|4	.|0.14252|.	.|T|.	.|0.57|.	-8.0918|-8.0918|-8.0918	7.0682|7.0682|7.0682	0.25164|0.25164|0.25164	0.269:0.0:0.731:0.0|0.269:0.0:0.731:0.0|0.269:0.0:0.731:0.0	.|.|.	.|.|.	.|.|.	.|.|.	D|X|I	124|302|186	.|.|.	.|ENSP00000373278:E302X|.	E|E|R	+|+|+	3|1|2	2|0|0	ZCWPW2|ZCWPW2|ZCWPW2	28537606|28537606|28537606	0.435000|0.435000|0.435000	0.25577|0.25577|0.25577	0.888000|0.888000|0.888000	0.34837|0.34837|0.34837	0.630000|0.630000|0.630000	0.37929|0.37929|0.37929	0.994000|0.994000|0.994000	0.29693|0.29693|0.29693	1.203000|1.203000|1.203000	0.43233|0.43233|0.43233	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|GAA|AGA	.		0.338	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
NT5DC2	64943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52561903	52561903	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:52561903G>A	ENST00000307076.4	-	8	1166	c.766C>T	c.(766-768)Cgc>Tgc	p.R256C	NT5DC2_ENST00000422318.2_Missense_Mutation_p.R293C|NT5DC2_ENST00000307092.4_Missense_Mutation_p.R197C|NT5DC2_ENST00000490681.1_5'Flank|NT5DC2_ENST00000459839.1_Missense_Mutation_p.R268C	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	256							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		GCCACCAGGCGGCTCAGGACA	0.597																																					p.R293C		.											.	.	.	0			c.C877T						.						96.0	86.0	89.0					3																	52561903		2203	4300	6503	SO:0001583	missense	64943	exon8			CCAGGCGGCTCAG	AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.766C>T	3.37:g.52561903G>A	ENSP00000302468:p.Arg256Cys	Somatic	38	0		WXS	Illumina HiSeq	.	16	4	NM_001134231	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	ENST00000307076.4	37	CCDS2858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.01|15.01	2.705577|2.705577	0.48412|0.48412	.|.	.|.	ENSG00000168268|ENSG00000168268	ENST00000489316|ENST00000307092;ENST00000307076;ENST00000422318;ENST00000459839	.|T;T;T;T	.|0.25250	.|1.81;1.81;1.81;1.81	4.73|4.73	4.73|4.73	0.59995|0.59995	.|HAD-like domain (2);	.|0.059165	.|0.64402	.|D	.|0.000003	T|T	0.55049|0.55049	0.1896|0.1896	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.74023	.|0.982;0.973;0.973	T|T	0.63726|0.63726	-0.6572|-0.6572	5|10	.|0.87932	.|D	.|0	-28.249|-28.249	12.2441|12.2441	0.54560|0.54560	0.0:0.0:0.7012:0.2988|0.0:0.0:0.7012:0.2988	.|.	.|268;256;293	.|C9JTZ6;Q9H857;E9PAL9	.|.;NT5D2_HUMAN;.	L|C	177|197;256;293;268	.|ENSP00000306017:R197C;ENSP00000302468:R256C;ENSP00000406933:R293C;ENSP00000419547:R268C	.|ENSP00000302468:R256C	P|R	-|-	2|1	0|0	NT5DC2|NT5DC2	52536943|52536943	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.546000|0.546000	0.35178|0.35178	2.765000|2.765000	0.47621|0.47621	2.189000|2.189000	0.69895|0.69895	0.313000|0.313000	0.20887|0.20887	CCG|CGC	.		0.597	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000351509.1	NM_022908	
PRKD1	5587	hgsc.bcm.edu	37	14	30100276	30100276	+	Intron	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:30100276C>T	ENST00000331968.5	-	10	1622				PRKD1_ENST00000415220.2_Intron	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AGTATGTAAACTTTCAAAGAA	0.279																																					.		.											.	.	.	0			.						.						17.0	18.0	18.0					14																	30100276		2160	4278	6438	SO:0001627	intron_variant	100616347	.			TGTAAACTTTCAA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1393-49G>A	14.37:g.30100276C>T		Somatic	62	0		WXS	Illumina HiSeq	.	92	4	.	A6NL64|B2RAF6	RNA	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																			.		0.279	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
LRBA	987	hgsc.bcm.edu	37	4	151242369	151242369	+	Missense_Mutation	SNP	G	G	A	rs377257515		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:151242369G>A	ENST00000357115.3	-	51	7880	c.7637C>T	c.(7636-7638)gCg>gTg	p.A2546V	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.A2535V|LRBA_ENST00000510413.1_Missense_Mutation_p.A2535V|LRBA_ENST00000507224.1_Missense_Mutation_p.A2535V	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2546						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTTGTTCACCGCAAATAACCT	0.453																																					p.A2546V		.											LRBA,colon,carcinoma,0,1	LRBA	0	0			c.C7637T						.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	159.0	144.0	149.0		7637,7637	6.1	1.0	4		149	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LRBA	NM_001199282.2,NM_006726.4	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	2546/2864,2546/2864	151242369	1,13005	2203	4300	6503	SO:0001583	missense	987	exon51			TTCACCGCAAATA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7637C>T	4.37:g.151242369G>A	ENSP00000349629:p.Ala2546Val	Somatic	51	0		WXS	Illumina HiSeq	.	56	3	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.120134|4.120134	0.77323|0.77323	0.0|0.0	1.16E-4|1.16E-4	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.73152|.	-0.72;-0.72;-0.72;-0.72|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.058195|.	0.64402|.	D|.	0.000002|.	T|T	0.75265|0.75265	0.3826|0.3826	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.89917|.	1.0;0.999;0.773;0.995|.	D;D;B;P|.	0.71656|.	0.971;0.974;0.324;0.645|.	T|T	0.70350|0.70350	-0.4896|-0.4896	10|5	0.49607|.	T|.	0.09|.	.|.	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2546;2535;2535;441|.	P50851;F5H1X8;P50851-2;Q68D03|.	LRBA_HUMAN;.;.;.|.	V|W	2535;2535;2546;2535|1188	ENSP00000446299:A2535V;ENSP00000421552:A2535V;ENSP00000349629:A2546V;ENSP00000422180:A2535V|.	ENSP00000349629:A2546V|.	A|R	-|-	2|1	0|2	LRBA|LRBA	151461819|151461819	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.721000|0.721000	0.41392|0.41392	9.807000|9.807000	0.99171|0.99171	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GCG|CGG	.		0.453	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
NAE1	8883	hgsc.bcm.edu	37	16	66839907	66839907	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:66839907T>A	ENST00000290810.3	-	18	1450	c.1353A>T	c.(1351-1353)gaA>gaT	p.E451D	NAE1_ENST00000379463.2_Missense_Mutation_p.E445D|NAE1_ENST00000394074.2_Missense_Mutation_p.E362D|NAE1_ENST00000359087.4_Missense_Mutation_p.E454D			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	451					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	CTATATCTTCTTCAACTTGAT	0.303																																					p.E451D		.											.	.	.	0			c.A1353T						.						77.0	72.0	74.0					16																	66839907		2200	4300	6500	SO:0001583	missense	8883	exon18			ATCTTCTTCAACT	U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.1353A>T	16.37:g.66839907T>A	ENSP00000290810:p.Glu451Asp	Somatic	60	0		WXS	Illumina HiSeq	.	104	2	NM_003905	A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Missense_Mutation	SNP	ENST00000290810.3	37	CCDS10820.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.334093	0.41297	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463;ENST00000394074	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.78	5.78	0.91487	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.34483	0.0899	L	0.46614	1.455	0.80722	D	1	B;B;B	0.15719	0.0;0.007;0.014	B;B;B	0.23574	0.004;0.021;0.047	T	0.18023	-1.0350	10	0.21014	T	0.42	-23.2553	8.4916	0.33104	0.0:0.1439:0.0:0.8561	.	454;451;445	A6NCK0;Q13564;A6NFN4	.;ULA1_HUMAN;.	D	454;451;445;362	ENSP00000351990:E454D;ENSP00000290810:E451D;ENSP00000368776:E445D;ENSP00000377637:E362D	ENSP00000290810:E451D	E	-	3	2	NAE1	65397408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.773000	0.47686	2.212000	0.71576	0.523000	0.50628	GAA	.		0.303	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268832.1	NM_003905	
NAV1	89796	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	201618049	201618049	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:201618049C>G	ENST00000367296.4	+	1	673	c.253C>G	c.(253-255)Ctg>Gtg	p.L85V	NAV1_ENST00000295624.6_Missense_Mutation_p.L85V|NAV1_ENST00000367300.3_Missense_Mutation_p.L85V|NAV1_ENST00000367302.1_Missense_Mutation_p.L98V|NAV1_ENST00000367297.4_Missense_Mutation_p.L85V	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	85					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CGCCTCCAACCTGCGCAAGCA	0.642																																					p.L85V		.											.	.	.	0			c.C253G						.						24.0	27.0	26.0					1																	201618049		2199	4299	6498	SO:0001583	missense	89796	exon1			TCCAACCTGCGCA	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.253C>G	1.37:g.201618049C>G	ENSP00000356265:p.Leu85Val	Somatic	45	0		WXS	Illumina HiSeq	.	36	12	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508591	0.64410	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	4.89	3.0	0.34707	.	0.000000	0.64402	D	0.000018	T	0.38825	0.1055	L	0.59436	1.845	0.36091	D	0.843488	B	0.12013	0.005	B	0.17433	0.018	T	0.43556	-0.9384	10	0.87932	D	0	-8.9877	10.2403	0.43308	0.0:0.7879:0.1359:0.0763	.	85	Q8NEY1-3	.	V	98;85;85;85;85	ENSP00000356271:L98V;ENSP00000356265:L85V;ENSP00000295624:L85V;ENSP00000356266:L85V;ENSP00000356269:L85V	ENSP00000295624:L85V	L	+	1	2	NAV1	199884672	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	4.836000	0.62789	0.462000	0.27095	0.313000	0.20887	CTG	.		0.642	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
B3GNT2	10678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	62449365	62449365	+	Missense_Mutation	SNP	G	G	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:62449365G>C	ENST00000301998.4	+	2	262	c.10G>C	c.(10-12)Gga>Cga	p.G4R	B3GNT2_ENST00000405767.1_Missense_Mutation_p.G4R	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	4					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			AATGAGTGTTGGACGTCGAAG	0.353																																					p.G4R		.											.	.	.	0			c.G10C						.						71.0	70.0	70.0					2																	62449365		2203	4300	6503	SO:0001583	missense	10678	exon2			AGTGTTGGACGTC	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.10G>C	2.37:g.62449365G>C	ENSP00000305595:p.Gly4Arg	Somatic	35	0		WXS	Illumina HiSeq	.	34	12	NM_006577	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	ENST00000301998.4	37	CCDS1870.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.992413	0.74703	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.28255	1.62;1.62	6.02	6.02	0.97574	.	0.382752	0.29631	N	0.011611	T	0.43366	0.1244	M	0.68317	2.08	0.80722	D	1	D	0.56035	0.974	P	0.46585	0.521	T	0.26018	-1.0115	10	0.46703	T	0.11	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	4	Q9NY97	B3GN2_HUMAN	R	4	ENSP00000305595:G4R;ENSP00000384692:G4R	ENSP00000305595:G4R	G	+	1	0	B3GNT2	62302869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.939000	0.87685	2.865000	0.98341	0.655000	0.94253	GGA	.		0.353	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251606.2	NM_006577	
CPNE1	8904	hgsc.bcm.edu	37	20	34215234	34215234	+	Missense_Mutation	SNP	C	C	A	rs147019139|rs76294482	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr20:34215234C>A	ENST00000317619.3	-	16	1598	c.1204G>T	c.(1204-1206)Gca>Tca	p.A402S	CPNE1_ENST00000397442.1_Missense_Mutation_p.A402S|CPNE1_ENST00000397446.1_Missense_Mutation_p.A402S|CPNE1_ENST00000352393.4_Missense_Mutation_p.A402S|CPNE1_ENST00000397443.1_Missense_Mutation_p.A402S|CPNE1_ENST00000317677.5_Missense_Mutation_p.A407S|CPNE1_ENST00000397445.1_Missense_Mutation_p.A402S			Q99829	CPNE1_HUMAN	copine I	402	VWFA.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A402fs*21(1)		breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GCCTGGGCTGCAAACCTGGCC	0.587																																					p.A407S		.											.,1	.	44	1	Insertion - Frameshift(1)	ovary(1)	c.G1219T						.						102.0	87.0	92.0					20																	34215234		2203	4300	6503	SO:0001583	missense	8904	exon14			GGGCTGCAAACCT	U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.1204G>T	20.37:g.34215234C>A	ENSP00000326126:p.Ala402Ser	Somatic	39	0		WXS	Illumina HiSeq	.	45	4	NM_003915	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Missense_Mutation	SNP	ENST00000317619.3	37	CCDS13260.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.387247|5.387247	0.95988|0.95988	.|.	.|.	ENSG00000214078|ENSG00000214078	ENST00000352393;ENST00000317677;ENST00000317619;ENST00000397446;ENST00000397445;ENST00000397443;ENST00000397442;ENST00000437340;ENST00000430570|ENST00000415920	T;T;T;T;T;T;T;T;T|.	0.27557|.	1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66|.	5.06|5.06	5.06|5.06	0.68205|0.68205	von Willebrand factor, type A (1);Copine (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	D|D	0.82834|0.82834	0.5123|0.5123	M|M	0.87180|0.87180	2.865|2.865	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.89917|.	0.999;0.995;0.998;1.0;1.0|.	D;D;D;D;D|.	0.91635|.	0.981;0.977;0.992;0.999;0.999|.	D|D	0.85135|0.85135	0.0977|0.0977	10|5	0.72032|.	D|.	0.01|.	-17.6519|-17.6519	17.3695|17.3695	0.87372|0.87372	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	407;402;402;382;402|.	B0QZ18;A6PVH9;Q99829;Q59EI4;F2Z2V0|.	.;.;CPNE1_HUMAN;.;.|.	S|F	402;407;402;402;402;402;402;402;378|40	ENSP00000336945:A402S;ENSP00000317257:A407S;ENSP00000326126:A402S;ENSP00000380588:A402S;ENSP00000380587:A402S;ENSP00000380585:A402S;ENSP00000380584:A402S;ENSP00000415597:A402S;ENSP00000390626:A378S|.	ENSP00000326126:A402S|.	A|L	-|-	1|3	0|2	CPNE1|CPNE1	33678648|33678648	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.807000|4.807000	0.62576|0.62576	2.627000|2.627000	0.88993|0.88993	0.563000|0.563000	0.77884|0.77884	GCA|TTG	.		0.587	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078909.3	NM_152930	
FAM184A	79632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	119295656	119295656	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:119295656A>G	ENST00000338891.7	-	14	3295	c.2852T>C	c.(2851-2853)aTg>aCg	p.M951T	FAM184A_ENST00000368475.4_Intron|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Intron|FAM184A_ENST00000521531.1_Intron	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	951						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						ATCTGCCCGCATGATATTTTT	0.338																																					p.M951T		.											.	.	.	0			c.T2852C						.						259.0	246.0	250.0					6																	119295656		1810	4081	5891	SO:0001583	missense	79632	exon14			GCCCGCATGATAT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2852T>C	6.37:g.119295656A>G	ENSP00000342604:p.Met951Thr	Somatic	57	0		WXS	Illumina HiSeq	.	49	7	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089806	0.55968	.	.	ENSG00000111879	ENST00000521043;ENST00000338891;ENST00000368472	T;T	0.52057	2.13;0.68	5.4	5.4	0.78164	.	0.042989	0.85682	D	0.000000	T	0.36880	0.0983	M	0.76574	2.34	0.80722	D	1	P	0.37276	0.589	B	0.32805	0.153	T	0.49916	-0.8888	10	0.66056	D	0.02	-8.8095	15.713	0.77646	1.0:0.0:0.0:0.0	.	951	Q8NB25	F184A_HUMAN	T	114;951;12	ENSP00000342604:M951T;ENSP00000357457:M12T	ENSP00000342604:M951T	M	-	2	0	FAM184A	119337355	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.640000	0.91028	2.178000	0.69098	0.477000	0.44152	ATG	.		0.338	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
XPOT	11260	hgsc.bcm.edu	37	12	64823857	64823857	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:64823857G>T	ENST00000332707.5	+	17	2295	c.1766G>T	c.(1765-1767)aGc>aTc	p.S589I		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	589	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.S589N(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTACTGAGCAGCGATGATCAA	0.363																																					p.S589I		.											XPOT,caecum,carcinoma,-1,1	XPOT	-1	1	Substitution - Missense(1)	breast(1)	c.G1766T						.						74.0	72.0	72.0					12																	64823857		2203	4300	6503	SO:0001583	missense	11260	exon17			TGAGCAGCGATGA	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.1766G>T	12.37:g.64823857G>T	ENSP00000327821:p.Ser589Ile	Somatic	51	0		WXS	Illumina HiSeq	.	41	2	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.897324	0.52121	.	.	ENSG00000184575	ENST00000332707;ENST00000538086	T;T	0.51817	0.69;1.48	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.039754	0.85682	D	0.000000	T	0.44540	0.1298	L	0.54323	1.7	0.80722	D	1	P	0.36110	0.537	B	0.31686	0.134	T	0.37150	-0.9718	9	.	.	.	.	19.2838	0.94063	0.0:0.0:1.0:0.0	.	589	O43592	XPOT_HUMAN	I	589;111	ENSP00000327821:S589I;ENSP00000444345:S111I	.	S	+	2	0	XPOT	63110124	1.000000	0.71417	0.999000	0.59377	0.828000	0.46876	9.331000	0.96430	2.646000	0.89796	0.650000	0.86243	AGC	.		0.363	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
APOBEC4	403314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	183617622	183617622	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:183617622A>T	ENST00000308641.4	-	2	566	c.295T>A	c.(295-297)Ttt>Att	p.F99I	RGL1_ENST00000536277.1_Intron|APOBEC4_ENST00000481562.1_Intron|RGL1_ENST00000304685.4_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	99					mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						TTCATTTCAAAGAGCATTGAT	0.398																																					p.F99I		.											.	.	.	0			c.T295A						.						149.0	147.0	148.0					1																	183617622		2203	4300	6503	SO:0001583	missense	403314	exon2			TTTCAAAGAGCAT	BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.295T>A	1.37:g.183617622A>T	ENSP00000310622:p.Phe99Ile	Somatic	37	0		WXS	Illumina HiSeq	.	39	5	NM_203454	Q8N7F6	Missense_Mutation	SNP	ENST00000308641.4	37	CCDS1358.1	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619574	0.46736	.	.	ENSG00000173627	ENST00000308641	T	0.63744	-0.06	5.28	5.28	0.74379	APOBEC-like, N-terminal (1);	0.096682	0.44688	D	0.000423	T	0.69691	0.3139	L	0.34521	1.04	0.42513	D	0.992975	D	0.76494	0.999	D	0.75484	0.986	T	0.70898	-0.4747	10	0.44086	T	0.13	-16.8727	14.8743	0.70483	1.0:0.0:0.0:0.0	.	99	Q8WW27	ABEC4_HUMAN	I	99	ENSP00000310622:F99I	ENSP00000310622:F99I	F	-	1	0	APOBEC4	181884245	0.997000	0.39634	0.527000	0.27925	0.069000	0.16628	4.379000	0.59575	1.996000	0.58369	0.533000	0.62120	TTT	.		0.398	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086126.1	NM_203454	
POM121	9883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	72416719	72416719	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:72416719C>T	ENST00000434423.2	+	13	3696	c.3696C>T	c.(3694-3696)acC>acT	p.T1232T	POM121_ENST00000446813.1_Intron|POM121_ENST00000358357.3_Silent_p.T967T|POM121_ENST00000257622.4_Silent_p.T967T|NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000395270.1_Intron			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1232	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GATCCAAGACCCCAGGGGCTC	0.582																																					p.T967T		.											.	.	.	0			c.C2901T						.						49.0	54.0	52.0					7																	72416719		2203	4300	6503	SO:0001819	synonymous_variant	9883	exon13			CAAGACCCCAGGG	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3696C>T	7.37:g.72416719C>T		Somatic	120	0		WXS	Illumina HiSeq	.	100	42	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	ENST00000434423.2	37																																																																																				.		0.582	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
PLXNA4	91584	hgsc.bcm.edu	37	7	132174138	132174138	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:132174138G>T	ENST00000359827.3	-	3	2246	c.1284C>A	c.(1282-1284)gaC>gaA	p.D428E	PLXNA4_ENST00000423507.2_Missense_Mutation_p.D428E|PLXNA4_ENST00000321063.4_Missense_Mutation_p.D428E|PLXNA4_ENST00000378539.5_Missense_Mutation_p.D428E			Q9HCM2	PLXA4_HUMAN	plexin A4	428	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.D428D(4)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGCGGTCCCTGTCCTCCGTGA	0.527																																					p.D428E		.											PLXNA4_ENST00000423507,NS,carcinoma,0,7	PLXNA4_ENST00000423507	0	4	Substitution - coding silent(4)	endometrium(4)	c.C1284A						.						121.0	98.0	106.0					7																	132174138		2203	4300	6503	SO:0001583	missense	91584	exon3			GTCCCTGTCCTCC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1284C>A	7.37:g.132174138G>T	ENSP00000352882:p.Asp428Glu	Somatic	36	0		WXS	Illumina HiSeq	.	30	2	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413528	0.25465	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.22	5.22	0.72569	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.182932	0.32314	U	0.006263	T	0.06781	0.0173	N	0.11927	0.2	0.39256	D	0.964124	B;B;B	0.25667	0.051;0.126;0.131	B;B;B	0.34991	0.085;0.193;0.103	T	0.12293	-1.0553	10	0.02654	T	1	.	12.7152	0.57111	0.0848:0.0:0.9152:0.0	.	428;428;428	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	E	428	ENSP00000323194:D428E;ENSP00000352882:D428E;ENSP00000392772:D428E;ENSP00000367800:D428E	ENSP00000323194:D428E	D	-	3	2	PLXNA4	131824678	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.165000	0.42396	2.712000	0.92718	0.650000	0.86243	GAC	.		0.527	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CAD	790	hgsc.bcm.edu	37	2	27464966	27464966	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:27464966G>T	ENST00000403525.1	+	38	6026	c.5882G>T	c.(5881-5883)cGg>cTg	p.R1961L	CAD_ENST00000264705.4_Missense_Mutation_p.R2024L			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCGTGCTCCGGCACCCCCAG	0.627																																					p.R2024L		.											CAD,colon,carcinoma,0,1	CAD	0	0			c.G6071T						.						28.0	27.0	28.0					2																	27464966		2203	4298	6501	SO:0001583	missense	790	exon39			TGCTCCGGCACCC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.5882G>T	2.37:g.27464966G>T	ENSP00000384510:p.Arg1961Leu	Somatic	19	0		WXS	Illumina HiSeq	.	19	2	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.447791|5.447791	0.96205|0.96205	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000428460|ENST00000264705;ENST00000403525	.|D;D	.|0.99961	.|-9.33;-9.33	5.2|5.2	5.2|5.2	0.72013|0.72013	.|Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99977|0.99977	0.9993|0.9993	H|H	0.99806|0.99806	4.795|4.795	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.997	.|D;D	.|0.97110	.|1.0;0.995	D|D	0.98166|0.98166	1.0449|1.0449	5|10	.|0.87932	.|D	.|0	-12.5231|-12.5231	17.3144|17.3144	0.87218|0.87218	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1961;2024	.|F8VPD4;P27708	.|.;PYR1_HUMAN	C|L	60|2024;1961	.|ENSP00000264705:R2024L;ENSP00000384510:R1961L	.|ENSP00000264705:R2024L	G|R	+|+	1|2	0|0	CAD|CAD	27318470|27318470	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.959000|0.959000	0.62525|0.62525	9.174000|9.174000	0.94824|0.94824	2.430000|2.430000	0.82344|0.82344	0.491000|0.491000	0.48974|0.48974	GGC|CGG	.		0.627	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
FHOD3	80206	hgsc.bcm.edu	37	18	34335227	34335227	+	Missense_Mutation	SNP	G	G	A	rs571460399		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr18:34335227G>A	ENST00000359247.4	+	21	3802	c.3802G>A	c.(3802-3804)Gcc>Acc	p.A1268T	FHOD3_ENST00000590592.1_Missense_Mutation_p.A1460T|FHOD3_ENST00000257209.4_Missense_Mutation_p.A1285T|FHOD3_ENST00000445677.1_Missense_Mutation_p.A1247T|FHOD3_ENST00000592128.1_Missense_Mutation_p.A264T|FHOD3_ENST00000591635.1_Missense_Mutation_p.A481T	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1268	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACAGAAACGGGCCAACCACAG	0.418													G|||	1	0.000199681	0.0008	0.0	5008	,	,		11801	0.0		0.0	False		,,,				2504	0.0				p.A1285T		.											FHOD3,right_upper_lobe,carcinoma,0,1	FHOD3	0	0			c.G3853A						.						97.0	74.0	82.0					18																	34335227		2203	4300	6503	SO:0001583	missense	80206	exon22			AAACGGGCCAACC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3802G>A	18.37:g.34335227G>A	ENSP00000352186:p.Ala1268Thr	Somatic	61	0		WXS	Illumina HiSeq	.	47	2	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	G	35	5.596244	0.96602	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.64618	-0.11;-0.11;-0.11	6.17	6.17	0.99709	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.000000	0.85682	D	0.000000	T	0.81612	0.4859	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;0.989	D;D;D;D	0.87578	0.954;0.998;0.996;0.92	T	0.82034	-0.0657	10	0.72032	D	0.01	.	19.4575	0.94900	0.0:0.0:1.0:0.0	.	489;1247;1268;1285	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	T	1285;1268;1247	ENSP00000257209:A1285T;ENSP00000352186:A1268T;ENSP00000411430:A1247T	ENSP00000257209:A1285T	A	+	1	0	FHOD3	32589225	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GCC	.		0.418	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FCGR3A	2214	hgsc.bcm.edu	37	1	161595956	161595956	+	Intron	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:161595956C>T	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.V186M|FCGR3B_ENST00000531221.1_Missense_Mutation_p.V222M|FCGR2B_ENST00000367960.5_Intron|FCGR3B_ENST00000367964.2_Missense_Mutation_p.V186M			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GTGATGTTCACAGTCTCTGAA	0.502																																					p.V222M		.											.	.	.	0			c.G664A						.						86.0	94.0	91.0					1																	161595956		2200	4300	6500	SO:0001627	intron_variant	2215	exon4			TGTTCACAGTCTC	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+4201G>A	1.37:g.161595956C>T		Somatic	75	0		WXS	Illumina HiSeq	.	79	4	NM_001244753	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	13.72|13.72	2.320199|2.320199	0.41096|0.41096	.|.	.|.	ENSG00000162747|ENSG00000162747	ENST00000421702|ENST00000367964;ENST00000294800;ENST00000531221	.|T;T;T	.|0.15952	.|2.38;2.38;2.38	2.39|2.39	-4.38|-4.38	0.03622|0.03622	.|Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.|1.110400	.|0.06937	.|N	.|0.812044	T|T	0.05547|0.05547	0.0146|0.0146	M|M	0.75150|0.75150	2.29|2.29	0.09310|0.09310	N|N	1|1	.|B	.|0.33583	.|0.418	.|B	.|0.31016	.|0.123	T|T	0.27262|0.27262	-1.0079|-1.0079	5|10	.|0.66056	.|D	.|0.02	.|.	1.1009|1.1009	0.01683|0.01683	0.3788:0.2996:0.1869:0.1347|0.3788:0.2996:0.1869:0.1347	.|.	.|186	.|O75015	.|FCG3B_HUMAN	Y|M	206|186;186;222	.|ENSP00000356941:V186M;ENSP00000294800:V186M;ENSP00000433642:V222M	.|ENSP00000294800:V186M	C|V	-|-	2|1	0|0	FCGR3B|FCGR3B	159862580|159862580	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.253000|0.253000	0.25986|0.25986	0.054000|0.054000	0.14205|0.14205	-1.119000|-1.119000	0.02958|0.02958	-0.557000|-0.557000	0.04193|0.04193	TGT|GTG	.		0.502	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
SACS	26278	hgsc.bcm.edu	37	13	23911856	23911856	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:23911856C>A	ENST00000382292.3	-	9	6432	c.6159G>T	c.(6157-6159)gaG>gaT	p.E2053D	SACS_ENST00000382298.3_Missense_Mutation_p.E2053D|SACS_ENST00000402364.1_Missense_Mutation_p.E1303D			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2053					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAAACTGTTTCTCTGAAAATG	0.328																																					p.E2053D		.											.	.	.	0			c.G6159T						.						25.0	28.0	27.0					13																	23911856		2191	4289	6480	SO:0001583	missense	26278	exon10			CTGTTTCTCTGAA	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6159G>T	13.37:g.23911856C>A	ENSP00000371729:p.Glu2053Asp	Somatic	62	0		WXS	Illumina HiSeq	.	98	4	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277273	0.40294	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88277	-2.21;-2.36;-2.21	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.88209	0.6375	L	0.56769	1.78	0.38477	D	0.947626	P	0.47762	0.9	P	0.47299	0.543	D	0.88851	0.3319	10	0.52906	T	0.07	.	9.7457	0.40446	0.0:0.8104:0.0:0.1896	.	2053	Q9NZJ4	SACS_HUMAN	D	2053;1303;2053	ENSP00000371729:E2053D;ENSP00000385844:E1303D;ENSP00000371735:E2053D	ENSP00000371729:E2053D	E	-	3	2	SACS	22809856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.981000	0.40628	2.706000	0.92434	0.561000	0.74099	GAG	.		0.328	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
BMP2K	55589	hgsc.bcm.edu	37	4	79792166	79792166	+	Missense_Mutation	SNP	C	C	G	rs202184856|rs200441916	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:79792166C>G	ENST00000335016.5	+	11	1627	c.1461C>G	c.(1459-1461)caC>caG	p.H487Q	BMP2K_ENST00000502871.1_Missense_Mutation_p.H487Q	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	487	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						agcagcagcaccaccaccacc	0.502													c|||	68	0.0135783	0.0416	0.0043	5008	,	,		11259	0.001		0.007	False		,,,				2504	0.002				p.H487Q		.											BMP2K_ENST00000502871,caecum,carcinoma,0,4	BMP2K_ENST00000502871	0	0			c.C1461G						.	-	GLN/HIS,GLN/HIS	12,4302		0,12,2145	20.0	24.0	23.0		1461,1461		0.1	4		23	2,8424		0,2,4211	no	missense,missense	BMP2K	NM_017593.3,NM_198892.1	24,24	0,14,6356	GG,GC,CC		0.0237,0.2782,0.1099	possibly-damaging,possibly-damaging	487/663,487/1162	79792166	14,12726	2157	4213	6370	SO:0001583	missense	55589	exon11			GCAGCACCACCAC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1461C>G	4.37:g.79792166C>G	ENSP00000334836:p.His487Gln	Somatic	26	1		WXS	Illumina HiSeq	.	29	5	NM_017593	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.755|0.755	-0.771272|-0.771272	0.02951|0.02951	0.002782|0.002782	2.37E-4|2.37E-4	ENSG00000138756|ENSG00000138756	ENST00000502871;ENST00000335016;ENST00000264889|ENST00000502613	T;T|.	0.71341|.	1.16;-0.56|.	.|.	.|.	.|.	.|.	3.253760|.	0.01410|.	N|.	0.013962|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.39094|.	0.659;0.404|.	B;B|.	0.18263|.	0.021;0.021|.	T|T	0.24119|0.24119	-1.0169|-1.0169	9|4	0.10902|.	T|.	0.67|.	.|.	3.2348|3.2348	0.06761|0.06761	0.4658:0.5342:0.0:0.0|0.4658:0.5342:0.0:0.0	.|.	487;487|.	Q9NSY1;Q4W5H2|.	BMP2K_HUMAN;.|.	Q|A	487;487;501|180	ENSP00000421768:H487Q;ENSP00000334836:H487Q|.	ENSP00000264889:H501Q|.	H|P	+|+	3|1	2|0	BMP2K|BMP2K	80011190|80011190	0.000000|0.000000	0.05858|0.05858	0.126000|0.126000	0.21872|0.21872	0.030000|0.030000	0.12068|0.12068	-1.617000|-1.617000	0.02051|0.02051	0.372000|0.372000	0.24591|0.24591	0.377000|0.377000	0.23210|0.23210	CAC|CCA	.		0.502	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
C12orf10	60314	hgsc.bcm.edu	37	12	53700882	53700882	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:53700882C>T	ENST00000267103.5	+	7	1132	c.1080C>T	c.(1078-1080)agC>agT	p.S360S	AAAS_ENST00000549983.1_5'Flank|C12orf10_ENST00000548632.1_Silent_p.S285S|C12orf10_ENST00000549488.1_Silent_p.S197S	NM_021640.3	NP_067653	Q9HB07	MYG1_HUMAN	chromosome 12 open reading frame 10	360					locomotory exploration behavior (GO:0035641)|pigmentation (GO:0043473)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|kidney(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	20						GTGCCTTGAGCATGGCCCGTG	0.572																																					p.S360S		.											.	.	.	0			c.C1080T						.						81.0	78.0	79.0					12																	53700882		2202	4300	6502	SO:0001819	synonymous_variant	60314	exon7			CTTGAGCATGGCC	AF289485	CCDS31810.1	12q13.13	2014-05-29			ENSG00000139637	ENSG00000139637			17590	protein-coding gene	gene with protein product	"""melanocyte related gene"", ""melanocyte proliferating gene 1"""	611366					Standard	NM_021640		Approved	MYG, MYG1, Gamm1	uc001scp.4	Q9HB07	OTTHUMG00000170030	ENST00000267103.5:c.1080C>T	12.37:g.53700882C>T		Somatic	57	0		WXS	Illumina HiSeq	.	38	3	NM_021640		Silent	SNP	ENST00000267103.5	37	CCDS31810.1																																																																																			.		0.572	C12orf10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406906.1	NM_021640	
TUBB4A	10382	hgsc.bcm.edu	37	19	6495789	6495789	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:6495789G>A	ENST00000264071.2	-	4	1092	c.721C>T	c.(721-723)Cgc>Tgc	p.R241C	CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.R241C|CTD-2396E7.9_ENST00000599292.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	241					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										CCCGGGAAGCGCAGGCAGGTG	0.647																																					p.R241C		.											TUBB4,NS,carcinoma,0,1	TUBB4	0	0			c.C721T						.						66.0	61.0	62.0					19																	6495789		2203	4300	6503	SO:0001583	missense	10382	exon4			GGAAGCGCAGGCA	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.721C>T	19.37:g.6495789G>A	ENSP00000264071:p.Arg241Cys	Somatic	76	0		WXS	Illumina HiSeq	.	46	2	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065864	0.55539	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	T;T	0.74632	-0.86;-0.86	3.89	3.89	0.44902	.	0.000000	0.64402	D	0.000005	D	0.84338	0.5450	H	0.97131	3.945	0.80722	D	1	P	0.41498	0.752	B	0.42593	0.392	D	0.89765	0.3950	10	0.87932	D	0	.	14.7919	0.69848	0.0:0.0:1.0:0.0	.	241	P04350	TBB4A_HUMAN	C	241;241;159	ENSP00000264071:R241C;ENSP00000443590:R241C	ENSP00000264071:R241C	R	-	1	0	TUBB4	6446789	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.595000	0.98260	1.745000	0.51790	0.478000	0.44815	CGC	.		0.647	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	13811890	13811890	+	Missense_Mutation	SNP	G	G	T	rs376707969		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:13811890G>T	ENST00000265104.4	-	44	7377	c.7273C>A	c.(7273-7275)Cgt>Agt	p.R2425S		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2425	AAA 2. {ECO:0000250}.		R -> H (in dbSNP:rs35900306).		cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TACAGCTGACGAAGAATTTCT	0.433									Kartagener syndrome																												p.R2425S		.											DNAH5,NS,malignant_melanoma,0,3	DNAH5	0	0			c.C7273A						.						80.0	78.0	79.0					5																	13811890		2203	4300	6503	SO:0001583	missense	1767	exon44	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GCTGACGAAGAAT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.7273C>A	5.37:g.13811890G>T	ENSP00000265104:p.Arg2425Ser	Somatic	61	0		WXS	Illumina HiSeq	.	61	7	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183145	0.38511	.	.	ENSG00000039139	ENST00000265104	T	0.26067	1.76	5.78	5.78	0.91487	.	0.107097	0.64402	D	0.000008	T	0.28466	0.0704	M	0.70903	2.155	0.58432	D	0.999993	B	0.29590	0.25	B	0.30029	0.11	T	0.05954	-1.0854	10	0.10111	T	0.7	.	14.8147	0.70024	0.0:0.0:0.856:0.1439	.	2425	Q8TE73	DYH5_HUMAN	S	2425	ENSP00000265104:R2425S	ENSP00000265104:R2425S	R	-	1	0	DNAH5	13864890	1.000000	0.71417	0.999000	0.59377	0.886000	0.51366	3.164000	0.50770	2.729000	0.93468	0.650000	0.86243	CGT	.		0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PAFAH1B1	5048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	2570445	2570445	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:2570445C>T	ENST00000397195.5	+	5	803	c.352C>T	c.(352-354)Cct>Tct	p.P118S	PAFAH1B1_ENST00000572915.2_3'UTR	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						CATTTTCCATCCTGTGTTCAG	0.448																																					p.P118S		.											.	.	.	0			c.C352T						.						111.0	100.0	104.0					17																	2570445		2203	4300	6503	SO:0001583	missense	5048	exon5			TTCCATCCTGTGT	L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.352C>T	17.37:g.2570445C>T	ENSP00000380378:p.Pro118Ser	Somatic	57	0		WXS	Illumina HiSeq	.	38	8	NM_000430		Missense_Mutation	SNP	ENST00000397195.5	37	CCDS32528.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.995629	0.93167	.	.	ENSG00000007168	ENST00000397195	T	0.70399	-0.48	5.02	5.02	0.67125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82577	0.5067	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83972	0.0327	10	0.62326	D	0.03	.	17.6689	0.88211	0.0:1.0:0.0:0.0	.	118	P43034	LIS1_HUMAN	S	118	ENSP00000380378:P118S	ENSP00000380378:P118S	P	+	1	0	PAFAH1B1	2517195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.477000	0.83638	0.585000	0.79938	CCT	.		0.448	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437797.2	NM_000430	
WDR93	56964	hgsc.bcm.edu	37	15	90245237	90245237	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr15:90245237G>A	ENST00000268130.7	+	2	361	c.260G>A	c.(259-261)aGc>aAc	p.S87N	WDR93_ENST00000560294.1_Missense_Mutation_p.S87N|RP11-300G22.2_ENST00000557964.1_RNA|WDR93_ENST00000558000.1_Missense_Mutation_p.S87N	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	87					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			GCTGAGAGCAGCCAGATCCAG	0.483																																					p.S87N		.											.	.	.	0			c.G260A						.						59.0	61.0	61.0					15																	90245237		2200	4299	6499	SO:0001583	missense	56964	exon2			AGAGCAGCCAGAT		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.260G>A	15.37:g.90245237G>A	ENSP00000268130:p.Ser87Asn	Somatic	59	0		WXS	Illumina HiSeq	.	64	4	NM_020212	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	ENST00000268130.7	37	CCDS32326.1	.	.	.	.	.	.	.	.	.	.	G	7.648	0.682378	0.14907	.	.	ENSG00000140527	ENST00000268130	T	0.23950	1.88	5.59	-2.64	0.06114	.	0.869087	0.10030	N	0.724840	T	0.12135	0.0295	N	0.21583	0.68	0.09310	N	1	B;B;B	0.11235	0.004;0.002;0.004	B;B;B	0.09377	0.004;0.004;0.004	T	0.29397	-1.0013	10	0.40728	T	0.16	-0.773	0.838	0.01144	0.371:0.2731:0.2019:0.154	.	87;87;87	Q6P2C0-2;B4E3E2;Q6P2C0	.;.;WDR93_HUMAN	N	87	ENSP00000268130:S87N	ENSP00000268130:S87N	S	+	2	0	WDR93	88046241	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.742000	0.04850	-0.102000	0.12197	-0.157000	0.13467	AGC	.		0.483	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212	
BRCA2	675	hgsc.bcm.edu;bcgsc.ca	37	13	32914379	32914379	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:32914379G>T	ENST00000380152.3	+	11	6120	c.5887G>T	c.(5887-5889)Ggg>Tgg	p.G1963W	BRCA2_ENST00000544455.1_Missense_Mutation_p.G1963W			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1963					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATGTAGTATAGGGAAGCTTCA	0.348			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.G1963W	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	.	.	0			c.G5887T						.						86.0	94.0	92.0					13																	32914379		2203	4299	6502	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AGTATAGGGAAGC	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5887G>T	13.37:g.32914379G>T	ENSP00000369497:p.Gly1963Trp	Somatic	65	0		WXS	Illumina HiSeq	.	81	4	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.280811	0.23392	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00776	5.71;5.71	5.72	5.72	0.89469	.	0.449096	0.21013	N	0.081651	T	0.03178	0.0093	M	0.67953	2.075	0.09310	N	1	D	0.76494	0.999	D	0.74674	0.984	T	0.45877	-0.9231	10	0.37606	T	0.19	.	10.9018	0.47056	0.1126:0.0:0.8874:0.0	.	1963	P51587	BRCA2_HUMAN	W	1963	ENSP00000369497:G1963W;ENSP00000439902:G1963W	ENSP00000369497:G1963W	G	+	1	0	BRCA2	31812379	0.001000	0.12720	0.006000	0.13384	0.016000	0.09150	1.070000	0.30653	2.717000	0.92951	0.655000	0.94253	GGG	.		0.348	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ZNF250	58500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	146107584	146107584	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:146107584G>T	ENST00000292579.7	-	6	1115	c.999C>A	c.(997-999)caC>caA	p.H333Q	ZNF250_ENST00000342660.6_Intron|ZNF250_ENST00000417550.2_Missense_Mutation_p.H328Q|ZNF250_ENST00000543949.1_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		TCTCCCCAGTGTGTACCCTCT	0.567																																					p.H333Q	NSCLC(16;520 556 24096 40084 43446)	.											.	.	.	0			c.C999A						.						76.0	55.0	62.0					8																	146107584		2203	4300	6503	SO:0001583	missense	58500	exon6			CCCAGTGTGTACC	AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.999C>A	8.37:g.146107584G>T	ENSP00000292579:p.His333Gln	Somatic	25	0		WXS	Illumina HiSeq	.	30	5	NM_021061	D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	ENST00000292579.7	37	CCDS34972.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352445	0.61293	.	.	ENSG00000196150	ENST00000292579;ENST00000417550;ENST00000394912	T;T	0.66995	-0.24;-0.24	3.94	3.94	0.45596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000082	D	0.86213	0.5879	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	D	0.90292	0.4323	10	0.87932	D	0	-33.4966	15.944	0.79779	0.0:0.0:1.0:0.0	.	328;333	D3DWP1;P15622	.;ZN250_HUMAN	Q	333;328;328	ENSP00000292579:H333Q;ENSP00000393442:H328Q	ENSP00000292579:H333Q	H	-	3	2	ZNF250	146078388	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.164000	0.50770	2.511000	0.84671	0.313000	0.20887	CAC	.		0.567	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382968.1	NM_021061	
SLC12A2	6558	hgsc.bcm.edu;bcgsc.ca	37	5	127483404	127483404	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:127483404G>A	ENST00000262461.2	+	11	2053	c.1864G>A	c.(1864-1866)Gct>Act	p.A622T	SLC12A2_ENST00000343225.4_Missense_Mutation_p.A622T	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	622					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	CCTAGTGAGTGCTCCCAAAAT	0.323																																					p.A622T		.											.	.	.	0			c.G1864A						.						105.0	104.0	105.0					5																	127483404		2203	4297	6500	SO:0001583	missense	6558	exon11			GTGAGTGCTCCCA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1864G>A	5.37:g.127483404G>A	ENSP00000262461:p.Ala622Thr	Somatic	35	0		WXS	Illumina HiSeq	.	33	4	NM_001046	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029151	0.93518	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98876	-5.2;-5.2	5.06	5.06	0.68205	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99263	0.9743	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99260	1.0890	10	0.87932	D	0	.	18.6192	0.91315	0.0:0.0:1.0:0.0	.	622;622	P55011-3;P55011	.;S12A2_HUMAN	T	622	ENSP00000262461:A622T;ENSP00000340878:A622T	ENSP00000262461:A622T	A	+	1	0	SLC12A2	127511303	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.121000	0.94375	2.638000	0.89438	0.585000	0.79938	GCT	.		0.323	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
PPM1E	22843	hgsc.bcm.edu	37	17	57046944	57046944	+	Silent	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:57046944G>T	ENST00000308249.2	+	4	957	c.828G>T	c.(826-828)ggG>ggT	p.G276G	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			ATGGCCATGGGGGAGTAGATG	0.493																																					p.G276G		.											PPM1E,right_lower_lobe,carcinoma,0,1	PPM1E	0	0			c.G828T						.						190.0	154.0	166.0					17																	57046944		2203	4300	6503	SO:0001819	synonymous_variant	22843	exon4			CCATGGGGGAGTA	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.828G>T	17.37:g.57046944G>T		Somatic	58	0		WXS	Illumina HiSeq	.	69	3	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	37	CCDS11613.1																																																																																			.		0.493	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
CDH5	1003	hgsc.bcm.edu	37	16	66424368	66424368	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:66424368G>T	ENST00000341529.3	+	6	992	c.844G>T	c.(844-846)Gtt>Ttt	p.V282F	CDH5_ENST00000563425.2_Missense_Mutation_p.V282F	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	282	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CTCTCTGTTTGTTGAGGACCC	0.552																																					p.V282F		.											CDH5,NS,lymphoid_neoplasm,0,1	CDH5	0	0			c.G844T						.						70.0	69.0	69.0					16																	66424368		2201	4300	6501	SO:0001583	missense	1003	exon6			CTGTTTGTTGAGG	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.844G>T	16.37:g.66424368G>T	ENSP00000344115:p.Val282Phe	Somatic	36	0		WXS	Illumina HiSeq	.	47	2	NM_001795	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	G	32	5.158136	0.94686	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.55413	0.52	5.78	5.78	0.91487	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.79969	0.4538	M	0.93328	3.405	0.80722	D	1	D	0.67145	0.996	D	0.71184	0.972	D	0.84392	0.0555	9	0.87932	D	0	.	17.8559	0.88762	0.0:0.0:1.0:0.0	.	282	P33151	CADH5_HUMAN	F	282	ENSP00000344115:V282F	ENSP00000344115:V282F	V	+	1	0	CDH5	64981869	1.000000	0.71417	0.986000	0.45419	0.974000	0.67602	7.695000	0.84257	2.894000	0.99253	0.655000	0.94253	GTT	.		0.552	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ZNF721	170960	hgsc.bcm.edu	37	4	466365	466365	+	Intron	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:466365T>C	ENST00000338977.5	-	1	47				ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000511833.2_Splice_Site_p.L11L|ZNF721_ENST00000507078.1_5'UTR|ZNF721_ENST00000506646.1_Splice_Site_p.L43L			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L11L(1)		endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TATCCTCACCTAGGGAGACCA	0.368																																					p.I11M		.											ZNF721_ENST00000511833,NS,carcinoma,0,1	ZNF721_ENST00000511833	0	1	Substitution - coding silent(1)	lung(1)	c.C33G						.						79.0	87.0	84.0					4																	466365		2203	4300	6503	SO:0001627	intron_variant	170960	exon2			CTCACCTAGGGAG	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1+26479A>G	4.37:g.466365T>C		Somatic	68	1		WXS	Illumina HiSeq	.	88	4	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37																																																																																				.		0.368	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
BCO2	83875	hgsc.bcm.edu	37	11	112071442	112071442	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:112071442C>A	ENST00000357685.5	+	7	1107	c.972C>A	c.(970-972)agC>agA	p.S324R	BCO2_ENST00000531169.1_Missense_Mutation_p.S290R|BCO2_ENST00000438022.1_Missense_Mutation_p.S290R|BCO2_ENST00000361053.4_Missense_Mutation_p.S251R|BCO2_ENST00000526088.1_Missense_Mutation_p.S290R|BCO2_ENST00000393032.2_Missense_Mutation_p.S290R|BCO2_ENST00000532593.1_Missense_Mutation_p.S219R			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	324					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						ATGGGATAAGCTGGGAACCCC	0.388																																					p.S324R	GBM(177;1916 2099 21049 29541 39946)	.											.	.	.	0			c.C972A						.						116.0	119.0	118.0					11																	112071442		2201	4297	6498	SO:0001583	missense	83875	exon7			GATAAGCTGGGAA	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.972C>A	11.37:g.112071442C>A	ENSP00000350314:p.Ser324Arg	Somatic	61	0		WXS	Illumina HiSeq	.	78	4	NM_031938	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554103	0.45487	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51;-3.51;-3.51	5.54	3.62	0.41486	.	0.232360	0.53938	N	0.000050	D	0.94272	0.8160	L	0.41415	1.275	0.38599	D	0.950619	P;D;P;P	0.61080	0.939;0.989;0.939;0.891	P;P;P;P	0.61477	0.889;0.856;0.842;0.666	D	0.93254	0.6637	10	0.44086	T	0.13	-20.2743	10.9061	0.47081	0.0:0.7987:0.1308:0.0705	.	301;251;324;151	C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.;.;BCDO2_HUMAN;.	R	324;290;251;290;290;219;290	ENSP00000350314:S324R;ENSP00000376752:S290R;ENSP00000354338:S251R;ENSP00000414843:S290R;ENSP00000436615:S290R;ENSP00000431802:S219R;ENSP00000437053:S290R	ENSP00000350314:S324R	S	+	3	2	BCO2	111576652	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.364000	0.52328	0.670000	0.31165	0.585000	0.79938	AGC	.		0.388	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
CR2	1380	hgsc.bcm.edu	37	1	207643300	207643300	+	Silent	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:207643300C>A	ENST00000367058.3	+	6	1267	c.1078C>A	c.(1078-1080)Cga>Aga	p.R360R	CR2_ENST00000367057.3_Silent_p.R360R|CR2_ENST00000367059.3_Silent_p.R360R|CR2_ENST00000458541.2_Silent_p.R360R	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	360	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCTAAGAGGCCGAATGGTATC	0.498																																					p.R360R		.											CR2,NS,carcinoma,0,1	CR2	0	0			c.C1078A						.						139.0	124.0	129.0					1																	207643300		2203	4300	6503	SO:0001819	synonymous_variant	1380	exon6			AGAGGCCGAATGG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1078C>A	1.37:g.207643300C>A		Somatic	62	0		WXS	Illumina HiSeq	.	67	3	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	CCDS1478.1																																																																																			.		0.498	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
TMEM260	54916	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	57046731	57046731	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:57046731C>T	ENST00000261556.6	+	1	221	c.99C>T	c.(97-99)ttC>ttT	p.F33F	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Silent_p.F33F	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	33						integral component of membrane (GO:0016021)											TGGCGGTGTTCGCCGCCGTGG	0.726																																					p.F33F		.											.	.	.	0			c.C99T						.						4.0	3.0	4.0					14																	57046731		1914	3800	5714	SO:0001819	synonymous_variant	0	exon1			GGTGTTCGCCGCC	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.99C>T	14.37:g.57046731C>T		Somatic	35	0		WXS	Illumina HiSeq	.	42	7	NM_017799	A8KAN4|B3KPF5|Q86XE1	Silent	SNP	ENST00000261556.6	37	CCDS9727.2																																																																																			.		0.726	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
KCNH7	90134	hgsc.bcm.edu	37	2	163279884	163279884	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:163279884G>A	ENST00000332142.5	-	9	2215	c.2116C>T	c.(2116-2118)Cac>Tac	p.H706Y	KCNH7_ENST00000328032.4_Missense_Mutation_p.H699Y	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	706					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GTCCATGCGTGCTGGAAATAT	0.443																																					p.H706Y	GBM(196;1492 2208 17507 24132 45496)	.											.	.	.	0			c.C2116T						.						249.0	232.0	238.0					2																	163279884		2203	4300	6503	SO:0001583	missense	90134	exon9			ATGCGTGCTGGAA	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2116C>T	2.37:g.163279884G>A	ENSP00000331727:p.His706Tyr	Somatic	63	0		WXS	Illumina HiSeq	.	85	4	NM_033272	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807749	0.90623	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.95622	-3.76;-3.76	5.82	5.82	0.92795	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.97483	0.9176	M	0.66939	2.045	0.80722	D	1	D;B	0.89917	1.0;0.22	D;B	0.91635	0.999;0.168	D	0.97429	1.0014	10	0.59425	D	0.04	.	20.093	0.97828	0.0:0.0:1.0:0.0	.	699;706	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	Y	706;699	ENSP00000331727:H706Y;ENSP00000333781:H699Y	ENSP00000333781:H699Y	H	-	1	0	KCNH7	162988130	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	9.813000	0.99286	2.756000	0.94617	0.561000	0.74099	CAC	.		0.443	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
DSC1	1823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	28710755	28710755	+	Intron	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr18:28710755C>T	ENST00000257198.5	-	16	2749				RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_Splice_Site	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1						homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CTTTGATTTACCTTTTACTGT	0.274																																					.		.											.	.	.	0			c.2533+1G>A						.						65.0	68.0	67.0					18																	28710755		2202	4299	6501	SO:0001627	intron_variant	1823	exon17			GATTTACCTTTTA	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2488-81G>A	18.37:g.28710755C>T		Somatic	64	0		WXS	Illumina HiSeq	.	65	39	NM_004948	Q9HB01	Splice_Site	SNP	ENST00000257198.5	37	CCDS11894.1																																																																																			.		0.274	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421	
PRPF39	55015	hgsc.bcm.edu	37	14	45571897	45571897	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:45571897G>A	ENST00000355765.6	+	5	905	c.735G>A	c.(733-735)caG>caA	p.Q245Q		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	245					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.Q124Q(1)		breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ATCATTTTCAGAGGTAGGTGG	0.323																																					p.Q245Q		.											PRPF39,NS,carcinoma,0,1	PRPF39	0	1	Substitution - coding silent(1)	breast(1)	c.G735A						.						167.0	183.0	178.0					14																	45571897		2203	4300	6503	SO:0001819	synonymous_variant	55015	exon5			TTTTCAGAGGTAG	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.735G>A	14.37:g.45571897G>A		Somatic	43	0		WXS	Illumina HiSeq	.	50	2	NM_017922	Q08AL1|Q08AL2|Q9NUU5	Silent	SNP	ENST00000355765.6	37	CCDS9682.2																																																																																			.		0.323	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
CSRP2BP	57325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	18143422	18143422	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr20:18143422A>G	ENST00000435364.3	+	6	1845	c.1504A>G	c.(1504-1506)Agg>Ggg	p.R502G	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.R501G|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.R374G	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	502					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						ACAAGCGAAAAGGGATAGGGG	0.473																																					p.R502G		.											.	.	.	0			c.A1504G						.						147.0	116.0	126.0					20																	18143422		2203	4300	6503	SO:0001583	missense	57325	exon6			GCGAAAAGGGATA	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1504A>G	20.37:g.18143422A>G	ENSP00000392318:p.Arg502Gly	Somatic	55	0		WXS	Illumina HiSeq	.	32	4	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.351655	0.61183	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.54479	0.57;0.58;0.57;0.61	6.17	2.47	0.30058	.	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	T	0.73525	-0.3955	10	0.87932	D	0	-15.6602	15.819	0.78626	0.3959:0.6041:0.0:0.0	.	374;502	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	G	502;501;502;374	ENSP00000278816:R502G;ENSP00000366909:R501G;ENSP00000392318:R502G;ENSP00000425909:R374G	ENSP00000278816:R502G	R	+	1	2	CSRP2BP	18091422	0.981000	0.34729	0.399000	0.26333	0.954000	0.61252	0.242000	0.18087	0.137000	0.18759	0.533000	0.62120	AGG	.		0.473	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
CD59	966	hgsc.bcm.edu	37	11	33731761	33731761	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:33731761G>A	ENST00000395850.3	-	4	373	c.298C>T	c.(298-300)Ctt>Ttt	p.L100F	CD59_ENST00000528700.1_Missense_Mutation_p.L100F|CD59_ENST00000527577.1_Missense_Mutation_p.L100F|CD59_ENST00000351554.3_Missense_Mutation_p.L100F|CD59_ENST00000534312.1_Missense_Mutation_p.L100F|CD59_ENST00000415002.2_Missense_Mutation_p.L100F|CD59_ENST00000437761.2_Missense_Mutation_p.L100F|CD59_ENST00000426650.2_Missense_Mutation_p.L100F|CD59_ENST00000533403.1_3'UTR|CD59_ENST00000445143.2_Missense_Mutation_p.L100F	NM_000611.5|NM_001127225.1|NM_001127226.1|NM_001127227.1|NM_203329.2|NM_203330.2|NM_203331.2	NP_000602.1|NP_001120697.1|NP_001120698.1|NP_001120699.1|NP_976074.1|NP_976075.1|NP_976076.1	P13987	CD59_HUMAN	CD59 molecule, complement regulatory protein	100	UPAR/Ly6.				blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|negative regulation of activation of membrane attack complex (GO:0001971)|negative regulation of apoptotic process (GO:0043066)|positive regulation of T cell proliferation (GO:0042102)|regulation of complement activation (GO:0030449)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|compact myelin (GO:0043218)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	complement binding (GO:0001848)			endometrium(1)|lung(2)	3						CCATTTTCAAGCTGTTCGTTA	0.468																																					p.L100F		.											.	.	.	0			c.C298T						.						169.0	132.0	145.0					11																	33731761		2202	4298	6500	SO:0001583	missense	966	exon5			TTTCAAGCTGTTC		CCDS7886.1	11p13	2014-09-17	2006-03-28			ENSG00000085063		"""CD molecules"", ""Complement system"""	1689	protein-coding gene	gene with protein product		107271	"""CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344)"", ""CD59 antigen, complement regulatory protein"""	MIC11, MIN1, MSK21, MIN2, MIN3		7691713	Standard	NM_001127223		Approved	16.3A5, EJ16, EJ30, EL32, G344, p18-20	uc001mus.4	P13987		ENST00000395850.3:c.298C>T	11.37:g.33731761G>A	ENSP00000379191:p.Leu100Phe	Somatic	95	0		WXS	Illumina HiSeq	.	65	4	NM_203331		Missense_Mutation	SNP	ENST00000395850.3	37	CCDS7886.1	.	.	.	.	.	.	.	.	.	.	G	4.212	0.038107	0.08148	.	.	ENSG00000085063	ENST00000534312;ENST00000527926;ENST00000395850;ENST00000351554;ENST00000415002;ENST00000445143;ENST00000426650;ENST00000437761;ENST00000527577;ENST00000528700	D;D;T;T;T;T;T;T;T;T	0.93019	-3.15;-3.12;2.85;2.85;2.85;2.85;2.85;2.85;2.85;2.85	1.81	-3.62	0.04543	Ly-6 antigen / uPA receptor -like (1);	.	.	.	.	D	0.86041	0.5838	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.69818	-0.5042	9	0.22706	T	0.39	.	0.2547	0.00210	0.3064:0.2037:0.285:0.2049	.	100	P13987	CD59_HUMAN	F	100	ENSP00000432362:L100F;ENSP00000437122:L100F;ENSP00000379191:L100F;ENSP00000340210:L100F;ENSP00000404822:L100F;ENSP00000403511:L100F;ENSP00000402425:L100F;ENSP00000410182:L100F;ENSP00000432942:L100F;ENSP00000434617:L100F	ENSP00000340210:L100F	L	-	1	0	CD59	33688337	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.318000	0.01121	-1.143000	0.02866	0.467000	0.42956	CTT	.		0.468	CD59-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000388809.1	NM_203329	
NPLOC4	55666	hgsc.bcm.edu;bcgsc.ca	37	17	79526288	79526288	+	Silent	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:79526288G>T	ENST00000331134.6	-	17	2039	c.1824C>A	c.(1822-1824)acC>acA	p.T608T	NPLOC4_ENST00000573876.1_3'UTR|NPLOC4_ENST00000572760.1_3'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	608					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AGGCGCCCTAGGTCCTGGGGA	0.642																																					p.T608T		.											.	.	.	0			c.C1824A						.						17.0	22.0	20.0					17																	79526288		2043	4186	6229	SO:0001819	synonymous_variant	55666	exon17			GCCCTAGGTCCTG	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1824C>A	17.37:g.79526288G>T		Somatic	73	0		WXS	Illumina HiSeq	.	56	4	NM_017921	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	ENST00000331134.6	37	CCDS45812.1																																																																																			.		0.642	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
CCDC129	223075	hgsc.bcm.edu	37	7	31617905	31617905	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:31617905C>T	ENST00000407970.3	+	8	1065	c.1027C>T	c.(1027-1029)Ccg>Tcg	p.P343S	CCDC129_ENST00000409210.1_Missense_Mutation_p.P251S|CCDC129_ENST00000451887.2_Missense_Mutation_p.P369S|CCDC129_ENST00000319386.3_Intron	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	343										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CTCATCTATGCCGGCCAAGCA	0.502																																					p.P369S		.											CCDC129,NS,carcinoma,0,1	CCDC129	0	0			c.C1105T						.						70.0	69.0	69.0					7																	31617905		1968	4137	6105	SO:0001583	missense	223075	exon8			TCTATGCCGGCCA	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1027C>T	7.37:g.31617905C>T	ENSP00000384416:p.Pro343Ser	Somatic	34	0		WXS	Illumina HiSeq	.	25	2	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	2.546	-0.305078	0.05495	.	.	ENSG00000180347	ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T	0.15952	2.64;2.64;2.38	5.08	-0.835	0.10775	.	.	.	.	.	T	0.09291	0.0229	N	0.22421	0.69	0.09310	N	1	B;B;B	0.13145	0.007;0.004;0.004	B;B;B	0.13407	0.009;0.009;0.009	T	0.39251	-0.9623	8	.	.	.	1.756	5.512	0.16886	0.0:0.2803:0.3167:0.403	.	369;353;343	F5H3V5;F5H2J8;Q6ZRS4	.;.;CC129_HUMAN	S	343;369;353;251	ENSP00000384416:P343S;ENSP00000395835:P369S;ENSP00000387214:P251S	.	P	+	1	0	CCDC129	31584430	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.390000	0.07332	-0.066000	0.12998	-0.885000	0.02943	CCG	.		0.502	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
USP21	27005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161130441	161130441	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:161130441C>T	ENST00000289865.8	+	2	232	c.11C>T	c.(10-12)gCc>gTc	p.A4V	RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368002.3_Missense_Mutation_p.A4V|USP21_ENST00000368001.1_Missense_Mutation_p.A4V	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	4					histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ATGCCCCAGGCCTCTGAGCAC	0.602																																					p.A4V		.											.	.	.	0			c.C11T						.						48.0	50.0	49.0					1																	161130441		2203	4300	6503	SO:0001583	missense	27005	exon2			CCCAGGCCTCTGA	AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.11C>T	1.37:g.161130441C>T	ENSP00000289865:p.Ala4Val	Somatic	28	0		WXS	Illumina HiSeq	.	43	15	NM_012475	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	CCDS30920.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737179	0.49045	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.18960	2.35;2.35;2.18	4.94	4.94	0.65067	.	0.206143	0.33364	N	0.004997	T	0.04407	0.0121	N	0.08118	0	0.34209	D	0.674045	B	0.32781	0.384	B	0.23716	0.048	T	0.15954	-1.0419	10	0.87932	D	0	.	10.6444	0.45610	0.0:0.9115:0.0:0.0885	.	4	Q9UK80	UBP21_HUMAN	V	4	ENSP00000356981:A4V;ENSP00000289865:A4V;ENSP00000356980:A4V	ENSP00000289865:A4V	A	+	2	0	USP21	159397065	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.021000	0.49651	2.560000	0.86352	0.561000	0.74099	GCC	.		0.602	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1		
IL6ST	3572	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	55243387	55243387	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:55243387G>T	ENST00000381298.2	-	15	2183	c.1871C>A	c.(1870-1872)cCt>cAt	p.P624H	IL6ST_ENST00000336909.5_Missense_Mutation_p.P624H|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000381294.3_Missense_Mutation_p.P563H|IL6ST_ENST00000502326.3_Missense_Mutation_p.P624H|IL6ST_ENST00000381286.3_Intron	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	624					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TAAGCAAACAGGCACGACTAT	0.338			O		hepatocellular ca																																p.P624H		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	.	.	0			c.C1871A						.						83.0	78.0	80.0					5																	55243387		2203	4300	6503	SO:0001583	missense	3572	exon15			CAAACAGGCACGA	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1871C>A	5.37:g.55243387G>T	ENSP00000370698:p.Pro624His	Somatic	45	0		WXS	Illumina HiSeq	.	36	4	NM_002184	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080036	0.76528	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.41065	1.29;1.29;1.01	5.52	4.65	0.58169	.	0.444700	0.26535	N	0.023825	T	0.48003	0.1476	L	0.36672	1.1	0.80722	D	1	D;D;D	0.67145	0.996;0.987;0.996	P;P;P	0.55999	0.789;0.711;0.711	T	0.49698	-0.8912	10	0.62326	D	0.03	.	13.9594	0.64170	0.0736:0.0:0.9264:0.0	.	624;563;624	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	H	624;624;563	ENSP00000370698:P624H;ENSP00000338799:P624H;ENSP00000370694:P563H	ENSP00000338799:P624H	P	-	2	0	IL6ST	55279144	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.049000	0.76613	1.341000	0.45600	0.455000	0.32223	CCT	.		0.338	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
ITGA4	3676	hgsc.bcm.edu;bcgsc.ca	37	2	182359521	182359521	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:182359521G>T	ENST00000397033.2	+	12	1751	c.1321G>T	c.(1321-1323)Gat>Tat	p.D441Y		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	441					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	AATTGATGCAGATAATAATGG	0.323																																					p.D441Y		.											.	.	.	0			c.G1321T						.						145.0	137.0	140.0					2																	182359521		1826	4080	5906	SO:0001583	missense	3676	exon12			GATGCAGATAATA		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1321G>T	2.37:g.182359521G>T	ENSP00000380227:p.Asp441Tyr	Somatic	58	0		WXS	Illumina HiSeq	.	69	4	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050059	0.75846	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.81415	-1.49;-1.49	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.93148	0.7818	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94255	0.7497	10	0.87932	D	0	.	20.126	0.97982	0.0:0.0:1.0:0.0	.	441	P13612	ITA4_HUMAN	Y	441	ENSP00000380227:D441Y;ENSP00000233573:D441Y	ENSP00000233573:D441Y	D	+	1	0	ITGA4	182067766	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.453000	0.66645	2.749000	0.94314	0.655000	0.94253	GAT	.		0.323	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
TTC21A	199223	hgsc.bcm.edu	37	3	39154059	39154059	+	Silent	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:39154059G>T	ENST00000431162.2	+	5	680	c.546G>T	c.(544-546)ggG>ggT	p.G182G	TTC21A_ENST00000301819.6_Silent_p.G182G|TTC21A_ENST00000440121.1_Intron			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	182								p.G182G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		ATGTGCTGGGGCTGATGGGAA	0.572																																					p.G182G		.											TTC21A,NS,carcinoma,0,1	TTC21A	0	1	Substitution - coding silent(1)	endometrium(1)	c.G546T						.						64.0	70.0	68.0					3																	39154059		1985	4175	6160	SO:0001819	synonymous_variant	199223	exon5			GCTGGGGCTGATG	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.546G>T	3.37:g.39154059G>T		Somatic	30	0		WXS	Illumina HiSeq	.	30	2	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Silent	SNP	ENST00000431162.2	37	CCDS46800.1																																																																																			.		0.572	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
GALNT11	63917	hgsc.bcm.edu;bcgsc.ca	37	7	151802439	151802439	+	Silent	SNP	C	C	T	rs574571147		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:151802439C>T	ENST00000434507.1	+	7	1133	c.696C>T	c.(694-696)ggC>ggT	p.G232G	GALNT11_ENST00000452146.2_Silent_p.G151G|GALNT11_ENST00000430044.2_Silent_p.G232G|GALNT11_ENST00000422997.2_3'UTR|GALNT11_ENST00000320311.2_Silent_p.G232G			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	232	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		GAATGATTGGCGCGGCCCACG	0.473													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16711	0.0		0.0	False		,,,				2504	0.0				p.G232G		.											.	.	.	0			c.C696T						.						99.0	97.0	97.0					7																	151802439		2203	4300	6503	SO:0001819	synonymous_variant	63917	exon5			GATTGGCGCGGCC	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.696C>T	7.37:g.151802439C>T		Somatic	78	0		WXS	Illumina HiSeq	.	69	4	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Silent	SNP	ENST00000434507.1	37	CCDS5930.1																																																																																			.		0.473	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
DNASE1L1	1774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153631921	153631921	+	Silent	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:153631921A>G	ENST00000393638.1	-	5	640	c.354T>C	c.(352-354)gaT>gaC	p.D118D	DNASE1L1_ENST00000369809.1_Silent_p.D118D	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	118					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGTCATCCTCATCGTTGTACA	0.552																																					p.D118D		.											.	.	.	0			c.T354C						.						125.0	103.0	111.0					X																	153631921		2203	4300	6503	SO:0001819	synonymous_variant	1774	exon5			ATCCTCATCGTTG	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.354T>C	X.37:g.153631921A>G		Somatic	42	0		WXS	Illumina HiSeq	.	42	14	NM_006730	D3DWW7|Q5HY41	Silent	SNP	ENST00000393638.1	37	CCDS14747.1																																																																																			.		0.552	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080928.2		
VPS26A	9559	hgsc.bcm.edu	37	10	70916899	70916899	+	Silent	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr10:70916899C>A	ENST00000373382.1	+	5	1019	c.366C>A	c.(364-366)atC>atA	p.I122I	VPS26A_ENST00000541711.1_Silent_p.I11I|VPS26A_ENST00000395098.1_Silent_p.I122I|VPS26A_ENST00000490696.1_3'UTR|VPS26A_ENST00000489794.1_Silent_p.I97I|VPS26A_ENST00000546041.1_Silent_p.I105I|VPS26A_ENST00000263559.6_Silent_p.I122I			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	122					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)	p.I122I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						AATCTTACATCGGTGCCAATG	0.353																																					p.I122I	Colon(90;545 1358 4729 6702 16773)	.											VPS26A,rectum,carcinoma,0,1	VPS26A	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C366A						.						103.0	100.0	101.0					10																	70916899		2203	4300	6503	SO:0001819	synonymous_variant	9559	exon4			TTACATCGGTGCC	AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.366C>A	10.37:g.70916899C>A		Somatic	68	0		WXS	Illumina HiSeq	.	50	2	NM_004896	A8MZ56|B2RDD3|Q8TBH4|Q9H982	Silent	SNP	ENST00000373382.1	37	CCDS7286.1																																																																																			.		0.353	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048403.1	NM_004896	
KIAA1429	25962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	95539408	95539408	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:95539408T>C	ENST00000297591.5	-	8	1139	c.1064A>G	c.(1063-1065)tAc>tGc	p.Y355C	KIAA1429_ENST00000421249.2_Missense_Mutation_p.Y355C|KIAA1429_ENST00000437199.1_Missense_Mutation_p.Y355C	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	355					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AGTAGTCTTGTATGGACAACT	0.393																																					p.Y355C		.											.	.	.	0			c.A1064G						.						114.0	113.0	113.0					8																	95539408		2203	4300	6503	SO:0001583	missense	25962	exon8			GTCTTGTATGGAC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1064A>G	8.37:g.95539408T>C	ENSP00000297591:p.Tyr355Cys	Somatic	22	0		WXS	Illumina HiSeq	.	46	27	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.584671	0.46110	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.46451	0.88;0.87;0.87	5.7	5.7	0.88788	.	0.141869	0.48767	D	0.000166	T	0.57799	0.2078	L	0.51422	1.61	0.49213	D	0.999763	D;D	0.71674	0.998;0.998	D;D	0.64776	0.929;0.929	T	0.59263	-0.7487	10	0.59425	D	0.04	-7.5852	15.9596	0.79918	0.0:0.0:0.0:1.0	.	355;355	Q69YN4-4;Q69YN4	.;VIR_HUMAN	C	355	ENSP00000297591:Y355C;ENSP00000395600:Y355C;ENSP00000398390:Y355C	ENSP00000297591:Y355C	Y	-	2	0	KIAA1429	95608584	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.922000	0.70036	2.171000	0.68590	0.402000	0.26972	TAC	.		0.393	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
MLLT3	4300	hgsc.bcm.edu;bcgsc.ca	37	9	20414313	20414313	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr9:20414313G>A	ENST00000380338.4	-	5	817	c.531C>T	c.(529-531)agC>agT	p.S177S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S174S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	177	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																p.S177S		.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	.	.	0			c.C531T						.						22.0	31.0	28.0					9																	20414313		2066	3973	6039	SO:0001819	synonymous_variant	4300	exon5			GCTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.531C>T	9.37:g.20414313G>A		Somatic	44	0		WXS	Illumina HiSeq	.	48	4	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
LRP1B	53353	hgsc.bcm.edu	37	2	141004670	141004670	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:141004670C>G	ENST00000389484.3	-	87	14280	c.13309G>C	c.(13309-13311)Gat>Cat	p.D4437H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4437					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D4437N(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGATATGATCAGACTTGCTG	0.378										TSP Lung(27;0.18)																											p.D4437H	Colon(99;50 2074 2507 20106)	.											LRP1B,NS,carcinoma,+2,1	LRP1B	+2	1	Substitution - Missense(1)	skin(1)	c.G13309C						.						106.0	99.0	102.0					2																	141004670		2203	4300	6503	SO:0001583	missense	53353	exon87			TATGATCAGACTT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13309G>C	2.37:g.141004670C>G	ENSP00000374135:p.Asp4437His	Somatic	48	0		WXS	Illumina HiSeq	.	42	2	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385667	0.82792	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.42513	0.97	5.8	5.8	0.92144	.	0.063505	0.64402	D	0.000010	T	0.37865	0.1019	N	0.14661	0.345	0.46396	D	0.999029	D	0.58970	0.984	P	0.48030	0.564	T	0.25676	-1.0125	10	0.49607	T	0.09	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	4437	Q9NZR2	LRP1B_HUMAN	H	4437;4375	ENSP00000374135:D4437H	ENSP00000374135:D4437H	D	-	1	0	LRP1B	140721140	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.736000	0.74811	2.741000	0.93983	0.650000	0.86243	GAT	.		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238296453	238296453	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:238296453T>C	ENST00000295550.4	-	4	1536	c.1084A>G	c.(1084-1086)Att>Gtt	p.I362V	COL6A3_ENST00000409809.1_Missense_Mutation_p.I156V|COL6A3_ENST00000392004.3_Missense_Mutation_p.I156V|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000347401.3_Intron|COL6A3_ENST00000353578.4_Missense_Mutation_p.I156V|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000346358.4_Missense_Mutation_p.I362V	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	362	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCGTAGCGAATCTCGTCACTA	0.632																																					p.I362V		.											.	.	.	0			c.A1084G						.						44.0	46.0	45.0					2																	238296453		2203	4300	6503	SO:0001583	missense	1293	exon4			AGCGAATCTCGTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1084A>G	2.37:g.238296453T>C	ENSP00000295550:p.Ile362Val	Somatic	20	0		WXS	Illumina HiSeq	.	29	15	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	8.137	0.784389	0.16189	.	.	ENSG00000163359	ENST00000295550;ENST00000353578;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000433762	T;T;T;T;T;D	0.97209	-1.03;-1.03;-1.03;-1.03;-1.03;-4.29	5.17	1.51	0.23008	von Willebrand factor, type A (3);	0.288406	0.24005	U	0.042425	D	0.86548	0.5959	N	0.02973	-0.45	0.21355	N	0.999712	B;B;B;B	0.32338	0.001;0.006;0.365;0.002	B;B;B;B	0.31495	0.003;0.019;0.131;0.003	T	0.81185	-0.1048	10	0.13108	T	0.6	.	3.7344	0.08504	0.2706:0.1471:0.0:0.5823	.	362;156;156;362	E9PCV6;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	V	362;156;156;362;156;362	ENSP00000295550:I362V;ENSP00000315873:I156V;ENSP00000386844:I156V;ENSP00000295546:I362V;ENSP00000375861:I156V;ENSP00000389539:I362V	ENSP00000295550:I362V	I	-	1	0	COL6A3	237961192	0.262000	0.24073	0.944000	0.38274	0.891000	0.51852	0.288000	0.18939	0.293000	0.22520	0.528000	0.53228	ATT	.		0.632	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
MUC17	140453	hgsc.bcm.edu	37	7	100682156	100682156	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:100682156A>G	ENST00000306151.4	+	3	7523	c.7459A>G	c.(7459-7461)Atg>Gtg	p.M2487V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2487	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGCACACCTATGACCACTTC	0.493																																					p.M2487V		.											MUC17,bladder,carcinoma,-2,1	MUC17	-2	0			c.A7459G						.						285.0	288.0	287.0					7																	100682156		2203	4300	6503	SO:0001583	missense	140453	exon3			ACACCTATGACCA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7459A>G	7.37:g.100682156A>G	ENSP00000302716:p.Met2487Val	Somatic	46	1		WXS	Illumina HiSeq	.	72	3	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.296	-0.976703	0.02215	.	.	ENSG00000169876	ENST00000306151	T	0.02032	4.49	1.06	-2.02	0.07388	.	.	.	.	.	T	0.00906	0.0030	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46261	-0.9204	9	0.15952	T	0.53	.	4.2578	0.10726	0.345:0.2168:0.4382:0.0	.	2487	Q685J3	MUC17_HUMAN	V	2487	ENSP00000302716:M2487V	ENSP00000302716:M2487V	M	+	1	0	MUC17	100468876	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-3.180000	0.00569	-1.550000	0.01708	-1.389000	0.01157	ATG	.		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
WDR34	89891	hgsc.bcm.edu	37	9	131396553	131396553	+	Missense_Mutation	SNP	G	G	A	rs545394162		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr9:131396553G>A	ENST00000372715.2	-	8	1384	c.1324C>T	c.(1324-1326)Cgc>Tgc	p.R442C	WDR34_ENST00000483181.1_5'Flank	NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	442						axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						GGGGACCAGCGCACAGCAAAC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		16726	0.0		0.0	False		,,,				2504	0.001				p.R442C		.											WDR34,caecum,carcinoma,0,1	WDR34	0	0			c.C1324T						.						70.0	76.0	74.0					9																	131396553		2203	4300	6503	SO:0001583	missense	89891	exon8			ACCAGCGCACAGC	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.1324C>T	9.37:g.131396553G>A	ENSP00000361800:p.Arg442Cys	Somatic	42	0		WXS	Illumina HiSeq	.	28	3	NM_052844	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068030	0.55539	.	.	ENSG00000119333	ENST00000372715	T	0.28666	1.6	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054497	0.64402	D	0.000001	T	0.34454	0.0898	M	0.74647	2.275	0.80722	D	1	B	0.25772	0.134	B	0.18871	0.023	T	0.14783	-1.0460	10	0.45353	T	0.12	-0.3061	13.1566	0.59520	0.0792:0.0:0.9208:0.0	.	442	Q96EX3	WDR34_HUMAN	C	442	ENSP00000361800:R442C	ENSP00000361800:R442C	R	-	1	0	WDR34	130436374	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.232000	0.43018	2.444000	0.82710	0.561000	0.74099	CGC	.		0.617	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	76440749	76440749	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:76440749G>A	ENST00000585328.1	-	71	11574	c.11450C>T	c.(11449-11451)aCg>aTg	p.T3817M	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.T3808M	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3808					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CTGCAGGGCCGTCTTGTTCTT	0.632																																					p.T3822M		.											.	.	.	0			c.C11465T						.						70.0	45.0	53.0					17																	76440749		2202	4300	6502	SO:0001583	missense	8632	exon71			AGGGCCGTCTTGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.11450C>T	17.37:g.76440749G>A	ENSP00000465516:p.Thr3817Met	Somatic	14	0		WXS	Illumina HiSeq	.	19	4	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	18.43	3.622039	0.66787	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.08984	3.03	4.99	4.02	0.46733	.	0.309555	0.28047	N	0.016815	T	0.34803	0.0910	M	0.92970	3.365	0.36662	D	0.878012	D	0.76494	0.999	D	0.65140	0.932	T	0.57510	-0.7799	10	0.87932	D	0	.	13.4806	0.61334	0.0762:0.0:0.9238:0.0	.	3817	E7EUM8	.	M	3817;3808	ENSP00000374490:T3808M	ENSP00000300671:T3817M	T	-	2	0	DNAH17	73952344	0.814000	0.29104	0.781000	0.31783	0.994000	0.84299	2.506000	0.45433	1.092000	0.41356	0.561000	0.74099	ACG	.		0.632	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
NOTCH2	4853	hgsc.bcm.edu	37	1	120539668	120539668	+	Missense_Mutation	SNP	T	T	A	rs200464440		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:120539668T>A	ENST00000256646.2	-	4	922	c.703A>T	c.(703-705)Acc>Tcc	p.T235S	NOTCH2_ENST00000602566.1_Missense_Mutation_p.T196S	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	235	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCCGACAGGTGCCTCCATTG	0.572			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.T235S		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	NOTCH2_ENST00000369342,NS,carcinoma,0,2	NOTCH2_ENST00000369342	0	0			c.A703T						.						50.0	40.0	43.0					1																	120539668		2203	4299	6502	SO:0001583	missense	4853	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GACAGGTGCCTCC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.703A>T	1.37:g.120539668T>A	ENSP00000256646:p.Thr235Ser	Somatic	32	0		WXS	Illumina HiSeq	.	25	3	NM_001200001	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508758	0.85282	.	.	ENSG00000134250	ENST00000256646;ENST00000539617;ENST00000401649;ENST00000369342	T	0.33438	1.41	5.83	5.83	0.93111	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38897	U	0.001527	T	0.42471	0.1204	L	0.58510	1.815	0.80722	D	1	P;D;D	0.71674	0.924;0.998;0.965	P;D;P	0.77004	0.585;0.989;0.834	T	0.25082	-1.0142	10	0.41790	T	0.15	.	15.3661	0.74523	0.0:0.0:0.0:1.0	.	196;235;235	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	S	235;196;208;196	ENSP00000256646:T235S	ENSP00000256646:T235S	T	-	1	0	NOTCH2	120341191	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.185000	0.72013	2.216000	0.71823	0.477000	0.44152	ACC	.		0.572	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
YTHDF1	54915	hgsc.bcm.edu	37	20	61834909	61834909	+	Missense_Mutation	SNP	G	G	A	rs146457378		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr20:61834909G>A	ENST00000370339.3	-	4	724	c.383C>T	c.(382-384)gCg>gTg	p.A128V	YTHDF1_ENST00000370333.4_Missense_Mutation_p.A78V|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	128							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						TGCTGAGAACGCAGGGTTTTC	0.567																																					p.A128V		.											.	.	.	0			c.C383T						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	57.0	54.0	55.0		383	5.2	1.0	20	dbSNP_134	55	0,8600		0,0,4300	no	missense	YTHDF1	NM_017798.3	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	128/560	61834909	1,13005	2203	4300	6503	SO:0001583	missense	54915	exon4			GAGAACGCAGGGT	AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.383C>T	20.37:g.61834909G>A	ENSP00000359364:p.Ala128Val	Somatic	70	0		WXS	Illumina HiSeq	.	55	4	NM_017798	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	CCDS13511.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.40|16.40	3.112949|3.112949	0.56398|0.56398	2.27E-4|2.27E-4	0.0|0.0	ENSG00000149658|ENSG00000149658	ENST00000370339;ENST00000370333|ENST00000342761	T;T|.	0.56444|.	0.46;0.46|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.093440|.	0.64402|.	N|.	0.000001|.	T|T	0.63534|0.63534	0.2519|0.2519	L|L	0.36672|0.36672	1.1|1.1	0.58432|0.58432	D|D	0.999995|0.999995	P|.	0.40476|.	0.718|.	B|.	0.29440|.	0.102|.	T|T	0.66834|0.66834	-0.5823|-0.5823	10|6	0.32370|0.72032	T|D	0.25|0.01	-15.007|-15.007	18.6283|18.6283	0.91349|0.91349	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	128|.	Q9BYJ9|.	YTHD1_HUMAN|.	V|C	128;78|27	ENSP00000359364:A128V;ENSP00000359358:A78V|.	ENSP00000359358:A78V|ENSP00000339489:R27C	A|R	-|-	2|1	0|0	YTHDF1|YTHDF1	61305354|61305354	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.927000|0.927000	0.56198|0.56198	7.924000|7.924000	0.87555|0.87555	2.400000|2.400000	0.81607|0.81607	0.491000|0.491000	0.48974|0.48974	GCG|CGT	0.000		0.567	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798	
CHRM3	1131	hgsc.bcm.edu	37	1	240070932	240070932	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:240070932G>A	ENST00000255380.4	+	5	960	c.181G>A	c.(181-183)Gga>Aga	p.G61R		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	61					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.G61*(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGACCCTCTGGGAGGTCATAC	0.537																																					p.G61R		.											CHRM3,NS,carcinoma,0,1	CHRM3	0	1	Substitution - Nonsense(1)	lung(1)	c.G181A						.						117.0	106.0	110.0					1																	240070932		2203	4300	6503	SO:0001583	missense	1131	exon5			CCTCTGGGAGGTC	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.181G>A	1.37:g.240070932G>A	ENSP00000255380:p.Gly61Arg	Somatic	31	0		WXS	Illumina HiSeq	.	40	2	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340781	0.81911	.	.	ENSG00000133019	ENST00000255380;ENST00000448020	T;T	0.36340	1.26;1.26	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.53077	0.1774	L	0.57536	1.79	0.80722	D	1	D	0.59357	0.985	P	0.59643	0.861	T	0.30794	-0.9966	10	0.19590	T	0.45	-10.3804	19.9823	0.97331	0.0:0.0:1.0:0.0	.	61	P20309	ACM3_HUMAN	R	61	ENSP00000255380:G61R;ENSP00000404764:G61R	ENSP00000255380:G61R	G	+	1	0	CHRM3	238137555	1.000000	0.71417	0.994000	0.49952	0.953000	0.61014	7.858000	0.86971	2.788000	0.95919	0.650000	0.86243	GGA	.		0.537	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
CPS1	1373	hgsc.bcm.edu	37	2	211460258	211460258	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:211460258G>A	ENST00000233072.5	+	13	1507	c.1311G>A	c.(1309-1311)caG>caA	p.Q437Q	CPS1_ENST00000430249.2_Silent_p.Q443Q|CPS1_ENST00000451903.2_5'UTR	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	437					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)	p.Q437H(2)|p.Q443H(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CCATTGGTCAGGCTGGAGAAT	0.368																																					p.Q443Q		.											CPS1_ENST00000430249,NS,carcinoma,0,3	CPS1_ENST00000430249	0	3	Substitution - Missense(3)	lung(3)	c.G1329A						.						149.0	167.0	161.0					2																	211460258		2203	4300	6503	SO:0001819	synonymous_variant	1373	exon14			TGGTCAGGCTGGA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1311G>A	2.37:g.211460258G>A		Somatic	80	0		WXS	Illumina HiSeq	.	45	2	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Silent	SNP	ENST00000233072.5	37	CCDS2393.1																																																																																			.		0.368	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
LAMTOR2	28956	hgsc.bcm.edu;bcgsc.ca	37	1	156024684	156024684	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:156024684C>T	ENST00000368305.4	+	1	142	c.4C>T	c.(4-6)Ctg>Ttg	p.L2L	LAMTOR2_ENST00000368302.3_Silent_p.L2L|LAMTOR2_ENST00000489664.1_3'UTR|UBQLN4_ENST00000368309.3_5'Flank|UBQLN4_ENST00000472638.1_5'Flank|LAMTOR2_ENST00000368304.5_Silent_p.L2L	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2	2					activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						CGTAGGCATGCTGCGCCCCAA	0.667																																					p.L2L		.											.	.	.	0			c.C4T						.						41.0	35.0	37.0					1																	156024684		2203	4300	6503	SO:0001819	synonymous_variant	28956	exon1			GGCATGCTGCGCC	BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.4C>T	1.37:g.156024684C>T		Somatic	48	0		WXS	Illumina HiSeq	.	61	4	NM_001145264	Q5VY97|Q5VY98|Q5VY99	Silent	SNP	ENST00000368305.4	37	CCDS1128.1																																																																																			.		0.667	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046197.1	NM_014017	
ZNF628	89887	hgsc.bcm.edu	37	19	55994920	55994920	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:55994920C>T	ENST00000598519.1	+	3	2913	c.2360C>T	c.(2359-2361)gCg>gTg	p.A787V	NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Missense_Mutation_p.A783V			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	787	Gly-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GTGCAGGGAGCGGCCAGCGCT	0.726																																					p.A787V		.											ZNF628_ENST00000391718,colon,carcinoma,0,2	ZNF628_ENST00000391718	0	0			c.C2360T						.						12.0	17.0	15.0					19																	55994920		2134	4213	6347	SO:0001583	missense	89887	exon3			AGGGAGCGGCCAG	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.2360C>T	19.37:g.55994920C>T	ENSP00000469591:p.Ala787Val	Somatic	19	0		WXS	Illumina HiSeq	.	25	2	NM_033113	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	10.95	1.496442	0.26861	.	.	ENSG00000197483	ENST00000391718	T	0.08634	3.07	3.71	2.65	0.31530	.	0.835611	0.09919	U	0.738733	T	0.04182	0.0116	N	0.08118	0	0.09310	N	0.999998	P	0.35908	0.527	B	0.23419	0.046	T	0.38329	-0.9666	10	0.59425	D	0.04	.	10.0987	0.42491	0.0:0.4265:0.5735:0.0	.	783	Q5EBL2	ZN628_HUMAN	V	783	ENSP00000375598:A783V	ENSP00000375598:A783V	A	+	2	0	ZNF628	60686732	0.025000	0.19082	0.140000	0.22221	0.538000	0.34931	1.294000	0.33365	0.889000	0.36185	-0.502000	0.04539	GCG	.		0.726	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
FIP1L1	81608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	54257252	54257252	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:54257252G>A	ENST00000337488.6	+	8	776	c.582G>A	c.(580-582)agG>agA	p.R194R	FIP1L1_ENST00000507166.1_Silent_p.R194R|FIP1L1_ENST00000306932.6_Silent_p.R179R|FIP1L1_ENST00000507922.1_Silent_p.R179R|FIP1L1_ENST00000358575.5_Silent_p.R179R	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	194	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with CPSF4.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AACAAAAGAGGATACGAATGG	0.343			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.R194R		.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	.	.	0			c.G582A						.						94.0	105.0	101.0					4																	54257252		2203	4298	6501	SO:0001819	synonymous_variant	81608	exon8			AAAGAGGATACGA	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.582G>A	4.37:g.54257252G>A		Somatic	102	0		WXS	Illumina HiSeq	.	107	50	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Silent	SNP	ENST00000337488.6	37	CCDS3491.1																																																																																			.		0.343	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
ZNF677	342926	hgsc.bcm.edu	37	19	53740544	53740544	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:53740544C>A	ENST00000598513.1	-	5	1586	c.1436G>T	c.(1435-1437)aGa>aTa	p.R479I	ZNF677_ENST00000333952.4_Missense_Mutation_p.R479I	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		AGTATGAGTTCTCTGATGACC	0.373																																					p.R479I		.											ZNF677,colon,carcinoma,0,1	ZNF677	0	0			c.G1436T						.						67.0	66.0	67.0					19																	53740544		2203	4300	6503	SO:0001583	missense	342926	exon5			TGAGTTCTCTGAT	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1436G>T	19.37:g.53740544C>A	ENSP00000469391:p.Arg479Ile	Somatic	50	0		WXS	Illumina HiSeq	.	46	2	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	C	9.922	1.212345	0.22289	.	.	ENSG00000197928	ENST00000333952	T	0.24908	1.83	2.21	1.13	0.20643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37136	N	0.002228	T	0.21801	0.0525	L	0.53671	1.685	0.34243	D	0.677887	B	0.26363	0.147	B	0.24394	0.053	T	0.21280	-1.0250	10	0.54805	T	0.06	.	8.6545	0.34055	0.0:0.7612:0.2388:0.0	.	479	Q86XU0	ZN677_HUMAN	I	479	ENSP00000334394:R479I	ENSP00000334394:R479I	R	-	2	0	ZNF677	58432356	0.000000	0.05858	0.573000	0.28510	0.858000	0.48976	-0.297000	0.08276	0.472000	0.27344	0.655000	0.94253	AGA	.		0.373	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
SLC38A1	81539	hgsc.bcm.edu	37	12	46633559	46633559	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:46633559C>T	ENST00000398637.5	-	3	719	c.25G>A	c.(25-27)Gaa>Aaa	p.E9K	SLC38A1_ENST00000439706.1_Missense_Mutation_p.E9K|SLC38A1_ENST00000552197.1_Missense_Mutation_p.E9K|SLC38A1_ENST00000546893.1_Missense_Mutation_p.E9K|SLC38A1_ENST00000549049.1_Missense_Mutation_p.E9K|SLC38A1_ENST00000549633.1_Intron	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	9					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TCAGTTAATTCGAGTCCACTT	0.358																																					p.E9K		.											SLC38A1,NS,carcinoma,0,1	SLC38A1	0	0			c.G25A						.						150.0	135.0	140.0					12																	46633559		1871	4119	5990	SO:0001583	missense	81539	exon3			TTAATTCGAGTCC	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.25G>A	12.37:g.46633559C>T	ENSP00000381634:p.Glu9Lys	Somatic	45	0		WXS	Illumina HiSeq	.	48	2	NM_030674	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839159	0.91117	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197;ENST00000550173	T;T;T;T;T	0.08008	3.35;3.35;3.35;3.35;3.14	5.11	5.11	0.69529	.	0.000000	0.56097	D	0.000029	T	0.14614	0.0353	N	0.08118	0	0.48040	D	0.999571	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.959	T	0.39313	-0.9620	10	0.56958	D	0.05	-20.3596	18.9275	0.92550	0.0:1.0:0.0:0.0	.	9;9	F8VX04;Q9H2H9	.;S38A1_HUMAN	K	9	ENSP00000449607:E9K;ENSP00000398142:E9K;ENSP00000381634:E9K;ENSP00000447853:E9K;ENSP00000449756:E9K	ENSP00000381634:E9K	E	-	1	0	SLC38A1	44919826	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	4.908000	0.63307	2.541000	0.85698	0.585000	0.79938	GAA	.		0.358	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
SPIRE2	84501	hgsc.bcm.edu	37	16	89920723	89920723	+	Silent	SNP	G	G	T	rs148030912		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:89920723G>T	ENST00000378247.3	+	4	718	c.675G>T	c.(673-675)ccG>ccT	p.P225P	SPIRE2_ENST00000393062.2_Silent_p.P225P	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	225					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		AGGACGAGCCGCATCTGGAGA	0.657																																					p.P225P		.											SPIRE2,caecum,carcinoma,0,1	SPIRE2	0	0			c.G675T						.						39.0	35.0	36.0					16																	89920723		2193	4286	6479	SO:0001819	synonymous_variant	84501	exon4			CGAGCCGCATCTG	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.675G>T	16.37:g.89920723G>T		Somatic	61	0		WXS	Illumina HiSeq	.	74	3	NM_032451	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Silent	SNP	ENST00000378247.3	37	CCDS32516.1																																																																																			.		0.657	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
FAM71A	149647	hgsc.bcm.edu	37	1	212798867	212798867	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:212798867G>T	ENST00000294829.3	+	1	1079	c.648G>T	c.(646-648)caG>caT	p.Q216H	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	216						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		AGGGGGATCAGGACCAGGTCA	0.547																																					p.Q216H		.											.	.	.	0			c.G648T						.						70.0	69.0	69.0					1																	212798867		2203	4300	6503	SO:0001583	missense	149647	exon1			GGATCAGGACCAG		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.648G>T	1.37:g.212798867G>T	ENSP00000294829:p.Gln216His	Somatic	40	0		WXS	Illumina HiSeq	.	38	4	NM_153606	Q5VTZ1	Missense_Mutation	SNP	ENST00000294829.3	37	CCDS1507.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363160	0.41902	.	.	ENSG00000162771	ENST00000294829	T	0.04194	3.68	4.12	1.09	0.20402	.	0.417472	0.17620	N	0.167767	T	0.09335	0.0230	L	0.55743	1.74	0.21878	N	0.999494	D	0.69078	0.997	P	0.56865	0.808	T	0.16512	-1.0400	10	0.52906	T	0.07	-11.0969	4.0071	0.09607	0.2197:0.1968:0.5835:0.0	.	216	Q8IYT1	FA71A_HUMAN	H	216	ENSP00000294829:Q216H	ENSP00000294829:Q216H	Q	+	3	2	FAM71A	210865490	0.737000	0.28175	0.379000	0.26080	0.715000	0.41141	0.746000	0.26275	0.129000	0.18514	0.563000	0.77884	CAG	.		0.547	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098529.1	NM_153606	
CYP3A43	64816	hgsc.bcm.edu	37	7	99459440	99459440	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:99459440C>T	ENST00000354829.2	+	11	1334	c.1231C>T	c.(1231-1233)Cct>Tct	p.P411S	CYP3A43_ENST00000342499.4_Missense_Mutation_p.P271S|CYP3A43_ENST00000415413.1_Missense_Mutation_p.P200S|CYP3A43_ENST00000222382.5_Missense_Mutation_p.P411S|CYP3A43_ENST00000417625.1_Missense_Mutation_p.P301S|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000444905.1_Missense_Mutation_p.P158S|CYP3A43_ENST00000312017.5_Missense_Mutation_p.P411S	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	411			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	CTGGACAGAGCCTGAGAAGTT	0.478																																					p.P411S		.											CYP3A43,NS,carcinoma,0,1	CYP3A43	0	0			c.C1231T						.						113.0	103.0	106.0					7																	99459440		2203	4300	6503	SO:0001583	missense	64816	exon11			ACAGAGCCTGAGA	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.1231C>T	7.37:g.99459440C>T	ENSP00000346887:p.Pro411Ser	Somatic	78	0		WXS	Illumina HiSeq	.	70	3	NM_057096	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Missense_Mutation	SNP	ENST00000354829.2	37	CCDS5676.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839454	0.51057	.	.	ENSG00000021461	ENST00000354829;ENST00000417625;ENST00000342499;ENST00000444905;ENST00000415413;ENST00000312017;ENST00000222382	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	2.71	1.77	0.24775	.	0.000000	0.85682	D	0.000000	D	0.94788	0.8317	H	0.97635	4.045	0.54753	D	0.999983	P;D;D;D;D	0.89917	0.95;0.997;0.999;1.0;1.0	P;D;D;D;D	0.80764	0.662;0.975;0.99;0.994;0.994	D	0.93653	0.6975	10	0.87932	D	0	.	8.6926	0.34275	0.2291:0.7709:0.0:0.0	.	301;271;411;411;411	Q495Y1;F8W6L8;Q9HB55-3;Q75MK2;Q9HB55	.;.;.;.;CP343_HUMAN	S	411;301;271;158;200;411;411	ENSP00000346887:P411S;ENSP00000416581:P301S;ENSP00000345351:P271S;ENSP00000405557:P158S;ENSP00000401521:P200S;ENSP00000312110:P411S;ENSP00000222382:P411S	ENSP00000222382:P411S	P	+	1	0	CYP3A43	99297376	0.983000	0.35010	0.554000	0.28268	0.570000	0.35934	4.076000	0.57591	0.650000	0.30769	0.404000	0.27445	CCT	.		0.478	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1		
CNOT3	4849	hgsc.bcm.edu	37	19	54649452	54649452	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:54649452G>A	ENST00000406403.1	+	7	2205	c.602G>A	c.(601-603)cGc>cAc	p.R201H	CNOT3_ENST00000221232.5_Missense_Mutation_p.R201H|CNOT3_ENST00000358389.3_Missense_Mutation_p.R20H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	201					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GACGCCATCCGCAAGATCAAG	0.552																																					p.R201H		.											CNOT3_ENST00000358389,NS,malignant_melanoma,0,2	CNOT3_ENST00000358389	0	0			c.G602A						.						177.0	116.0	137.0					19																	54649452		2203	4300	6503	SO:0001583	missense	4849	exon8			CCATCCGCAAGAT	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.602G>A	19.37:g.54649452G>A	ENSP00000383954:p.Arg201His	Somatic	27	0		WXS	Illumina HiSeq	.	19	2	NM_014516	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.0|24.0	4.477841|4.477841	0.84640|0.84640	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000440571|ENST00000221232;ENST00000358389;ENST00000406403	.|T;T	.|0.43294	.|0.95;0.95	4.73|4.73	4.73|4.73	0.59995|0.59995	.|Not CCR4-Not complex component, N-terminal (1);	.|0.369213	.|0.28778	.|N	.|0.014165	T|T	0.38878|0.38878	0.1057|0.1057	L|L	0.43923|0.43923	1.385|1.385	0.45676|0.45676	D|D	0.998591|0.998591	.|B;B;B	.|0.30709	.|0.034;0.027;0.291	.|B;B;B	.|0.29077	.|0.013;0.008;0.098	T|T	0.38222|0.38222	-0.9671|-0.9671	5|10	.|0.62326	.|D	.|0.03	-27.0596|-27.0596	17.3261|17.3261	0.87248|0.87248	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|201;201;125	.|B7Z6J7;O75175;Q6ZMJ6	.|.;CNOT3_HUMAN;.	T|H	123|201;20;201	.|ENSP00000221232:R201H;ENSP00000383954:R201H	.|ENSP00000221232:R201H	A|R	+|+	1|2	0|0	CNOT3|CNOT3	59341264|59341264	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	3.707000|3.707000	0.54838|0.54838	2.567000|2.567000	0.86603|0.86603	0.609000|0.609000	0.83330|0.83330	GCA|CGC	.		0.552	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
MOG	4340	hgsc.bcm.edu	37	6	29640988	29640988	+	IGR	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:29640988G>T	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376881.3_Silent_p.T280T|ZFP57_ENST00000376883.1_Silent_p.T280T|ZFP57_ENST00000488757.1_Silent_p.T300T	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						ATTCAGCCTGGGTGCCTGGAA	0.557																																					p.T300T		.											ZFP57,bladder,carcinoma,0,2	ZFP57	0	0			c.C900A						.						144.0	150.0	148.0					6																	29640988		1229	2537	3766	SO:0001628	intergenic_variant	346171	exon4			AGCCTGGGTGCCT		CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29640988G>T		Somatic	51	0		WXS	Illumina HiSeq	.	32	2	NM_001109809	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	CCDS34370.1																																																																																			.		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433	
PACS1	55690	hgsc.bcm.edu	37	11	65978677	65978677	+	Missense_Mutation	SNP	C	C	T	rs398123009		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:65978677C>T	ENST00000320580.4	+	4	640	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	203			R -> W (in MRD17). {ECO:0000269|PubMed:23159249}.	Missing (in Ref. 2; BAC04831). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R203W(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TTACAAGAATCGGACCATCTT	0.488																																					p.R203W		.											PACS1,NS,carcinoma,0,1	PACS1	0	1	Substitution - Missense(1)	ovary(1)	c.C607T						.						201.0	168.0	179.0					11																	65978677		2201	4295	6496	SO:0001583	missense	55690	exon4			AAGAATCGGACCA	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.607C>T	11.37:g.65978677C>T	ENSP00000316454:p.Arg203Trp	Somatic	52	0		WXS	Illumina HiSeq	.	39	3	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102284	0.76983	.	.	ENSG00000175115	ENST00000320580;ENST00000533756;ENST00000527380	T	0.38077	1.16	4.79	4.79	0.61399	.	0.111023	0.64402	D	0.000006	T	0.63331	0.2502	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.948;0.987	T	0.69083	-0.5239	10	0.87932	D	0	-22.9264	12.765	0.57386	0.1648:0.8352:0.0:0.0	.	203;203	Q6VY07;Q6VY07-2	PACS1_HUMAN;.	W	203;100;105	ENSP00000316454:R203W	ENSP00000316454:R203W	R	+	1	2	PACS1	65735253	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	2.044000	0.41241	2.659000	0.90383	0.313000	0.20887	CGG	.		0.488	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
BRD9	65980	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	864589	864589	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:864589C>T	ENST00000467963.1	-	16	1954	c.1788G>A	c.(1786-1788)aaG>aaA	p.K596K	BRD9_ENST00000388890.4_Silent_p.K480K|BRD9_ENST00000323510.4_Silent_p.K500K|BRD9_ENST00000483173.1_Silent_p.K543K	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	596					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			AGAGTTAGGTCTTGGCAGAGG	0.483																																					p.K596K		.											.	.	.	0			c.G1788A						.						62.0	66.0	64.0					5																	864589		2203	4300	6503	SO:0001819	synonymous_variant	65980	exon16			TTAGGTCTTGGCA	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1788G>A	5.37:g.864589C>T		Somatic	47	0		WXS	Illumina HiSeq	.	296	26	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Silent	SNP	ENST00000467963.1	37	CCDS34127.2																																																																																			.		0.483	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
PCDHA5	56143	hgsc.bcm.edu	37	5	140203213	140203213	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:140203213G>A	ENST00000529859.1	+	1	1853	c.1853G>A	c.(1852-1854)cGc>cAc	p.R618H	PCDHA5_ENST00000378126.3_Missense_Mutation_p.R618H|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R618H|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	618	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R618H(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAGTGCGCGCATCCCGTTC	0.652																																					p.R618H		.											PCDHA5_ENST00000529859,colon,carcinoma,0,2	PCDHA5_ENST00000529859	0	2	Substitution - Missense(2)	large_intestine(2)	c.G1853A						.						74.0	77.0	76.0					5																	140203213		2203	4300	6503	SO:0001583	missense	56143	exon1			GTGCGCGCATCCC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1853G>A	5.37:g.140203213G>A	ENSP00000436557:p.Arg618His	Somatic	72	1		WXS	Illumina HiSeq	.	46	2	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	g	0.473	-0.883725	0.02530	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.52526	0.66;0.66;0.66	3.87	2.06	0.26882	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35508	0.0934	L	0.44542	1.39	0.23421	N	0.997713	B;B;B	0.29301	0.241;0.171;0.171	B;B;B	0.27715	0.082;0.03;0.046	T	0.22941	-1.0202	9	0.41790	T	0.15	.	5.4247	0.16419	0.1933:0.1635:0.6433:0.0	.	618;618;618	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	H	618	ENSP00000433416:R618H;ENSP00000436557:R618H;ENSP00000367366:R618H	ENSP00000367366:R618H	R	+	2	0	PCDHA5	140183397	0.000000	0.05858	0.173000	0.22940	0.289000	0.27227	-0.561000	0.05957	0.264000	0.21851	-0.699000	0.03677	CGC	.		0.652	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140744334	140744334	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:140744334C>T	ENST00000518069.1	+	1	437	c.437C>T	c.(436-438)gCg>gTg	p.A146V	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	146	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A146V(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGAAAATGCGGCTGCAGGG	0.443																																					p.A146V		.											PCDHGA5_ENST00000518069,colon,carcinoma,0,2	PCDHGA5_ENST00000518069	0	2	Substitution - Missense(2)	large_intestine(2)	c.C437T						.						35.0	37.0	36.0					5																	140744334		1958	4153	6111	SO:0001583	missense	56110	exon1			AAAATGCGGCTGC	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.437C>T	5.37:g.140744334C>T	ENSP00000429834:p.Ala146Val	Somatic	61	0		WXS	Illumina HiSeq	.	41	2	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	37	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	10.74	1.434592	0.25813	.	.	ENSG00000253485	ENST00000518069	T	0.55588	0.51	5.42	5.42	0.78866	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.52789	0.1756	L	0.48986	1.54	0.32280	N	0.567715	B;B	0.32071	0.305;0.355	B;B	0.33568	0.103;0.166	T	0.60811	-0.7189	9	0.44086	T	0.13	.	19.1867	0.93647	0.0:1.0:0.0:0.0	.	146;146	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	V	146	ENSP00000429834:A146V	ENSP00000429834:A146V	A	+	2	0	PCDHGA5	140724518	0.016000	0.18221	0.923000	0.36655	0.074000	0.17049	2.730000	0.47335	2.699000	0.92147	0.563000	0.77884	GCG	.		0.443	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
STAG1	10274	hgsc.bcm.edu	37	3	136136813	136136813	+	Splice_Site	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:136136813C>A	ENST00000383202.2	-	21	2366	c.2110G>T	c.(2110-2112)Gca>Tca	p.A704S	STAG1_ENST00000236698.5_Splice_Site_p.A704S|STAG1_ENST00000536929.1_Splice_Site_p.A288S|STAG1_ENST00000434713.2_Splice_Site_p.A478S	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	704					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.A704P(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AGATCATGTGCACTGAAATAA	0.343																																					p.A704S		.											STAG1,NS,carcinoma,0,1	STAG1	0	1	Substitution - Missense(1)	breast(1)	c.G2110T						.						108.0	98.0	102.0					3																	136136813		2203	4300	6503	SO:0001630	splice_region_variant	10274	exon21			CATGTGCACTGAA	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2109-1G>T	3.37:g.136136813C>A		Somatic	61	0		WXS	Illumina HiSeq	.	65	3	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622275	0.87460	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.32023	1.9;1.92;1.95;1.47	4.83	4.83	0.62350	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.77486	2.375	0.80722	D	1	B;P;B	0.50943	0.228;0.94;0.228	B;P;B	0.49853	0.137;0.624;0.094	T	0.43782	-0.9370	10	0.14656	T	0.56	.	17.9405	0.89025	0.0:1.0:0.0:0.0	.	721;704;704	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	S	704;704;478;288	ENSP00000372689:A704S;ENSP00000236698:A704S;ENSP00000404396:A478S;ENSP00000445787:A288S	ENSP00000236698:A704S	A	-	1	0	STAG1	137619503	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.732000	0.84908	2.204000	0.70986	0.555000	0.69702	GCA	.		0.343	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	Missense_Mutation
C16orf45	89927	hgsc.bcm.edu	37	16	15675170	15675170	+	Missense_Mutation	SNP	C	C	T	rs371464387		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:15675170C>T	ENST00000300006.4	+	4	760	c.401C>T	c.(400-402)gCg>gTg	p.A134V	C16orf45_ENST00000561692.1_Missense_Mutation_p.A86V|C16orf45_ENST00000452191.2_Missense_Mutation_p.A117V|C16orf45_ENST00000565913.1_3'UTR|C16orf45_ENST00000566490.1_Missense_Mutation_p.A134V	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	134										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						GTGGACGATGCGGAGGTCGAG	0.527																																					p.A134V		.											C16orf45,NS,neuroblastoma,0,1	C16orf45	0	0			c.C401T						.						95.0	81.0	86.0					16																	15675170		2197	4300	6497	SO:0001583	missense	89927	exon4			ACGATGCGGAGGT	AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.401C>T	16.37:g.15675170C>T	ENSP00000300006:p.Ala134Val	Somatic	64	0		WXS	Illumina HiSeq	.	72	3	NM_033201	O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	ENST00000300006.4	37	CCDS10561.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369012	0.42003	.	.	ENSG00000166780	ENST00000300006;ENST00000452191	T;T	0.41065	1.01;1.01	5.2	5.2	0.72013	Domain of unknown function DUF3585 (1);	0.048402	0.85682	D	0.000000	T	0.41766	0.1173	L	0.36672	1.1	0.58432	D	0.999998	P;D	0.63880	0.951;0.993	P;P	0.47251	0.542;0.525	T	0.16630	-1.0396	10	0.30854	T	0.27	-6.863	18.3148	0.90217	0.0:1.0:0.0:0.0	.	78;134	B4DE25;Q96MC5	.;CP045_HUMAN	V	134;117	ENSP00000300006:A134V;ENSP00000408976:A117V	ENSP00000300006:A134V	A	+	2	0	C16orf45	15582671	1.000000	0.71417	0.154000	0.22540	0.216000	0.24613	5.395000	0.66291	2.430000	0.82344	0.563000	0.77884	GCG	.		0.527	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252130.2	NM_033201	
OR9I1	219954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	57886193	57886193	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:57886193C>T	ENST00000302610.1	-	1	723	c.724G>A	c.(724-726)Gcc>Acc	p.A242T	OR9Q1_ENST00000335397.3_Intron	NM_001005211.1	NP_001005211.1	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I, member 1	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|liver(1)|lung(15)|pancreas(1)|skin(1)|urinary_tract(1)	23		Breast(21;0.0589)				ATGTGAGAGGCACATGTGGAG	0.488																																					p.A242T		.											.	.	.	0			c.G724A						.						110.0	94.0	100.0					11																	57886193		2201	4296	6497	SO:0001583	missense	219954	exon1			GAGAGGCACATGT	AB065733	CCDS31542.1	11q12.1	2012-08-09			ENSG00000172377	ENSG00000172377		"""GPCR / Class A : Olfactory receptors"""	14718	protein-coding gene	gene with protein product							Standard	NM_001005211		Approved		uc021qjl.1	Q8NGQ6	OTTHUMG00000167404	ENST00000302610.1:c.724G>A	11.37:g.57886193C>T	ENSP00000302606:p.Ala242Thr	Somatic	17	0		WXS	Illumina HiSeq	.	12	5	NM_001005211	Q6IFH0|Q96RA8	Missense_Mutation	SNP	ENST00000302610.1	37	CCDS31542.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.260054	0.23051	.	.	ENSG00000172377	ENST00000302610	T	0.36878	1.23	4.87	1.98	0.26296	GPCR, rhodopsin-like superfamily (1);	0.311519	0.22937	N	0.053826	T	0.21468	0.0517	L	0.28608	0.87	0.20821	N	0.999844	B	0.23591	0.088	B	0.24541	0.054	T	0.13176	-1.0519	10	0.37606	T	0.19	-9.0047	3.684	0.08321	0.1348:0.581:0.131:0.1533	.	242	Q8NGQ6	OR9I1_HUMAN	T	242	ENSP00000302606:A242T	ENSP00000302606:A242T	A	-	1	0	OR9I1	57642769	0.000000	0.05858	0.684000	0.30055	0.536000	0.34869	-2.396000	0.01052	0.361000	0.24292	0.467000	0.42956	GCC	.		0.488	OR9I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394539.1	NM_001005211	
CAPN14	440854	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	31403830	31403830	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:31403830G>A	ENST00000403897.3	-	17	1823	c.1682C>T	c.(1681-1683)gCc>gTc	p.A561V	CAPN14_ENST00000444918.2_Missense_Mutation_p.A561V	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	561	Domain IV.|EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						CCCCTGGCAGGCTTCCAGGCT	0.567																																					p.A561V		.											.	.	.	0			c.C1682T						.						63.0	65.0	64.0					2																	31403830		692	1591	2283	SO:0001583	missense	440854	exon17			TGGCAGGCTTCCA	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.1682C>T	2.37:g.31403830G>A	ENSP00000385247:p.Ala561Val	Somatic	22	0		WXS	Illumina HiSeq	.	15	4	NM_001145122	B3KRU9	Missense_Mutation	SNP	ENST00000403897.3	37	CCDS46254.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654781	0.29425	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	T;T	0.29142	1.58;1.58	4.04	1.11	0.20524	EF-hand-like domain (1);	0.316028	0.24247	U	0.040217	T	0.13713	0.0332	N	0.17379	0.485	0.23376	N	0.9978	B;B	0.02656	0.0;0.0	B;B	0.09377	0.001;0.004	T	0.11842	-1.0571	10	0.31617	T	0.26	.	2.3246	0.04220	0.1097:0.1947:0.495:0.2006	.	561;385	A8MX76;A8MX76-2	CAN14_HUMAN;.	V	561	ENSP00000398670:A561V;ENSP00000385247:A561V	ENSP00000385247:A561V	A	-	2	0	CAPN14	31257334	0.970000	0.33590	0.174000	0.22961	0.085000	0.17905	1.630000	0.37081	0.423000	0.26033	0.585000	0.79938	GCC	.		0.567	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
ZNF761	388561	hgsc.bcm.edu	37	19	53958982	53958982	+	RNA	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:53958982G>T	ENST00000454407.1	+	0	1674							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		ATACTGGAGAGAAACCTTACA	0.373																																					p.E407D		.											ZNF761,colon,carcinoma,0,1	ZNF761	0	0			c.G1221T						.						118.0	123.0	121.0					19																	53958982		2203	4298	6501			388561	exon7			TGGAGAGAAACCT	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958982G>T		Somatic	83	0		WXS	Illumina HiSeq	.	66	3	NM_001008401	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.373	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
TSPAN18	90139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	44941490	44941490	+	Silent	SNP	C	C	T	rs558236701		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:44941490C>T	ENST00000520358.2	+	8	970	c.555C>T	c.(553-555)gaC>gaT	p.D185D	TSPAN18_ENST00000340160.3_Silent_p.D185D			Q96SJ8	TSN18_HUMAN	tetraspanin 18	185						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						AAAGTCGGGACGGGGTCCTGC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17560	0.0		0.001	False		,,,				2504	0.0				p.D185D		.											.	.	.	0			c.C555T						.						81.0	85.0	84.0					11																	44941490		2203	4299	6502	SO:0001819	synonymous_variant	90139	exon7			TCGGGACGGGGTC	AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.555C>T	11.37:g.44941490C>T		Somatic	45	0		WXS	Illumina HiSeq	.	33	13	NM_130783	Q6UY44|Q8NBI9	Silent	SNP	ENST00000520358.2	37	CCDS7910.1	.	.	.	.	.	.	.	.	.	.	C	9.221	1.033441	0.19590	.	.	ENSG00000157570	ENST00000518429	.	.	.	5.27	-6.9	0.01655	.	.	.	.	.	T	0.32496	0.0831	.	.	.	0.32327	N	0.561621	.	.	.	.	.	.	T	0.44267	-0.9339	4	.	.	.	.	6.8085	0.23790	0.1032:0.1301:0.1023:0.6644	.	.	.	.	W	189	.	.	R	+	1	2	TSPAN18	44898066	0.000000	0.05858	0.616000	0.29078	0.966000	0.64601	-3.223000	0.00551	-1.011000	0.03391	-0.224000	0.12420	CGG	.		0.597	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	NM_130783	
ARAP2	116984	hgsc.bcm.edu;bcgsc.ca	37	4	36152626	36152626	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:36152626C>T	ENST00000303965.4	-	16	3282	c.2793G>A	c.(2791-2793)ttG>ttA	p.L931L		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	931	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.L931L(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CATAGTAACTCAAGAAGCCTC	0.308																																					p.L931L		.											ARAP2,colon,carcinoma,0,1	ARAP2	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G2793A						.						128.0	128.0	128.0					4																	36152626		2203	4299	6502	SO:0001819	synonymous_variant	116984	exon16			GTAACTCAAGAAG	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.2793G>A	4.37:g.36152626C>T		Somatic	39	0		WXS	Illumina HiSeq	.	54	4	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	ENST00000303965.4	37	CCDS3441.1																																																																																			.		0.308	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14576921	14576921	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:14576921G>A	ENST00000540793.1	+	1	227	c.72G>A	c.(70-72)caG>caA	p.Q24Q	ATF7IP_ENST00000544627.1_Silent_p.Q32Q|ATF7IP_ENST00000261168.4_Silent_p.Q24Q|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Silent_p.Q24Q|ATF7IP_ENST00000536444.1_Silent_p.Q24Q			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	24					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GTGATCGTCAGCAACTTGAAG	0.388																																					p.Q24Q		.											.	.	.	0			c.G72A						.						87.0	77.0	81.0					12																	14576921		2203	4300	6503	SO:0001819	synonymous_variant	55729	exon2			TCGTCAGCAACTT	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.72G>A	12.37:g.14576921G>A		Somatic	86	0		WXS	Illumina HiSeq	.	84	57	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Silent	SNP	ENST00000540793.1	37	CCDS8663.1																																																																																			.		0.388	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52510551	52510551	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:52510551C>T	ENST00000479054.1	+	9	926	c.854C>T	c.(853-855)aCt>aTt	p.T285I	NISCH_ENST00000420808.2_Missense_Mutation_p.T285I|NISCH_ENST00000464280.1_3'UTR|NISCH_ENST00000345716.4_Missense_Mutation_p.T285I|NISCH_ENST00000488380.1_Missense_Mutation_p.T285I			Q9Y2I1	NISCH_HUMAN	nischarin	285	Interaction with PAK1. {ECO:0000250}.|Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GTCATCCCCACTTGGCAGGCA	0.552																																					p.T285I		.											.	.	.	0			c.C854T						.						91.0	77.0	82.0					3																	52510551		2203	4300	6503	SO:0001583	missense	11188	exon8			TCCCCACTTGGCA	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.854C>T	3.37:g.52510551C>T	ENSP00000418232:p.Thr285Ile	Somatic	28	0		WXS	Illumina HiSeq	.	8	7	NM_001276293	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585686	0.66105	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000488380;ENST00000420808	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.59	4.72	0.59763	.	0.161093	0.56097	D	0.000033	T	0.14184	0.0343	L	0.45581	1.43	0.39390	D	0.966406	P;B	0.36144	0.539;0.036	B;B	0.24974	0.057;0.012	T	0.10590	-1.0623	10	0.33141	T	0.24	-9.7887	6.626	0.22830	0.1452:0.7078:0.0:0.1469	.	285;285	Q9Y2I1;C9J715	NISCH_HUMAN;.	I	285	ENSP00000418232:T285I;ENSP00000339958:T285I;ENSP00000417812:T285I;ENSP00000392484:T285I	ENSP00000339958:T285I	T	+	2	0	NISCH	52485591	0.965000	0.33210	0.876000	0.34364	0.978000	0.69477	2.190000	0.42630	1.386000	0.46466	0.655000	0.94253	ACT	.		0.552	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
MSN	4478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	64958961	64958961	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:64958961G>A	ENST00000360270.5	+	12	1646	c.1474G>A	c.(1474-1476)Gct>Act	p.A492T		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	492					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						AGAGGCTAGTGCTGACCTACG	0.557			T	ALK	ALCL																																p.A492T		.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	.	.	0			c.G1474A						.						81.0	53.0	63.0					X																	64958961		2203	4298	6501	SO:0001583	missense	4478	exon12			GCTAGTGCTGACC	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1474G>A	X.37:g.64958961G>A	ENSP00000353408:p.Ala492Thr	Somatic	34	0		WXS	Illumina HiSeq	.	42	19	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	g	20.5	4.009168	0.75046	.	.	ENSG00000147065	ENST00000360270	D	0.83163	-1.69	5.36	5.36	0.76844	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86793	0.6018	M	0.83312	2.635	0.80722	D	1	B	0.28552	0.215	B	0.39590	0.304	D	0.83901	0.0290	10	0.21540	T	0.41	.	16.6317	0.85035	0.0:0.0:1.0:0.0	.	492	P26038	MOES_HUMAN	T	492	ENSP00000353408:A492T	ENSP00000353408:A492T	A	+	1	0	MSN	64875686	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.715000	0.98748	2.242000	0.73789	0.519000	0.50382	GCT	.		0.557	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
ANGPT1	284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	108315583	108315583	+	Missense_Mutation	SNP	C	C	A	rs549007148	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:108315583C>A	ENST00000520734.1	-	4	506	c.221G>T	c.(220-222)gGa>gTa	p.G74V	ANGPT1_ENST00000520052.1_Missense_Mutation_p.G73V|ANGPT1_ENST00000518386.1_Intron			Q15389	ANGP1_HUMAN	angiopoietin 1	274					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TCTTTTTCCTCCCTTTAGTAA	0.308																																					p.G274V		.											.	.	.	0			c.G821T						.						81.0	92.0	88.0					8																	108315583		2202	4300	6502	SO:0001583	missense	284	exon5			TTTCCTCCCTTTA	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.221G>T	8.37:g.108315583C>A	ENSP00000430750:p.Gly74Val	Somatic	47	0		WXS	Illumina HiSeq	.	122	32	NM_001146	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	C	10.18	1.278980	0.23307	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820;ENST00000520734;ENST00000520052	T;T;T;T	0.54071	0.59;1.04;0.61;0.62	4.45	4.45	0.53987	.	0.405081	0.26895	N	0.021945	T	0.35158	0.0922	L	0.33485	1.01	0.54753	D	0.99998	B;B;B	0.15473	0.013;0.0;0.0	B;B;B	0.14578	0.011;0.001;0.001	T	0.19844	-1.0293	10	0.20519	T	0.43	.	5.2634	0.15586	0.0:0.7487:0.0:0.2513	.	73;274;274	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	V	274;273;86;74;73	ENSP00000428340:G274V;ENSP00000297450:G273V;ENSP00000430750:G74V;ENSP00000429349:G73V	ENSP00000297450:G273V	G	-	2	0	ANGPT1	108384759	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.017000	0.40981	2.296000	0.77279	0.650000	0.86243	GGA	.		0.308	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
ANK3	288	hgsc.bcm.edu	37	10	61828580	61828580	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr10:61828580T>C	ENST00000280772.2	-	37	12250	c.12059A>G	c.(12058-12060)aAg>aGg	p.K4020R	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4020					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GGACTGCATCTTTTTTTCTTC	0.458																																					p.K4020R		.											.,3	.	703	0			c.A12059G						.						118.0	115.0	116.0					10																	61828580		2203	4300	6503	SO:0001583	missense	288	exon37			TGCATCTTTTTTT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12059A>G	10.37:g.61828580T>C	ENSP00000280772:p.Lys4020Arg	Somatic	77	0		WXS	Illumina HiSeq	.	66	3	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.462552	0.63513	.	.	ENSG00000151150	ENST00000280772	T	0.18174	2.23	5.72	5.72	0.89469	.	0.000000	0.44097	D	0.000483	T	0.12050	0.0293	N	0.24115	0.695	0.80722	D	1	P	0.43094	0.799	B	0.33339	0.162	T	0.03795	-1.1003	10	0.59425	D	0.04	.	16.0157	0.80439	0.0:0.0:0.0:1.0	.	4020	Q12955	ANK3_HUMAN	R	4020	ENSP00000280772:K4020R	ENSP00000280772:K4020R	K	-	2	0	ANK3	61498586	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.145000	0.71769	2.189000	0.69895	0.533000	0.62120	AAG	.		0.458	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
NOS2	4843	hgsc.bcm.edu	37	17	26101406	26101406	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:26101406G>A	ENST00000313735.6	-	12	1586	c.1353C>T	c.(1351-1353)taC>taT	p.Y451Y		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	451					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.Y451*(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CACGGGACCGGTATTCATTCT	0.552																																					p.Y451Y		.											NOS2,NS,carcinoma,0,1	NOS2	0	1	Substitution - Nonsense(1)	ovary(1)	c.C1353T						.						96.0	92.0	94.0					17																	26101406		2203	4300	6503	SO:0001819	synonymous_variant	4843	exon12			GGACCGGTATTCA	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1353C>T	17.37:g.26101406G>A		Somatic	29	0		WXS	Illumina HiSeq	.	42	2	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	ENST00000313735.6	37	CCDS11223.1																																																																																			.		0.552	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
CDC7	8317	hgsc.bcm.edu	37	1	91967356	91967356	+	Nonsense_Mutation	SNP	T	T	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:91967356T>A	ENST00000428239.1	+	2	342	c.83T>A	c.(82-84)tTa>tAa	p.L28*	CDC7_ENST00000430031.2_Nonsense_Mutation_p.L28*|CDC7_ENST00000234626.6_Nonsense_Mutation_p.L28*|CDC7_ENST00000497611.1_3'UTR	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	28					cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GAAGGCTCTTTAAAAAAAAAC	0.403																																					p.L28X		.											CDC7,NS,carcinoma,0,4	CDC7	0	0			c.T83A						.						89.0	96.0	94.0					1																	91967356		2203	4300	6503	SO:0001587	stop_gained	8317	exon2			GCTCTTTAAAAAA	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.83T>A	1.37:g.91967356T>A	ENSP00000393139:p.Leu28*	Somatic	54	1		WXS	Illumina HiSeq	.	57	3	NM_001134419	D3DT31|O00558|Q5T5U5	Nonsense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919905	0.73098	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239;ENST00000426137	.	.	.	5.22	2.9	0.33743	.	1.340040	0.04577	N	0.394259	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7639	5.0268	0.14389	0.0:0.1687:0.1674:0.6639	.	.	.	.	X	28	.	ENSP00000234626:L28X	L	+	2	0	CDC7	91739944	0.004000	0.15560	0.151000	0.22473	0.174000	0.22865	0.295000	0.19065	0.391000	0.25143	-0.346000	0.07831	TTA	.		0.403	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
ZNF287	57336	hgsc.bcm.edu	37	17	16455209	16455209	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:16455209C>T	ENST00000395824.1	-	6	2864	c.2247G>A	c.(2245-2247)caG>caA	p.Q749Q	ZNF287_ENST00000395825.3_Silent_p.Q749Q			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	742					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		CACGTTGATGCTGAATAAGGT	0.378																																					p.Q749Q		.											.	.	.	0			c.G2247A						.						192.0	184.0	187.0					17																	16455209		2203	4300	6503	SO:0001819	synonymous_variant	57336	exon6			TTGATGCTGAATA	AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.2247G>A	17.37:g.16455209C>T		Somatic	90	0		WXS	Illumina HiSeq	.	95	4	NM_020653	Q6IAG1	Silent	SNP	ENST00000395824.1	37	CCDS11179.2																																																																																			.		0.378	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130504.1		
IFNL3	282617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39734285	39734285	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:39734285T>C	ENST00000413851.2	-	5	616	c.578A>G	c.(577-579)gAc>gGc	p.D193G		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	193					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											GACACACAGGTCCCCGCTGGC	0.517																																					p.D193G		.											.	.	.	0			c.A578G						.						45.0	44.0	44.0					19																	39734285		2203	4300	6503	SO:0001583	missense	282617	exon5			CACAGGTCCCCGC	AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.578A>G	19.37:g.39734285T>C	ENSP00000409000:p.Asp193Gly	Somatic	105	0		WXS	Illumina HiSeq	.	62	30	NM_172139	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Missense_Mutation	SNP	ENST00000413851.2	37	CCDS12530.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.190275	0.38707	.	.	ENSG00000197110	ENST00000413851	T	0.35236	1.32	3.53	-0.329	0.12686	.	0.779715	0.11610	N	0.546879	T	0.45418	0.1341	M	0.83483	2.645	0.09310	N	1	P	0.48911	0.917	P	0.49708	0.62	T	0.37798	-0.9690	10	0.72032	D	0.01	-2.9492	4.7276	0.12948	0.0:0.1229:0.4307:0.4464	.	193	Q8IZI9	IL28B_HUMAN	G	193	ENSP00000409000:D193G	ENSP00000409000:D193G	D	-	2	0	IL28B	44426125	0.001000	0.12720	0.002000	0.10522	0.020000	0.10135	0.538000	0.23160	-0.237000	0.09739	0.172000	0.16884	GAC	.		0.517	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463832.1	NM_172139	
GIMAP6	474344	hgsc.bcm.edu	37	7	150324841	150324841	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:150324841G>A	ENST00000328902.5	-	3	1061	c.845C>T	c.(844-846)gCc>gTc	p.A282V	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	282						cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCATCTGTGGGCTTCCTCAGA	0.587																																					p.A352V		.											GIMAP6,NS,carcinoma,0,1	GIMAP6	0	0			c.C1055T						.						87.0	74.0	79.0					7																	150324841		2203	4300	6503	SO:0001583	missense	474344	exon3			CTGTGGGCTTCCT	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.845C>T	7.37:g.150324841G>A	ENSP00000330374:p.Ala282Val	Somatic	51	0		WXS	Illumina HiSeq	.	26	2	NM_001244072	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572493	0.28092	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.05925	3.37	3.3	-1.69	0.08186	.	2.954240	0.01187	N	0.007228	T	0.04543	0.0124	L	0.27053	0.805	0.09310	N	1	B;B	0.22003	0.063;0.025	B;B	0.19666	0.026;0.006	T	0.34576	-0.9823	10	0.16420	T	0.52	.	2.4116	0.04426	0.2901:0.0:0.3113:0.3986	.	282;202	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	V	282;343	ENSP00000330374:A282V	ENSP00000330374:A282V	A	-	2	0	GIMAP6	149955774	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.072000	0.11486	-0.196000	0.10366	-0.345000	0.07892	GCC	.		0.587	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
TFAP2D	83741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	50696636	50696636	+	Silent	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:50696636T>C	ENST00000008391.3	+	4	894	c.666T>C	c.(664-666)agT>agC	p.S222S	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CCCTTCTTAGTTCTACTTCCA	0.478																																					p.S222S		.											.	.	.	0			c.T666C						.						104.0	103.0	103.0					6																	50696636		2203	4300	6503	SO:0001819	synonymous_variant	83741	exon4			TCTTAGTTCTACT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.666T>C	6.37:g.50696636T>C		Somatic	48	0		WXS	Illumina HiSeq	.	27	16	NM_172238		Silent	SNP	ENST00000008391.3	37	CCDS4933.1																																																																																			.		0.478	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
UNC79	57578	hgsc.bcm.edu;bcgsc.ca	37	14	93994975	93994975	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:93994975C>T	ENST00000393151.2	+	9	1035	c.1035C>T	c.(1033-1035)tgC>tgT	p.C345C	UNC79_ENST00000256339.4_Silent_p.C168C|UNC79_ENST00000555664.1_Silent_p.C345C|UNC79_ENST00000553484.1_Silent_p.C345C			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	345					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GTGAAGAATGCAGCGAGAGGA	0.378																																					p.C168C		.											.	.	.	0			c.C504T						.						104.0	99.0	101.0					14																	93994975		2203	4300	6503	SO:0001819	synonymous_variant	57578	exon9			AGAATGCAGCGAG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1035C>T	14.37:g.93994975C>T		Somatic	77	0		WXS	Illumina HiSeq	.	81	4	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																				.		0.378	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	18895427	18895427	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:18895427C>A	ENST00000446231.2	-	9	1496	c.1084G>T	c.(1084-1086)Ggt>Tgt	p.G362C	SMG1_ENST00000389467.3_Missense_Mutation_p.G362C|SMG1_ENST00000565224.1_Missense_Mutation_p.G336C			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	362	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						AGAAACTGACCAAGAAGAGTA	0.383																																					p.G362C		.											.	.	.	0			c.G1084T						.						47.0	42.0	43.0					16																	18895427		1817	4074	5891	SO:0001583	missense	23049	exon9			ACTGACCAAGAAG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.1084G>T	16.37:g.18895427C>A	ENSP00000402515:p.Gly362Cys	Somatic	305	0		WXS	Illumina HiSeq	.	348	45	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.145697	0.77888	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.18810	2.19;2.19	5.17	5.17	0.71159	Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.45637	0.1352	L	0.56769	1.78	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.37407	-0.9707	10	0.66056	D	0.02	.	19.0192	0.92906	0.0:1.0:0.0:0.0	.	362	Q96Q15	SMG1_HUMAN	C	362	ENSP00000402515:G362C;ENSP00000374118:G362C	ENSP00000374118:G362C	G	-	1	0	SMG1	18802928	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.647000	0.83462	2.577000	0.86979	0.555000	0.69702	GGT	.		0.383	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000359597.4_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000445888.2_Missense_Mutation_p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S241F	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,147	TP53_ENST00000545858	0	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	c.C722T	GRCh37	CM920673	TP53	M	rs28934573	.						139.0	108.0	118.0					17																	7577559		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATGCAGGAACTGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	17.37:g.7577559G>A	ENSP00000269305:p.Ser241Phe	Somatic	32	0		WXS	Illumina HiSeq	.	24	14	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CLSTN1	22883	broad.mit.edu;bcgsc.ca	37	1	9811620	9811620	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:9811620G>A	ENST00000377298.4	-	5	1352	c.560C>T	c.(559-561)gCc>gTc	p.A187V	CLSTN1_ENST00000361311.4_Missense_Mutation_p.A177V|CLSTN1_ENST00000377288.3_Missense_Mutation_p.A187V	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GGCATCCACGGCCTCCACCCT	0.527																																					p.A187V													.	CLSTN1	88	0			c.C560T						.						114.0	101.0	106.0					1																	9811620		2203	4300	6503	SO:0001583	missense	22883	exon5			TCCACGGCCTCCA	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.560C>T	1.37:g.9811620G>A	ENSP00000366513:p.Ala187Val	Somatic	52	0		WXS	Illumina GAIIx	Phase_I	28	3	NM_001009566	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	ENST00000377298.4	37	CCDS30580.1	.	.	.	.	.	.	.	.	.	.	G	36	5.668902	0.96754	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.91	5.91	0.95273	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.82089	0.4961	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.84644	0.0697	10	0.87932	D	0	-50.7651	20.2985	0.98592	0.0:0.0:1.0:0.0	.	187;177;187	B4E3Q1;O94985-2;O94985	.;.;CSTN1_HUMAN	V	187;177;7;187;187	ENSP00000366513:A187V;ENSP00000354997:A177V;ENSP00000401934:A7V;ENSP00000366502:A187V	ENSP00000354997:A177V	A	-	2	0	CLSTN1	9734207	1.000000	0.71417	0.975000	0.42487	0.949000	0.60115	9.835000	0.99442	2.793000	0.96121	0.655000	0.94253	GCC	.		0.527	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
LINC00303	284573	broad.mit.edu	37	1	204001795	204001795	+	lincRNA	DEL	A	A	-	rs67373210|rs572570826	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:204001795delA	ENST00000367207.3	-	0	1670							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		TCTTGCTATTAAAAAAAAAAA	0.343													|||unknown(HR)	714	0.142572	0.4501	0.0663	5008	,	,		24454	0.0099		0.0447	False		,,,				2504	0.0184				.													.	.	.	0			.						.																																					0	.			GCTATTAAAAAAA	AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204001795delA		Somatic	8	0		WXS	Illumina GAIIx	Phase_I	8	3	.	Q3SY06|Q8N7U1	RNA	DEL	ENST00000367207.3	37																																																																																				.		0.343	LINC00303-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000087885.3	NR_027902	
CCNYL2	414194	broad.mit.edu	37	10	42965532	42965532	+	RNA	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr10:42965532G>A	ENST00000483242.3	-	0	620					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						TCACTTACTTGCATGAAGTAC	0.418																																					.													.	.	.	0			.						.																																					414194	.			TTACTTGCATGAA	BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42965532G>A		Somatic	53	0		WXS	Illumina GAIIx	Phase_I	52	6	.		RNA	SNP	ENST00000483242.3	37																																																																																				.		0.418	CCNYL2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047670.5	XM_936368	
BMS1	9790	broad.mit.edu	37	10	43318571	43318571	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr10:43318571G>A	ENST00000374518.5	+	20	3201	c.3138G>A	c.(3136-3138)atG>atA	p.M1046I		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1046					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.M1046I(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGTAGGGAATGTTTAATTCTG	0.393																																					p.M1046I													BMS1,NS,carcinoma,0,2	BMS1	132	1	Substitution - Missense(1)	endometrium(1)	c.G3138A						.						74.0	83.0	80.0					10																	43318571		2202	4297	6499	SO:0001583	missense	9790	exon20			GGGAATGTTTAAT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3138G>A	10.37:g.43318571G>A	ENSP00000363642:p.Met1046Ile	Somatic	317	1		WXS	Illumina GAIIx	Phase_I	354	6	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485181	0.63962	.	.	ENSG00000165733	ENST00000374518	T	0.26957	1.7	4.54	4.54	0.55810	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	M	0.86953	2.85	0.80722	D	1	B	0.14438	0.01	B	0.17433	0.018	T	0.48636	-0.9018	10	0.72032	D	0.01	.	17.7203	0.88349	0.0:0.0:1.0:0.0	.	1046	Q14692	BMS1_HUMAN	I	1046	ENSP00000363642:M1046I	ENSP00000363642:M1046I	M	+	3	0	BMS1	42638577	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.443000	0.97568	2.250000	0.74265	0.454000	0.30748	ATG	.		0.393	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
UBE2L6	9246	broad.mit.edu	37	11	57322034	57322034	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:57322034C>T	ENST00000287156.4	-	3	381	c.186G>A	c.(184-186)ccG>ccA	p.P62P	UBE2L6_ENST00000340573.4_5'UTR	NM_004223.4	NP_004214.1	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6	62					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|ovary(1)	5						GAGGCTTGAACGGATACTCCG	0.537																																					p.P62P													.	UBE2L6	20	0			c.G186A						.						188.0	173.0	178.0					11																	57322034		2201	4296	6497	SO:0001819	synonymous_variant	9246	exon3			CTTGAACGGATAC	AF031141, AK093462, BC032491	CCDS7960.1, CCDS7961.1	11q12.1	2008-02-01			ENSG00000156587	ENSG00000156587		"""Ubiquitin-conjugating enzymes E2"""	12490	protein-coding gene	gene with protein product		603890				9153201	Standard	NM_004223		Approved	UBCH8	uc001nkn.2	O14933	OTTHUMG00000167047	ENST00000287156.4:c.186G>A	11.37:g.57322034C>T		Somatic	44	1		WXS	Illumina GAIIx	Phase_I	35	4	NM_004223	A6NDM6|A8MY53|Q8N5D8|Q9UEZ0	Silent	SNP	ENST00000287156.4	37	CCDS7960.1																																																																																			.		0.537	UBE2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392657.1	NM_004223	
EIF1AD	84285	broad.mit.edu;ucsc.edu	37	11	65767103	65767103	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:65767103C>T	ENST00000312234.2	-	4	574	c.240G>A	c.(238-240)gtG>gtA	p.V80V	EIF1AD_ENST00000526451.1_Silent_p.V80V|EIF1AD_ENST00000525767.1_Silent_p.V28V|EIF1AD_ENST00000527249.1_Silent_p.V80V|EIF1AD_ENST00000529964.1_Silent_p.V80V|BANF1_ENST00000533166.1_5'Flank|BANF1_ENST00000312175.2_5'Flank|EIF1AD_ENST00000533544.1_Silent_p.V80V|BANF1_ENST00000445560.2_5'Flank	NM_001242481.1|NM_001242482.1|NM_001242483.1|NM_032325.3	NP_001229410.1|NP_001229411.1|NP_001229412.1|NP_115701.2	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A domain containing	80	S1-like. {ECO:0000255|PROSITE- ProRule:PRU00181}.					intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	translation initiation factor activity (GO:0003743)			lung(5)	5						TTTCAGCCTTCACCTTTTCTC	0.493																																					p.V80V													.	EIF1AD	10	0			c.G240A						.						125.0	110.0	115.0					11																	65767103		2201	4296	6497	SO:0001819	synonymous_variant	84285	exon4			AGCCTTCACCTTT	AK094129	CCDS8124.1	11q13.1	2009-05-27				ENSG00000175376			28147	protein-coding gene	gene with protein product						12477932	Standard	NM_001242482		Approved	MGC11102, haponin	uc001ogn.2	Q8N9N8		ENST00000312234.2:c.240G>A	11.37:g.65767103C>T		Somatic	15	0		WXS	Illumina GAIIx	Phase_I	19	4	NM_001242483	B2R4N5|Q9BSC1	Silent	SNP	ENST00000312234.2	37	CCDS8124.1																																																																																			.		0.493	EIF1AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391072.1	NM_032325	
SUGT1	10910	broad.mit.edu	37	13	53240953	53240953	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:53240953G>T	ENST00000343788.6	+	11	704	c.622G>T	c.(622-624)Gct>Tct	p.A208S	SUGT1_ENST00000535397.1_Missense_Mutation_p.A120S|SUGT1_ENST00000310528.8_Missense_Mutation_p.A176S	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	208	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		TTAGTTGTCTGCTTTGGTTAA	0.308																																					p.A208S													.	SUGT1	37	0			c.G622T						.						86.0	82.0	84.0					13																	53240953		2203	4298	6501	SO:0001583	missense	10910	exon11			TTGTCTGCTTTGG	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.622G>T	13.37:g.53240953G>T	ENSP00000367208:p.Ala208Ser	Somatic	57	0		WXS	Illumina GAIIx	Phase_I	67	3	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	37	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038331	0.93630	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	T;T;T	0.14144	2.53;2.53;2.53	6.07	6.07	0.98685	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.047832	0.85682	D	0.000000	T	0.42787	0.1218	M	0.81341	2.54	0.58432	D	0.999999	P;D;D;D	0.63880	0.93;0.993;0.993;0.992	P;D;D;D	0.70016	0.649;0.959;0.967;0.928	T	0.19128	-1.0315	10	0.72032	D	0.01	-15.6618	19.4154	0.94694	0.0:0.0:1.0:0.0	.	120;120;208;176	F5H5A9;B4DYC6;Q9Y2Z0;Q9Y2Z0-2	.;.;SUGT1_HUMAN;.	S	208;120;176	ENSP00000367208:A208S;ENSP00000443521:A120S;ENSP00000308067:A176S	ENSP00000308067:A176S	A	+	1	0	SUGT1	52138954	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.935000	0.70145	2.884000	0.98904	0.655000	0.94253	GCT	.		0.308	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
ZIC5	85416	broad.mit.edu	37	13	100622668	100622670	+	In_Frame_Del	DEL	GGC	GGC	-	rs71114653		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr13:100622668_100622670delGGC	ENST00000267294.4	-	1	1493_1495	c.1260_1262delGCC	c.(1258-1263)ccgcca>cca	p.420_421PP>P		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	420	Pro-rich.				cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cgggggcggtggcggcggcggcg	0.724																																					p.420_421del													.	ZIC5	38	0			c.1260_1262del						.																																			SO:0001651	inframe_deletion	85416	exon1			GGCGGTGGCGGCG	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1260_1262delGCC	13.37:g.100622677_100622679delGGC	ENSP00000267294:p.Pro424del	Somatic	6	0		WXS	Illumina GAIIx	Phase_I	24	8	NM_033132	Q5VYB0	In_Frame_Del	DEL	ENST00000267294.4	37	CCDS9494.2																																																																																			-|1.000;|0.000		0.724	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132	
AHNAK2	113146	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105411931	105411931	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:105411931T>C	ENST00000333244.5	-	7	9976	c.9857A>G	c.(9856-9858)gAt>gGt	p.D3286G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3286						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGTGCACCATCCAACTTGGC	0.602																																					p.D3286G													.	AHNAK2	719	0			c.A9857G						.						142.0	117.0	125.0					14																	105411931		1926	4109	6035	SO:0001583	missense	113146	exon7			GCACCATCCAACT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9857A>G	14.37:g.105411931T>C	ENSP00000353114:p.Asp3286Gly	Somatic	69	0		WXS	Illumina GAIIx	Phase_I	62	29	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	11.52	1.661730	0.29515	.	.	ENSG00000185567	ENST00000333244	T	0.00892	5.57	1.79	1.79	0.24919	.	.	.	.	.	T	0.01454	0.0047	M	0.79343	2.45	0.09310	N	1	B	0.21309	0.054	B	0.20184	0.028	T	0.44651	-0.9314	9	0.36615	T	0.2	.	2.4425	0.04498	0.0:0.1871:0.2988:0.5142	.	3286	Q8IVF2	AHNK2_HUMAN	G	3286	ENSP00000353114:D3286G	ENSP00000353114:D3286G	D	-	2	0	AHNAK2	104482976	.	.	0.004000	0.12327	0.002000	0.02628	.	.	0.667000	0.31107	0.397000	0.26171	GAT	.		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DDX52	11056	broad.mit.edu	37	17	35974393	35974393	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:35974393delT	ENST00000349699.2	-	15	1791	c.1748delA	c.(1747-1749)aagfs	p.K583fs	DDX52_ENST00000394367.3_Frame_Shift_Del_p.K475fs|RP11-697E22.1_ENST00000591689.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	583	Lys-rich.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				ACCAGTGACCTTTTTCCTGTA	0.308																																					p.K583fs													.	DDX52	40	0			c.1748delA						.						80.0	74.0	76.0					17																	35974393		2201	4299	6500	SO:0001589	frameshift_variant	11056	exon15			GTGACCTTTTTCC	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1748delA	17.37:g.35974393delT	ENSP00000268854:p.Lys583fs	Somatic	115	0		WXS	Illumina GAIIx	Phase_I	2999	17	NM_007010	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Frame_Shift_Del	DEL	ENST00000349699.2	37	CCDS11323.1																																																																																			.		0.308	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
HDAC5	10014	broad.mit.edu	37	17	42165022	42165022	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:42165022G>T	ENST00000393622.2	-	13	1973	c.1642C>A	c.(1642-1644)Cac>Aac	p.H548N	HDAC5_ENST00000586802.1_Missense_Mutation_p.H548N|HDAC5_ENST00000336057.5_Missense_Mutation_p.H548N|HDAC5_ENST00000225983.6_Missense_Mutation_p.H549N	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	548					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		TCCTCAGGGTGGGTGGTGGGC	0.632																																					p.H549N													.	HDAC5	67	0			c.C1645A						.						95.0	101.0	99.0					17																	42165022		2203	4300	6503	SO:0001583	missense	10014	exon13			CAGGGTGGGTGGT	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1642C>A	17.37:g.42165022G>T	ENSP00000377244:p.His548Asn	Somatic	34	0		WXS	Illumina GAIIx	Phase_I	30	3	NM_001015053	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	37	CCDS45696.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422494	0.83559	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.53206	0.76;0.76;0.63	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.67627	0.2913	M	0.80616	2.505	0.58432	D	0.999999	D;D;D;D	0.61080	0.989;0.981;0.989;0.981	D;D;D;D	0.70487	0.969;0.932;0.969;0.932	T	0.67492	-0.5657	10	0.27082	T	0.32	-15.6939	15.4975	0.75666	0.0:0.0:1.0:0.0	.	548;548;549;548	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	N	549;548;548	ENSP00000225983:H549N;ENSP00000377244:H548N;ENSP00000337290:H548N	ENSP00000225983:H549N	H	-	1	0	HDAC5	39520548	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.453000	0.90349	2.187000	0.69744	0.491000	0.48974	CAC	.		0.632	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
TVP23C	201158	broad.mit.edu;bcgsc.ca	37	17	15441469	15441469	+	Intron	SNP	C	C	T	rs568909748	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:15441469C>T	ENST00000225576.3	-	5	558				TVP23C_ENST00000438826.3_Splice_Site|TVP23C_ENST00000583206.1_5'Flank|TVP23C_ENST00000428082.2_Splice_Site|TVP23C_ENST00000584811.1_Splice_Site|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAGTGTTCCGCAAAAGACA	0.393													c|||	3	0.000599042	0.0015	0.0	5008	,	,		17476	0.001		0.0	False		,,,				2504	0.0				.													.	.	.	0			.						.																																			SO:0001627	intron_variant	201158	.			GTGTTCCGCAAAA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7629G>A	17.37:g.15441469C>T		Somatic	130	1		WXS	Illumina GAIIx	Phase_I	94	5	.	Q3LIC7	Splice_Site	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	c	13.58	2.280351	0.40294	.	.	ENSG00000175106	ENST00000438826	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0583	0.25111	0.0:0.1033:0.0:0.8967	.	.	.	.	.	-1	.	.	.	-	.	.	FAM18B2	15382194	1.000000	0.71417	0.996000	0.52242	0.698000	0.40448	1.919000	0.40015	0.852000	0.35287	-0.352000	0.07741	.	.		0.393	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
LRRC37A4P	55073	broad.mit.edu	37	17	43587569	43587569	+	RNA	SNP	G	G	C	rs202189074		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:43587569G>C	ENST00000579913.1	-	0	1444				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		aactccgtctgaaaagaaaag	0.443																																					.													.	.	.	0			.						.																																					0	.			CCGTCTGAAAAGA	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43587569G>C		Somatic	64	2		WXS	Illumina GAIIx	Phase_I	76	10	.		RNA	SNP	ENST00000579913.1	37																																																																																				G|1.000;|0.000		0.443	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000445300.1	NR_002940	
NPEPPS	9520	broad.mit.edu	37	17	45663749	45663749	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:45663749G>A	ENST00000322157.4	+	8	1202	c.965G>A	c.(964-966)gGc>gAc	p.G322D	NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000544660.1_Missense_Mutation_p.G242D|NPEPPS_ENST00000530173.1_Missense_Mutation_p.G318D	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	322					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G322D(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GAGAACTGGGGCCTTGTTACT	0.313																																					p.G322D													NPEPPS,NS,carcinoma,0,2	NPEPPS	59	2	Substitution - Missense(2)	endometrium(2)	c.G965A						.						65.0	51.0	55.0					17																	45663749		1829	4069	5898	SO:0001583	missense	9520	exon8			ACTGGGGCCTTGT	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.965G>A	17.37:g.45663749G>A	ENSP00000320324:p.Gly322Asp	Somatic	126	0		WXS	Illumina GAIIx	Phase_I	149	4	NM_006310	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961429	0.74016	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11	5.71	5.71	0.89125	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.52306	0.1726	H	0.99535	4.615	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	T	0.74878	-0.3514	10	0.87932	D	0	.	19.8494	0.96733	0.0:0.0:1.0:0.0	rs1809279;rs1809279	318;322	E9PLK3;P55786	.;PSA_HUMAN	D	318;322;309;242;5;5	ENSP00000433287:G318D;ENSP00000320324:G322D;ENSP00000442461:G242D;ENSP00000435639:G5D;ENSP00000435966:G5D	ENSP00000320324:G322D	G	+	2	0	NPEPPS	43018748	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.016000	0.88706	2.705000	0.92388	0.585000	0.79938	GGC	G|0.500;A|0.500		0.313	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
HAAO	23498	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	43010487	43010487	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:43010487C>T	ENST00000294973.6	-	4	372	c.317G>A	c.(316-318)cGa>cAa	p.R106Q		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						CAGCCGCCTTCGCTCAACCAC	0.587																																					p.R106Q													.	HAAO	26	0			c.G317A						.						40.0	36.0	38.0					2																	43010487		2203	4300	6503	SO:0001583	missense	23498	exon4			CGCCTTCGCTCAA	Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.317G>A	2.37:g.43010487C>T	ENSP00000294973:p.Arg106Gln	Somatic	30	1		WXS	Illumina GAIIx	Phase_I	28	9	NM_012205		Missense_Mutation	SNP	ENST00000294973.6	37	CCDS33187.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952480	0.73787	.	.	ENSG00000162882	ENST00000294973;ENST00000431905	T;T	0.35048	1.33;1.33	4.69	4.69	0.59074	Cupin, RmlC-type (1);	0.000000	0.85682	D	0.000000	T	0.53642	0.1809	L	0.54863	1.705	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.54036	-0.8353	10	0.59425	D	0.04	.	12.9987	0.58662	0.0:1.0:0.0:0.0	.	106	P46952	3HAO_HUMAN	Q	106;72	ENSP00000294973:R106Q;ENSP00000412601:R72Q	ENSP00000294973:R106Q	R	-	2	0	HAAO	42863991	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.685000	0.68204	2.457000	0.83068	0.460000	0.39030	CGA	.		0.587	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325948.2		
BIN1	274	broad.mit.edu;bcgsc.ca	37	2	127811543	127811543	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr2:127811543G>T	ENST00000316724.5	-	13	1588	c.1177C>A	c.(1177-1179)Ctg>Atg	p.L393M	BIN1_ENST00000409400.1_Intron|BIN1_ENST00000393040.3_Intron|BIN1_ENST00000351659.3_Intron|BIN1_ENST00000466111.1_Intron|BIN1_ENST00000357970.3_Missense_Mutation_p.L350M|BIN1_ENST00000376113.2_Intron|BIN1_ENST00000393041.3_Intron|BIN1_ENST00000346226.3_Intron|BIN1_ENST00000259238.4_Intron|BIN1_ENST00000348750.4_Intron|BIN1_ENST00000352848.3_Intron	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	393	Clathrin-binding.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCAAAGTCCAGGTCCAGCAGA	0.647																																					p.L393M													.	BIN1	85	0			c.C1177A						.						25.0	26.0	26.0					2																	127811543		2120	4148	6268	SO:0001583	missense	274	exon13			AGTCCAGGTCCAG	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.1177C>A	2.37:g.127811543G>T	ENSP00000316779:p.Leu393Met	Somatic	84	2		WXS	Illumina GAIIx	Phase_I	57	27	NM_139343	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493806	0.64186	.	.	ENSG00000136717	ENST00000357970;ENST00000316724	T;T	0.72394	-0.45;-0.65	5.36	4.47	0.54385	.	0.223028	0.36972	N	0.002317	T	0.72969	0.3527	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.998;0.998	P;D	0.80764	0.904;0.994	T	0.67476	-0.5661	10	0.22706	T	0.39	-15.4853	9.4319	0.38615	0.1558:0.0:0.8442:0.0	.	350;393	O00499-5;O00499	.;BIN1_HUMAN	M	350;393	ENSP00000350654:L350M;ENSP00000316779:L393M	ENSP00000316779:L393M	L	-	1	2	BIN1	127528013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.708000	0.47152	2.533000	0.85409	0.456000	0.33151	CTG	.		0.647	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
ZNF512B	57473	broad.mit.edu	37	20	62594090	62594090	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr20:62594090C>T	ENST00000450537.1	-	13	2073	c.2013G>A	c.(2011-2013)ccG>ccA	p.P671P	ZNF512B_ENST00000369888.1_Silent_p.P671P|ZNF512B_ENST00000217130.3_Silent_p.P671P			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	671					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCACACCCAGCGGGTCCTCAG	0.697																																					p.P671P													ZNF512B,colon,carcinoma,-1,1	ZNF512B	72	0			c.G2013A						.						10.0	11.0	11.0					20																	62594090		2180	4257	6437	SO:0001819	synonymous_variant	57473	exon13			ACCCAGCGGGTCC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2013G>A	20.37:g.62594090C>T		Somatic	45	0		WXS	Illumina GAIIx	Phase_I	46	3	NM_020713	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.697	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
KRTAP27-1	643812	broad.mit.edu	37	21	31709645	31709645	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr21:31709645C>T	ENST00000382835.2	-	1	367	c.342G>A	c.(340-342)caG>caA	p.Q114Q		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	114						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						ATTGGCAAGGCTGAGAAACAC	0.522																																					p.Q114Q													.	KRTAP27-1	53	0			c.G342A						.						121.0	124.0	123.0					21																	31709645		2203	4300	6503	SO:0001819	synonymous_variant	643812	exon1			GCAAGGCTGAGAA	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.342G>A	21.37:g.31709645C>T		Somatic	32	0		WXS	Illumina GAIIx	Phase_I	22	3	NM_001077711		Silent	SNP	ENST00000382835.2	37	CCDS33532.1																																																																																			.		0.522	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
MLH1	4292	broad.mit.edu	37	3	37067150	37067150	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:37067150G>T	ENST00000231790.2	+	12	1277	c.1061G>T	c.(1060-1062)gGc>gTc	p.G354V	MLH1_ENST00000458205.2_Missense_Mutation_p.G113V|MLH1_ENST00000539477.1_Missense_Mutation_p.G113V|MLH1_ENST00000455445.2_Missense_Mutation_p.G113V|MLH1_ENST00000536378.1_Missense_Mutation_p.G113V|MLH1_ENST00000435176.1_Missense_Mutation_p.G256V	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	354					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						GGACTTGCTGGCCCCTCTGGG	0.358		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.G354V			yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	226	1	Whole gene deletion(1)	ovary(1)	c.G1061T	GRCh37	CD044147	MLH1	D		.						28.0	31.0	30.0					3																	37067150		2199	4300	6499	SO:0001583	missense	4292	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	TTGCTGGCCCCTC	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1061G>T	3.37:g.37067150G>T	ENSP00000231790:p.Gly354Val	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	27	3	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.56|10.56	1.384819|1.384819	0.25031|0.25031	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000537937;ENST00000456676|ENST00000231790;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378	.|D;D;D;D;D;D	.|0.93763	.|-3.28;-3.28;-3.28;-3.28;-3.28;-3.28	5.67|5.67	4.79|4.79	0.61399|0.61399	.|.	.|0.476362	.|0.23270	.|N	.|0.050024	D|D	0.83681|0.83681	0.5307|0.5307	N|N	0.14661|0.14661	0.345|0.345	0.27271|0.27271	N|N	0.958361|0.958361	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.04013	.|0.001;0.001;0.001	T|T	0.67673|0.67673	-0.5610|-0.5610	5|10	.|0.12103	.|T	.|0.63	-12.3212|-12.3212	8.2793|8.2793	0.31892|0.31892	0.0782:0.0:0.7655:0.1563|0.0782:0.0:0.7655:0.1563	.|.	.|256;354;354	.|E9PCU2;Q53GX1;P40692	.|.;.;MLH1_HUMAN	S|V	269;346|354;218;113;113;113;256;113	.|ENSP00000231790:G354V;ENSP00000402667:G113V;ENSP00000443665:G113V;ENSP00000398272:G113V;ENSP00000402564:G256V;ENSP00000444286:G113V	.|ENSP00000231790:G354V	A|G	+|+	1|2	0|0	MLH1|MLH1	37042154|37042154	0.983000|0.983000	0.35010|0.35010	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	2.169000|2.169000	0.42434|0.42434	2.671000|2.671000	0.90904|0.90904	0.557000|0.557000	0.71058|0.71058	GCC|GGC	.		0.358	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
HSPBAP1	79663	broad.mit.edu;bcgsc.ca	37	3	122459462	122459462	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:122459462G>A	ENST00000306103.2	-	8	1340	c.1197C>T	c.(1195-1197)tcC>tcT	p.S399S	HSPBAP1_ENST00000383659.1_3'UTR	NM_024610.5	NP_078886.2	Q96EW2	HBAP1_HUMAN	HSPB (heat shock 27kDa) associated protein 1	399						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(114;0.0531)		GCGGTTCTTCGGACCTCTGTG	0.507																																					p.S399S													.	HSPBAP1	32	0			c.C1197T						.						140.0	138.0	139.0					3																	122459462		2203	4300	6503	SO:0001819	synonymous_variant	79663	exon8			TTCTTCGGACCTC	AF400663	CCDS3017.1	3q21.1	2008-07-18	2002-08-29		ENSG00000169087	ENSG00000169087			16389	protein-coding gene	gene with protein product		608263	"""HSPB (heat shock 27kD) associated protein 1"""			11978969	Standard	NM_024610		Approved	FLJ22623, PASS1	uc003efu.2	Q96EW2	OTTHUMG00000159550	ENST00000306103.2:c.1197C>T	3.37:g.122459462G>A		Somatic	31	1		WXS	Illumina GAIIx	Phase_I	35	12	NM_024610	Q6P476|Q8N8J4|Q8NHH6|Q8WWF0	Silent	SNP	ENST00000306103.2	37	CCDS3017.1																																																																																			.		0.507	HSPBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356161.1	NM_024610	
SATB1	6304	broad.mit.edu	37	3	18391133	18391135	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:18391133_18391135delCTG	ENST00000338745.6	-	11	3553_3555	c.1819_1821delCAG	c.(1819-1821)cagdel	p.Q607del	SATB1_ENST00000454909.2_In_Frame_Del_p.Q607del|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000417717.2_In_Frame_Del_p.Q639del	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	607	Poly-Gln.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GCGGCGGTGCctgctgctgctgc	0.606																																					p.639_639del													.	SATB1	96	0			c.1915_1917del						.		,,	7,190,3727		2,0,3,5,180,1772					,,	-1.4	0.0			13	18,388,7346		2,0,14,7,374,3479	no	codingComplex,codingComplex,codingComplex	SATB1	NM_002971.4,NM_001195470.1,NM_001131010.2	,,	4,0,17,12,554,5251	A1A1,A1A2,A1R,A2A2,A2R,RR		5.2374,5.0204,5.1644	,,	,,		25,578,11073				SO:0001651	inframe_deletion	6304	exon12			CGGTGCCTGCTGC		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1819_1821delCAG	3.37:g.18391142_18391144delCTG	ENSP00000341024:p.Gln607del	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_001195470	B3KXF1|C9JTR6|Q59EQ0	In_Frame_Del	DEL	ENST00000338745.6	37	CCDS2631.1																																																																																			.		0.606	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
TMCC1	23023	broad.mit.edu	37	3	129370592	129370592	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:129370592T>A	ENST00000393238.3	-	6	2034	c.1694A>T	c.(1693-1695)cAg>cTg	p.Q565L	TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L|TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	565						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTGCTGCTGCTGCAGCTCCAT	0.572																																					p.Q565L													.	TMCC1	105	0			c.A1694T						.						79.0	76.0	77.0					3																	129370592		2203	4300	6503	SO:0001583	missense	23023	exon6			TGCTGCTGCAGCT	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1694A>T	3.37:g.129370592T>A	ENSP00000376930:p.Gln565Leu	Somatic	24	0		WXS	Illumina GAIIx	Phase_I	34	3	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009576	0.75046	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	L	0.46614	1.455	0.80722	D	1	D;D	0.67145	0.996;0.985	D;D	0.85130	0.997;0.973	T	0.58278	-0.7664	10	0.33940	T	0.23	-18.4911	15.1509	0.72696	0.0:0.0:0.0:1.0	.	386;565	B4DE04;O94876	.;TMCC1_HUMAN	L	241;565;451;386	ENSP00000404711:Q241L;ENSP00000376930:Q565L;ENSP00000389892:Q451L;ENSP00000327349:Q386L	ENSP00000327349:Q386L	Q	-	2	0	TMCC1	130853282	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.735000	0.84939	2.172000	0.68678	0.533000	0.62120	CAG	.		0.572	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
SI	6476	broad.mit.edu	37	3	164785167	164785167	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:164785167A>G	ENST00000264382.3	-	6	658	c.596T>C	c.(595-597)tTt>tCt	p.F199S		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	199	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTGGATGCTAAATGGGTTTTG	0.303										HNSCC(35;0.089)																											p.F199S													.	SI	500	0			c.T596C						.						101.0	102.0	102.0					3																	164785167		2203	4298	6501	SO:0001583	missense	6476	exon6			ATGCTAAATGGGT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.596T>C	3.37:g.164785167A>G	ENSP00000264382:p.Phe199Ser	Somatic	192	1		WXS	Illumina GAIIx	Phase_I	239	6	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035748	0.54896	.	.	ENSG00000090402	ENST00000264382	T	0.32988	1.43	5.25	5.25	0.73442	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	H	0.97540	4.025	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.80650	-0.1288	10	0.51188	T	0.08	.	15.4536	0.75297	1.0:0.0:0.0:0.0	.	199	P14410	SUIS_HUMAN	S	199	ENSP00000264382:F199S	ENSP00000264382:F199S	F	-	2	0	SI	166267861	1.000000	0.71417	0.833000	0.33012	0.178000	0.23041	7.591000	0.82666	2.115000	0.64714	0.467000	0.42956	TTT	.		0.303	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
MUC4	4585	broad.mit.edu	37	3	195510149	195510149	+	Missense_Mutation	SNP	G	G	A	rs542186658	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:195510149G>A	ENST00000463781.3	-	2	8761	c.8302C>T	c.(8302-8304)Cct>Tct	p.P2768S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2768S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2768S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGCGTGA	0.577													.|||	2	0.000399361	0.0015	0.0	5008	,	,		5215	0.0		0.0	False		,,,				2504	0.0				p.P2768S													MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	1	Substitution - Missense(1)	endometrium(1)	c.C8302T						.																																			SO:0001583	missense	4585	exon2			GAAGAGGGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8302C>T	3.37:g.195510149G>A	ENSP00000417498:p.Pro2768Ser	Somatic	68	1		WXS	Illumina GAIIx	Phase_I	77	9	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.381	0.255488	0.10185	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27256	1.68;1.68	1.02	-2.03	0.07365	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33523	-0.9865	8	.	.	.	.	2.0272	0.03521	0.2702:0.0:0.2738:0.456	.	2640	E7ESK3	.	S	2768	ENSP00000417498:P2768S;ENSP00000420243:P2768S	.	P	-	1	0	MUC4	196994928	0.000000	0.05858	0.010000	0.14722	0.113000	0.19764	-2.060000	0.01392	-0.413000	0.07507	0.074000	0.15403	CCT	.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
BRD9	65980	broad.mit.edu	37	5	891803	891805	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:891803_891805delCTT	ENST00000467963.1	-	2	383_385	c.217_219delAAG	c.(217-219)aagdel	p.K73del	BRD9_ENST00000388890.4_5'Flank|BRD9_ENST00000323510.4_5'Flank|BRD9_ENST00000435709.2_5'UTR|BRD9_ENST00000483173.1_In_Frame_Del_p.R21del|TRIP13_ENST00000166345.3_5'Flank	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	73	Lys-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CCTTCTCGGActtcttcttcttc	0.547																																					p.73_73del													.	BRD9	113	0			c.217_219del						.		,	4,2404		0,4,1200					,	0.7	0.8			98	16,4654		3,10,2322	no	coding,coding	BRD9	NM_023924.4,NM_001009877.2	,	3,14,3522	A1A1,A1R,RR		0.3426,0.1661,0.2826	,	,		20,7058				SO:0001651	inframe_deletion	65980	exon2			CTCGGACTTCTTC	AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.217_219delAAG	5.37:g.891812_891814delCTT	ENSP00000419765:p.Lys73del	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	267	6	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	In_Frame_Del	DEL	ENST00000467963.1	37	CCDS34127.2																																																																																			.		0.547	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
MLLT4	4301	broad.mit.edu	37	6	168289932	168289932	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:168289932A>G	ENST00000447894.2	+	7	935	c.935A>G	c.(934-936)aAg>aGg	p.K312R	MLLT4_ENST00000392108.3_Missense_Mutation_p.K312R|MLLT4_ENST00000366806.2_Missense_Mutation_p.K312R|MLLT4_ENST00000392112.1_Missense_Mutation_p.K311R|MLLT4_ENST00000351017.4_Missense_Mutation_p.K312R|MLLT4_ENST00000400822.3_Missense_Mutation_p.K311R|MLLT4_ENST00000344191.4_Missense_Mutation_p.K312R			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	312	Ras-associating 2. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCTGATGAAAAGGGTGCTAAA	0.338			T	MLL	AL																																p.K312R				Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	MLLT4,NS,carcinoma,-1,1	MLLT4	351	0			c.A935G						.						156.0	157.0	157.0					6																	168289932		2203	4296	6499	SO:0001583	missense	4301	exon7			ATGAAAAGGGTGC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.935A>G	6.37:g.168289932A>G	ENSP00000404595:p.Lys312Arg	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	40	3	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		.	.	.	.	.	.	.	.	.	.	A	12.61	1.990802	0.35131	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.38	3.07	0.35406	.	0.107097	0.64402	N	0.000008	T	0.04407	0.0121	L	0.40543	1.245	0.45390	D	0.998376	B;B;B;B	0.13145	0.001;0.001;0.0;0.007	B;B;B;B	0.14023	0.01;0.005;0.002;0.009	T	0.25847	-1.0120	10	0.20046	T	0.44	-13.2169	6.81	0.23799	0.7742:0.0:0.2258:0.0	.	25;311;312;311	Q96C95;P55196-5;P55196-6;P55196-2	.;.;.;.	R	312;312;312;312;311;312;311;312	ENSP00000341118:K312R;ENSP00000252692:K312R;ENSP00000375956:K312R;ENSP00000355771:K312R;ENSP00000375960:K311R;ENSP00000383623:K311R;ENSP00000404595:K312R	ENSP00000345834:K312R	K	+	2	0	MLLT4	168032781	1.000000	0.71417	0.833000	0.33012	0.900000	0.52787	4.435000	0.59941	0.375000	0.24679	0.533000	0.62120	AAG	.		0.338	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
CCT6P3	643180	broad.mit.edu	37	7	64530103	64530103	+	RNA	SNP	G	G	A	rs369683052		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:64530103G>A	ENST00000426828.1	+	0	923				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TGACTGCTTGGGACATGCAGG	0.388																																					.													.	.	.	0			.						.																																					0	.			TGCTTGGGACATG			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64530103G>A		Somatic	92	0		WXS	Illumina GAIIx	Phase_I	98	4	.		RNA	SNP	ENST00000426828.1	37																																																																																				.		0.388	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000344862.1		
MMP16	4325	broad.mit.edu	37	8	89053972	89053972	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:89053972A>T	ENST00000286614.6	-	10	1822	c.1541T>A	c.(1540-1542)aTa>aAa	p.I514K		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	514					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TACCTTGAGTATCTGGTTGTT	0.423																																					p.I514K													.	MMP16	176	0			c.T1541A						.						207.0	176.0	186.0					8																	89053972		2203	4300	6503	SO:0001583	missense	4325	exon10			TTGAGTATCTGGT	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1541T>A	8.37:g.89053972A>T	ENSP00000286614:p.Ile514Lys	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	35	3	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	A	2.684	-0.274592	0.05679	.	.	ENSG00000156103	ENST00000286614	T	0.07114	3.22	5.86	5.86	0.93980	Hemopexin/matrixin (2);	0.347772	0.35970	N	0.002877	T	0.01695	0.0054	N	0.00176	-1.92	0.49130	D	0.999758	B	0.02656	0.0	B	0.01281	0.0	T	0.40997	-0.9533	10	0.02654	T	1	.	11.3518	0.49592	0.8646:0.0:0.0:0.1354	.	514	P51512	MMP16_HUMAN	K	514	ENSP00000286614:I514K	ENSP00000286614:I514K	I	-	2	0	MMP16	89123088	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.735000	0.55044	2.232000	0.73038	0.533000	0.62120	ATA	.		0.423	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
MT-CO1	4512	broad.mit.edu	37	M	5970	5970	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrM:5970G>A	ENST00000361624.2	+	1	67	c.67G>A	c.(67-69)Ggc>Agc	p.G23S	MT-TC_ENST00000387405.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	23					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACCTATTATTCGGCGCATGAG	0.507																																					p.G23S													.	.	.	0			c.G67A						.																																			SO:0001583	missense	4512	exon1			TTATTCGGCGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.67G>A	M.37:g.5970G>A	ENSP00000354499:p.Gly23Ser	Somatic	44	0		WXS	Illumina GAIIx	Phase_I	53	9	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	37																																																																																				.		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
FGF16	8823	broad.mit.edu;ucsc.edu	37	X	76709751	76709751	+	Splice_Site	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:76709751G>A	ENST00000439435.1	+	1	104	c.104G>A	c.(103-105)cGa>cAa	p.R35Q				O43320	FGF16_HUMAN	fibroblast growth factor 16	0					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of brown fat cell proliferation (GO:0070349)|response to temperature stimulus (GO:0009266)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(1)|lung(2)	4						TCTATGGGTCGGTAAGTTTAA	0.393																																					p.S35S													.	FGF16	16	0			c.G105A						.						66.0	56.0	59.0					X																	76709751		1841	4075	5916	SO:0001630	splice_region_variant	8823	exon1			TGGGTCGGTAAGT	AB009391	CCDS75996.1	Xq21.1	2014-01-31			ENSG00000196468	ENSG00000196468			3672	protein-coding gene	gene with protein product		300827	"""metacarpal 4-5 fusion"""	MF4		9473496, 11474196, 23709756	Standard	NM_003868		Approved		uc011mqp.2	O43320	OTTHUMG00000013133	ENST00000439435.1:c.104+1G>A	X.37:g.76709751G>A		Somatic	58	0		WXS	Illumina GAIIx	Phase_I	67	21	NM_003868		Splice_Site	SNP	ENST00000439435.1	37		.	.	.	.	.	.	.	.	.	.	G	14.39	2.520520	0.44866	.	.	ENSG00000196468	ENST00000439435	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	T	0.71039	0.3293	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.75560	-0.3275	3	.	.	.	.	16.3197	0.82945	0.0:0.0:1.0:0.0	.	.	.	.	Q	35	.	.	R	+	2	0	FGF16	76596407	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.923000	0.56469	2.107000	0.64212	0.600000	0.82982	CGA	.		0.393	FGF16-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000036814.1	NM_003868	Missense_Mutation
MSN	4478	broad.mit.edu	37	X	64956743	64956743	+	Missense_Mutation	SNP	A	A	G	rs200135811		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:64956743A>G	ENST00000360270.5	+	9	1218	c.1046A>G	c.(1045-1047)gAg>gGg	p.E349G		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	349					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)	p.E349G(1)	MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						gagctgatggagaggctgaag	0.493			T	ALK	ALCL																																p.E349G				Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	89	1	Substitution - Missense(1)	skin(1)	c.A1046G						.						105.0	84.0	91.0					X																	64956743		2203	4299	6502	SO:0001583	missense	4478	exon9			TGATGGAGAGGCT	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1046A>G	X.37:g.64956743A>G	ENSP00000353408:p.Glu349Gly	Somatic	47	1		WXS	Illumina GAIIx	Phase_I	66	3	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	A	15.36	2.810728	0.50421	.	.	ENSG00000147065	ENST00000360270	D	0.83837	-1.77	4.56	3.39	0.38822	Ezrin/radixin/moesin, C-terminal (1);	0.283599	0.40385	N	0.001109	D	0.83431	0.5253	M	0.85945	2.785	0.58432	D	0.999995	B	0.27229	0.172	B	0.36186	0.219	T	0.77338	-0.2625	10	0.34782	T	0.22	.	5.9609	0.19299	0.8811:0.0:0.1189:0.0	.	349	P26038	MOES_HUMAN	G	349	ENSP00000353408:E349G	ENSP00000353408:E349G	E	+	2	0	MSN	64873468	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.780000	0.75063	0.705000	0.31890	0.481000	0.45027	GAG	.		0.493	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
L1CAM	3897	broad.mit.edu;bcgsc.ca	37	X	153149697	153149697	+	Intron	SNP	G	G	A	rs375989685		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:153149697G>A	ENST00000370060.1	-	1	82				LCA10_ENST00000357566.1_Missense_Mutation_p.D8N|L1CAM_ENST00000370055.1_Intron|L1CAM_ENST00000484587.1_5'UTR	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCAGTACACGACTGCCCATC	0.622																																					.													.	.	.	0			.						.	G		1,3832		0,1,1631,569	37.0	27.0	31.0			0.7	0.0	X		31	0,6724		0,0,2428,1868	no	intergenic				0,1,4059,2437	AA,AG,GG,G		0.0,0.0261,0.0095			153149697	1,10556	2201	4296	6497	SO:0001627	intron_variant	0	.			GTACACGACTGCC	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.107+1821C>T	X.37:g.153149697G>A		Somatic	44	0		WXS	Illumina GAIIx	Phase_I	26	10	.	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	g	11.67	1.707201	0.30232	2.61E-4	0.0	ENSG00000196987	ENST00000357566	.	.	.	2.54	0.734	0.18294	.	.	.	.	.	T	0.37679	0.1012	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36962	-0.9726	5	0.87932	D	0	.	4.3753	0.11267	0.3572:0.0:0.6428:0.0	.	.	.	.	N	8	.	ENSP00000350178:D8N	D	+	1	0	U52112.12	152802891	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.008000	0.13197	0.080000	0.16959	0.366000	0.22137	GAC	.		0.622	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
ABCA4	24	ucsc.edu;bcgsc.ca	37	1	94486813	94486813	+	Silent	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:94486813C>T	ENST00000370225.3	-	35	5087	c.5001G>A	c.(4999-5001)caG>caA	p.Q1667Q	ABCA4_ENST00000536513.1_5'Flank	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1667					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCTCTGAGAGCTGCTCCTTGG	0.557																																					p.Q1667Q													.	ABCA4	275	0			c.G5001A						.						205.0	196.0	199.0					1																	94486813		2203	4300	6503	SO:0001819	synonymous_variant	24	exon35			TGAGAGCTGCTCC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5001G>A	1.37:g.94486813C>T		Somatic	44	0		WXS	Illumina HiSeq		24	4	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.557	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
DRD5	1816	ucsc.edu	37	4	9783917	9783917	+	Silent	SNP	T	T	C	rs76288744		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:9783917T>C	ENST00000304374.2	+	1	660	c.264T>C	c.(262-264)ctT>ctC	p.L88L		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	88			L -> R (in dbSNP:rs6282). {ECO:0000269|PubMed:10391209}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TGTCAGACCTTTTCGTGGCGC	0.637																																					p.L88L													.	DRD5	119	0			c.T264C						.						55.0	48.0	50.0					4																	9783917		2203	4300	6503	SO:0001819	synonymous_variant	1816	exon1			AGACCTTTTCGTG	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.264T>C	4.37:g.9783917T>C		Somatic	40	5		WXS	Illumina HiSeq		34	9	NM_000798	B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	CCDS3405.1																																																																																			.		0.637	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
CEP85L	387119	ucsc.edu;bcgsc.ca	37	6	118886922	118886922	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:118886922G>A	ENST00000368491.3	-	3	1411	c.790C>T	c.(790-792)Ccc>Tcc	p.P264S	CEP85L_ENST00000419517.2_Missense_Mutation_p.P264S|CEP85L_ENST00000392500.3_Missense_Mutation_p.P267S|CEP85L_ENST00000368488.5_Missense_Mutation_p.P267S|CEP85L_ENST00000472713.1_5'UTR|CEP85L_ENST00000360290.3_Missense_Mutation_p.P162S	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	264						centrosome (GO:0005813)|cytoplasm (GO:0005737)											GTCATAATGGGCTTGCTTTCA	0.448																																					p.P267S													.	CEP85L	26	0			c.C799T						.						112.0	108.0	110.0					6																	118886922		2203	4300	6503	SO:0001583	missense	387119	exon4			TAATGGGCTTGCT	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.790C>T	6.37:g.118886922G>A	ENSP00000357477:p.Pro264Ser	Somatic	41	0		WXS	Illumina HiSeq		36	4	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493788	0.26774	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000360290;ENST00000419517	T;T;T;T;T;T	0.23552	3.09;3.09;2.5;2.23;1.9;2.24	6.07	1.89	0.25635	.	0.333921	0.32372	N	0.006183	T	0.08088	0.0202	L	0.27053	0.805	0.44635	D	0.997616	B;B;B;B;B	0.26081	0.012;0.081;0.141;0.141;0.084	B;B;B;B;B	0.26202	0.027;0.046;0.046;0.067;0.028	T	0.10132	-1.0643	10	0.42905	T	0.14	-0.9603	11.8106	0.52181	0.2727:0.0:0.7273:0.0	.	162;267;264;267;264	B4DYT2;Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;.;CF204_HUMAN	S	264;267;267;267;162;264	ENSP00000357477:P264S;ENSP00000357474:P267S;ENSP00000392131:P267S;ENSP00000376288:P267S;ENSP00000353434:P162S;ENSP00000393317:P264S	ENSP00000353434:P162S	P	-	1	0	C6orf204	118993615	1.000000	0.71417	0.983000	0.44433	0.789000	0.44602	1.575000	0.36493	0.473000	0.27368	-0.136000	0.14681	CCC	.		0.448	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
RPS6KA2	6196	ucsc.edu;bcgsc.ca	37	6	166826350	166826350	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr6:166826350G>T	ENST00000265678.4	-	21	2325	c.2102C>A	c.(2101-2103)gCt>gAt	p.A701D	RPS6KA2_ENST00000510118.1_Missense_Mutation_p.A726D|RPS6KA2_ENST00000509742.1_5'UTR|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.A709D|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.A612D|RPS6KA2_ENST00000481261.2_Missense_Mutation_p.A612D	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	701					axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TCTGTTTAGAGCAAAGTAGGT	0.647																																					p.A709D													.	RPS6KA2	212	0			c.C2126A						.						28.0	30.0	29.0					6																	166826350		2177	4269	6446	SO:0001583	missense	6196	exon22			TTTAGAGCAAAGT	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.2102C>A	6.37:g.166826350G>T	ENSP00000265678:p.Ala701Asp	Somatic	30	0		WXS	Illumina HiSeq		36	4	NM_001006932	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.640451	0.87859	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	4.38	4.38	0.52667	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.60919	0.2306	M	0.89904	3.07	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.999	T	0.70230	-0.4929	10	0.56958	D	0.05	.	16.3563	0.83236	0.0:0.0:1.0:0.0	.	726;709;701	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	D	701;726;709;612;612	ENSP00000265678:A701D;ENSP00000422435:A726D;ENSP00000427015:A709D;ENSP00000422484:A612D;ENSP00000386050:A612D	ENSP00000265678:A701D	A	-	2	0	RPS6KA2	166746340	1.000000	0.71417	0.653000	0.29593	0.925000	0.55904	8.676000	0.91199	2.168000	0.68352	0.558000	0.71614	GCT	.		0.647	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
TMEM132A	54972	ucsc.edu;bcgsc.ca	37	11	60696291	60696291	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr11:60696291C>T	ENST00000453848.2	+	4	883	c.725C>T	c.(724-726)gCa>gTa	p.A242V	TMEM132A_ENST00000005286.4_Missense_Mutation_p.A242V			Q24JP5	T132A_HUMAN	transmembrane protein 132A	242						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CTGCGCCCAGCAGACCCCCCG	0.692																																					p.A242V													.	TMEM132A	135	0			c.C725T						.						22.0	23.0	23.0					11																	60696291		2200	4291	6491	SO:0001583	missense	54972	exon4			GCCCAGCAGACCC	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.725C>T	11.37:g.60696291C>T	ENSP00000405823:p.Ala242Val	Somatic	27	0		WXS	Illumina HiSeq		30	4	NM_178031	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	C	5.437	0.265789	0.10294	.	.	ENSG00000006118	ENST00000453848;ENST00000005286	T;T	0.06068	3.35;3.35	4.38	2.35	0.29111	.	0.577689	0.15222	N	0.273917	T	0.05181	0.0138	L	0.38838	1.175	0.09310	N	1	B;B;B	0.15141	0.012;0.007;0.007	B;B;B	0.13407	0.009;0.009;0.009	T	0.38650	-0.9651	10	0.87932	D	0	.	2.8119	0.05444	0.3288:0.4252:0.1529:0.0931	.	231;242;242	Q24JP5-3;Q24JP5;Q24JP5-2	.;T132A_HUMAN;.	V	242	ENSP00000405823:A242V;ENSP00000005286:A242V	ENSP00000005286:A242V	A	+	2	0	TMEM132A	60452867	0.000000	0.05858	0.279000	0.24732	0.258000	0.26162	-0.180000	0.09754	0.336000	0.23639	0.555000	0.69702	GCA	.		0.692	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
DPY19L2	283417	ucsc.edu	37	12	63964599	63964599	+	Missense_Mutation	SNP	T	T	C	rs557778926	byFrequency	TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:63964599T>C	ENST00000324472.4	-	20	2122	c.1939A>G	c.(1939-1941)Atc>Gtc	p.I647V	DPY19L2_ENST00000413230.2_Missense_Mutation_p.I94V	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	647					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)	p.I647V(1)|p.S646>?(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GACAGCTTGATGCTTGCCATT	0.378													t|||	19	0.00379393	0.0061	0.0072	5008	,	,		17686	0.0		0.001	False		,,,				2504	0.0051				p.I647V													DPY19L2,NS,carcinoma,0,1	DPY19L2	97	2	Substitution - Missense(1)|Complex(1)	prostate(1)|skin(1)	c.A1939G						.						99.0	81.0	87.0					12																	63964599		2203	4300	6503	SO:0001583	missense	283417	exon20			GCTTGATGCTTGC		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1939A>G	12.37:g.63964599T>C	ENSP00000315988:p.Ile647Val	Somatic	48	2		WXS	Illumina HiSeq		61	9	NM_173812	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.763076	0.00082	.	.	ENSG00000177990	ENST00000324472;ENST00000413230	T;T	0.41758	0.99;0.99	3.3	-4.21	0.03812	.	0.207319	0.40554	N	0.001062	T	0.11793	0.0287	N	0.01219	-0.95	0.24371	N	0.994833	B	0.02656	0.0	B	0.12837	0.008	T	0.24548	-1.0157	9	.	.	.	.	9.8173	0.40860	0.0:0.4434:0.0:0.5566	.	647	Q6NUT2	D19L2_HUMAN	V	647;94	ENSP00000315988:I647V;ENSP00000439794:I94V	.	I	-	1	0	DPY19L2	62250866	0.986000	0.35501	0.039000	0.18376	0.096000	0.18686	0.513000	0.22770	-1.601000	0.01601	-1.232000	0.01568	ATC	.		0.378	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
ADAMTSL3	57188	ucsc.edu;bcgsc.ca	37	15	84700090	84700090	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr15:84700090C>A	ENST00000286744.5	+	28	4884	c.4660C>A	c.(4660-4662)Cct>Act	p.P1554T	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.P1554T	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1554						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTTCCAGTGTCCTGGACGTTG	0.498																																					p.P1554T													.	ADAMTSL3	290	0			c.C4660A						.						214.0	187.0	196.0					15																	84700090		2203	4299	6502	SO:0001583	missense	57188	exon28			CAGTGTCCTGGAC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.4660C>A	15.37:g.84700090C>A	ENSP00000286744:p.Pro1554Thr	Somatic	30	0		WXS	Illumina HiSeq		25	4	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	C	6.890	0.533775	0.13188	.	.	ENSG00000156218	ENST00000286744	T	0.64438	-0.1	5.15	4.19	0.49359	.	1.194670	0.06123	N	0.669216	T	0.44244	0.1284	N	0.17723	0.515	0.28558	N	0.911254	B;B	0.17852	0.004;0.024	B;B	0.15052	0.009;0.012	T	0.37619	-0.9698	10	0.09084	T	0.74	.	7.1672	0.25698	0.0:0.7363:0.1732:0.0905	.	1554;1554	P82987-2;P82987	.;ATL3_HUMAN	T	1554	ENSP00000286744:P1554T	ENSP00000286744:P1554T	P	+	1	0	ADAMTSL3	82491094	0.984000	0.35163	1.000000	0.80357	0.826000	0.46750	0.631000	0.24568	2.654000	0.90174	0.655000	0.94253	CCT	.		0.498	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
PRKCA	5578	ucsc.edu;bcgsc.ca	37	17	64685166	64685166	+	Splice_Site	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:64685166G>A	ENST00000413366.3	+	8	944		c.e8+1			NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GAAATTCGAGGTGAGGATAAC	0.443																																					.													.	PRKCA	82	0			c.918+1G>A						.						78.0	68.0	71.0					17																	64685166		2203	4300	6503	SO:0001630	splice_region_variant	5578	exon8			TTCGAGGTGAGGA		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.918+1G>A	17.37:g.64685166G>A		Somatic	47	0		WXS	Illumina HiSeq		49	5	NM_002737	B5BU22|Q15137|Q32M72|Q96RE4	Splice_Site	SNP	ENST00000413366.3	37	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899524	0.91962	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8283	0.92127	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRKCA	62115628	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.388000	0.97237	2.443000	0.82685	0.561000	0.74099	.	.		0.443	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1		Intron
GCDH	2639	ucsc.edu;bcgsc.ca	37	19	13007078	13007078	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:13007078G>T	ENST00000222214.5	+	8	906	c.695G>T	c.(694-696)tGc>tTc	p.C232F	GCDH_ENST00000422947.2_Missense_Mutation_p.C188F|GCDH_ENST00000457854.1_Missense_Mutation_p.C232F|GCDH_ENST00000591470.1_Missense_Mutation_p.C232F			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	232					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	GAAGATGGCTGCATTCGGGGC	0.622																																					p.C232F	GBM(123;875 1636 7726 16444 26754)												.	GCDH	76	0			c.G695T						.						92.0	84.0	87.0					19																	13007078		2203	4300	6503	SO:0001583	missense	2639	exon8			ATGGCTGCATTCG	AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.695G>T	19.37:g.13007078G>T	ENSP00000222214:p.Cys232Phe	Somatic	50	0		WXS	Illumina HiSeq		36	4	NM_013976	A8K2Z2|O14719	Missense_Mutation	SNP	ENST00000222214.5	37	CCDS12286.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873173	0.33069	.	.	ENSG00000105607	ENST00000457854;ENST00000222214;ENST00000421816;ENST00000422947	D;D;D	0.98849	-5.18;-5.18;-5.18	5.35	1.46	0.22682	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.511935	0.21750	N	0.069688	D	0.92977	0.7765	N	0.14661	0.345	0.20307	N	0.999918	B;B;B;B;B	0.27853	0.191;0.106;0.009;0.012;0.027	B;B;B;B;B	0.10450	0.005;0.005;0.005;0.002;0.004	D	0.87634	0.2518	10	0.56958	D	0.05	.	1.1956	0.01874	0.1733:0.2046:0.4128:0.2093	.	188;68;199;232;232	B4DK85;B4DUY0;B4DQF2;Q92947;Q92947-2	.;.;.;GCDH_HUMAN;.	F	232;232;199;188	ENSP00000394872:C232F;ENSP00000222214:C232F;ENSP00000394821:C188F	ENSP00000222214:C232F	C	+	2	0	GCDH	12868078	0.007000	0.16637	0.076000	0.20297	0.988000	0.76386	1.248000	0.32827	0.707000	0.31934	0.655000	0.94253	TGC	.		0.622	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451897.1		
GNB1L	54584	ucsc.edu	37	22	19808754	19808754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr22:19808754G>T	ENST00000329517.6	-	3	361	c.125C>A	c.(124-126)tCa>tAa	p.S42*	GNB1L_ENST00000403325.1_Nonsense_Mutation_p.S42*|GNB1L_ENST00000460402.1_Intron|GNB1L_ENST00000405009.1_Nonsense_Mutation_p.S42*	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	42					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					TACTCACCCTGAGAAGAGGAG	0.662																																					p.S42X													.	GNB1L	34	0			c.C125A						.						45.0	56.0	52.0					22																	19808754		2203	4300	6503	SO:0001587	stop_gained	54584	exon3			CACCCTGAGAAGA	AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.125C>A	22.37:g.19808754G>T	ENSP00000331313:p.Ser42*	Somatic	51	0		WXS	Illumina HiSeq		35	4	NM_053004	Q9H2S2|Q9H4M4	Nonsense_Mutation	SNP	ENST00000329517.6	37	CCDS13768.1	.	.	.	.	.	.	.	.	.	.	G	37	6.050740	0.97236	.	.	ENSG00000185838	ENST00000329517;ENST00000403325;ENST00000405009;ENST00000453108	.	.	.	5.03	3.94	0.45596	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2098	0.54373	0.0:0.0:0.8299:0.1701	.	.	.	.	X	42	.	ENSP00000331313:S42X	S	-	2	0	GNB1L	18188754	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	4.386000	0.59620	2.330000	0.79161	0.313000	0.20887	TCA	.		0.662	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1		
ARHGEF3	50650	bcgsc.ca	37	3	56807804	56807804	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr3:56807804G>A	ENST00000296315.3	-	2	305	c.137C>T	c.(136-138)aCg>aTg	p.T46M	ARHGEF3_ENST00000498517.1_5'UTR|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.T78M|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.T52M|ARHGEF3_ENST00000413728.2_Missense_Mutation_p.T52M|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.T17M|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.T46M	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	46					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TGCTAGCGACGTGACTCGGGA	0.468																																					p.T78M													.	ARHGEF3	128	0			c.C233T						.						112.0	109.0	110.0					3																	56807804		2203	4300	6503	SO:0001583	missense	50650	exon5			AGCGACGTGACTC	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.137C>T	3.37:g.56807804G>A	ENSP00000296315:p.Thr46Met	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	47	4	NM_001128615	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770626	0.90108	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373;ENST00000468727;ENST00000473779;ENST00000468466	T;T;T;T;T;T	0.29142	1.66;1.58;1.58;1.59;1.7;1.76	5.28	5.28	0.74379	.	0.049077	0.85682	D	0.000000	T	0.58192	0.2105	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	P;P;P;D;P;D	0.74023	0.902;0.902;0.84;0.982;0.902;0.955	T	0.61608	-0.7028	10	0.87932	D	0	-6.9843	19.3092	0.94179	0.0:0.0:1.0:0.0	.	52;17;46;78;46;52	E9PG37;E7EU49;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;ARHG3_HUMAN;.	M	46;78;52;52;17;46;47;64;78	ENSP00000296315:T46M;ENSP00000341071:T78M;ENSP00000410922:T52M;ENSP00000420420:T52M;ENSP00000418826:T17M;ENSP00000417986:T46M	ENSP00000296315:T46M	T	-	2	0	ARHGEF3	56782844	1.000000	0.71417	0.996000	0.52242	0.808000	0.45660	9.202000	0.95026	2.655000	0.90218	0.650000	0.86243	ACG	.		0.468	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
TRIM2	23321	bcgsc.ca	37	4	154237032	154237032	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr4:154237032C>T	ENST00000437508.2	+	8	1783	c.1582C>T	c.(1582-1584)Cgc>Tgc	p.R528C	TRIM2_ENST00000338700.5_Missense_Mutation_p.R555C	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	528					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		CATACGGGGACGCTCTCCGGG	0.458																																					p.R555C													.	TRIM2	105	0			c.C1663T						.						77.0	86.0	83.0					4																	154237032		2203	4300	6503	SO:0001583	missense	23321	exon8			CGGGGACGCTCTC	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1582C>T	4.37:g.154237032C>T	ENSP00000415812:p.Arg528Cys	Somatic	24	0		WXS	Illumina HiSeq	Phase_1	18	3	NM_015271	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153728	0.38021	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	T;T	0.70631	-0.5;-0.5	5.07	5.07	0.68467	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.82153	0.4975	M	0.75150	2.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	D	0.83968	0.0325	10	0.87932	D	0	-22.1086	12.0881	0.53708	0.2902:0.7098:0.0:0.0	.	555;528	D3DP09;Q9C040	.;TRIM2_HUMAN	C	528;555	ENSP00000415812:R528C;ENSP00000339659:R555C	ENSP00000339659:R555C	R	+	1	0	TRIM2	154456482	0.685000	0.27652	0.924000	0.36721	0.962000	0.63368	1.435000	0.34969	2.506000	0.84524	0.650000	0.86243	CGC	.		0.458	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
ARAP3	64411	bcgsc.ca	37	5	141039000	141039000	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr5:141039000A>T	ENST00000239440.4	-	23	3376	c.3311T>A	c.(3310-3312)cTt>cAt	p.L1104H	ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000513878.1_Missense_Mutation_p.L766H|ARAP3_ENST00000508305.1_Missense_Mutation_p.L935H	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1104					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGTGGTGATAAGACTGACCTC	0.527																																					p.L1104H													.	ARAP3	139	0			c.T3311A						.						113.0	95.0	101.0					5																	141039000		2203	4300	6503	SO:0001583	missense	64411	exon23			GTGATAAGACTGA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3311T>A	5.37:g.141039000A>T	ENSP00000239440:p.Leu1104His	Somatic	43	0		WXS	Illumina HiSeq	Phase_1	14	3	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719219	0.89205	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.18016	2.24;2.96;2.82	5.96	5.96	0.96718	.	0.307790	0.31323	N	0.007855	T	0.36635	0.0974	L	0.46157	1.445	0.58432	D	0.999991	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.96;0.994;0.972	T	0.04976	-1.0914	10	0.72032	D	0.01	.	16.0995	0.81163	1.0:0.0:0.0:0.0	.	766;935;1104	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	H	935;1104;766	ENSP00000421826:L935H;ENSP00000239440:L1104H;ENSP00000421468:L766H	ENSP00000239440:L1104H	L	-	2	0	ARAP3	141019184	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.518000	0.90559	2.280000	0.76307	0.533000	0.62120	CTT	.		0.527	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
Unknown	0	bcgsc.ca	37	7	56357187	56357187	+	IGR	SNP	G	G	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:56357187G>T								AC073136.1 (19643 upstream) : RNU6-1335P (50736 downstream)																							TTTCACCAGAGTTACTGGTGG	0.393																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACCAGAGTTACTG																													7.37:g.56357187G>T		Somatic	57	0		WXS	Illumina HiSeq	Phase_1	78	4	.		RNA	SNP		37																																																																																				.	0	0.393								
TYW1B	441250	bcgsc.ca	37	7	72093929	72093929	+	RNA	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr7:72093929C>T	ENST00000435769.2	-	0	1683				TYW1B_ENST00000438125.1_RNA|TYW1B_ENST00000343721.5_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										AGGCCTGGAGCTCGTCCACGT	0.522																																					.													.	.	.	0			.						.						79.0	88.0	85.0					7																	72093929		692	1588	2280			441250	.			CTGGAGCTCGTCC	BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72093929C>T		Somatic	71	0		WXS	Illumina HiSeq	Phase_1	68	4	.	A6NG09|B4DFY2|Q3KQX2	RNA	SNP	ENST00000435769.2	37																																																																																				.		0.522	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347346.2	NM_001145440	
OR7E160P	402333	bcgsc.ca	37	8	11891485	11891485	+	IGR	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr8:11891485C>T								RP11-481A20.11 (18442 upstream) : DEFB130 (30412 downstream)																							ATAGTACTATCGAAATATATG	0.393																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	402333	.			TACTATCGAAATA																													8.37:g.11891485C>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_1	54	28	.		RNA	SNP		37																																																																																				.	0	0.393								
SLC4A1APP1	100288436	bcgsc.ca	37	9	30559152	30559152	+	IGR	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr9:30559152C>T								snoU13 (380577 upstream) : AL590726.2 (211942 downstream)																							GACATGTTTTCATGGGTTTGG	0.448																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGTTTTCATGGGT																													9.37:g.30559152C>T		Somatic	32	0		WXS	Illumina HiSeq	Phase_1	21	6	.		RNA	SNP		37																																																																																				.	0	0.448								
RPL13AP23	441641	bcgsc.ca	37	12	58068622	58068622	+	IGR	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr12:58068622C>T								snoU13 (5800 upstream) : OS9 (19115 downstream)																							GGCTTTCCTCCGCAAGCGGAT	0.632																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTCCTCCGCAAGC																													12.37:g.58068622C>T		Somatic	36	0		WXS	Illumina HiSeq	Phase_1	20	13	.		RNA	SNP		37																																																																																				.	0	0.632								
SRCAP	10847	bcgsc.ca	37	16	30722104	30722104	+	Silent	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr16:30722104G>A	ENST00000262518.4	+	9	1549	c.1164G>A	c.(1162-1164)caG>caA	p.Q388Q	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Silent_p.Q388Q|SRCAP_ENST00000344771.4_Silent_p.Q388Q	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	388	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTGTCACACAGCGCAACAAAC	0.468																																					p.Q388Q													.	SRCAP	298	0			c.G1164A						.						134.0	116.0	122.0					16																	30722104		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon9			CACACAGCGCAAC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1164G>A	16.37:g.30722104G>A		Somatic	33	0		WXS	Illumina HiSeq	Phase_1	30	4	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.468	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CACNG4	27092	bcgsc.ca	37	17	65026740	65026740	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr17:65026740G>A	ENST00000262138.3	+	4	606	c.604G>A	c.(604-606)Gct>Act	p.A202T	RP11-74H8.1_ENST00000579138.1_RNA|AC005544.1_ENST00000375684.1_5'Flank	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	202					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GGGCGTCCTGGCTGTAAACAT	0.453																																					p.A202T													.	CACNG4	44	0			c.G604A						.						86.0	83.0	84.0					17																	65026740		2203	4300	6503	SO:0001583	missense	27092	exon4			GTCCTGGCTGTAA	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.604G>A	17.37:g.65026740G>A	ENSP00000262138:p.Ala202Thr	Somatic	72	0		WXS	Illumina HiSeq	Phase_1	65	4	NM_014405	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	37	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364947	0.82463	.	.	ENSG00000075461	ENST00000262138	D	0.89415	-2.51	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.92825	0.7718	L	0.59436	1.845	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.91842	0.5484	10	0.34782	T	0.22	-1.7597	16.3423	0.83085	0.0:0.0:1.0:0.0	.	202	Q9UBN1	CCG4_HUMAN	T	202	ENSP00000262138:A202T	ENSP00000262138:A202T	A	+	1	0	CACNG4	62457202	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.314000	0.96306	2.285000	0.76669	0.556000	0.70494	GCT	.		0.453	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
ANKRD24	170961	bcgsc.ca	37	19	4217178	4217178	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:4217178C>T	ENST00000600132.1	+	18	2297	c.2021C>T	c.(2020-2022)gCc>gTc	p.A674V	ANKRD24_ENST00000318934.4_Missense_Mutation_p.A674V|ANKRD24_ENST00000262970.5_Missense_Mutation_p.A764V	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	674										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		AACATGGAGGCCACGGGCTCT	0.612																																					p.A674V													.	ANKRD24	180	0			c.C2021T						.						23.0	30.0	28.0					19																	4217178		2143	4249	6392	SO:0001583	missense	170961	exon18			TGGAGGCCACGGG	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2021C>T	19.37:g.4217178C>T	ENSP00000471252:p.Ala674Val	Somatic	18	0		WXS	Illumina HiSeq	Phase_1	10	3	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	c	15.55	2.866201	0.51588	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.38887	1.14;1.11	2.05	2.05	0.26809	.	.	.	.	.	T	0.33147	0.0853	N	0.19112	0.55	0.24253	N	0.995315	D;D	0.57899	0.968;0.981	B;P	0.48795	0.385;0.59	T	0.12528	-1.0544	9	0.29301	T	0.29	.	10.93	0.47211	0.0:1.0:0.0:0.0	.	674;764	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	V	674;764	ENSP00000321731:A674V;ENSP00000262970:A764V	ENSP00000262970:A764V	A	+	2	0	ANKRD24	4168178	0.032000	0.19561	0.034000	0.17996	0.009000	0.06853	1.932000	0.40143	1.142000	0.42291	0.407000	0.27541	GCC	.		0.612	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
KIRREL2	84063	bcgsc.ca	37	19	36351555	36351555	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:36351555C>T	ENST00000360202.5	+	7	1112	c.914C>T	c.(913-915)gCg>gTg	p.A305V	KIRREL2_ENST00000592409.1_Missense_Mutation_p.A305V|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000262625.7_Missense_Mutation_p.A305V|KIRREL2_ENST00000347900.6_Missense_Mutation_p.A255V	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	305	Ig-like C2-type 3.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGCAGTACTGCGCTGGATGTG	0.682																																					p.A305V													.	KIRREL2	170	0			c.C914T						.						59.0	66.0	64.0					19																	36351555		2203	4300	6503	SO:0001583	missense	84063	exon7			GTACTGCGCTGGA	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.914C>T	19.37:g.36351555C>T	ENSP00000353331:p.Ala305Val	Somatic	32	0		WXS	Illumina HiSeq	Phase_1	15	3	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	c	11.57	1.678249	0.29783	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.14640	2.49;2.49;2.49	3.99	2.95	0.34219	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41605	D	0.000857	T	0.18257	0.0438	L	0.36672	1.1	0.32016	N	0.601369	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.989;0.982;0.996;0.994;0.994	T	0.05022	-1.0911	10	0.02654	T	1	-14.4209	7.6299	0.28232	0.0:0.882:0.0:0.118	.	305;285;305;255;305	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	V	305;255;305;285	ENSP00000262625:A305V;ENSP00000345067:A255V;ENSP00000353331:A305V	ENSP00000262625:A305V	A	+	2	0	KIRREL2	41043395	1.000000	0.71417	0.978000	0.43139	0.759000	0.43091	4.047000	0.57383	1.049000	0.40321	0.444000	0.29173	GCG	.		0.682	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
PAGE1	8712	bcgsc.ca	37	X	49458702	49458702	+	Splice_Site	SNP	C	C	A			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chrX:49458702C>A	ENST00000376150.3	-	3	298	c.166G>T	c.(166-168)Ggg>Tgg	p.G56W		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	56					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					TTCCCTTCACCTTGAGCTGCA	0.502																																					p.G56W													.	PAGE1	23	0			c.G166T						.						164.0	121.0	136.0					X																	49458702		2203	4296	6499	SO:0001630	splice_region_variant	8712	exon3			CTTCACCTTGAGC	AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.166+1G>T	X.37:g.49458702C>A		Somatic	95	0		WXS	Illumina HiSeq	Phase_1	101	6	NM_003785	Q6FGM3|Q9BSS7	Missense_Mutation	SNP	ENST00000376150.3	37	CCDS14327.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465354	0.43839	.	.	ENSG00000068985	ENST00000376150	T	0.13307	2.6	1.42	1.42	0.22433	.	.	.	.	.	T	0.31544	0.0800	M	0.76170	2.325	0.09310	N	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.04216	-1.0968	8	.	.	.	.	5.7394	0.18085	0.0:1.0:0.0:0.0	.	56	O75459	GAGB1_HUMAN	W	56	ENSP00000365320:G56W	.	G	-	1	0	PAGE1	49345413	0.451000	0.25705	0.381000	0.26106	0.539000	0.34962	0.143000	0.16115	0.987000	0.38709	0.436000	0.28706	GGG	.		0.502	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081210.1		Missense_Mutation
LCE4A	199834	hgsc.bcm.edu	37	1	152681695	152681696	+	Missense_Mutation	DNP	TG	TG	CT	rs74871420|rs113617356|rs79268808		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr1:152681695_152681696TG>CT	ENST00000368777.1	+	2	400_401	c.144_145TG>CT	c.(142-147)tgTGgt>tgCTgt	p.G49C	LCE4A_ENST00000335535.3_Missense_Mutation_p.G49C			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	49	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CTGGGGGCTGTGGTTGCTGCAG	0.579																																					p.G49C		.											.	.	.	0			c.G145T						.																																			SO:0001583	missense	199834	exon1			GGCTGTGGTTGCT	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	Exception_encountered	1.37:g.152681695_152681696delinsCT	ENSP00000357766:p.Gly49Cys	Somatic	33	0		WXS	Illumina HiSeq	.	34	7	NM_178356	Q14D97	Missense_Mutation	DNP	ENST00000368777.1	37	CCDS1022.1																																																																																			.		0.579	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
USP29	57663	broad.mit.edu	37	19	57641516	57641517	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	GA	GA						Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr19:57641516_57641517GA>TC	ENST00000254181.4	+	4	1927_1928	c.1473_1474GA>TC	c.(1471-1476)caGAag>caTCag	p.491_492QK>HQ	USP29_ENST00000598197.1_Missense_Mutation_p.491_492QK>HQ	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	491	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGTGTAAGCAGAAGAGTTGTGT	0.386																																					p.QK491HQ													.	USP29	186	0			c.A1474C						.																																			SO:0001583	missense	0	exon4			AAGCAGAAGAGTT		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		Exception_encountered	19.37:g.57641516_57641517delinsTC	ENSP00000254181:p.Q491_K492delinsHQ	Somatic	25	0		WXS	Illumina GAIIx	Phase_I	29	3	NM_020903		Missense_Mutation	DNP	ENST00000254181.4	37	CCDS33124.1																																																																																			.		0.386	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
RP11-384J4.2	0	bcgsc.ca	37	14	27396917	27396918	+	lincRNA	DNP	AA	AA	GG	rs398024627|rs71125415|rs75230975		TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr14:27396917_27396918AA>GG	ENST00000552303.1	+	0	205				AL110292.1_ENST00000410967.1_RNA																							aaagtatggcaaaaaaaaaaaa	0.297																																					.													.	.	.	0			.						.																																					0	.			ATGGCAAAAAAAA																												Exception_encountered	14.37:g.27396917_27396918delinsGG		Somatic	135	0		WXS	Illumina HiSeq	Phase_1	152	14	.		RNA	DNP	ENST00000552303.1	37																																																																																				.		0.297	RP11-384J4.2-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000409120.1		
PCSK6	5046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	101929744	101929744	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVC-01A-21D-A417-09	TCGA-3X-AAVC-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f8ff080-bd3a-4f6c-a410-8072cad1487d	bec1f340-525b-4029-bf48-4e747de711b1	g.chr15:101929744C>T	ENST00000348070.1	-	10	1231	c.1232G>A	c.(1231-1233)tGt>tAt	p.C411Y	PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Missense_Mutation_p.C411Y|PCSK6_ENST00000331826.7_Missense_Mutation_p.C246Y|PCSK6_ENST00000398181.2_Missense_Mutation_p.C411Y|PCSK6_ENST00000344273.2_Missense_Mutation_p.C411Y	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	412	Peptidase S8.				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCCATCGGTACAGCGCTGACG	0.567																																					.		.											.	.	.	0			.						.						69.0	76.0	74.0					15																	101929744		2138	4250	6388	SO:0001583	missense	5046	p.C411Y			TCGGTACAGCGCT		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1232G>A	15.37:g.101929744C>T	ENSP00000305056:p.Cys411Tyr	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	52	4	.	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37		.	.	.	.	.	.	.	.	.	.	C	29.3	4.996071	0.93167	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39	5.74	5.74	0.90152	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.103904	0.64402	D	0.000001	D	0.89273	0.6668	M	0.68728	2.09	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.999;0.998;1.0;0.999;1.0;1.0;0.997;1.0;1.0	D	0.89670	0.3883	10	0.87932	D	0	-41.0897	18.9079	0.92471	0.0:1.0:0.0:0.0	.	412;317;411;412;411;411;412;412;411	P29122;Q59H04;E7EUC8;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	Y	411;411;316;411;411;246	ENSP00000305056:C411Y;ENSP00000351193:C411Y;ENSP00000344410:C411Y;ENSP00000381243:C411Y;ENSP00000332052:C246Y	ENSP00000332052:C246Y	C	-	2	0	PCSK6	99747267	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.688000	0.84153	2.702000	0.92279	0.655000	0.94253	TGT	.		0.567	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570	
