#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KRCC1	51315	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	88328025	88328027	+	In_Frame_Del	DEL	TAA	TAA	-			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	TAA	TAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:88328025_88328027delTAA	ENST00000347055.3	-	4	449_451	c.56_58delTTA	c.(55-60)attaaa>aaa	p.I19del		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	19										cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						TTCTGTACTTTAATATAATCTTC	0.369																																					p.19_20del		.											.	.	.	0			c.57_59del						.																																			SO:0001651	inframe_deletion	51315	exon4			GTACTTTAATATA	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.56_58delTTA	2.37:g.88328025_88328027delTAA	ENSP00000340083:p.Ile19del	Somatic	32	0		WXS	Illumina HiSeq	.	43	10	NM_016618	Q3B7J7	In_Frame_Del	DEL	ENST00000347055.3	37	CCDS2000.1																																																																																			.		0.369	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252664.1	NM_016618	
IFRD1	3475	hgsc.bcm.edu	37	7	112102177	112102178	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:112102177_112102178insA	ENST00000403825.3	+	7	1001_1002	c.740_741insA	c.(739-744)gcatggfs	p.W248fs	IFRD1_ENST00000486688.1_3'UTR|IFRD1_ENST00000535603.1_Frame_Shift_Ins_p.W198fs|IFRD1_ENST00000005558.4_Frame_Shift_Ins_p.W248fs	NM_001550.3	NP_001541.2	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	248					adult somatic muscle development (GO:0007527)|multicellular organismal development (GO:0007275)|myoblast fate determination (GO:0007518)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|urinary_tract(1)	15						TCTCTTCTTGCATGGACACTAC	0.342																																					p.A247fs		.											.	.	.	0			c.740_741insA						.																																			SO:0001589	frameshift_variant	3475	exon8			TTCTTGCATGGAC	Y10313	CCDS34736.1, CCDS56504.1	7q31.1	2005-10-17			ENSG00000006652	ENSG00000006652			5456	protein-coding gene	gene with protein product		603502				9722946	Standard	NM_001550		Approved	PC4, TIS7	uc003vgh.3	O00458	OTTHUMG00000155124	ENST00000403825.3:c.741dupA	7.37:g.112102178_112102178dupA	ENSP00000384477:p.Trp248fs	Somatic	102	0		WXS	Illumina HiSeq	.	85	18	NM_001007245	B7Z5G1|O75234|Q5U013|Q9BVE4	Frame_Shift_Ins	INS	ENST00000403825.3	37	CCDS34736.1																																																																																			.		0.342	IFRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338700.1	NM_001550	
CHMP1A	5119	hgsc.bcm.edu	37	16	89712424	89712425	+	3'UTR	INS	-	-	CCTT			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr16:89712424_89712425insCCTT	ENST00000397901.3	-	0	896_897				CHMP1A_ENST00000253475.5_Frame_Shift_Ins_p.-207fs|CHMP1A_ENST00000547614.1_5'Flank|CHMP1A_ENST00000550102.1_3'UTR|CHMP1A_ENST00000535997.2_3'UTR	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A						cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		GAGGACAGGAGCCTTCCAGCAC	0.678																																					p.G207fs		.											.	.	.	0			c.621_622insAAGG						.																																			SO:0001624	3_prime_UTR_variant	5119	exon6			ACAGGAGCCTTCC	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.*50->AAGG	16.37:g.89712425_89712428dupCCTT		Somatic	99	0		WXS	Illumina HiSeq	.	89	12	NM_001083314	A2RU09|Q14468|Q15779|Q96G31	Frame_Shift_Ins	INS	ENST00000397901.3	37	CCDS45552.1																																																																																			.		0.678	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	
SNX9	51429	hgsc.bcm.edu	37	6	158288657	158288716	+	Splice_Site	DEL	ACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	ACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	-	rs145589455|rs141851391	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	ACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	ACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:158288657_158288716delACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	ENST00000392185.3	+	2	262_270	c.91_99delACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA	c.(91-99)acaaatccgdel	p.TNP31del		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	31	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		CATCACAATCACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTAACAAATCCGG	0.369																																					p.30_33del		.											.	.	.	0			c.90_99del						.																																			SO:0001630	splice_region_variant	51429	exon2			ACAATCACAAATC	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.99+1ACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA>-	6.37:g.158288657_158288716delACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTA		Somatic	71	0		WXS	Illumina HiSeq	.	94	0	NM_016224	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Frame_Shift_Del	DEL	ENST00000392185.3	37	CCDS5253.1																																																																																			.		0.369	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1		In_Frame_Del
FKRP	79147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	47258782	47258782	+	Silent	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:47258782G>A	ENST00000318584.5	+	4	372	c.75G>A	c.(73-75)tcG>tcA	p.S25S	FKRP_ENST00000600646.1_Intron|FKRP_ENST00000391909.3_Silent_p.S25S	NM_001039885.2|NM_024301.4	NP_001034974.1|NP_077277.1	Q9H9S5	FKRP_HUMAN	fukutin related protein	25					glycoprotein biosynthetic process (GO:0009101)|protein processing (GO:0016485)	dystrophin-associated glycoprotein complex (GO:0016010)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)	transferase activity (GO:0016740)			NS(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		TCTATGTCTCGTGGCTGCAGC	0.697																																					p.S25S		.											.	.	.	0			c.G75A						.						13.0	14.0	13.0					19																	47258782		2193	4283	6476	SO:0001819	synonymous_variant	79147	exon4			TGTCTCGTGGCTG	AJ314847	CCDS12691.1	19q13.32	2014-09-17			ENSG00000181027	ENSG00000181027			17997	protein-coding gene	gene with protein product		606596				11592034, 11741828	Standard	NM_024301		Approved	LGMD2I, MDC1C	uc002pfp.2	Q9H9S5		ENST00000318584.5:c.75G>A	19.37:g.47258782G>A		Somatic	110	0		WXS	Illumina HiSeq	.	78	15	NM_024301	A8K5G7	Silent	SNP	ENST00000318584.5	37	CCDS12691.1																																																																																			.		0.697	FKRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465473.1	NM_024301	
GZF1	64412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23349409	23349409	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr20:23349409T>C	ENST00000338121.5	+	4	1547	c.1470T>C	c.(1468-1470)ccT>ccC	p.P490P	GZF1_ENST00000377051.2_Silent_p.P490P|GZF1_ENST00000544236.1_Silent_p.P14P|GZF1_ENST00000542987.1_5'UTR|GZF1_ENST00000461789.1_3'UTR			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	490					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GTGAAAGACCTTTTATGTGTG	0.358																																					p.P490P		.											.	.	.	0			c.T1470C						.						99.0	95.0	97.0					20																	23349409		2203	4300	6503	SO:0001819	synonymous_variant	64412	exon3			AAGACCTTTTATG	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1470T>C	20.37:g.23349409T>C		Somatic	112	0		WXS	Illumina HiSeq	.	87	36	NM_022482	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Silent	SNP	ENST00000338121.5	37	CCDS13151.1																																																																																			.		0.358	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078333.1	NM_022482	
PEX11B	8799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145518133	145518133	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:145518133G>A	ENST00000369306.3	+	3	384	c.235G>A	c.(235-237)Gat>Aat	p.D79N	PEX11B_ENST00000537888.1_Missense_Mutation_p.D65N|GNRHR2_ENST00000312753.5_RNA	NM_003846.2	NP_003837.1	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	79					peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|protein homooligomerization (GO:0051260)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCACCTATCAGATGTTGTCCT	0.488																																					p.D79N		.											.	.	.	0			c.G235A						.						216.0	188.0	198.0					1																	145518133		2203	4300	6503	SO:0001583	missense	8799	exon3			CTATCAGATGTTG	AF093670	CCDS72870.1, CCDS72871.1	1q21	2008-08-26	2008-08-26		ENSG00000131779	ENSG00000131779			8853	protein-coding gene	gene with protein product		603867	"""peroxisomal biogenesis factor 11B"""			9792670	Standard	NM_003846		Approved		uc001eny.2	O96011	OTTHUMG00000013756	ENST00000369306.3:c.235G>A	1.37:g.145518133G>A	ENSP00000358312:p.Asp79Asn	Somatic	48	0		WXS	Illumina HiSeq	.	51	17	NM_003846	B3KN85|B4DXH9|Q96ET2	Missense_Mutation	SNP	ENST00000369306.3	37	CCDS917.1	.	.	.	.	.	.	.	.	.	.	G	32	5.163236	0.94727	.	.	ENSG00000131779	ENST00000369306;ENST00000537888	T;T	0.62364	0.03;0.03	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.75309	0.3832	M	0.80982	2.52	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.66497	0.944;0.944	T	0.77542	-0.2549	10	0.62326	D	0.03	-9.4312	16.4665	0.84080	0.0:0.0:1.0:0.0	.	65;79	B4DXH9;O96011	.;PX11B_HUMAN	N	79;65	ENSP00000358312:D79N;ENSP00000437510:D65N	ENSP00000358312:D79N	D	+	1	0	PEX11B	144229490	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.218000	0.95166	2.756000	0.94617	0.655000	0.94253	GAT	.		0.488	PEX11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038549.1	NM_003846	
CPS1	1373	hgsc.bcm.edu	37	2	211464283	211464283	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:211464283G>T	ENST00000233072.5	+	14	1743	c.1547G>T	c.(1546-1548)tGt>tTt	p.C516F	CPS1_ENST00000451903.2_Missense_Mutation_p.C65F|CPS1_ENST00000430249.2_Missense_Mutation_p.C522F	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	516					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GCTCTGAACTGTGGTGAGTTC	0.428																																					p.C522F		.											CPS1,NS,carcinoma,0,1	CPS1	0	0			c.G1565T						.						107.0	110.0	109.0					2																	211464283		2202	4300	6502	SO:0001583	missense	1373	exon15			TGAACTGTGGTGA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1547G>T	2.37:g.211464283G>T	ENSP00000233072:p.Cys516Phe	Somatic	40	0		WXS	Illumina HiSeq	.	42	2	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065416	0.76187	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97352	-4.35;-4.35;-4.35	5.17	5.17	0.71159	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98858	0.9614	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99647	1.0990	10	0.87932	D	0	-13.3357	19.03	0.92952	0.0:0.0:1.0:0.0	.	526;516	Q59HF8;P31327	.;CPSM_HUMAN	F	522;524;516;65	ENSP00000402608:C522F;ENSP00000233072:C516F;ENSP00000406136:C65F	ENSP00000233072:C516F	C	+	2	0	CPS1	211172528	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.307000	0.96226	2.579000	0.87056	0.455000	0.32223	TGT	.		0.428	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
MED16	10025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	875282	875282	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:875282T>C	ENST00000589119.1	-	9	1732	c.1733A>G	c.(1732-1734)gAc>gGc	p.D578G	MED16_ENST00000269814.4_Missense_Mutation_p.D578G|MED16_ENST00000325464.1_Missense_Mutation_p.D578G|MED16_ENST00000312090.6_Missense_Mutation_p.D578G|MED16_ENST00000606828.1_5'UTR|MED16_ENST00000395808.3_Missense_Mutation_p.D578G			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	578					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCAGCCGGTCGCCGGGGCT	0.557																																					p.D578G		.											.	.	.	0			c.A1733G						.						57.0	64.0	62.0					19																	875282		2202	4298	6500	SO:0001583	missense	10025	exon10			AGCCGGTCGCCGG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1733A>G	19.37:g.875282T>C	ENSP00000464810:p.Asp578Gly	Somatic	105	0		WXS	Illumina HiSeq	.	89	28	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.906102	0.72868	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000541440;ENST00000424039	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.64461	0.2600	L	0.61218	1.895	0.80722	D	1	D;D;D;D;D;D	0.69078	0.993;0.996;0.997;0.996;0.996;0.997	D;D;D;D;D;D	0.83275	0.984;0.993;0.994;0.993;0.993;0.996	T	0.66893	-0.5808	10	0.56958	D	0.05	-9.9511	12.9806	0.58562	0.0:0.0:0.0:1.0	.	166;578;578;578;578;578	B9TX03;Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;.;MED16_HUMAN	G	578;578;578;578;509;434;339;337;296;578	ENSP00000325612:D578G;ENSP00000308528:D578G;ENSP00000379153:D578G;ENSP00000269814:D578G	ENSP00000269814:D578G	D	-	2	0	MED16	826282	1.000000	0.71417	0.991000	0.47740	0.517000	0.34286	7.241000	0.78201	1.664000	0.50801	0.459000	0.35465	GAC	.		0.557	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
RTBDN	83546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12939521	12939521	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:12939521T>C	ENST00000458671.2	-	4	467	c.315A>G	c.(313-315)ctA>ctG	p.L105L	RTBDN_ENST00000589272.1_Silent_p.L137L|RTBDN_ENST00000393233.2_Missense_Mutation_p.Y64C|RTBDN_ENST00000592204.1_Silent_p.L115L|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000322912.5_Silent_p.L137L	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	105						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GTACCCCCAATAGCCGCAGGC	0.652																																					p.L137L		.											.	.	.	0			c.A411G						.						50.0	52.0	51.0					19																	12939521		2203	4300	6503	SO:0001819	synonymous_variant	83546	exon5			CCCCAATAGCCGC	AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.315A>G	19.37:g.12939521T>C		Somatic	36	0		WXS	Illumina HiSeq	.	23	7	NM_001270440	F1T0I8|Q9BWT5	Silent	SNP	ENST00000458671.2	37	CCDS45994.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.378168	0.42105	.	.	ENSG00000132026	ENST00000393233	T	0.41400	1.0	3.87	-7.75	0.01236	.	.	.	.	.	T	0.40932	0.1137	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.55121	-0.8190	6	0.62326	D	0.03	.	12.3982	0.55397	0.0:0.214:0.6717:0.1143	.	.	.	.	C	64	ENSP00000376925:Y64C	ENSP00000376925:Y64C	Y	-	2	0	RTBDN	12800521	0.000000	0.05858	0.000000	0.03702	0.818000	0.46254	-1.991000	0.01478	-2.216000	0.00732	-0.460000	0.05396	TAT	.		0.652	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
DUSP18	150290	hgsc.bcm.edu	37	22	31059695	31059695	+	Missense_Mutation	SNP	C	C	T	rs200346696		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr22:31059695C>T	ENST00000334679.3	-	2	801	c.296G>A	c.(295-297)cGt>cAt	p.R99H	DUSP18_ENST00000407308.1_Missense_Mutation_p.R99H|DUSP18_ENST00000404885.1_Missense_Mutation_p.R99H|DUSP18_ENST00000461301.1_Intron|DUSP18_ENST00000403268.1_Silent_p.P62P	NM_152511.3	NP_689724.3	Q8NEJ0	DUS18_HUMAN	dual specificity phosphatase 18	99	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R99H(1)		large_intestine(1)|lung(1)|prostate(1)|skin(1)	4						CAGCAAAGTACGGCCCTGCTT	0.577																																					p.R99H		.											DUSP18,caecum,carcinoma,0,1	DUSP18	0	1	Substitution - Missense(1)	large_intestine(1)	c.G296A						.	C	HIS/ARG	0,4406		0,0,2203	145.0	108.0	121.0		296	5.4	1.0	22		121	1,8599	1.2+/-3.3	0,1,4299	no	missense	DUSP18	NM_152511.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	99/189	31059695	1,13005	2203	4300	6503	SO:0001583	missense	150290	exon2			AAAGTACGGCCCT	AF461689	CCDS13883.1	22q12.1	2011-06-09				ENSG00000167065		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	18484	protein-coding gene	gene with protein product		611446				12408986	Standard	NM_152511		Approved	DUSP20	uc003aiw.1	Q8NEJ0		ENST00000334679.3:c.296G>A	22.37:g.31059695C>T	ENSP00000333917:p.Arg99His	Somatic	40	0		WXS	Illumina HiSeq	.	34	3	NM_152511	B3KPA4	Missense_Mutation	SNP	ENST00000334679.3	37	CCDS13883.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387570	0.61956	0.0	1.16E-4	ENSG00000167065	ENST00000404885;ENST00000407308;ENST00000334679;ENST00000342474	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	5.43	5.43	0.79202	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.100766	0.64402	N	0.000001	T	0.55386	0.1917	M	0.71296	2.17	0.80722	D	1	P	0.45428	0.858	B	0.33339	0.162	T	0.63580	-0.6605	10	0.45353	T	0.12	.	18.8532	0.92241	0.0:1.0:0.0:0.0	.	99	Q8NEJ0	DUS18_HUMAN	H	99	ENSP00000385463:R99H;ENSP00000386063:R99H;ENSP00000333917:R99H;ENSP00000340795:R99H	ENSP00000333917:R99H	R	-	2	0	DUSP18	29389695	1.000000	0.71417	0.998000	0.56505	0.708000	0.40852	1.523000	0.35932	2.547000	0.85894	0.655000	0.94253	CGT	0.001		0.577	DUSP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321400.1		
OTUD7A	161725	hgsc.bcm.edu	37	15	31794022	31794022	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:31794022C>T	ENST00000307050.4	-	8	1113	c.1021G>A	c.(1021-1023)Gga>Aga	p.G341R	OTUD7A_ENST00000382902.1_Missense_Mutation_p.G348R	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	341	Catalytic. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TAGATCCCTCCGAATGGGATG	0.612																																					p.G341R		.											OTUD7A,NS,malignant_melanoma,0,1	OTUD7A	0	0			c.G1021A						.						120.0	108.0	112.0					15																	31794022		2202	4300	6502	SO:0001583	missense	161725	exon8			TCCCTCCGAATGG	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1021G>A	15.37:g.31794022C>T	ENSP00000305926:p.Gly341Arg	Somatic	41	0		WXS	Illumina HiSeq	.	34	2	NM_130901	Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869069	0.91587	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.31769	1.48;1.48	4.84	4.84	0.62591	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	M	0.80508	2.5	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66284	-0.5962	10	0.72032	D	0.01	-15.5	18.2918	0.90133	0.0:1.0:0.0:0.0	.	348;341	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	R	341;348	ENSP00000305926:G341R;ENSP00000372358:G348R	ENSP00000305926:G341R	G	-	1	0	OTUD7A	29581314	1.000000	0.71417	0.977000	0.42913	0.977000	0.68977	6.996000	0.76263	2.357000	0.79964	0.655000	0.94253	GGA	.		0.612	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901	
BMP7	655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	55777538	55777538	+	Silent	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr20:55777538C>T	ENST00000395863.3	-	3	1258	c.753G>A	c.(751-753)acG>acA	p.T251T	BMP7_ENST00000395864.3_Silent_p.T251T|BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000450594.2_Silent_p.T251T	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	251					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			CACCATCCAGCGTCTCCACCG	0.612																																					p.T251T		.											.	.	.	0			c.G753A						.						39.0	35.0	36.0					20																	55777538		2203	4300	6503	SO:0001819	synonymous_variant	655	exon3			ATCCAGCGTCTCC		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.753G>A	20.37:g.55777538C>T		Somatic	23	0		WXS	Illumina HiSeq	.	21	4	NM_001719	Q9H512|Q9NTQ7	Silent	SNP	ENST00000395863.3	37	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	C	8.639	0.895543	0.17686	.	.	ENSG00000101144	ENST00000433911	.	.	.	4.78	-9.27	0.00659	.	.	.	.	.	T	0.33614	0.0869	.	.	.	0.48696	D	0.999691	.	.	.	.	.	.	T	0.39292	-0.9621	4	.	.	.	.	1.9545	0.03373	0.1933:0.2871:0.3309:0.1887	.	.	.	.	T	173	.	.	A	-	1	0	BMP7	55210945	0.016000	0.18221	0.488000	0.27440	0.921000	0.55340	-0.524000	0.06222	-2.380000	0.00594	-2.560000	0.00174	GCT	.		0.612	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
PARP4	143	hgsc.bcm.edu	37	13	25064843	25064843	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr13:25064843G>T	ENST00000381989.3	-	10	1282	c.1177C>A	c.(1177-1179)Ctc>Atc	p.L393I		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	393	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CTAACCCTGAGAAATTCTTCA	0.388																																					p.L393I		.											PARP4,NS,carcinoma,0,1	PARP4	0	0			c.C1177A						.						129.0	128.0	128.0					13																	25064843		2203	4300	6503	SO:0001583	missense	143	exon10			CCCTGAGAAATTC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1177C>A	13.37:g.25064843G>T	ENSP00000371419:p.Leu393Ile	Somatic	106	0		WXS	Illumina HiSeq	.	70	3	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	G	6.902	0.535938	0.13188	.	.	ENSG00000102699	ENST00000381989	T	0.13538	2.58	4.63	1.84	0.25277	Poly(ADP-ribose) polymerase, catalytic domain (2);	1.359980	0.04827	N	0.438032	T	0.12135	0.0295	L	0.46157	1.445	0.09310	N	0.99999	B	0.18166	0.026	B	0.16289	0.015	T	0.36407	-0.9749	10	0.22706	T	0.39	-0.0676	2.7327	0.05231	0.5665:0.0:0.2436:0.1898	.	393	Q9UKK3	PARP4_HUMAN	I	393	ENSP00000371419:L393I	ENSP00000371419:L393I	L	-	1	0	PARP4	23962843	0.177000	0.23109	0.318000	0.25279	0.937000	0.57800	0.431000	0.21444	0.170000	0.19704	-0.280000	0.10049	CTC	.		0.388	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
RRN3P1	730092	hgsc.bcm.edu	37	16	21821976	21821976	+	RNA	SNP	C	C	A	rs148768203		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr16:21821976C>A	ENST00000546471.1	-	0	0							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		CAAGTGGATACAAAAAAAAAA	0.254																																					.		.											.	.	.	0			.						.																																					730092	.			TGGATACAAAAAA			16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21821976C>A		Somatic	37	0		WXS	Illumina HiSeq	.	30	4	.	A8K6T4|B3KWX9|O75704	RNA	SNP	ENST00000546471.1	37																																																																																				.		0.254	RRN3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000409035.1	NR_003370	
CADM4	199731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44130107	44130107	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:44130107C>A	ENST00000222374.2	-	6	759	c.711G>T	c.(709-711)gaG>gaT	p.E237D	CADM4_ENST00000593506.1_5'UTR	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	237	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				GCGTGTCTCCCTCCCTCACCA	0.597																																					p.E237D		.											.	.	.	0			c.G711T						.						65.0	63.0	64.0					19																	44130107		2203	4300	6503	SO:0001583	missense	199731	exon6			GTCTCCCTCCCTC	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.711G>T	19.37:g.44130107C>A	ENSP00000222374:p.Glu237Asp	Somatic	54	0		WXS	Illumina HiSeq	.	48	11	NM_145296	B2R7L5|Q9Y4A4	Missense_Mutation	SNP	ENST00000222374.2	37	CCDS12627.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253215	0.59212	.	.	ENSG00000105767	ENST00000222374	T	0.15017	2.46	5.7	4.67	0.58626	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	M	0.75884	2.315	0.39973	D	0.974819	D	0.63046	0.992	D	0.77004	0.989	T	0.28618	-1.0038	10	0.59425	D	0.04	.	8.6566	0.34066	0.0:0.8284:0.0:0.1716	.	237	Q8NFZ8	CADM4_HUMAN	D	237	ENSP00000222374:E237D	ENSP00000222374:E237D	E	-	3	2	CADM4	48821947	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.535000	0.45685	1.411000	0.46957	0.591000	0.81541	GAG	.		0.597	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	
COL20A1	57642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61944199	61944199	+	Silent	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr20:61944199C>A	ENST00000358894.6	+	16	2089	c.1989C>A	c.(1987-1989)gtC>gtA	p.V663V	COL20A1_ENST00000422202.1_Silent_p.V670V|COL20A1_ENST00000326996.6_Silent_p.V663V|COL20A1_ENST00000435874.1_Silent_p.V670V	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	663	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GGGATGCAGTCCAGCTGGCGT	0.662																																					p.V663V		.											.	.	.	0			c.C1989A						.						17.0	24.0	22.0					20																	61944199		1935	4116	6051	SO:0001819	synonymous_variant	57642	exon16			TGCAGTCCAGCTG	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.1989C>A	20.37:g.61944199C>A		Somatic	32	0		WXS	Illumina HiSeq	.	34	9	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	ENST00000358894.6	37	CCDS46628.1																																																																																			.		0.662	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	28394632	28394632	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr22:28394632A>G	ENST00000397906.2	-	16	5156	c.5015T>C	c.(5014-5016)tTc>tCc	p.F1672S	TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000426594.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000424161.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1672					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GGATGAGTAGAAGGCATGGAT	0.622																																					p.F1672S		.											.	.	.	0			c.T5015C						.						34.0	33.0	34.0					22																	28394632		692	1591	2283	SO:0001583	missense	23331	exon16			GAGTAGAAGGCAT	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5015T>C	22.37:g.28394632A>G	ENSP00000381003:p.Phe1672Ser	Somatic	36	0		WXS	Illumina HiSeq	.	35	7	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.247687	0.80024	.	.	ENSG00000100154	ENST00000397906	D	0.92495	-3.05	4.76	4.76	0.60689	.	0.129465	0.52532	D	0.000067	D	0.96513	0.8862	M	0.93375	3.41	0.58432	D	0.999992	D	0.61080	0.989	D	0.65233	0.933	D	0.97217	0.9875	10	0.87932	D	0	-18.0616	12.3265	0.55013	1.0:0.0:0.0:0.0	.	1672	Q96AY4	TTC28_HUMAN	S	1672	ENSP00000381003:F1672S	ENSP00000381003:F1672S	F	-	2	0	TTC28	26724632	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.968000	0.93407	1.918000	0.55548	0.379000	0.24179	TTC	.		0.622	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
BRINP3	339479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	190068073	190068073	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:190068073C>T	ENST00000367462.3	-	8	1607	c.1376G>A	c.(1375-1377)cGc>cAc	p.R459H	BRINP3_ENST00000534846.1_Missense_Mutation_p.R357H	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	459					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GGTGCCGCAGCGGGTGCGGTT	0.617																																					p.R459H		.											.	.	.	0			c.G1376A						.						75.0	73.0	74.0					1																	190068073		2203	4300	6503	SO:0001583	missense	339479	exon8			CCGCAGCGGGTGC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1376G>A	1.37:g.190068073C>T	ENSP00000356432:p.Arg459His	Somatic	19	0		WXS	Illumina HiSeq	.	16	6	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786286	0.70337	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.42900	0.96;0.96	5.65	5.65	0.86999	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.65573	0.936;0.865	T	0.64702	-0.6345	10	0.59425	D	0.04	.	17.2216	0.86959	0.0:1.0:0.0:0.0	.	357;459	B7Z260;Q76B58	.;FAM5C_HUMAN	H	459;357	ENSP00000356432:R459H;ENSP00000438022:R357H	ENSP00000356432:R459H	R	-	2	0	FAM5C	188334696	1.000000	0.71417	0.997000	0.53966	0.584000	0.36387	7.734000	0.84928	2.656000	0.90262	0.591000	0.81541	CGC	.		0.617	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
NT5DC3	51559	hgsc.bcm.edu;bcgsc.ca	37	12	104171615	104171615	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr12:104171615C>T	ENST00000392876.3	-	14	1679	c.1639G>A	c.(1639-1641)Gcc>Acc	p.A547T		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	547						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						GGCTACTTGGCCTGGGCCTCC	0.572																																					p.A547T		.											.	.	.	0			c.G1639A						.						52.0	57.0	55.0					12																	104171615		2203	4300	6503	SO:0001583	missense	51559	exon14			ACTTGGCCTGGGC	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1639G>A	12.37:g.104171615C>T	ENSP00000376615:p.Ala547Thr	Somatic	45	0		WXS	Illumina HiSeq	.	51	4	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013123	0.54468	.	.	ENSG00000111696	ENST00000392876	T	0.23754	1.89	5.8	5.8	0.92144	.	0.458926	0.22874	N	0.054589	T	0.11965	0.0291	N	0.08118	0	0.28766	N	0.900658	B	0.19817	0.039	B	0.14023	0.01	T	0.13575	-1.0504	10	0.06494	T	0.89	-28.8217	12.5202	0.56054	0.0:0.9216:0.0:0.0784	.	547	Q86UY8	NT5D3_HUMAN	T	547	ENSP00000376615:A547T	ENSP00000376615:A547T	A	-	1	0	NT5DC3	102695745	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	0.990000	0.29642	2.735000	0.93741	0.655000	0.94253	GCC	.		0.572	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
PEG3	5178	hgsc.bcm.edu	37	19	57335782	57335782	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:57335782G>T	ENST00000326441.9	-	4	605	c.242C>A	c.(241-243)aCc>aAc	p.T81N	ZIM2_ENST00000593931.1_5'Flank|ZIM2_ENST00000221722.5_5'UTR|PEG3_ENST00000423103.2_Missense_Mutation_p.T81N|PEG3_ENST00000593695.1_5'UTR|ZIM2_ENST00000593711.1_5'UTR|ZIM2_ENST00000601070.1_5'UTR|PEG3_ENST00000598410.1_5'UTR|ZIM2_ENST00000391708.3_5'UTR|PEG3_ENST00000594706.1_5'UTR|ZIM2_ENST00000599935.1_5'UTR	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	81	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CTCCTCCTTGGTGCGGGTCTC	0.527																																					p.T81N		.											ZIM2_ENST00000326441,right_lower_lobe,carcinoma,0,4	ZIM2_ENST00000326441	0	0			c.C242A						.						92.0	90.0	91.0					19																	57335782		2203	4300	6503	SO:0001583	missense	5178	exon3			TCCTTGGTGCGGG	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.242C>A	19.37:g.57335782G>T	ENSP00000326581:p.Thr81Asn	Somatic	27	0		WXS	Illumina HiSeq	.	32	2	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433351	0.62844	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.11495	2.77;2.77	4.82	2.57	0.30868	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.590841	0.14143	N	0.338544	T	0.25680	0.0625	M	0.86740	2.835	.	.	.	P;P	0.45348	0.856;0.856	P;P	0.48368	0.575;0.575	T	0.48681	-0.9014	9	0.87932	D	0	-15.9389	11.7442	0.51811	0.0:0.3579:0.6421:0.0	.	81;14	Q9GZU2;Q96Q96	PEG3_HUMAN;.	N	81	ENSP00000326581:T81N;ENSP00000403051:T81N	ENSP00000292074:T81N	T	-	2	0	ZIM2	62027594	0.660000	0.27420	0.788000	0.31933	0.836000	0.47400	0.498000	0.22530	0.657000	0.30906	0.650000	0.86243	ACC	.		0.527	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
TLE1	7088	hgsc.bcm.edu	37	9	84226713	84226713	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:84226713C>T	ENST00000376499.3	-	13	2289	c.1225G>A	c.(1225-1227)Gcc>Acc	p.A409T	TLE1_ENST00000376484.1_Missense_Mutation_p.A84T|TLE1_ENST00000376472.1_Missense_Mutation_p.A84T|TLE1_ENST00000464999.1_5'Flank	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	409	Pro/Ser-rich.			AAAVVA -> RGRRGR (in Ref. 1; AAA61192). {ECO:0000305}.	multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GCCACCACGGCGGCCGCGGCG	0.682																																					p.A409T	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											TLE1,NS,carcinoma,0,1	TLE1	0	0			c.G1225A						.						12.0	15.0	14.0					9																	84226713		2120	4150	6270	SO:0001583	missense	7088	exon13			CCACGGCGGCCGC		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1225G>A	9.37:g.84226713C>T	ENSP00000365682:p.Ala409Thr	Somatic	65	0		WXS	Illumina HiSeq	.	56	2	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157213	0.57259	.	.	ENSG00000196781	ENST00000376499;ENST00000376484;ENST00000376472	T;T;T	0.54866	0.9;0.55;0.55	5.6	5.6	0.85130	.	0.256692	0.39274	N	0.001415	T	0.63628	0.2527	M	0.72894	2.215	0.80722	D	1	B;P;P;P	0.51449	0.086;0.92;0.945;0.939	B;B;B;P	0.49252	0.014;0.425;0.422;0.604	T	0.64067	-0.6494	10	0.42905	T	0.14	-20.2783	19.6254	0.95676	0.0:1.0:0.0:0.0	.	335;394;435;409	B4E345;B4DEF9;Q59EF7;Q04724	.;.;.;TLE1_HUMAN	T	409;84;84	ENSP00000365682:A409T;ENSP00000365667:A84T;ENSP00000365655:A84T	ENSP00000365655:A84T	A	-	1	0	TLE1	83416533	1.000000	0.71417	0.960000	0.40013	0.175000	0.22909	7.702000	0.84576	2.662000	0.90505	0.655000	0.94253	GCC	.		0.682	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
KCNK4	50801	hgsc.bcm.edu	37	11	64064727	64064727	+	Silent	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:64064727C>T	ENST00000539216.1	+	3	810	c.450C>T	c.(448-450)atC>atT	p.I150I	Y_RNA_ENST00000384297.1_RNA|KCNK4_ENST00000394525.2_Silent_p.I150I|KCNK4_ENST00000539651.1_3'UTR|KCNK4_ENST00000538767.1_Missense_Mutation_p.S84L|RP11-783K16.10_ENST00000539086.1_RNA|KCNK4_ENST00000422670.2_Silent_p.I150I			Q9NYG8	KCNK4_HUMAN	potassium channel, subfamily K, member 4	150					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.I150I(1)		breast(2)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	10						GCCATGGCATCGGTCACATTG	0.627																																					p.I150I		.											KCNK4,rectum,carcinoma,0,1	KCNK4	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C450T						.						47.0	47.0	47.0					11																	64064727		2201	4297	6498	SO:0001819	synonymous_variant	50801	exon4			TGGCATCGGTCAC	AF247042	CCDS8067.1	11q13	2012-03-07			ENSG00000182450	ENSG00000182450		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6279	protein-coding gene	gene with protein product		605720				10767409, 16382106	Standard	NM_033310		Approved	K2p4.1, TRAAK	uc001nzk.1	Q9NYG8	OTTHUMG00000168006	ENST00000539216.1:c.450C>T	11.37:g.64064727C>T		Somatic	34	0		WXS	Illumina HiSeq	.	26	3	NM_033310	B5TJL1|Q96T94	Silent	SNP	ENST00000539216.1	37	CCDS8067.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.320064	0.41096	.	.	ENSG00000182450	ENST00000538767	.	.	.	5.05	-2.44	0.06502	.	.	.	.	.	T	0.49949	0.1587	.	.	.	0.80722	D	1	B;B	0.20780	0.048;0.048	B;B	0.11329	0.006;0.006	T	0.36817	-0.9732	7	0.87932	D	0	.	10.8859	0.46965	0.0:0.5438:0.0:0.4562	.	123;84	B4DJC9;F5GYE0	.;.	L	84	.	ENSP00000446454:S84L	S	+	2	0	KCNK4	63821303	0.030000	0.19436	0.729000	0.30791	0.995000	0.86356	-0.960000	0.03849	-0.504000	0.06577	0.561000	0.74099	TCG	.		0.627	KCNK4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396430.1	NM_033311	
GJA9	81025	hgsc.bcm.edu;bcgsc.ca	37	1	39340249	39340249	+	Silent	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:39340249G>T	ENST00000360786.3	-	1	1774	c.1522C>A	c.(1522-1524)Cgg>Agg	p.R508R	MYCBP_ENST00000489803.1_5'UTR|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000454994.2_Intron|MYCBP_ENST00000397572.2_5'Flank|GJA9_ENST00000357771.3_Silent_p.R508R|RP5-864K19.4_ENST00000433671.2_RNA|RP5-864K19.4_ENST00000456813.1_RNA			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	508					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			GTGGGAACCCGCCTACCAATG	0.453																																					p.R508R		.											.	.	.	0			c.C1522A						.						76.0	76.0	76.0					1																	39340249		2203	4300	6503	SO:0001819	synonymous_variant	81025	exon2			GAACCCGCCTACC	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1522C>A	1.37:g.39340249G>T		Somatic	67	0		WXS	Illumina HiSeq	.	70	4	NM_030772	B2R722|B3KVQ2|Q5TA63|Q96KG0	Silent	SNP	ENST00000360786.3	37	CCDS432.1																																																																																			.		0.453	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001205.1	NM_030772	
MGA	23269	hgsc.bcm.edu	37	15	41961679	41961679	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:41961679C>A	ENST00000570161.1	+	1	587	c.587C>A	c.(586-588)tCt>tAt	p.S196Y	MGA_ENST00000389936.4_Missense_Mutation_p.S196Y|MGA_ENST00000545763.1_Missense_Mutation_p.S196Y|MGA_ENST00000219905.7_Missense_Mutation_p.S196Y|MGA_ENST00000568630.1_Intron|MGA_ENST00000566586.1_Missense_Mutation_p.S196Y			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.S196C(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATCTTGCACTCTATGCATCGT	0.448																																					p.S196Y		.											MGA,NS,carcinoma,0,2	MGA	0	1	Substitution - Missense(1)	lung(1)	c.C587A						.						168.0	166.0	166.0					15																	41961679		1978	4161	6139	SO:0001583	missense	23269	exon2			TGCACTCTATGCA	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.587C>A	15.37:g.41961679C>A	ENSP00000457035:p.Ser196Tyr	Somatic	20	0		WXS	Illumina HiSeq	.	19	2	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344740	0.82022	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.91894	-2.93;-2.93;-2.93	5.93	5.93	0.95920	.	0.095329	0.85682	D	0.000000	D	0.97284	0.9112	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97481	1.0047	10	0.87932	D	0	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	196;196	F5H7K2;E7ENI0	.;.	Y	196	ENSP00000219905:S196Y;ENSP00000374586:S196Y;ENSP00000442467:S196Y	ENSP00000219905:S196Y	S	+	2	0	MGA	39748971	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.814000	0.96858	0.563000	0.77884	TCT	.		0.448	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
ZNF727	442319	hgsc.bcm.edu	37	7	63529386	63529386	+	Missense_Mutation	SNP	T	T	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:63529386T>G	ENST00000550760.3	+	2	300	c.121T>G	c.(121-123)Ttc>Gtc	p.F41V	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F41V(1)		endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CGGAAACCTGTTCTCCTTGGG	0.383																																					p.F41V		.											ZNF727,NS,carcinoma,0,1	ZNF727	0	1	Substitution - Missense(1)	endometrium(1)	c.T121G						.						97.0	87.0	90.0					7																	63529386		692	1591	2283	SO:0001583	missense	442319	exon2			AACCTGTTCTCCT			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.121T>G	7.37:g.63529386T>G	ENSP00000447987:p.Phe41Val	Somatic	103	1		WXS	Illumina HiSeq	.	90	6	NM_001159522		Missense_Mutation	SNP	ENST00000550760.3	37	CCDS55113.1	.	.	.	.	.	.	.	.	.	.	T	0.370	-0.934798	0.02340	.	.	ENSG00000257482	ENST00000550760	T	0.01287	5.05	0.149	-0.298	0.12814	Krueppel-associated box (4);	.	.	.	.	T	0.00300	0.0009	N	0.00040	-2.495	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42548	-0.9445	8	.	.	.	.	1.4234	0.02317	0.3213:0.0:0.3267:0.3519	.	41	A8MUV8	ZN727_HUMAN	V	41	ENSP00000447987:F41V	.	F	+	1	0	ZNF727	63166821	0.000000	0.05858	0.026000	0.17262	0.026000	0.11368	-1.012000	0.03649	-1.244000	0.02516	-1.266000	0.01441	TTC	.		0.383	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
MT-ND1	4535	hgsc.bcm.edu	37	M	1072	1072	+	5'Flank	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chrM:1072G>A	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAGACCCAAACTGGGATTAGA	0.403																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6052	.			CAAACTGGGATTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1072G>A	Exception_encountered	Somatic	62	0		WXS	Illumina HiSeq	.	60	12	.	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																				.		0.403	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
TMEM132E	124842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	32955682	32955682	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr17:32955682G>A	ENST00000321639.5	+	4	1157	c.829G>A	c.(829-831)Gcc>Acc	p.A277T		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	277						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCACTCAACAGCCACCGTGGA	0.612																																					p.A277T		.											.	.	.	0			c.G829A						.						57.0	45.0	49.0					17																	32955682		2203	4300	6503	SO:0001583	missense	124842	exon4			TCAACAGCCACCG	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.829G>A	17.37:g.32955682G>A	ENSP00000316532:p.Ala277Thr	Somatic	46	0		WXS	Illumina HiSeq	.	47	8	NM_207313	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	g	14.16	2.452720	0.43531	.	.	ENSG00000181291	ENST00000321639	T	0.16196	2.36	4.86	4.86	0.63082	.	0.183125	0.48286	D	0.000186	T	0.17408	0.0418	L	0.37850	1.14	0.48696	D	0.999692	B	0.22541	0.071	B	0.28011	0.085	T	0.04811	-1.0925	10	0.27785	T	0.31	-34.3322	17.3609	0.87350	0.0:0.0:1.0:0.0	.	277	Q6IEE7	T132E_HUMAN	T	277	ENSP00000316532:A277T	ENSP00000316532:A277T	A	+	1	0	TMEM132E	29979795	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	3.635000	0.54309	2.410000	0.81850	0.290000	0.19541	GCC	.		0.612	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
UBR3	130507	hgsc.bcm.edu	37	2	170780438	170780438	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:170780438G>T	ENST00000272793.5	+	12	1916		c.e12-1		UBR3_ENST00000418381.1_Splice_Site			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)						embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GTTTATTCCAGCCAGCACCTA	0.323																																					.		.											.	.	.	0			c.1867-1G>T						.						148.0	119.0	127.0					2																	170780438		692	1589	2281	SO:0001630	splice_region_variant	130507	exon12			ATTCCAGCCAGCA	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.1867-1G>T	2.37:g.170780438G>T		Somatic	67	0		WXS	Illumina HiSeq	.	93	3	NM_172070	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Splice_Site	SNP	ENST00000272793.5	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.580486	0.86645	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBR3	170488684	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	9.869000	0.99810	2.805000	0.96524	0.655000	0.94253	.	.		0.323	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	Intron
ARID1B	57492	hgsc.bcm.edu	37	6	157469954	157469954	+	Missense_Mutation	SNP	G	G	T	rs146077641		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:157469954G>T	ENST00000350026.5	+	8	2710	c.2709G>T	c.(2707-2709)atG>atT	p.M903I	ARID1B_ENST00000478761.2_3'UTR|ARID1B_ENST00000275248.4_Missense_Mutation_p.M845I|ARID1B_ENST00000367148.1_Missense_Mutation_p.M903I|ARID1B_ENST00000346085.5_Missense_Mutation_p.M916I	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	903					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.M845I(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TGAGCAGCATGACCCCCAGTT	0.592																																					p.M916I		.											ARID1B,NS,carcinoma,0,1	ARID1B	0	1	Substitution - Missense(1)	breast(1)	c.G2748T						.						95.0	87.0	90.0					6																	157469954		2203	4296	6499	SO:0001583	missense	57492	exon9			CAGCATGACCCCC	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.2709G>T	6.37:g.157469954G>T	ENSP00000055163:p.Met903Ile	Somatic	42	1		WXS	Illumina HiSeq	.	32	3	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535032	0.45073	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000535255;ENST00000414678;ENST00000319584	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91	6.17	5.29	0.74685	.	0.187458	0.47852	D	0.000210	T	0.11110	0.0271	L	0.39898	1.24	0.38139	D	0.938392	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0	T	0.03993	-1.0986	10	0.41790	T	0.15	.	12.7814	0.57479	0.0:0.1293:0.7436:0.1271	.	153;287;903;916;845	Q8NFD5-4;F5H333;Q8NFD5;Q8NFD5-2;G3XAA0	.;.;ARI1B_HUMAN;.;.	I	916;903;903;845;320;287;372;325	ENSP00000344546:M916I;ENSP00000055163:M903I;ENSP00000356116:M903I;ENSP00000275248:M845I;ENSP00000412835:M372I;ENSP00000313006:M325I	ENSP00000275248:M845I	M	+	3	0	ARID1B	157511646	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.823000	0.55715	1.585000	0.49928	0.655000	0.94253	ATG	.		0.592	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
MT-ND4L	4539	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	10668	10668	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chrM:10668G>A	ENST00000361335.1	+	1	199	c.199G>A	c.(199-201)Gcc>Acc	p.A67T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	67					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						TACTAGTCTTTGCCGCCTGCG	0.453																																					p.A67T		.											.	.	.	0			c.G199A						.																																			SO:0001583	missense	0	exon1			GTCTTTGCCGCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.199G>A	M.37:g.10668G>A	ENSP00000354728:p.Ala67Thr	Somatic	47	0		WXS	Illumina HiSeq	.	36	31	ENST00000361335		Missense_Mutation	SNP	ENST00000361335.1	37																																																																																				.		0.453	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
THAP3	90326	hgsc.bcm.edu	37	1	6692962	6692962	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:6692962T>C	ENST00000054650.4	+	6	703	c.545T>C	c.(544-546)cTt>cCt	p.L182P	DNAJC11_ENST00000465508.1_5'Flank|THAP3_ENST00000377627.3_Intron|THAP3_ENST00000307896.6_Missense_Mutation_p.L181P	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3	182							DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L182P(1)		breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGCTATGCCCTTTTGGACTTA	0.567																																					p.L182P		.											THAP3_ENST00000054650,NS,carcinoma,0,1	THAP3_ENST00000054650	0	1	Substitution - Missense(1)	lung(1)	c.T545C						.						80.0	82.0	82.0					1																	6692962		876	1991	2867	SO:0001583	missense	90326	exon6			ATGCCCTTTTGGA	BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.545T>C	1.37:g.6692962T>C	ENSP00000054650:p.Leu182Pro	Somatic	71	1		WXS	Illumina HiSeq	.	50	3	NM_001195753	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Missense_Mutation	SNP	ENST00000054650.4	37	CCDS55572.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682959	0.68157	.	.	ENSG00000041988	ENST00000054650;ENST00000307896	D;D	0.96802	-4.13;-4.13	4.05	4.05	0.47172	.	0.529158	0.14984	N	0.287069	D	0.97284	0.9112	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	D	0.96587	0.9435	10	0.72032	D	0.01	-24.6352	9.3095	0.37895	0.0:0.0:0.0:1.0	.	181;182	Q8WTV1-3;Q8WTV1	.;THAP3_HUMAN	P	182;181	ENSP00000054650:L182P;ENSP00000311537:L181P	ENSP00000054650:L182P	L	+	2	0	THAP3	6615549	0.996000	0.38824	0.997000	0.53966	0.985000	0.73830	4.508000	0.60441	1.683000	0.51011	0.379000	0.24179	CTT	.		0.567	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004203.1	NM_138350	
TRIM51HP	440041	hgsc.bcm.edu	37	11	55062174	55062174	+	RNA	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:55062174G>T	ENST00000526016.1	-	0	756					NR_038174.2				tripartite motif-containing 51H, pseudogene																		GAAAACATCTGCTAAAATCTT	0.343																																					.		.											.	.	.	0			.						.																																					440041	.			ACATCTGCTAAAA			11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55062174G>T		Somatic	177	0		WXS	Illumina HiSeq	.	133	35	.		RNA	SNP	ENST00000526016.1	37																																																																																				.		0.343	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000391438.1		
C8B	732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	57409394	57409394	+	Silent	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:57409394G>A	ENST00000371237.4	-	8	1275	c.1209C>T	c.(1207-1209)tgC>tgT	p.C403C	C8B_ENST00000535057.1_Silent_p.C341C|C8B_ENST00000543257.1_Silent_p.C351C	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	403	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						GAATACCTCTGCATTTGCCTA	0.428																																					p.C403C		.											.	.	.	0			c.C1209T						.						217.0	184.0	196.0					1																	57409394		2203	4300	6503	SO:0001819	synonymous_variant	732	exon8			ACCTCTGCATTTG	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1209C>T	1.37:g.57409394G>A		Somatic	56	0		WXS	Illumina HiSeq	.	62	12	NM_000066	A1L4K7	Silent	SNP	ENST00000371237.4	37	CCDS30730.1																																																																																			.		0.428	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
C6orf164	63914	hgsc.bcm.edu;ucsc.edu	37	6	88107925	88107925	+	5'UTR	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:88107925A>G	ENST00000369570.4	+	0	1086				RP1-102H19.8_ENST00000448282.2_Intron|RP1-102H19.8_ENST00000369572.2_Intron			Q5TEZ4	CF164_HUMAN	chromosome 6 open reading frame 164																		gggctgctgaataaagccatg	0.537																																					.		.											.	.	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	63914	.			TGCTGAATAAAGC	AK021476		6q15-q16.1	2008-10-20			ENSG00000203871	ENSG00000203871			21404	protein-coding gene	gene with protein product							Standard	NR_026784		Approved	dJ102H19.4	uc021zcm.2	Q5TEZ4	OTTHUMG00000015170	ENST00000369570.4:c.-8A>G	6.37:g.88107925A>G		Somatic	21	0		WXS	Illumina HiSeq	.	13	5	.	A6NM89	RNA	SNP	ENST00000369570.4	37																																																																																				.		0.537	C6orf164-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000041437.2	NM_022084	
SIK2	23235	hgsc.bcm.edu	37	11	111572283	111572283	+	Silent	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:111572283G>A	ENST00000304987.3	+	6	884	c.711G>A	c.(709-711)ccG>ccA	p.P237P		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						TCCGGATTCCGTATTTCATGT	0.408																																					p.P237P		.											.	.	.	0			c.G711A						.						191.0	173.0	179.0					11																	111572283		2201	4297	6498	SO:0001819	synonymous_variant	23235	exon6			GATTCCGTATTTC	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.711G>A	11.37:g.111572283G>A		Somatic	107	0		WXS	Illumina HiSeq	.	91	4	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Silent	SNP	ENST00000304987.3	37	CCDS8347.1																																																																																			.		0.408	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
RPSAP58	388524	hgsc.bcm.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:24010294C>G	ENST00000496398.1	+	4	754	c.331C>G	c.(331-333)Cag>Gag	p.Q111E	RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.Q111E					ribosomal protein SA pseudogene 58									p.Q111E(12)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						CTTCACTAACCAGATCCAGGC	0.567																																					.		.											RPSAP58_ENST00000496398,NS,carcinoma,0,40	RPSAP58_ENST00000496398	0	12	Substitution - Missense(12)	kidney(6)|urinary_tract(2)|prostate(2)|endometrium(2)	.						.																																			SO:0001583	missense	388524	.			ACTAACCAGATCC			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.331C>G	19.37:g.24010294C>G	ENSP00000417240:p.Gln111Glu	Somatic	45	0		WXS	Illumina HiSeq	.	41	2	.		RNA	SNP	ENST00000496398.1	37		.	.	.	.	.	.	.	.	.	.	.	13.90	2.375690	0.42105	.	.	ENSG00000205246	ENST00000496398;ENST00000354585	T;T	0.21932	1.98;1.98	2.52	2.52	0.30459	.	0.000000	0.64402	U	0.000001	T	0.17619	0.0423	.	.	.	0.48830	D	0.999718	B	0.34226	0.443	B	0.32624	0.149	T	0.11084	-1.0602	9	0.72032	D	0.01	.	10.8987	0.47038	0.0:1.0:0.0:0.0	.	111	A6NE09	.	E	111	ENSP00000417240:Q111E;ENSP00000346598:Q111E	ENSP00000346598:Q111E	Q	+	1	0	RPSAP58	23802134	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	4.812000	0.62613	1.477000	0.48234	0.627000	0.83407	CAG	.		0.567	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662	
ERVK13-1	100507321	hgsc.bcm.edu	37	16	2712543	2712543	+	RNA	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr16:2712543C>T	ENST00000568395.1	-	0	4184					NR_040023.1		Q9NX77	ENK13_HUMAN	endogenous retrovirus group K13, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)	structural molecule activity (GO:0005198)										ttttggagcccaatcaataac	0.388																																					.		.											.	.	.	0			.						.						113.0	90.0	97.0					16																	2712543		692	1591	2283			100507321	.			GGAGCCCAATCAA			16p13.3	2011-12-16				ENSG00000260565			27548	other	endogenous retrovirus	"""HERV-K_16p3.3 provirus ancestral Env polyprotein"""						Standard	NR_040023		Approved		uc010bss.2	Q9NX77			16.37:g.2712543C>T		Somatic	67	0		WXS	Illumina HiSeq	.	62	6	.	A8K9G3	RNA	SNP	ENST00000568395.1	37																																																																																				.		0.388	ERVK13-1-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000431428.1	NR_040023	
C16orf86	388284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67702138	67702138	+	Missense_Mutation	SNP	G	G	A	rs369814761	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr16:67702138G>A	ENST00000403458.4	+	4	744	c.589G>A	c.(589-591)Gtc>Atc	p.V197I	ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000602644.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	197										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GTACCAGTACGTCAACTATTG	0.672											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3	0.000599042	0.0	0.0	5008	,	,		17886	0.002		0.0	False		,,,				2504	0.001				p.V197I		.											.	.	.	0			c.G589A						.	G	ILE/VAL	0,4380		0,0,2190	14.0	16.0	15.0		589	4.9	1.0	16		15	2,8584		0,2,4291	no	missense	C16orf86	NM_001012984.2	29	0,2,6481	AA,AG,GG		0.0233,0.0,0.0154	benign	197/318	67702138	2,12964	2190	4293	6483	SO:0001583	missense	388284	exon4			CAGTACGTCAACT		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.589G>A	16.37:g.67702138G>A	ENSP00000384117:p.Val197Ile	Somatic	38	0	1101	WXS	Illumina HiSeq	.	33	8	NM_001012984	B5MCW6	Missense_Mutation	SNP	ENST00000403458.4	37	CCDS32468.2	.	.	.	.	.	.	.	.	.	.	G	6.613	0.481577	0.12581	0.0	2.33E-4	ENSG00000159761	ENST00000403458	.	.	.	5.95	4.86	0.63082	.	.	.	.	.	T	0.12050	0.0293	N	0.01168	-0.975	0.23657	N	0.997188	B	0.02656	0.0	B	0.01281	0.0	T	0.20739	-1.0266	8	0.02654	T	1	-5.1869	10.6841	0.45833	0.9268:0.0:0.0732:0.0	.	197	Q6ZW13	CP086_HUMAN	I	197	.	ENSP00000384117:V197I	V	+	1	0	C16orf86	66259639	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.183000	0.42565	1.064000	0.40671	-0.414000	0.06135	GTC	.		0.672	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
ADD2	119	hgsc.bcm.edu	37	2	70933527	70933527	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:70933527G>A	ENST00000264436.4	-	3	458	c.14C>T	c.(13-15)aCg>aTg	p.T5M	ADD2_ENST00000413157.2_Missense_Mutation_p.T5M|ADD2_ENST00000473232.1_5'Flank|ADD2_ENST00000430656.1_Missense_Mutation_p.T21M|ADD2_ENST00000355733.3_Missense_Mutation_p.T5M|ADD2_ENST00000407644.2_Missense_Mutation_p.T5M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	5					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.T5M(2)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CTCGGGGACCGTCTCTTCGCT	0.637																																					p.T21M		.											ADD2_ENST00000264436,colon,carcinoma,0,2	ADD2_ENST00000264436	0	2	Substitution - Missense(2)	large_intestine(2)	c.C62T						.						47.0	49.0	48.0					2																	70933527		2202	4300	6502	SO:0001583	missense	119	exon2			GGGACCGTCTCTT	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.14C>T	2.37:g.70933527G>A	ENSP00000264436:p.Thr5Met	Somatic	62	0		WXS	Illumina HiSeq	.	39	2	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566111	0.45694	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000522886;ENST00000264439;ENST00000356565;ENST00000517596;ENST00000413157;ENST00000430656;ENST00000415348;ENST00000425976;ENST00000447731	T;T;T;T;T;T;T;T	0.39997	3.31;3.31;3.1;1.84;3.01;1.05;1.43;1.41	5.64	3.74	0.42951	.	0.838109	0.10718	N	0.642033	T	0.23532	0.0569	N	0.14661	0.345	0.09310	N	1	P;P;P;P;P;P	0.50819	0.916;0.773;0.606;0.861;0.939;0.872	B;B;B;B;B;B	0.37480	0.179;0.229;0.058;0.179;0.179;0.251	T	0.05852	-1.0860	10	0.87932	D	0	-0.0539	8.2528	0.31737	0.0844:0.0:0.7569:0.1586	.	21;5;5;5;5;5	B4DM17;P35612-4;E9PAN1;Q05DK5;P35612;P35612-3	.;.;.;.;ADDB_HUMAN;.	M	5;5;5;5;5;5;5;5;5;21;5;5;5	ENSP00000264436:T5M;ENSP00000384677:T5M;ENSP00000347972:T5M;ENSP00000430243:T5M;ENSP00000388072:T5M;ENSP00000398112:T21M;ENSP00000412357:T5M;ENSP00000412681:T5M	ENSP00000264436:T5M	T	-	2	0	ADD2	70787035	0.162000	0.22906	0.105000	0.21289	0.736000	0.42039	1.508000	0.35769	2.807000	0.96579	0.591000	0.81541	ACG	.		0.637	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
TTN	7273	hgsc.bcm.edu	37	2	179569097	179569097	+	Silent	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:179569097C>T	ENST00000591111.1	-	104	29273	c.29049G>A	c.(29047-29049)ctG>ctA	p.L9683L	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.L10000L|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Silent_p.L8756L|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13761	Ig-like 78.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCCTTCTTTCAGAGTCACAT	0.428																																					p.L10000L		.											TTN_ENST00000342992,NS,carcinoma,0,1	TTN_ENST00000342992	0	0			c.G30000A						.						185.0	177.0	180.0					2																	179569097		1973	4171	6144	SO:0001819	synonymous_variant	7273	exon106			TTCTTTCAGAGTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29049G>A	2.37:g.179569097C>T		Somatic	36	0		WXS	Illumina HiSeq	.	48	2	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SUGT1	10910	hgsc.bcm.edu	37	13	53250435	53250435	+	Missense_Mutation	SNP	C	C	T	rs371011852		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr13:53250435C>T	ENST00000343788.6	+	12	876	c.794C>T	c.(793-795)aCg>aTg	p.T265M	SUGT1_ENST00000535397.1_Missense_Mutation_p.T177M|SUGT1_ENST00000310528.8_Missense_Mutation_p.T233M	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	265					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		GATGTGCCTACGCCAAAACAA	0.368																																					p.T265M		.											.	.	.	0			c.C794T						.	C	MET/THR,MET/THR	0,4406		0,0,2203	101.0	104.0	103.0		698,794	0.0	0.0	13		103	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SUGT1	NM_006704.3,NM_001130912.1	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	233/334,265/366	53250435	1,13005	2203	4300	6503	SO:0001583	missense	10910	exon12			TGCCTACGCCAAA	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.794C>T	13.37:g.53250435C>T	ENSP00000367208:p.Thr265Met	Somatic	43	0		WXS	Illumina HiSeq	.	48	4	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	37	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	C	7.730	0.698971	0.15106	0.0	1.16E-4	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	T;T	0.25749	1.79;1.78	5.18	0.0141	0.14098	HSP20-like chaperone (1);	0.458238	0.25570	N	0.029762	T	0.11495	0.0280	N	0.08118	0	0.09310	N	1	B;B;B;B	0.21753	0.029;0.011;0.06;0.018	B;B;B;B	0.19148	0.024;0.003;0.018;0.013	T	0.22382	-1.0218	10	0.48119	T	0.1	0.5222	9.1228	0.36797	0.4271:0.4666:0.0:0.1063	.	177;177;265;233	F5H5A9;B4DYC6;Q9Y2Z0;Q9Y2Z0-2	.;.;SUGT1_HUMAN;.	M	265;177;233	ENSP00000367208:T265M;ENSP00000308067:T233M	ENSP00000308067:T233M	T	+	2	0	SUGT1	52148436	0.163000	0.22920	0.000000	0.03702	0.498000	0.33706	1.603000	0.36794	0.106000	0.17784	-0.271000	0.10264	ACG	.		0.368	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
NET1	10276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	5496410	5496410	+	Silent	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr10:5496410A>G	ENST00000355029.4	+	9	1093	c.951A>G	c.(949-951)aaA>aaG	p.K317K	NET1_ENST00000484741.1_3'UTR|NET1_ENST00000542715.1_Silent_p.K136K|NET1_ENST00000380359.3_Silent_p.K263K	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	317	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						GCCTAGTCAAATACCCTTTAC	0.433																																					p.K317K		.											.	.	.	0			c.A951G						.						63.0	66.0	65.0					10																	5496410		2203	4300	6503	SO:0001819	synonymous_variant	10276	exon9			AGTCAAATACCCT	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.951A>G	10.37:g.5496410A>G		Somatic	60	0		WXS	Illumina HiSeq	.	55	8	NM_001047160	Q12773|Q96D82|Q99903|Q9UEN6	Silent	SNP	ENST00000355029.4	37	CCDS41483.1																																																																																			.		0.433	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
CYP2S1	29785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41709463	41709463	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:41709463G>A	ENST00000310054.4	+	7	1301	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	CYP2S1_ENST00000542619.1_Missense_Mutation_p.R87Q	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	362					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						GAGGCGCAGCGGCTGCTGGCG	0.682																																					p.R362Q		.											.	.	.	0			c.G1085A						.						27.0	24.0	25.0					19																	41709463		2191	4293	6484	SO:0001583	missense	29785	exon7			CGCAGCGGCTGCT	AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.1085G>A	19.37:g.41709463G>A	ENSP00000308032:p.Arg362Gln	Somatic	85	0		WXS	Illumina HiSeq	.	71	11	NM_030622	Q9BZ66	Missense_Mutation	SNP	ENST00000310054.4	37	CCDS12573.1	.	.	.	.	.	.	.	.	.	.	G	34	5.385031	0.95967	.	.	ENSG00000167600	ENST00000301173;ENST00000310054;ENST00000542619	D;D	0.97480	-4.4;-4.4	5.02	5.02	0.67125	.	0.135740	0.47093	D	0.000247	D	0.98858	0.9614	H	0.94658	3.565	0.37100	D	0.899854	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99960	1.1716	10	0.87932	D	0	.	15.8828	0.79216	0.0:0.0:1.0:0.0	.	87;362	B4DJI0;Q96SQ9	.;CP2S1_HUMAN	Q	362;362;87	ENSP00000308032:R362Q;ENSP00000445299:R87Q	ENSP00000301173:R362Q	R	+	2	0	CYP2S1	46401303	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.908000	0.87438	2.340000	0.79590	0.549000	0.68633	CGG	.		0.682	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		
PLCL1	5334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198950711	198950711	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:198950711C>T	ENST00000428675.1	+	2	2868	c.2470C>T	c.(2470-2472)Cgg>Tgg	p.R824W	PLCL1_ENST00000437704.2_Missense_Mutation_p.R726W	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	824					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GCCTGGATATCGGCATGTTCC	0.453																																					p.R824W		.											.	.	.	0			c.C2470T						.						208.0	183.0	192.0					2																	198950711		2203	4300	6503	SO:0001583	missense	5334	exon2			GGATATCGGCATG	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2470C>T	2.37:g.198950711C>T	ENSP00000402861:p.Arg824Trp	Somatic	87	0		WXS	Illumina HiSeq	.	67	14	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	37	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.698517	0.48307	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.16597	2.33;2.33	5.5	4.6	0.57074	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.099179	0.43416	D	0.000565	T	0.43656	0.1257	M	0.83603	2.65	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.44375	-0.9332	9	.	.	.	.	12.3071	0.54908	0.4667:0.5333:0.0:0.0	.	824;750	Q15111;B4DYZ4	PLCL1_HUMAN;.	W	824;726	ENSP00000402861:R824W;ENSP00000414138:R726W	.	R	+	1	2	PLCL1	198658956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.053000	0.49901	1.514000	0.48869	0.655000	0.94253	CGG	.		0.453	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
ASB7	140460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101170164	101170164	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:101170164A>G	ENST00000332783.7	+	5	1519	c.734A>G	c.(733-735)tAt>tGt	p.Y245C	ASB7_ENST00000343276.4_Missense_Mutation_p.Y245C|ASB7_ENST00000558747.1_Intron	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	245					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			ACACGGAACTATGAAGGACAG	0.408																																					p.Y245C		.											.	.	.	0			c.A734G						.						94.0	89.0	91.0					15																	101170164		2203	4300	6503	SO:0001583	missense	140460	exon5			GGAACTATGAAGG		CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.734A>G	15.37:g.101170164A>G	ENSP00000328327:p.Tyr245Cys	Somatic	77	0		WXS	Illumina HiSeq	.	73	21	NM_024708	A8K1E5|Q6GSJ6|Q7Z4S3	Missense_Mutation	SNP	ENST00000332783.7	37	CCDS10387.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.439849	0.63067	.	.	ENSG00000183475	ENST00000332783;ENST00000343276	T;T	0.64803	-0.12;-0.12	5.53	5.53	0.82687	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.72252	0.3437	L	0.39397	1.21	0.80722	D	1	D;P	0.71674	0.998;0.904	D;P	0.73380	0.98;0.481	T	0.75022	-0.3464	10	0.72032	D	0.01	-11.2018	15.9682	0.79991	1.0:0.0:0.0:0.0	.	245;245	Q9H672;Q9H672-2	ASB7_HUMAN;.	C	245	ENSP00000328327:Y245C;ENSP00000339819:Y245C	ENSP00000328327:Y245C	Y	+	2	0	ASB7	98987687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.740000	0.91579	2.224000	0.72417	0.528000	0.53228	TAT	.		0.408	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313617.1	NM_024708	
ZNF418	147686	hgsc.bcm.edu;bcgsc.ca	37	19	58437921	58437921	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:58437921C>A	ENST00000396147.1	-	4	1919	c.1628G>T	c.(1627-1629)tGt>tTt	p.C543F	ZNF418_ENST00000599852.1_Missense_Mutation_p.C458F|ZNF418_ENST00000425570.3_Missense_Mutation_p.C564F|ZNF418_ENST00000595830.1_Missense_Mutation_p.C543F|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TGACTTTCCACATTCTCCACA	0.443																																					p.C543F		.											.	.	.	0			c.G1628T						.						87.0	90.0	89.0					19																	58437921		2189	4293	6482	SO:0001583	missense	147686	exon4			TTTCCACATTCTC	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.1628G>T	19.37:g.58437921C>A	ENSP00000379451:p.Cys543Phe	Somatic	50	0		WXS	Illumina HiSeq	.	61	4	NM_133460	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	ENST00000396147.1	37	CCDS42642.1	.	.	.	.	.	.	.	.	.	.	.	15.59	2.878297	0.51801	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	D;D	0.85861	-2.04;-2.04	2.41	-0.123	0.13527	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.88153	0.6360	H	0.97659	4.05	0.30537	N	0.766844	P	0.44521	0.837	B	0.39971	0.315	D	0.84106	0.0398	9	0.87932	D	0	.	5.2005	0.15262	0.2007:0.6745:0.0:0.1248	.	543	Q8TF45	ZN418_HUMAN	F	543;564;509	ENSP00000379451:C543F;ENSP00000407039:C564F	ENSP00000379451:C543F	C	-	2	0	ZNF418	63129733	1.000000	0.71417	0.001000	0.08648	0.331000	0.28603	3.016000	0.49607	-0.077000	0.12752	0.313000	0.20887	TGT	.		0.443	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460	
ZNF12	7559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6731851	6731851	+	Missense_Mutation	SNP	T	T	C	rs367716418		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:6731851T>C	ENST00000405858.1	-	5	1263	c.722A>G	c.(721-723)tAt>tGt	p.Y241C	ZNF12_ENST00000404360.1_Missense_Mutation_p.Y167C|AC073343.13_ENST00000366167.2_RNA|ZNF12_ENST00000342651.5_Missense_Mutation_p.Y203C|AC073343.2_ENST00000577401.1_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	241					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		ATTCCACTTATAGGGCTTTTC	0.383																																					p.Y241C		.											.	.	.	0			c.A722G						.	T	CYS/TYR,CYS/TYR	1,4105		0,1,2052	52.0	55.0	54.0		722,608	1.7	0.6	7		54	0,8484		0,0,4242	no	missense,missense	ZNF12	NM_016265.3,NM_006956.2	194,194	0,1,6294	CC,CT,TT		0.0,0.0244,0.0079	benign,benign	241/698,203/660	6731851	1,12589	2053	4242	6295	SO:0001583	missense	7559	exon5			CACTTATAGGGCT	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.722A>G	7.37:g.6731851T>C	ENSP00000385939:p.Tyr241Cys	Somatic	54	0		WXS	Illumina HiSeq	.	57	8	NM_016265	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	ENST00000405858.1	37	CCDS47538.1	.	.	.	.	.	.	.	.	.	.	T	7.968	0.748346	0.15710	2.44E-4	0.0	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476;ENST00000330442	T;T;T	0.63913	-0.07;1.35;1.35	4.03	1.7	0.24286	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.575278	0.14693	N	0.304034	T	0.51534	0.1680	L	0.60904	1.88	0.23568	N	0.997399	B;B	0.09022	0.002;0.001	B;B	0.10450	0.002;0.005	T	0.51196	-0.8736	10	0.72032	D	0.01	.	2.2617	0.04068	0.2234:0.2878:0.0:0.4888	.	241;203	P17014;P17014-5	ZNF12_HUMAN;.	C	167;241;203;299;205	ENSP00000384405:Y167C;ENSP00000385939:Y241C;ENSP00000344745:Y203C	ENSP00000331039:Y205C	Y	-	2	0	ZNF12	6698376	0.011000	0.17503	0.599000	0.28851	0.997000	0.91878	0.233000	0.17911	0.374000	0.24650	0.460000	0.39030	TAT	.		0.383	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265	
EHMT2	10919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31855598	31855598	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:31855598C>T	ENST00000375537.4	-	14	1892	c.1886G>A	c.(1885-1887)cGg>cAg	p.R629Q	EHMT2_ENST00000395728.3_Missense_Mutation_p.R686Q|EHMT2_ENST00000375528.4_Missense_Mutation_p.R652Q|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375530.4_Missense_Mutation_p.R595Q	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	629					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CAGGGCCTCCCGGCCTGGCCC	0.662																																					p.R629Q		.											.	.	.	0			c.G1886A						.						85.0	105.0	98.0					6																	31855598		1509	2706	4215	SO:0001583	missense	10919	exon14			GCCTCCCGGCCTG	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1886G>A	6.37:g.31855598C>T	ENSP00000364687:p.Arg629Gln	Somatic	32	0		WXS	Illumina HiSeq	.	22	6	NM_006709	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679728	0.68042	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.70986	-0.53;-0.43;-0.37;-0.52	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	N	0.24115	0.695	0.52501	D	0.999951	P;P;P;P	0.50710	0.898;0.938;0.627;0.791	B;B;B;B	0.41466	0.195;0.358;0.139;0.195	T	0.58205	-0.7677	10	0.49607	T	0.09	.	17.9856	0.89155	0.0:1.0:0.0:0.0	.	652;595;629;443	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	Q	686;652;595;629;443	ENSP00000379078:R686Q;ENSP00000364678:R652Q;ENSP00000364680:R595Q;ENSP00000364687:R629Q	ENSP00000364678:R652Q	R	-	2	0	EHMT2	31963577	0.985000	0.35326	1.000000	0.80357	0.991000	0.79684	2.615000	0.46368	2.534000	0.85438	0.585000	0.79938	CGG	.		0.662	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
TRAK1	22906	hgsc.bcm.edu	37	3	42260987	42260987	+	Splice_Site	SNP	G	G	A	rs545460609		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:42260987G>A	ENST00000327628.5	+	15	2365	c.1965G>A	c.(1963-1965)gcG>gcA	p.A655A	RNU4-78P_ENST00000410940.1_RNA|TRAK1_ENST00000396175.1_Splice_Site_p.A597A|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	655					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAATTTAGCGCACCATCCTG	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16610	0.0		0.0	False		,,,				2504	0.0				p.A655A	GBM(44;195 884 22595 31865 41850)	.											TRAK1_ENST00000543338,lower_third,carcinoma,0,2	TRAK1_ENST00000543338	0	0			c.G1965A						.						245.0	238.0	240.0					3																	42260987		2071	4210	6281	SO:0001630	splice_region_variant	22906	exon15			TTTAGCGCACCAT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1964-1G>A	3.37:g.42260987G>A		Somatic	58	0		WXS	Illumina HiSeq	.	43	2	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.463	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	Silent
GPR17	2840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128407628	128407628	+	Silent	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:128407628A>G	ENST00000272644.3	+	2	116	c.42A>G	c.(40-42)ccA>ccG	p.P14P	GPR17_ENST00000544369.1_Silent_p.P14P|LIMS2_ENST00000324938.5_Intron|GPR17_ENST00000486700.1_Intron|LIMS2_ENST00000410011.1_Intron|GPR17_ENST00000393018.3_Silent_p.P14P|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000410038.1_5'Flank|LIMS2_ENST00000409254.1_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000409808.2_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	14					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		GAAAGCCCCCAAGAGAGATGC	0.572											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P14P		.											.	.	.	0			c.A42G						.						50.0	44.0	46.0					2																	128407628		2202	4299	6501	SO:0001819	synonymous_variant	2840	exon2			GCCCCCAAGAGAG		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.42A>G	2.37:g.128407628A>G		Somatic	103	0	1564	WXS	Illumina HiSeq	.	88	27	NM_005291	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Silent	SNP	ENST00000272644.3	37	CCDS2148.1																																																																																			.		0.572	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1		
NIPBL	25836	hgsc.bcm.edu;bcgsc.ca	37	5	37007576	37007576	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:37007576G>T	ENST00000282516.8	+	18	4738	c.4239G>T	c.(4237-4239)caG>caT	p.Q1413H	NIPBL_ENST00000448238.2_Splice_Site_p.Q1413H	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1413					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAATTCTTCAGGTAAGATTTT	0.299																																					p.Q1413H		.											.	.	.	0			c.G4239T						.						40.0	40.0	40.0					5																	37007576		2198	4293	6491	SO:0001630	splice_region_variant	25836	exon18			TCTTCAGGTAAGA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4239+1G>T	5.37:g.37007576G>T		Somatic	59	0		WXS	Illumina HiSeq	.	70	4	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801473	0.50315	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93859	-3.3;-3.3	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.90198	0.6936	L	0.45137	1.4	0.58432	D	0.999998	B;B	0.16802	0.011;0.019	B;B	0.15052	0.012;0.008	D	0.86103	0.1557	10	0.23891	T	0.37	.	17.1344	0.86735	0.0:0.0:1.0:0.0	.	1413;1413	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	H	1413	ENSP00000282516:Q1413H;ENSP00000406266:Q1413H	ENSP00000282516:Q1413H	Q	+	3	2	NIPBL	37043333	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.658000	0.83755	2.495000	0.84180	0.650000	0.86243	CAG	.		0.299	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	Missense_Mutation
ZNF703	80139	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	37555950	37555950	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr8:37555950G>A	ENST00000331569.4	+	2	1760	c.1531G>A	c.(1531-1533)Gcc>Acc	p.A511T		NM_025069.1	NP_079345.1	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	511	Poly-Ala.				adherens junction assembly (GO:0034333)|cellular response to estradiol stimulus (GO:0071392)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)		FGFR1/ZNF703(2)	breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)	7			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			cgccgccgccgccgccgccgc	0.766																																					p.A511T		.											.	.	.	0			c.G1531A						.						1.0	1.0	1.0					8																	37555950		706	1819	2525	SO:0001583	missense	80139	exon2			GCCGCCGCCGCCG	AK024361	CCDS6094.1	8p12	2008-05-02				ENSG00000183779			25883	protein-coding gene	gene with protein product						15897872	Standard	NM_025069		Approved	FLJ14299, ZNF503L	uc003xjy.1	Q9H7S9		ENST00000331569.4:c.1531G>A	8.37:g.37555950G>A	ENSP00000332325:p.Ala511Thr	Somatic	30	0		WXS	Illumina HiSeq	.	35	9	NM_025069	Q5XG76	Missense_Mutation	SNP	ENST00000331569.4	37	CCDS6094.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.115878	0.56505	.	.	ENSG00000183779	ENST00000331569	T	0.47528	0.84	3.48	3.48	0.39840	.	0.000000	0.38058	N	0.001822	T	0.22975	0.0555	N	0.14661	0.345	0.32638	N	0.521036	D	0.53745	0.962	B	0.35240	0.198	T	0.26467	-1.0102	10	0.22109	T	0.4	-7.487	10.3471	0.43911	0.0:0.0:1.0:0.0	.	511	Q9H7S9	ZN703_HUMAN	T	511	ENSP00000332325:A511T	ENSP00000332325:A511T	A	+	1	0	ZNF703	37675108	0.990000	0.36364	0.296000	0.24974	0.757000	0.42996	3.077000	0.50089	1.771000	0.52183	0.313000	0.20887	GCC	.		0.766	ZNF703-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376683.2	NM_025069	
ITGA9	3680	hgsc.bcm.edu	37	3	37670693	37670693	+	Missense_Mutation	SNP	G	G	A	rs369282174		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:37670693G>A	ENST00000264741.5	+	16	1961	c.1705G>A	c.(1705-1707)Gtc>Atc	p.V569I	ITGA9_ENST00000422441.1_Missense_Mutation_p.V569I	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	569					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GGTGCAGGACGTCATCAGCCC	0.507																																					p.V569I		.											ITGA9,NS,carcinoma,0,1	ITGA9	0	0			c.G1705A						.	G	ILE/VAL	0,4406		0,0,2203	127.0	119.0	121.0		1705	5.2	1.0	3		121	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITGA9	NM_002207.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	569/1036	37670693	1,13005	2203	4300	6503	SO:0001583	missense	3680	exon16			CAGGACGTCATCA	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1705G>A	3.37:g.37670693G>A	ENSP00000264741:p.Val569Ile	Somatic	45	0		WXS	Illumina HiSeq	.	40	2	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166928	0.38217	0.0	1.16E-4	ENSG00000144668	ENST00000422441;ENST00000264741	T;T	0.43688	0.94;0.94	5.17	5.17	0.71159	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.28200	0.0696	N	0.25060	0.705	0.58432	D	0.999999	B;B	0.31730	0.337;0.165	B;B	0.31495	0.131;0.044	T	0.08452	-1.0721	10	0.05620	T	0.96	.	17.4652	0.87630	0.0:0.0:1.0:0.0	.	569;569	Q13797;E9PDS3	ITA9_HUMAN;.	I	569	ENSP00000397258:V569I;ENSP00000264741:V569I	ENSP00000264741:V569I	V	+	1	0	ITGA9	37645697	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	7.479000	0.81095	2.403000	0.81681	0.655000	0.94253	GTC	.		0.507	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
AAK1	22848	hgsc.bcm.edu	37	2	69741780	69741780	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:69741780C>G	ENST00000409085.4	-	13	1975	c.1599G>C	c.(1597-1599)caG>caC	p.Q533H	RN7SL604P_ENST00000492589.2_RNA|AAK1_ENST00000406297.3_Missense_Mutation_p.Q533H|AAK1_ENST00000409068.1_Missense_Mutation_p.Q533H	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	533	Gln-rich.		Q -> H. {ECO:0000269|PubMed:17344846}.		endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						gctgctgctgctgGTAGAAAT	0.532																																					p.Q533H		.											AAK1_ENST00000409085,NS,carcinoma,0,2	AAK1_ENST00000409085	0	0			c.G1599C						.						38.0	40.0	39.0					2																	69741780		2200	4298	6498	SO:0001583	missense	22848	exon13			CTGCTGCTGGTAG	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1599G>C	2.37:g.69741780C>G	ENSP00000386456:p.Gln533His	Somatic	43	1		WXS	Illumina HiSeq	.	45	3	NM_014911	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	C	8.018	0.758927	0.15846	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.78003	1.57;-1.13;-1.14	4.89	3.07	0.35406	.	0.854162	0.10089	N	0.717362	T	0.57725	0.2073	N	0.14661	0.345	0.25395	N	0.988498	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.41610	-0.9499	10	0.11794	T	0.64	0.4343	6.749	0.23477	0.0:0.7262:0.1782:0.0957	.	533;533;533	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	H	533	ENSP00000386342:Q533H;ENSP00000386456:Q533H;ENSP00000385181:Q533H	ENSP00000385181:Q533H	Q	-	3	2	AAK1	69595284	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.245000	0.18142	0.670000	0.31165	0.447000	0.29281	CAG	.		0.532	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
MEI1	150365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42191438	42191438	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr22:42191438T>C	ENST00000401548.3	+	29	3598	c.3558T>C	c.(3556-3558)agT>agC	p.S1186S	MEI1_ENST00000400107.1_Silent_p.S519S|MEI1_ENST00000300398.4_Intron|MEI1_ENST00000476893.1_3'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GGAGTAGCAGTGTCCTCTCTC	0.542																																					p.S1186S		.											.	.	.	0			c.T3558C						.						156.0	158.0	157.0					22																	42191438		2041	4207	6248	SO:0001819	synonymous_variant	150365	exon29			TAGCAGTGTCCTC	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3558T>C	22.37:g.42191438T>C		Somatic	102	0		WXS	Illumina HiSeq	.	96	26	NM_152513		Silent	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	t	0.171	-1.071513	0.01918	.	.	ENSG00000167077	ENST00000423900	.	.	.	5.01	-4.66	0.03329	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36432	-0.9748	4	.	.	.	-18.1103	12.128	0.53926	0.0:0.3302:0.0:0.6698	.	.	.	.	R	5	.	.	C	+	1	0	MEI1	40521384	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-1.319000	0.02702	-1.224000	0.02581	-0.464000	0.05259	TGT	.		0.542	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
EXD1	161829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41483652	41483652	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:41483652T>C	ENST00000314992.5	-	8	868	c.678A>G	c.(676-678)caA>caG	p.Q226Q	EXD1_ENST00000458580.2_Silent_p.Q284Q|RN7SL497P_ENST00000476341.2_RNA	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	226							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						GAATTAGTTTTTGTCTCTTTT	0.373																																					p.Q226Q		.											.	.	.	0			c.A678G						.						77.0	80.0	79.0					15																	41483652		2203	4300	6503	SO:0001819	synonymous_variant	161829	exon8			TAGTTTTTGTCTC	BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.678A>G	15.37:g.41483652T>C		Somatic	289	0		WXS	Illumina HiSeq	.	318	72	NM_152596	A8K909|B7Z839|Q6ZW94	Silent	SNP	ENST00000314992.5	37	CCDS10072.1																																																																																			.		0.373	EXD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252553.2	NM_152596	
LRRC15	131578	hgsc.bcm.edu;broad.mit.edu	37	3	194080098	194080098	+	Missense_Mutation	SNP	C	C	T	rs372437949		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:194080098C>T	ENST00000347624.3	-	2	1760	c.1675G>A	c.(1675-1677)Gtc>Atc	p.V559I	LRRC15_ENST00000439944.2_Missense_Mutation_p.V565I|LRRC15_ENST00000428839.1_Missense_Mutation_p.V565I	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	559					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		CAACAGCCGACGCAGGCAGCC	0.612																																					p.V565I		.											LRRC15_ENST00000439944,NS,carcinoma,0,2	LRRC15_ENST00000439944	0	0			c.G1693A						.	T	ILE/VAL,ILE/VAL	1,4405	825.9+/-416.6	0,1,2202	63.0	62.0	62.0		1675,1693	5.5	1.0	3		62	0,8600		0,0,4300	no	missense,missense	LRRC15	NM_130830.4,NM_001135057.2	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	559/582,565/588	194080098	1,13005	2203	4300	6503	SO:0001583	missense	131578	exon3			AGCCGACGCAGGC	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1675G>A	3.37:g.194080098C>T	ENSP00000306276:p.Val559Ile	Somatic	20	0		WXS	Illumina HiSeq	.	18	3	NM_001135057	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	T	0.366	-0.936920	0.02340	2.27E-4	0.0	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.55760	0.5;0.54;0.54	5.48	5.48	0.80851	.	0.506040	0.19366	N	0.116030	T	0.25644	0.0624	N	0.03608	-0.345	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.18023	-1.0350	10	0.02654	T	1	.	11.7362	0.51767	0.0:0.069:0.0:0.931	.	559;565	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	I	559;565;565	ENSP00000306276:V559I;ENSP00000389128:V565I;ENSP00000413707:V565I	ENSP00000306276:V559I	V	-	1	0	LRRC15	195561393	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	1.401000	0.34589	1.039000	0.40074	-0.360000	0.07572	GTC	.		0.612	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2		
KLHL20	27252	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	173743534	173743534	+	Silent	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:173743534A>G	ENST00000209884.4	+	9	1522	c.1386A>G	c.(1384-1386)ttA>ttG	p.L462L	KLHL20_ENST00000546011.1_Silent_p.L273L	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	462					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GAGGGTTCTTATATGCTGTAG	0.507																																					p.L462L	GBM(159;862 2695 6559 23041)	.											.	.	.	0			c.A1386G						.						248.0	216.0	227.0					1																	173743534		2203	4300	6503	SO:0001819	synonymous_variant	27252	exon9			GTTCTTATATGCT	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1386A>G	1.37:g.173743534A>G		Somatic	94	0		WXS	Illumina HiSeq	.	110	6	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Silent	SNP	ENST00000209884.4	37	CCDS1310.1																																																																																			.		0.507	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
RPSAP58	388524	hgsc.bcm.edu	37	19	24010099	24010099	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:24010099A>G	ENST00000496398.1	+	4	559	c.136A>G	c.(136-138)Atc>Gtc	p.I46V	RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.I46V					ribosomal protein SA pseudogene 58									p.I46V(2)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						AAGTGATGGCATCTATATCAT	0.453																																					.		.											RPSAP58_ENST00000496398,NS,carcinoma,0,2	RPSAP58_ENST00000496398	0	2	Substitution - Missense(2)	kidney(2)	.						.																																			SO:0001583	missense	388524	.			GATGGCATCTATA			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.136A>G	19.37:g.24010099A>G	ENSP00000417240:p.Ile46Val	Somatic	37	0		WXS	Illumina HiSeq	.	39	2	.		RNA	SNP	ENST00000496398.1	37		.	.	.	.	.	.	.	.	.	.	.	4.856	0.159130	0.09236	.	.	ENSG00000205246	ENST00000486528;ENST00000496398;ENST00000354585	T;T;T	0.24151	1.87;1.87;1.87	2.75	2.75	0.32379	.	0.081810	0.48286	U	0.000182	T	0.11452	0.0279	.	.	.	0.26884	N	0.967484	B	0.02656	0.0	B	0.06405	0.002	T	0.28776	-1.0033	9	0.09590	T	0.72	.	9.0538	0.36392	1.0:0.0:0.0:0.0	.	46	A6NE09	.	V	46	ENSP00000420173:I46V;ENSP00000417240:I46V;ENSP00000346598:I46V	ENSP00000346598:I46V	I	+	1	0	RPSAP58	23801939	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.475000	0.35409	1.303000	0.44873	0.510000	0.49958	ATC	.		0.453	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662	
PSMA5	5686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	109964511	109964511	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:109964511G>A	ENST00000271308.4	-	2	87	c.67C>T	c.(67-69)Caa>Taa	p.Q23*	PSMA5_ENST00000538610.1_Intron|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	23					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		TATTCCACTTGAAATAATCTT	0.353																																					p.Q23X		.											.	.	.	0			c.C67T						.						74.0	70.0	71.0					1																	109964511		2203	4299	6502	SO:0001587	stop_gained	5686	exon2			CCACTTGAAATAA	X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.67C>T	1.37:g.109964511G>A	ENSP00000271308:p.Gln23*	Somatic	64	0		WXS	Illumina HiSeq	.	57	15	NM_002790	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Nonsense_Mutation	SNP	ENST00000271308.4	37	CCDS799.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873988	0.91664	.	.	ENSG00000143106	ENST00000271308	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-37.4456	15.9751	0.80057	0.0:0.0:1.0:0.0	.	.	.	.	X	23	.	.	Q	-	1	0	PSMA5	109766034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.331000	0.96430	2.497000	0.84241	0.655000	0.94253	CAA	.		0.353	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033192.2	NM_002790	
CYP4F3	4051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15758064	15758064	+	Missense_Mutation	SNP	C	C	T	rs200536182	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:15758064C>T	ENST00000221307.8	+	5	502	c.455C>T	c.(454-456)aCg>aTg	p.T152M	CYP4F3_ENST00000586182.2_Missense_Mutation_p.T152M|CYP4F3_ENST00000585846.1_Missense_Mutation_p.T152M|CYP4F3_ENST00000591058.1_Missense_Mutation_p.T152M	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	152					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CGGATGCTGACGCCTGCCTTC	0.552													.|||	3	0.000599042	0.0	0.0	5008	,	,		18659	0.0		0.0	False		,,,				2504	0.0031				p.T152M		.											CYP4F3,NS,malignant_melanoma,0,1	CYP4F3	0	0			c.C455T						.	C	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	80.0	85.0	83.0		455,455,455	3.4	1.0	19		83	1,8599		0,1,4299	no	missense,missense,missense	CYP4F3	NM_000896.2,NM_001199208.1,NM_001199209.1	81,81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	152/521,152/521,152/521	15758064	1,13005	2203	4300	6503	SO:0001583	missense	4051	exon5			TGCTGACGCCTGC	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.455C>T	19.37:g.15758064C>T	ENSP00000221307:p.Thr152Met	Somatic	85	0		WXS	Illumina HiSeq	.	57	9	NM_001199209	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	37	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	19.77	3.888447	0.72524	0.0	1.16E-4	ENSG00000186529	ENST00000538865;ENST00000221307	T	0.70631	-0.5	3.4	3.4	0.38934	.	0.000000	0.64402	U	0.000001	D	0.88518	0.6458	H	0.98178	4.165	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.68353	0.957;0.957	D	0.91768	0.5425	10	0.72032	D	0.01	.	12.3049	0.54895	0.0:1.0:0.0:0.0	.	152;152	B7Z8Z3;Q08477	.;CP4F3_HUMAN	M	79;152	ENSP00000221307:T152M	ENSP00000221307:T152M	T	+	2	0	CYP4F3	15619064	1.000000	0.71417	0.992000	0.48379	0.894000	0.52154	4.899000	0.63245	1.715000	0.51383	0.436000	0.28706	ACG	.		0.552	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
DLGAP2	9228	hgsc.bcm.edu	37	8	1616531	1616531	+	Missense_Mutation	SNP	C	C	T	rs370388753		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr8:1616531C>T	ENST00000421627.2	+	6	1741	c.1607C>T	c.(1606-1608)cCg>cTg	p.P536L		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	615					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		ACGCCCCCACCGGTGCCCCCT	0.577																																					p.P536L		.											.	.	.	0			c.C1607T						.	C	LEU/PRO	0,3734		0,0,1867	11.0	13.0	12.0		1607	5.5	0.1	8		12	1,8179		0,1,4089	no	missense	DLGAP2	NM_004745.3	98	0,1,5956	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	536/976	1616531	1,11913	1867	4090	5957	SO:0001583	missense	9228	exon6			CCCCACCGGTGCC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1607C>T	8.37:g.1616531C>T	ENSP00000400258:p.Pro536Leu	Somatic	110	0		WXS	Illumina HiSeq	.	93	5	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.68|17.68	3.450113|3.450113	0.63290|0.63290	0.0|0.0	1.22E-4|1.22E-4	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.20463|.	2.07|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83161|0.83161	0.5194|0.5194	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	D|D	0.84336|0.84336	0.0524|0.0524	10|5	0.87932|.	D|.	0|.	-14.7405|-14.7405	19.458|19.458	0.94903|0.94903	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	615;615|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	L|W	581;536|553	ENSP00000400258:P536L|.	ENSP00000348366:P581L|.	P|R	+|+	2|1	0|2	DLGAP2|DLGAP2	1603938|1603938	1.000000|1.000000	0.71417|0.71417	0.112000|0.112000	0.21494|0.21494	0.011000|0.011000	0.07611|0.07611	7.404000|7.404000	0.79996|0.79996	2.594000|2.594000	0.87642|0.87642	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.		0.577	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
SV2C	22987	hgsc.bcm.edu	37	5	75428097	75428097	+	Silent	SNP	C	C	T	rs370011561	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:75428097C>T	ENST00000502798.2	+	2	964	c.522C>T	c.(520-522)ttC>ttT	p.F174F	SV2C_ENST00000322285.7_Silent_p.F174F	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	174					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.F174F(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TCGTTGGCTTCGTGTTACCCA	0.517													C|||	3	0.000599042	0.0015	0.0	5008	,	,		16619	0.0		0.001	False		,,,				2504	0.0				p.F174F		.											SV2C,NS,adenocarcinoma,0,3	SV2C	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C522T						.	C		3,4115		0,3,2056	182.0	170.0	174.0		522	-1.7	1.0	5		174	0,8422		0,0,4211	no	coding-synonymous	SV2C	NM_014979.1		0,3,6267	TT,TC,CC		0.0,0.0729,0.0239		174/728	75428097	3,12537	2059	4211	6270	SO:0001819	synonymous_variant	22987	exon2			TGGCTTCGTGTTA	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.522C>T	5.37:g.75428097C>T		Somatic	39	0		WXS	Illumina HiSeq	.	48	2	NM_014979	Q496K1|Q9UPU8	Silent	SNP	ENST00000502798.2	37	CCDS43331.1																																																																																			.		0.517	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
FERD3L	222894	hgsc.bcm.edu	37	7	19184752	19184752	+	Silent	SNP	C	C	T	rs73079402		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:19184752C>T	ENST00000275461.3	-	1	292	c.234G>A	c.(232-234)gaG>gaA	p.E78E	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	78	Poly-Glu.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						gctcctcttcctcctcctctt	0.627																																					p.E78E		.											FERD3L,NS,carcinoma,0,1	FERD3L	0	0			c.G234A						.						71.0	51.0	58.0					7																	19184752		2203	4300	6503	SO:0001819	synonymous_variant	222894	exon1			CTCTTCCTCCTCC	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.234G>A	7.37:g.19184752C>T		Somatic	25	0		WXS	Illumina HiSeq	.	14	2	NM_152898	Q495K0	Silent	SNP	ENST00000275461.3	37	CCDS5368.1																																																																																			.		0.627	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
TPTE2P6	374491	hgsc.bcm.edu	37	13	25163341	25163341	+	RNA	SNP	G	G	T	rs535197900		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr13:25163341G>T	ENST00000453498.1	+	0	988				TPTE2P6_ENST00000440905.1_RNA																							ATGTTAATTGGTGAGACATAT	0.313																																					.		.											.	.	.	0			.						.																																					374491	.			TAATTGGTGAGAC																													13.37:g.25163341G>T		Somatic	87	0		WXS	Illumina HiSeq	.	72	4	.		RNA	SNP	ENST00000453498.1	37																																																																																				.		0.313	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000044193.1		
COL27A1	85301	hgsc.bcm.edu	37	9	116931158	116931158	+	Silent	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:116931158G>T	ENST00000356083.3	+	3	1714	c.1323G>T	c.(1321-1323)cgG>cgT	p.R441R		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	441	Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CCAGCACCCGGCCCCTACCTC	0.632																																					p.R441R		.											COL27A1,NS,carcinoma,0,1	COL27A1	0	0			c.G1323T						.						96.0	119.0	111.0					9																	116931158		2203	4300	6503	SO:0001819	synonymous_variant	85301	exon3			CACCCGGCCCCTA	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.1323G>T	9.37:g.116931158G>T		Somatic	52	0		WXS	Illumina HiSeq	.	42	2	NM_032888	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																			.		0.632	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22915663	22915663	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:22915663C>T	ENST00000166244.3	+	5	1351	c.1279C>T	c.(1279-1281)Cgg>Tgg	p.R427W	EPHA8_ENST00000538803.1_Missense_Mutation_p.R427W|EPHA8_ENST00000374644.4_Missense_Mutation_p.R427W	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	427	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CGAGCCCCGCCGGGCCGCTGT	0.667																																					p.R427W		.											.	.	.	0			c.C1279T						.						29.0	28.0	29.0					1																	22915663		2203	4297	6500	SO:0001583	missense	2046	exon5			CCCCGCCGGGCCG	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1279C>T	1.37:g.22915663C>T	ENSP00000166244:p.Arg427Trp	Somatic	77	0		WXS	Illumina HiSeq	.	57	11	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.133804	0.56828	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.74209	-0.82;0.91;0.91	4.52	2.47	0.30058	Fibronectin, type III (2);	0.567300	0.17178	N	0.183994	T	0.78323	0.4265	L	0.50333	1.59	0.09310	N	1	D;D	0.71674	0.985;0.998	B;P	0.57776	0.232;0.827	T	0.69595	-0.5103	10	0.72032	D	0.01	.	12.0714	0.53618	0.4841:0.5159:0.0:0.0	.	427;427	P29322;P29322-2	EPHA8_HUMAN;.	W	427	ENSP00000166244:R427W;ENSP00000363775:R427W;ENSP00000440274:R427W	ENSP00000166244:R427W	R	+	1	2	EPHA8	22788250	0.000000	0.05858	0.899000	0.35326	0.607000	0.37147	1.159000	0.31749	0.515000	0.28320	0.436000	0.28706	CGG	.		0.667	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
BIRC2	329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102221620	102221620	+	Missense_Mutation	SNP	G	G	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:102221620G>C	ENST00000227758.2	+	3	2340	c.941G>C	c.(940-942)aGg>aCg	p.R314T	BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000530675.1_Missense_Mutation_p.R265T|BIRC2_ENST00000532672.1_Missense_Mutation_p.R293T	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	314					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		GGTGGCTTGAGGTGTTGGGAA	0.353																																					p.R314T		.											.	.	.	0			c.G941C						.						332.0	312.0	319.0					11																	102221620		2203	4299	6502	SO:0001583	missense	329	exon3			GCTTGAGGTGTTG	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.941G>C	11.37:g.102221620G>C	ENSP00000227758:p.Arg314Thr	Somatic	91	0		WXS	Illumina HiSeq	.	72	17	NM_001256163	B4E026|Q16516|Q4TTG0	Missense_Mutation	SNP	ENST00000227758.2	37	CCDS8316.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478902	0.63849	.	.	ENSG00000110330	ENST00000530675;ENST00000227758;ENST00000541741;ENST00000532672	T;T;T	0.72051	-0.62;-0.62;-0.62	5.86	5.86	0.93980	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	D	0.84415	0.5467	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83530	0.0090	10	0.51188	T	0.08	-20.4457	20.2019	0.98263	0.0:0.0:1.0:0.0	.	314	Q13490	BIRC2_HUMAN	T	265;314;314;293	ENSP00000431723:R265T;ENSP00000227758:R314T;ENSP00000434979:R293T	ENSP00000227758:R314T	R	+	2	0	BIRC2	101726830	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.639000	0.83342	2.776000	0.95493	0.655000	0.94253	AGG	.		0.353	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
FBN3	84467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8150345	8150345	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:8150345C>T	ENST00000600128.1	-	56	7403	c.6989G>A	c.(6988-6990)cGg>cAg	p.R2330Q	FBN3_ENST00000601739.1_Missense_Mutation_p.R2330Q|FBN3_ENST00000270509.2_Missense_Mutation_p.R2330Q			Q75N90	FBN3_HUMAN	fibrillin 3	2330	TB 9.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCCCCAGCCCCGGCCACCCCC	0.697																																					p.R2330Q		.											.	.	.	0			c.G6989A						.						8.0	10.0	9.0					19																	8150345		2169	4238	6407	SO:0001583	missense	84467	exon55			CAGCCCCGGCCAC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6989G>A	19.37:g.8150345C>T	ENSP00000470498:p.Arg2330Gln	Somatic	32	0		WXS	Illumina HiSeq	.	34	9	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831469	0.91036	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.93426	-3.22	4.72	4.72	0.59763	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	U	0.000001	D	0.95781	0.8627	M	0.62154	1.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.989;0.999	D	0.94679	0.7863	10	0.29301	T	0.29	.	17.6552	0.88176	0.0:1.0:0.0:0.0	.	2330;436	Q75N90;Q6ZNB8	FBN3_HUMAN;.	Q	2330;436	ENSP00000270509:R2330Q	ENSP00000270509:R2330Q	R	-	2	0	FBN3	8056345	1.000000	0.71417	0.796000	0.32109	0.388000	0.30384	5.708000	0.68377	2.170000	0.68504	0.491000	0.48974	CGG	.		0.697	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
PHF3	23469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	64394977	64394977	+	Missense_Mutation	SNP	A	A	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:64394977A>C	ENST00000262043.3	+	4	1694	c.1354A>C	c.(1354-1356)Aat>Cat	p.N452H	PHF3_ENST00000509330.1_Missense_Mutation_p.N452H|PHF3_ENST00000393387.1_Missense_Mutation_p.N452H			Q92576	PHF3_HUMAN	PHD finger protein 3	452					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAAACAGTTGAATGCTATAGA	0.368																																					p.N452H	GBM(135;136 1820 29512 34071 46235)	.											.	.	.	0			c.A1354C						.						71.0	78.0	75.0					6																	64394977		2202	4299	6501	SO:0001583	missense	23469	exon3			CAGTTGAATGCTA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.1354A>C	6.37:g.64394977A>C	ENSP00000262043:p.Asn452His	Somatic	78	0		WXS	Illumina HiSeq	.	73	18	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	A	0.133	-1.111774	0.01813	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387	T;T;T;T;T;T	0.45276	2.18;1.89;2.22;1.9;0.9;2.22	3.75	0.101	0.14517	.	0.387176	0.18855	N	0.129281	T	0.27169	0.0666	L	0.57536	1.79	0.09310	N	1	P;P	0.50528	0.61;0.936	B;P	0.50490	0.205;0.642	T	0.10636	-1.0621	10	0.66056	D	0.02	.	7.1172	0.25423	0.7048:0.0:0.2952:0.0	.	452;452	Q92576;D6R9X2	PHF3_HUMAN;.	H	266;364;452;405;452;452	ENSP00000424694:N266H;ENSP00000425227:N364H;ENSP00000262043:N452H;ENSP00000424078:N405H;ENSP00000422841:N452H;ENSP00000377048:N452H	ENSP00000262043:N452H	N	+	1	0	PHF3	64452936	1.000000	0.71417	0.004000	0.12327	0.079000	0.17450	2.059000	0.41384	0.030000	0.15379	-0.462000	0.05337	AAT	.		0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
ITGB8	3696	hgsc.bcm.edu;bcgsc.ca	37	7	20441344	20441344	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:20441344G>T	ENST00000222573.4	+	10	1966	c.1282G>T	c.(1282-1284)Gtt>Ttt	p.V428F	ITGB8_ENST00000537992.1_Splice_Site_p.V293F	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	428					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						CTAAATTTAGGTTCTTTTCAA	0.249																																					p.V428F		.											.	.	.	0			c.G1282T						.						40.0	43.0	42.0					7																	20441344		2199	4300	6499	SO:0001630	splice_region_variant	3696	exon10			ATTTAGGTTCTTT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.1282-1G>T	7.37:g.20441344G>T		Somatic	45	0		WXS	Illumina HiSeq	.	48	4	NM_002214	A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	37	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977274	0.74360	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	T;T	0.70869	-0.52;-0.52	5.96	5.96	0.96718	Integrin beta subunit, N-terminal (2);	0.000000	0.64402	D	0.000002	D	0.87904	0.6295	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.88579	0.3135	9	.	.	.	.	20.4123	0.99019	0.0:0.0:1.0:0.0	.	428	P26012	ITB8_HUMAN	F	293;428	ENSP00000441561:V293F;ENSP00000222573:V428F	.	V	+	1	0	ITGB8	20407869	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.434000	0.73408	2.824000	0.97209	0.655000	0.94253	GTT	.		0.249	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059915.3	NM_002214	Missense_Mutation
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	225704784	225704784	+	Missense_Mutation	SNP	T	T	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:225704784T>A	ENST00000258390.7	-	24	2734	c.2667A>T	c.(2665-2667)ttA>ttT	p.L889F	DOCK10_ENST00000409592.3_Missense_Mutation_p.L883F	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	889					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CCACATTCAATAAGTTCTGTA	0.313																																					p.L889F		.											.	.	.	0			c.A2667T						.						44.0	39.0	41.0					2																	225704784		1787	4046	5833	SO:0001583	missense	55619	exon24			ATTCAATAAGTTC	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.2667A>T	2.37:g.225704784T>A	ENSP00000258390:p.Leu889Phe	Somatic	67	0		WXS	Illumina HiSeq	.	73	6	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.227298	0.39399	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.70399	1.69;-0.48	5.73	1.66	0.24008	.	0.000000	0.64402	D	0.000006	T	0.75774	0.3895	L	0.58669	1.825	0.33934	D	0.642436	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.981	T	0.77175	-0.2684	10	0.87932	D	0	.	3.7397	0.08524	0.1844:0.4514:0.0:0.3642	.	889;883	Q96BY6;B3FL70	DOC10_HUMAN;.	F	883;889	ENSP00000386694:L883F;ENSP00000258390:L889F	ENSP00000258390:L889F	L	-	3	2	DOCK10	225413028	0.065000	0.20965	0.198000	0.23420	0.261000	0.26267	0.280000	0.18790	0.329000	0.23460	0.533000	0.62120	TTA	.		0.313	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
PPP1R15A	23645	hgsc.bcm.edu	37	19	49377974	49377974	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:49377974C>T	ENST00000200453.5	+	2	1753	c.1484C>T	c.(1483-1485)gCt>gTt	p.A495V		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	495	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with KMT2A/MLL1.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GAAGAGGAAGCTGCTGAGGAC	0.627																																					p.A495V		.											.	.	.	0			c.C1484T						.						78.0	74.0	75.0					19																	49377974		2203	4300	6503	SO:0001583	missense	23645	exon2			AGGAAGCTGCTGA	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1484C>T	19.37:g.49377974C>T	ENSP00000200453:p.Ala495Val	Somatic	83	0		WXS	Illumina HiSeq	.	64	4	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	37	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248259	0.59103	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.05996	3.36	3.43	1.01	0.19927	.	1.116680	0.07067	N	0.834784	T	0.04588	0.0125	L	0.27053	0.805	0.09310	N	1	B	0.28636	0.218	B	0.27262	0.078	T	0.44682	-0.9312	10	0.30854	T	0.27	-1.1943	3.4275	0.07416	0.2519:0.6096:0.0:0.1385	.	495	O75807	PR15A_HUMAN	V	495;335;453	ENSP00000200453:A495V	ENSP00000200453:A495V	A	+	2	0	PPP1R15A	54069786	0.004000	0.15560	0.160000	0.22671	0.144000	0.21451	1.594000	0.36697	0.746000	0.32786	0.650000	0.86243	GCT	.		0.627	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
ZAK	51776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	174085956	174085956	+	Intron	SNP	A	A	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:174085956A>T	ENST00000375213.3	+	11	1065				MLK7-AS1_ENST00000423106.2_RNA|MLTK_ENST00000431503.2_Missense_Mutation_p.M255L|MLTK_ENST00000539448.1_Missense_Mutation_p.M356L|MLTK_ENST00000409176.2_Intron|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000338983.3_Missense_Mutation_p.M356L	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN							activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										CAGTGCAGAGATGTCATGTCA	0.468																																					p.M356L		.											.	.	.	0			c.A1066T						.						107.0	110.0	109.0					2																	174085956		2203	4300	6503	SO:0001627	intron_variant	0	exon12			GCAGAGATGTCAT																												ENST00000375213.3:c.987+3978A>T	2.37:g.174085956A>T		Somatic	43	0		WXS	Illumina HiSeq	.	28	5	NM_133646	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	37	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.663440	0.47572	.	.	ENSG00000091436	ENST00000539448;ENST00000338983;ENST00000431503	T;T;T	0.77489	-0.72;-0.72;-1.1	6.08	4.9	0.64082	.	.	.	.	.	T	0.61173	0.2326	N	0.14661	0.345	0.27608	N	0.94875	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43972	-0.9358	9	0.13108	T	0.6	.	12.5561	0.56254	0.8752:0.0:0.0:0.1248	.	356;356	A8K710;D4Q8H0	.;.	L	356;356;255	ENSP00000439414:M356L;ENSP00000340257:M356L;ENSP00000399787:M255L	ENSP00000340257:M356L	M	+	1	0	AC013461.1	173794202	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.789000	0.62446	1.082000	0.41137	0.533000	0.62120	ATG	.		0.468	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1		
CACNA1D	776	hgsc.bcm.edu	37	3	53810928	53810928	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:53810928G>A	ENST00000350061.5	+	37	5043	c.4532G>A	c.(4531-4533)cGc>cAc	p.R1511H	CACNA1D_ENST00000288139.4_Missense_Mutation_p.R1531H|CACNA1D_ENST00000422281.2_Missense_Mutation_p.R1496H|CACNA1D_ENST00000540742.1_Missense_Mutation_p.R403H	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1511					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGCTTCGACGCATCCAGCCT	0.517																																					p.R1531H		.											CACNA1D_ENST00000350061,NS,carcinoma,0,2	CACNA1D_ENST00000350061	0	0			c.G4592A						.						147.0	120.0	129.0					3																	53810928		2203	4300	6503	SO:0001583	missense	776	exon38			TTCGACGCATCCA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4532G>A	3.37:g.53810928G>A	ENSP00000288133:p.Arg1511His	Somatic	77	0		WXS	Illumina HiSeq	.	72	3	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778025	0.90195	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	D;D;D;T;T	0.96365	-3.96;-3.99;-3.98;2.93;2.93	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000001	D	0.96926	0.8996	L	0.35249	1.045	0.80722	D	1	D;B;D;P;D	0.89917	1.0;0.321;0.972;0.945;1.0	D;B;B;B;D	0.83275	0.985;0.073;0.286;0.286;0.996	D	0.97814	1.0252	10	0.66056	D	0.02	.	19.2391	0.93875	0.0:0.0:1.0:0.0	.	1496;403;1204;1511;1531	B0FYA3;F5H313;Q59GD8;Q01668;Q01668-2	.;.;.;CAC1D_HUMAN;.	H	1511;1531;1496;1204;403	ENSP00000288133:R1511H;ENSP00000288139:R1531H;ENSP00000409174:R1496H;ENSP00000418014:R1204H;ENSP00000438229:R403H	ENSP00000288139:R1531H	R	+	2	0	CACNA1D	53785968	1.000000	0.71417	0.847000	0.33407	0.976000	0.68499	9.869000	0.99810	2.539000	0.85634	0.563000	0.77884	CGC	.		0.517	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
ALMS1P	200420	hgsc.bcm.edu	37	2	73900918	73900918	+	RNA	SNP	C	C	T	rs35051622|rs566803482|rs397873806	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:73900918C>T	ENST00000450720.1	+	0	737					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												ctctctctctctttttttttt	0.438																																					.		.											.	.	.	0			.						.						7.0	8.0	8.0					2																	73900918		691	1583	2274			200420	.			CTCTCTCTTTTTT	BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73900918C>T		Somatic	25	0		WXS	Illumina HiSeq	.	21	4	.		RNA	SNP	ENST00000450720.1	37																																																																																				.		0.438	ALMS1P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000339824.1	NR_003683	
FNDC3A	22862	hgsc.bcm.edu	37	13	49719949	49719949	+	Silent	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr13:49719949C>A	ENST00000492622.2	+	8	1160	c.855C>A	c.(853-855)acC>acA	p.T285T	FNDC3A_ENST00000541916.1_Silent_p.T285T|FNDC3A_ENST00000398316.3_Silent_p.T229T	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	285	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TAGTACTTACCTGGTCACCAC	0.388																																					p.T285T		.											.	.	.	0			c.C855A						.						118.0	110.0	113.0					13																	49719949		2203	4300	6503	SO:0001819	synonymous_variant	22862	exon8			ACTTACCTGGTCA	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.855C>A	13.37:g.49719949C>A		Somatic	91	0		WXS	Illumina HiSeq	.	93	3	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Silent	SNP	ENST00000492622.2	37	CCDS41886.1																																																																																			.		0.388	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
CCDC178	374864	hgsc.bcm.edu	37	18	30926184	30926184	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr18:30926184C>T	ENST00000383096.3	-	9	831	c.649G>A	c.(649-651)Gtg>Atg	p.V217M	CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Missense_Mutation_p.V217M|CCDC178_ENST00000406524.2_Missense_Mutation_p.V217M|CCDC178_ENST00000403303.1_Missense_Mutation_p.V217M|CCDC178_ENST00000402325.1_Missense_Mutation_p.V217M|CCDC178_ENST00000583930.1_Missense_Mutation_p.V217M|CCDC178_ENST00000579947.1_Missense_Mutation_p.V217M			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	217																	CCTTTCTGCACAGCCAATGGG	0.323																																					p.V217M		.											C18orf34_ENST00000383096,rectum,carcinoma,+1,2	C18orf34_ENST00000383096	+1	0			c.G649A						.						100.0	100.0	100.0					18																	30926184		2203	4300	6503	SO:0001583	missense	374864	exon8			TCTGCACAGCCAA	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.649G>A	18.37:g.30926184C>T	ENSP00000372576:p.Val217Met	Somatic	96	0		WXS	Illumina HiSeq	.	74	3	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.380806	0.24944	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.62639	1.41;1.41;1.41;1.43;1.4;0.01	5.59	5.59	0.84812	.	.	.	.	.	T	0.72763	0.3501	L	0.45137	1.4	0.36139	D	0.846673	D;D;D;D	0.89917	1.0;0.998;0.998;0.998	D;D;D;D	0.91635	0.999;0.971;0.971;0.971	T	0.74942	-0.3492	9	0.36615	T	0.2	-16.5976	16.5129	0.84290	0.0:1.0:0.0:0.0	.	217;217;217;217	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	M	217	ENSP00000385591:V217M;ENSP00000372576:V217M;ENSP00000300227:V217M;ENSP00000385867:V217M;ENSP00000385234:V217M;ENSP00000382130:V217M	ENSP00000300227:V217M	V	-	1	0	C18orf34	29180182	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	4.659000	0.61504	2.636000	0.89361	0.557000	0.71058	GTG	.		0.323	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
ZNF208	7757	hgsc.bcm.edu	37	19	22155346	22155346	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:22155346T>C	ENST00000397126.4	-	4	2638	c.2490A>G	c.(2488-2490)gaA>gaG	p.E830E	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	830					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGGCTTTTCTCCAGCAT	0.373																																					p.E830E		.											ZNF208_ENST00000428290,NS,carcinoma,0,3	ZNF208_ENST00000428290	0	0			c.A2490G						.						66.0	72.0	70.0					19																	22155346		2117	4255	6372	SO:0001819	synonymous_variant	7757	exon4			GGGCTTTTCTCCA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2490A>G	19.37:g.22155346T>C		Somatic	61	0		WXS	Illumina HiSeq	.	71	4	NM_007153		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																			.		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
RPSAP58	388524	hgsc.bcm.edu	37	19	24010116	24010116	+	Silent	SNP	C	C	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:24010116C>G	ENST00000496398.1	+	4	576	c.153C>G	c.(151-153)ctC>ctG	p.L51L	RP11-255H23.4_ENST00000599944.1_lincRNA|RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Silent_p.L51L					ribosomal protein SA pseudogene 58									p.L51L(2)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						TCATAAATCTCAAGAGGACCT	0.458																																					.		.											RPSAP58_ENST00000496398,NS,carcinoma,0,2	RPSAP58_ENST00000496398	0	2	Substitution - coding silent(2)	kidney(2)	.						.																																			SO:0001819	synonymous_variant	388524	.			AAATCTCAAGAGG			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.153C>G	19.37:g.24010116C>G		Somatic	46	0		WXS	Illumina HiSeq	.	45	2	.		RNA	SNP	ENST00000496398.1	37																																																																																				.		0.458	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662	
FAXDC2	10826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	154202045	154202045	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:154202045G>A	ENST00000326080.5	-	7	1088	c.665C>T	c.(664-666)cCt>cTt	p.P222L	FAXDC2_ENST00000523997.1_5'Flank|FAXDC2_ENST00000517938.1_Missense_Mutation_p.P199L	NM_032385.3	NP_115761.2	Q96IV6	FXDC2_HUMAN	fatty acid hydroxylase domain containing 2	222					fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)										ATGCTCTATAGGGTGGGCATA	0.522																																					p.P222L		.											.	.	.	0			c.C665T						.						249.0	233.0	238.0					5																	154202045		1946	4144	6090	SO:0001583	missense	10826	exon7			TCTATAGGGTGGG	AF159165	CCDS43390.1	5q31-q32	2013-03-04	2013-03-04	2013-03-04	ENSG00000170271	ENSG00000170271		"""Fatty acid hydroxylase domain containing"""	1334	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 4"""	C5orf4		10843801	Standard	NM_032385		Approved	FLJ13758	uc003lvs.4	Q96IV6	OTTHUMG00000164141	ENST00000326080.5:c.665C>T	5.37:g.154202045G>A	ENSP00000320604:p.Pro222Leu	Somatic	75	0		WXS	Illumina HiSeq	.	76	21	NM_032385	B4DIE1|Q9BSX6|Q9H8C7	Missense_Mutation	SNP	ENST00000326080.5	37	CCDS43390.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.661566	0.67700	.	.	ENSG00000170271	ENST00000326080;ENST00000517938	D;D	0.85955	-2.05;-2.05	5.27	5.27	0.74061	Fatty acid hydroxylase (1);	0.097389	0.64402	D	0.000001	D	0.94611	0.8263	H	0.94542	3.55	0.80722	D	1	D	0.61080	0.989	D	0.72625	0.978	D	0.95947	0.8951	10	0.87932	D	0	.	17.8919	0.88875	0.0:0.0:1.0:0.0	.	222	Q96IV6	CE004_HUMAN	L	222;199	ENSP00000320604:P222L;ENSP00000430286:P199L	ENSP00000320604:P222L	P	-	2	0	C5orf4	154182238	1.000000	0.71417	0.586000	0.28679	0.124000	0.20399	9.407000	0.97325	2.460000	0.83146	0.555000	0.69702	CCT	.		0.522	FAXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377429.1	NM_032385	
CDKN2A	1029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	21971003	21971003	+	Missense_Mutation	SNP	C	C	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:21971003C>G	ENST00000304494.5	-	2	625	c.355G>C	c.(355-357)Gag>Cag	p.E119Q	CDKN2A_ENST00000446177.1_Missense_Mutation_p.E119Q|CDKN2A_ENST00000494262.1_Missense_Mutation_p.E68Q|CDKN2A_ENST00000361570.3_Nonstop_Mutation_p.*174S|CDKN2A_ENST00000479692.2_Missense_Mutation_p.E68Q|CDKN2A_ENST00000579122.1_Missense_Mutation_p.E119Q|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579755.1_Nonstop_Mutation_p.*133S|CDKN2A_ENST00000530628.2_Nonstop_Mutation_p.*133S|CDKN2A_ENST00000578845.2_Missense_Mutation_p.E68Q|CDKN2A_ENST00000498628.2_Missense_Mutation_p.E68Q|CDKN2A_ENST00000498124.1_Missense_Mutation_p.E119Q|CDKN2A_ENST00000497750.1_Missense_Mutation_p.E68Q	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	119			E -> Q (in a biliary tract tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.E119*(4)|p.E119Q(2)|p.0(1)|p.A118fs*10(1)|p.A118fs*27(1)|p.*174L(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCAGCTCCTCAGCCAGGTCC	0.726		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.X133S		.											CDKN2A_ENST00000498124,bladder,carcinoma,0,13	CDKN2A_ENST00000498124	0	1369	Whole gene deletion(1316)|Unknown(44)|Substitution - Nonsense(4)|Substitution - Missense(2)|Deletion - Frameshift(1)|Complex - frameshift(1)|Nonstop extension(1)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(74)|soft_tissue(57)|pleura(51)|oesophagus(51)|upper_aerodigestive_tract(49)|ovary(36)|kidney(32)|breast(32)|pancreas(30)|biliary_tract(14)|thyroid(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.G398C						.						24.0	26.0	25.0					9																	21971003		2202	4298	6500	SO:0001583	missense	1029	exon2			GCTCCTCAGCCAG	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.355G>C	9.37:g.21971003C>G	ENSP00000307101:p.Glu119Gln	Somatic	25	0		WXS	Illumina HiSeq	.	23	9	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.17|13.17	2.157623|2.157623	0.38119|0.38119	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000304494;ENST00000446177|ENST00000361570;ENST00000530628	T;T|.	0.64085|.	-0.08;-0.08|.	5.93|5.93	2.91|2.91	0.33838|0.33838	Ankyrin repeat-containing domain (4);|.	.|.	.|.	.|.	.|.	T|.	0.35682|.	0.0940|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|.	0.69078|.	0.997|.	D|.	0.73380|.	0.98|.	T|.	0.20371|.	-1.0277|.	8|.	0.25751|.	T|.	0.34|.	-4.2732|-4.2732	8.4897|8.4897	0.33093|0.33093	0.0:0.4925:0.4233:0.0842|0.0:0.4925:0.4233:0.0842	.|.	119|.	P42771|.	CD2A1_HUMAN|.	Q|S	119|174;133	ENSP00000307101:E119Q;ENSP00000394932:E119Q|.	ENSP00000307101:E119Q|.	E|X	-|-	1|2	0|2	CDKN2A|CDKN2A	21961003|21961003	0.002000|0.002000	0.14202|0.14202	0.998000|0.998000	0.56505|0.56505	0.865000|0.865000	0.49528|0.49528	0.628000|0.628000	0.24522|0.24522	0.816000|0.816000	0.34421|0.34421	0.655000|0.655000	0.94253|0.94253	GAG|TGA	.		0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
SPTAN1	6709	hgsc.bcm.edu	37	9	131348107	131348107	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:131348107C>T	ENST00000372731.4	+	19	2751	c.2641C>T	c.(2641-2643)Cag>Tag	p.Q881*	SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.Q881*|SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.Q881*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	881					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CAAAGCTTCCCAGCGTCGGCA	0.557																																					p.Q881X	NSCLC(120;833 1744 2558 35612 37579)	.											SPTAN1,colon,carcinoma,0,1	SPTAN1	0	0			c.C2641T						.						85.0	82.0	83.0					9																	131348107		2203	4300	6503	SO:0001587	stop_gained	6709	exon19			GCTTCCCAGCGTC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2641C>T	9.37:g.131348107C>T	ENSP00000361816:p.Gln881*	Somatic	35	0		WXS	Illumina HiSeq	.	23	2	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Nonsense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	42	9.201112	0.99098	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	19.1131	0.93326	0.0:1.0:0.0:0.0	.	.	.	.	X	881	.	ENSP00000350882:Q881X	Q	+	1	0	SPTAN1	130387928	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	7.445000	0.80570	2.832000	0.97577	0.655000	0.94253	CAG	.		0.557	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
SEC14L4	284904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30888052	30888052	+	Missense_Mutation	SNP	G	G	A	rs369641628		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr22:30888052G>A	ENST00000255858.7	-	9	838	c.755C>T	c.(754-756)cCc>cTc	p.P252L	RP4-539M6.14_ENST00000442126.1_RNA|SEC14L4_ENST00000392772.2_Missense_Mutation_p.P198L|RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000540456.1_Missense_Mutation_p.P237L|SEC14L4_ENST00000381982.3_Missense_Mutation_p.P252L	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	252	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	CAGGCACTTGGGGTTGCCATC	0.577																																					p.P252L		.											.	.	.	0			c.C755T						.	G	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	40.0	44.0	43.0		755,755	4.3	1.0	22		43	0,8598		0,0,4299	no	missense,missense	SEC14L4	NM_001161368.1,NM_174977.3	98,98	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	252/361,252/407	30888052	1,13003	2203	4299	6502	SO:0001583	missense	284904	exon9			CACTTGGGGTTGC	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.755C>T	22.37:g.30888052G>A	ENSP00000255858:p.Pro252Leu	Somatic	54	0		WXS	Illumina HiSeq	.	61	17	NM_001161368	A5D6W7|A6NCV4	Missense_Mutation	SNP	ENST00000255858.7	37	CCDS13878.1	.	.	.	.	.	.	.	.	.	.	g	25.4	4.634092	0.87660	2.27E-4	0.0	ENSG00000133488	ENST00000255858;ENST00000540456;ENST00000392772;ENST00000381982	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	4.3	4.3	0.51218	Cellular retinaldehyde-binding/triple function, C-terminal (2);GOLD (1);	0.000000	0.85682	D	0.000000	T	0.56470	0.1987	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.991	D;D;P	0.72338	0.915;0.977;0.86	T	0.66044	-0.6021	10	0.66056	D	0.02	-19.3994	16.9205	0.86163	0.0:0.0:1.0:0.0	.	198;237;252	B3KSF0;G3V1L4;Q9UDX3	.;.;S14L4_HUMAN	L	252;237;198;252	ENSP00000255858:P252L;ENSP00000440848:P237L;ENSP00000376525:P198L;ENSP00000371412:P252L	ENSP00000255858:P252L	P	-	2	0	SEC14L4	29218052	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.051000	0.93849	2.389000	0.81357	0.591000	0.81541	CCC	.		0.577	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
CCDC66	285331	hgsc.bcm.edu	37	3	56658514	56658514	+	IGR	SNP	C	C	T	rs150032629		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:56658514C>T	ENST00000394672.3	+	0	3096				FAM208A_ENST00000431842.2_Silent_p.S1055S|FAM208A_ENST00000485156.1_5'UTR|FAM208A_ENST00000355628.5_Silent_p.S1431S|FAM208A_ENST00000493960.2_Silent_p.S1492S	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66						post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TACCTGACTGCGACTCAAGAT	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		19196	0.0		0.0	False		,,,				2504	0.001				p.S1492S		.											FAM208A,NS,carcinoma,0,4	FAM208A	0	0			c.G4476A						.	C	,	1,4405	2.1+/-5.4	0,1,2202	131.0	125.0	127.0		4476,3165	-10.6	0.1	3	dbSNP_134	127	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FAM208A	NM_001112736.1,NM_015224.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	1492/1513,1055/1234	56658514	1,13005	2203	4300	6503	SO:0001628	intergenic_variant	23272	exon23			TGACTGCGACTCA	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748		3.37:g.56658514C>T		Somatic	92	0		WXS	Illumina HiSeq	.	73	3	NM_001112736	B3KWL8|Q4VC34|Q8N949	Silent	SNP	ENST00000394672.3	37	CCDS46852.1																																																																																			0.000		0.363	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
GNPTAB	79158	hgsc.bcm.edu	37	12	102147186	102147186	+	Missense_Mutation	SNP	C	C	T	rs141007019		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr12:102147186C>T	ENST00000299314.7	-	19	3828	c.3566G>A	c.(3565-3567)cGa>cAa	p.R1189Q		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1189					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GAAACGGTTTCGATACTCTCT	0.403																																					p.R1189Q		.											GNPTAB,NS,carcinoma,0,3	GNPTAB	0	0			c.G3566A	GRCh37	CI054460	GNPTAB	I	rs141007019	.	C	GLN/ARG	0,4406		0,0,2203	146.0	131.0	136.0		3566	4.8	1.0	12	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GNPTAB	NM_024312.4	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1189/1257	102147186	1,13005	2203	4300	6503	SO:0001583	missense	79158	exon19			CGGTTTCGATACT	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3566G>A	12.37:g.102147186C>T	ENSP00000299314:p.Arg1189Gln	Somatic	40	0		WXS	Illumina HiSeq	.	46	2	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	37	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	C	35	5.439281	0.96168	0.0	1.16E-4	ENSG00000111670	ENST00000299314	D	0.82526	-1.62	5.69	4.8	0.61643	.	0.061347	0.64402	D	0.000004	D	0.87665	0.6234	M	0.79011	2.435	0.80722	D	1	D	0.76494	0.999	P	0.52627	0.704	D	0.89243	0.3585	10	0.72032	D	0.01	-13.337	14.7589	0.69590	0.0:0.9303:0.0:0.0697	.	1189	Q3T906	GNPTA_HUMAN	Q	1189	ENSP00000299314:R1189Q	ENSP00000299314:R1189Q	R	-	2	0	GNPTAB	100671317	1.000000	0.71417	0.958000	0.39756	0.975000	0.68041	7.484000	0.81180	1.409000	0.46915	0.591000	0.81541	CGA	0.000		0.403	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
STOX2	56977	hgsc.bcm.edu	37	4	184932087	184932087	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr4:184932087G>T	ENST00000308497.4	+	3	3531	c.2096G>T	c.(2095-2097)aGc>aTc	p.S699I	STOX2_ENST00000438269.1_Missense_Mutation_p.S699I	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	699					embryo development (GO:0009790)|maternal placenta development (GO:0001893)			p.S699I(1)		breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		GAGATATTTAGCAAAGACACA	0.542																																					p.S699I		.											STOX2_ENST00000308497,colon,carcinoma,0,1	STOX2_ENST00000308497	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2096T						.						34.0	39.0	37.0					4																	184932087		2017	4174	6191	SO:0001583	missense	56977	exon3			TATTTAGCAAAGA	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.2096G>T	4.37:g.184932087G>T	ENSP00000311257:p.Ser699Ile	Somatic	45	0		WXS	Illumina HiSeq	.	49	2	NM_020225	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	37	CCDS47167.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938048	0.73557	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;D	0.83755	-0.77;-1.76	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.87386	0.6164	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.80764	0.994;0.986	D	0.88557	0.3120	10	0.87932	D	0	-25.2765	18.987	0.92775	0.0:0.0:1.0:0.0	.	699;699	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	I	699	ENSP00000311257:S699I;ENSP00000390127:S699I	ENSP00000311257:S699I	S	+	2	0	STOX2	185169081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.936000	0.92931	2.725000	0.93324	0.655000	0.94253	AGC	.		0.542	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
CAMSAP1	157922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	138703285	138703285	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:138703285G>T	ENST00000389532.4	-	17	4743	c.4679C>A	c.(4678-4680)tCa>tAa	p.S1560*	CAMSAP1_ENST00000409386.3_Nonsense_Mutation_p.S1571*|CAMSAP1_ENST00000312405.6_Nonsense_Mutation_p.S1282*|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1560	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TTTTCGGTCTGAGCTGTATTT	0.473																																					p.S1560X		.											.	.	.	0			c.C4679A						.						243.0	195.0	211.0					9																	138703285		2203	4300	6503	SO:0001587	stop_gained	157922	exon17			CGGTCTGAGCTGT	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.4679C>A	9.37:g.138703285G>T	ENSP00000374183:p.Ser1560*	Somatic	59	0		WXS	Illumina HiSeq	.	46	23	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Nonsense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	G	44	11.038245	0.99507	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0966	0.93255	0.0:0.0:1.0:0.0	.	.	.	.	X	1560;1282;1571	.	ENSP00000312463:S1282X	S	-	2	0	CAMSAP1	137843106	1.000000	0.71417	0.988000	0.46212	0.976000	0.68499	9.662000	0.98603	2.582000	0.87167	0.561000	0.74099	TCA	.		0.473	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
HIST3H2A	92815	hgsc.bcm.edu	37	1	228645259	228645259	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:228645259G>A	ENST00000366695.2	-	1	301	c.260C>T	c.(259-261)gCc>gTc	p.A87V	HIST3H2BB_ENST00000369160.2_5'Flank	NM_033445.2	NP_254280.1	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	87					nucleosome disassembly (GO:0006337)|UV-damage excision repair (GO:0070914)	extracellular vesicular exosome (GO:0070062)|nuclear nucleosome (GO:0000788)	DNA binding (GO:0003677)			endometrium(1)|lung(3)|ovary(1)	5		Prostate(94;0.183)				GTTGCGGATGGCCAGCTGCAG	0.657																																					p.A87V		.											.	.	.	0			c.C260T						.						84.0	78.0	80.0					1																	228645259		2203	4299	6502	SO:0001583	missense	92815	exon1			CGGATGGCCAGCT	AY131974	CCDS1573.1	1q42.13	2011-01-27	2006-10-11		ENSG00000181218	ENSG00000181218		"""Histones / Replication-dependent"""	20507	protein-coding gene	gene with protein product		615015	"""histone 3, H2a"""			12408966	Standard	NM_033445		Approved	MGC3165	uc001hsy.3	Q7L7L0	OTTHUMG00000040046	ENST00000366695.2:c.260C>T	1.37:g.228645259G>A	ENSP00000355656:p.Ala87Val	Somatic	75	0		WXS	Illumina HiSeq	.	81	4	NM_033445	B2R4S4	Missense_Mutation	SNP	ENST00000366695.2	37	CCDS1573.1	.	.	.	.	.	.	.	.	.	.	.	23.7	4.442869	0.83993	.	.	ENSG00000181218	ENST00000366695	T	0.78816	-1.21	4.07	4.07	0.47477	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.47852	D	0.000209	D	0.90913	0.7144	H	0.95712	3.71	0.50171	D	0.999854	D	0.89917	1.0	D	0.79108	0.992	D	0.93233	0.6619	10	0.87932	D	0	.	14.5656	0.68173	0.0:0.0:1.0:0.0	.	87	Q7L7L0	H2A3_HUMAN	V	87	ENSP00000355656:A87V	ENSP00000355656:A87V	A	-	2	0	HIST3H2A	226711882	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.037000	0.93765	2.549000	0.85964	0.655000	0.94253	GCC	.		0.657	HIST3H2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096598.1	NM_033445	
ZNF208	7757	hgsc.bcm.edu	37	19	22154452	22154452	+	Silent	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:22154452A>G	ENST00000397126.4	-	4	3532	c.3384T>C	c.(3382-3384)ctT>ctC	p.L1128L	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L1000L(2)|p.L1128L(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGTTTAGTAAGGATTGAGA	0.373																																					p.L1128L		.											ZNF208_ENST00000428290,right_lower_lobe,carcinoma,0,6	ZNF208_ENST00000428290	0	3	Substitution - coding silent(3)	lung(3)	c.T3384C						.						57.0	61.0	60.0					19																	22154452		2123	4245	6368	SO:0001819	synonymous_variant	7757	exon4			TTTAGTAAGGATT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3384T>C	19.37:g.22154452A>G		Somatic	54	1		WXS	Illumina HiSeq	.	45	2	NM_007153		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																			.		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
GPD2	2820	hgsc.bcm.edu;broad.mit.edu	37	2	157427724	157427724	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:157427724G>T	ENST00000310454.6	+	13	2059	c.1687G>T	c.(1687-1689)Gtc>Ttc	p.V563F	GPD2_ENST00000409125.4_Missense_Mutation_p.V336F|GPD2_ENST00000540309.1_Intron|GPD2_ENST00000438166.2_Missense_Mutation_p.V563F|GPD2_ENST00000409674.1_Missense_Mutation_p.V563F	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	563					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						CTTTCTAAATGTCCAGGCAGC	0.423																																					p.V563F		.											GPD2,right_lower_lobe,carcinoma,0,1	GPD2	0	0			c.G1687T						.						141.0	135.0	137.0					2																	157427724		2203	4300	6503	SO:0001583	missense	2820	exon13			CTAAATGTCCAGG		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1687G>T	2.37:g.157427724G>T	ENSP00000308610:p.Val563Phe	Somatic	87	0		WXS	Illumina HiSeq	.	88	4	NM_001083112	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	37	CCDS2202.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.308963	0.81247	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000409674	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	6.06	6.06	0.98353	.	0.111956	0.64402	D	0.000014	T	0.61223	0.2330	M	0.89287	3.02	0.80722	D	1	B	0.09022	0.002	B	0.19148	0.024	T	0.61202	-0.7110	10	0.72032	D	0.01	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	563	P43304	GPDM_HUMAN	F	563;336;563;563	ENSP00000308610:V563F;ENSP00000386484:V336F;ENSP00000409708:V563F;ENSP00000386425:V563F	ENSP00000308610:V563F	V	+	1	0	GPD2	157135970	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	9.756000	0.98918	2.880000	0.98712	0.650000	0.86243	GTC	.		0.423	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
BAI1	575	hgsc.bcm.edu	37	8	143570419	143570419	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr8:143570419G>T	ENST00000517894.1	+	15	3370	c.2476G>T	c.(2476-2478)Gtg>Ttg	p.V826L	BAI1_ENST00000323289.5_Missense_Mutation_p.V826L			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	826					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATCCGTGTTTGTGGTGGGCAC	0.672																																					p.V826L		.											BAI1,right_lower_lobe,carcinoma,0,1	BAI1	0	0			c.G2476T						.						51.0	51.0	51.0					8																	143570419		2001	4149	6150	SO:0001583	missense	575	exon14			GTGTTTGTGGTGG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2476G>T	8.37:g.143570419G>T	ENSP00000430945:p.Val826Leu	Somatic	40	0		WXS	Illumina HiSeq	.	40	2	NM_001702		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	16.17	3.048306	0.55110	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.11821	2.74;2.74	4.94	4.94	0.65067	.	0.082710	0.47455	U	0.000221	T	0.13586	0.0329	L	0.54323	1.7	0.46798	D	0.999204	B	0.32409	0.37	B	0.30316	0.114	T	0.02868	-1.1100	10	0.49607	T	0.09	.	9.317	0.37941	0.0989:0.0:0.9011:0.0	.	826	E9PBK0	.	L	826	ENSP00000430945:V826L;ENSP00000313046:V826L	ENSP00000313046:V826L	V	+	1	0	BAI1	143567421	1.000000	0.71417	0.998000	0.56505	0.744000	0.42396	5.512000	0.67030	2.269000	0.75478	0.462000	0.41574	GTG	.		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
SNX29	92017	hgsc.bcm.edu	37	16	12136879	12136879	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr16:12136879G>T	ENST00000566228.1	+	5	442	c.373G>T	c.(373-375)Gaa>Taa	p.E125*	SNX29_ENST00000568359.1_3'UTR	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	125	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)	p.E125K(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						TGCCCTCAACGAACACTCCCT	0.662																																					p.E125X		.											RUNDC2A,NS,carcinoma,0,2	RUNDC2A	0	1	Substitution - Missense(1)	large_intestine(1)	c.G373T						.						38.0	32.0	34.0					16																	12136879		2197	4300	6497	SO:0001587	stop_gained	92017	exon5			CTCAACGAACACT	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.373G>T	16.37:g.12136879G>T	ENSP00000456480:p.Glu125*	Somatic	50	0		WXS	Illumina HiSeq	.	42	2	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Nonsense_Mutation	SNP	ENST00000566228.1	37	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	G	35	5.559648	0.96514	.	.	ENSG00000140660	ENST00000268271	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.6236	16.8321	0.85947	0.0:0.0:1.0:0.0	.	.	.	.	X	125	.	ENSP00000268271:E125X	E	+	1	0	RUNDC2A	12044380	1.000000	0.71417	0.972000	0.41901	0.948000	0.59901	9.354000	0.97083	2.555000	0.86185	0.462000	0.41574	GAA	.		0.662	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
ARHGAP24	83478	hgsc.bcm.edu	37	4	86921760	86921760	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr4:86921760C>T	ENST00000395184.1	+	10	2598	c.2132C>T	c.(2131-2133)gCc>gTc	p.A711V	RP13-514E23.2_ENST00000610225.1_RNA|ARHGAP24_ENST00000264343.4_Missense_Mutation_p.A618V|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.A616V	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	711					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		AAAGAAGATGCCGAGAAAAGA	0.423																																					p.A711V		.											.	.	.	0			c.C2132T						.						78.0	81.0	80.0					4																	86921760		2203	4300	6503	SO:0001583	missense	83478	exon10			AAGATGCCGAGAA	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.2132C>T	4.37:g.86921760C>T	ENSP00000378611:p.Ala711Val	Somatic	103	0		WXS	Illumina HiSeq	.	81	3	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421777	0.96111	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000264343	T;T;T	0.31769	1.48;1.48;1.48	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.53674	0.1811	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.994	T	0.37686	-0.9695	10	0.40728	T	0.16	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	616;618;711	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	V	711;616;618	ENSP00000378611:A711V;ENSP00000378610:A616V;ENSP00000264343:A618V	ENSP00000264343:A618V	A	+	2	0	ARHGAP24	87140784	1.000000	0.71417	0.970000	0.41538	0.886000	0.51366	7.744000	0.85034	2.882000	0.98803	0.655000	0.94253	GCC	.		0.423	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
ZNF136	7695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12297963	12297963	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:12297963G>A	ENST00000343979.4	+	4	910	c.770G>A	c.(769-771)tGt>tAt	p.C257Y	ZNF136_ENST00000398616.2_Missense_Mutation_p.C191Y	NM_003437.3	NP_003428.1	P52737	ZN136_HUMAN	zinc finger protein 136	257					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|biliary_tract(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	18						TGTAAGGTATGTGGGAAACCC	0.383																																					p.C257Y		.											.	.	.	0			c.G770A						.						85.0	80.0	81.0					19																	12297963		2203	4300	6503	SO:0001583	missense	7695	exon4			AGGTATGTGGGAA	U09367	CCDS32916.1	19p13.2	2013-01-08	2006-06-13		ENSG00000196646	ENSG00000196646		"""Zinc fingers, C2H2-type"", ""-"""	12920	protein-coding gene	gene with protein product		604078	"""zinc finger protein 136 (clone pHZ-20)"""			7557990	Standard	NM_003437		Approved	pHZ-20	uc002mti.3	P52737	OTTHUMG00000156429	ENST00000343979.4:c.770G>A	19.37:g.12297963G>A	ENSP00000344162:p.Cys257Tyr	Somatic	60	0		WXS	Illumina HiSeq	.	68	8	NM_003437		Missense_Mutation	SNP	ENST00000343979.4	37	CCDS32916.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083539	0.55861	.	.	ENSG00000196646	ENST00000343979;ENST00000398616	D;D	0.85861	-2.04;-2.04	1.37	1.37	0.22104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92231	0.7536	M	0.91717	3.235	0.43835	D	0.99641	D	0.89917	1.0	D	0.87578	0.998	D	0.91502	0.5220	8	.	.	.	.	8.3513	0.32303	0.0:0.0:1.0:0.0	.	257	P52737	ZN136_HUMAN	Y	257;191	ENSP00000344162:C257Y;ENSP00000381617:C191Y	.	C	+	2	0	ZNF136	12158963	1.000000	0.71417	0.055000	0.19348	0.887000	0.51463	6.997000	0.76270	1.067000	0.40740	0.650000	0.86243	TGT	.		0.383	ZNF136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344151.2	NM_003437	
ALPK3	57538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	85400849	85400849	+	Silent	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:85400849G>A	ENST00000258888.5	+	6	3653	c.3486G>A	c.(3484-3486)ctG>ctA	p.L1162L		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1162					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TAGATTCCCTGAAGAACTACC	0.652																																					p.L1162L		.											.	.	.	0			c.G3486A						.						44.0	50.0	48.0					15																	85400849		2203	4299	6502	SO:0001819	synonymous_variant	57538	exon6			TTCCCTGAAGAAC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3486G>A	15.37:g.85400849G>A		Somatic	35	0		WXS	Illumina HiSeq	.	30	4	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																			.		0.652	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
PA2G4	5036	hgsc.bcm.edu	37	12	56503676	56503676	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr12:56503676G>T	ENST00000303305.6	+	7	1005	c.586G>T	c.(586-588)Gat>Tat	p.D196Y	RP11-603J24.17_ENST00000548595.1_RNA|PA2G4_ENST00000552766.1_Missense_Mutation_p.D196Y	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	196					cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)	p.D196Y(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GCATGTCATCGATGGAGAAAA	0.438																																					p.D196Y		.											PA2G4,NS,carcinoma,0,1	PA2G4	0	1	Substitution - Missense(1)	endometrium(1)	c.G586T						.						119.0	110.0	113.0					12																	56503676		2203	4300	6503	SO:0001583	missense	5036	exon7			GTCATCGATGGAG	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.586G>T	12.37:g.56503676G>T	ENSP00000302886:p.Asp196Tyr	Somatic	33	0		WXS	Illumina HiSeq	.	42	2	NM_006191	O43846|Q9UM59	Missense_Mutation	SNP	ENST00000303305.6	37	CCDS8902.1	.	.	.	.	.	.	.	.	.	.	G	32	5.144729	0.94603	.	.	ENSG00000170515	ENST00000303305;ENST00000552766;ENST00000417031;ENST00000546435;ENST00000548711;ENST00000553057	T;T	0.80480	-1.38;-1.38	5.55	5.55	0.83447	Peptidase M24, structural domain (3);	0.041017	0.85682	D	0.000000	D	0.89612	0.6765	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.944;0.983;0.99	D	0.89535	0.3788	10	0.56958	D	0.05	.	18.6313	0.91360	0.0:0.0:1.0:0.0	.	196;196;196	F8VRZ3;F8VTY8;Q9UQ80	.;.;PA2G4_HUMAN	Y	196;196;225;196;196;185	ENSP00000302886:D196Y;ENSP00000448557:D196Y	ENSP00000302886:D196Y	D	+	1	0	PA2G4	54789943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.709000	0.98729	2.773000	0.95371	0.650000	0.86243	GAT	.		0.438	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407767.1	NM_006191	
KCNIP4	80333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	20736336	20736336	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr4:20736336A>G	ENST00000382152.2	-	6	619	c.452T>C	c.(451-453)aTt>aCt	p.I151T	KCNIP4_ENST00000359001.5_Missense_Mutation_p.I89T|KCNIP4_ENST00000382149.4_5'UTR|KCNIP4_ENST00000382150.4_Missense_Mutation_p.I130T|KCNIP4_ENST00000447367.2_Missense_Mutation_p.I117T|KCNIP4_ENST00000382148.3_Missense_Mutation_p.I126T|PACRGL_ENST00000507634.1_Intron|KCNIP4_ENST00000509207.1_Missense_Mutation_p.I89T	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4	151	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				CCGGAGCAAAATGGAAAGACC	0.303																																					p.I131T		.											.	.	.	0			c.T392C						.						118.0	124.0	122.0					4																	20736336		2203	4300	6503	SO:0001583	missense	80333	exon5			AGCAAAATGGAAA	AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.452T>C	4.37:g.20736336A>G	ENSP00000371587:p.Ile151Thr	Somatic	100	0		WXS	Illumina HiSeq	.	102	24	NM_025221	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	Missense_Mutation	SNP	ENST00000382152.2	37	CCDS43216.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453599	0.43531	.	.	ENSG00000185774	ENST00000382148;ENST00000447367;ENST00000382150;ENST00000413487;ENST00000382152;ENST00000509207;ENST00000359001	T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	6.03	6.03	0.97812	EF-hand-like domain (1);	0.134279	0.64402	D	0.000003	T	0.54902	0.1887	N	0.24115	0.695	0.48185	D	0.999608	B;B;B;B	0.29886	0.024;0.01;0.01;0.26	B;B;B;B	0.34991	0.127;0.087;0.127;0.193	T	0.57406	-0.7817	10	0.54805	T	0.06	.	10.6094	0.45412	0.9281:0.0:0.0719:0.0	.	126;130;134;151	Q3YAB9;Q3YAC0;Q3YAB7;Q6PIL6	.;.;.;KCIP4_HUMAN	T	126;117;130;89;151;89;89	ENSP00000371583:I126T;ENSP00000399080:I117T;ENSP00000371585:I130T;ENSP00000371587:I151T;ENSP00000423257:I89T;ENSP00000351892:I89T	ENSP00000351892:I89T	I	-	2	0	KCNIP4	20345434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.570000	0.82390	2.319000	0.78375	0.524000	0.50904	ATT	.		0.303	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360407.3	NM_025221	
HMGCL	3155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	24140684	24140684	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:24140684G>A	ENST00000374490.3	-	5	536	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W	HMGCL_ENST00000509389.1_Intron|HMGCL_ENST00000436439.2_Intron|HMGCL_ENST00000374483.4_Missense_Mutation_p.R140W	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	165			R -> Q (in HMGCLD; dbSNP:rs199587895). {ECO:0000269|PubMed:19036343}.		acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		ACTCACCCCCGCACAGAAATA	0.488																																					p.R165W		.											.	.	.	0			c.C493T						.						97.0	94.0	95.0					1																	24140684		2203	4300	6503	SO:0001583	missense	3155	exon5			ACCCCCGCACAGA	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.493C>T	1.37:g.24140684G>A	ENSP00000363614:p.Arg165Trp	Somatic	38	0		WXS	Illumina HiSeq	.	20	5	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	37	CCDS243.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311572	0.60414	.	.	ENSG00000117305	ENST00000374490;ENST00000374483	D;D	0.98362	-4.89;-4.89	5.39	3.34	0.38264	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.99354	0.9773	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98411	1.0572	10	0.87932	D	0	.	14.281	0.66211	0.0:0.0:0.7245:0.2755	.	140;165	B1AK13;P35914	.;HMGCL_HUMAN	W	165;140	ENSP00000363614:R165W;ENSP00000363607:R140W	ENSP00000363607:R140W	R	-	1	2	HMGCL	24013271	0.998000	0.40836	0.994000	0.49952	0.277000	0.26821	0.508000	0.22692	1.345000	0.45676	0.455000	0.32223	CGG	.		0.488	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
LRRC9	341883	hgsc.bcm.edu	37	14	60394514	60394514	+	Intron	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr14:60394514T>C	ENST00000445360.1	+	2	171				LRRC9_ENST00000454474.2_Intron			Q6ZRR7	LRRC9_HUMAN	leucine rich repeat containing 9																		TAATATACTATGTGAAGATTT	0.308																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	341883	.			ATACTATGTGAAG	AK128037		14q23.1	2013-01-29	2003-11-19		ENSG00000131951	ENSG00000131951			19848	other	unknown			"""leucine-rich repeat-containing 9"""				Standard	NR_075071		Approved	FLJ46156	uc001xep.1	Q6ZRR7	OTTHUMG00000028948	ENST00000445360.1:c.-33-115T>C	14.37:g.60394514T>C		Somatic	41	0		WXS	Illumina HiSeq	.	33	11	.		RNA	SNP	ENST00000445360.1	37																																																																																				.		0.308	LRRC9-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000072281.3		
GPN2	54707	broad.mit.edu	37	1	27210710	27210710	+	Missense_Mutation	SNP	C	C	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:27210710C>A	ENST00000374135.4	-	4	1001	c.801G>T	c.(799-801)gaG>gaT	p.E267D	GPN2_ENST00000374133.3_Missense_Mutation_p.E88D|GPN2_ENST00000461282.1_5'Flank	NM_018066.3	NP_060536.3			GPN-loop GTPase 2											endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9						AGCTTCGCTGCTCTTGGGCTC	0.537																																					p.E267D													GPN2,bladder,carcinoma,-2,1	GPN2	18	0			c.G801T						.						90.0	77.0	81.0					1																	27210710		2203	4300	6503	SO:0001583	missense	54707	exon4			TCGCTGCTCTTGG	AK001211	CCDS289.1	1p36.11	2008-04-30	2008-04-30	2008-04-30	ENSG00000142751	ENSG00000142751		"""GPN-loop GTPases"""	25513	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member B"""	ATPBD1B		12975309	Standard	NM_018066		Approved	FLJ10349	uc001bnd.1	Q9H9Y4	OTTHUMG00000004227	ENST00000374135.4:c.801G>T	1.37:g.27210710C>A	ENSP00000363250:p.Glu267Asp	Somatic	26	0		WXS	Illumina GAIIx	Phase_I	13	3	NM_018066		Missense_Mutation	SNP	ENST00000374135.4	37	CCDS289.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300563	0.40694	.	.	ENSG00000142751	ENST00000374135;ENST00000374133	T;T	0.27557	2.15;1.66	5.41	4.5	0.54988	.	0.052266	0.85682	D	0.000000	T	0.16342	0.0393	N	0.08118	0	0.41999	D	0.990886	B	0.21309	0.054	B	0.23419	0.046	T	0.05649	-1.0872	10	0.49607	T	0.09	-28.3688	8.6629	0.34103	0.0:0.7661:0.0:0.2339	.	267	Q9H9Y4	GPN2_HUMAN	D	267;88	ENSP00000363250:E267D;ENSP00000363248:E88D	ENSP00000363248:E88D	E	-	3	2	GPN2	27083297	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.051000	0.49885	1.281000	0.44480	0.491000	0.48974	GAG	.		0.537	GPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012175.2	NM_018066	
MACF1	23499	broad.mit.edu	37	1	39798190	39798190	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:39798190A>G	ENST00000372915.3	+	36	6032	c.5945A>G	c.(5944-5946)aAt>aGt	p.N1982S	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Missense_Mutation_p.N417S|MACF1_ENST00000564288.1_Missense_Mutation_p.N1977S|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.N2014S|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1982					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATGTGCAAAATGGACAGAGG	0.458																																					.													.	MACF1	909	0			.						.						91.0	95.0	94.0					1																	39798190		2203	4300	6503	SO:0001583	missense	23499	.			TGCAAAATGGACA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.5945A>G	1.37:g.39798190A>G	ENSP00000362006:p.Asn1982Ser	Somatic	23	0		WXS	Illumina GAIIx	Phase_I	20	3	.	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	0.556	-0.847321	0.02651	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.58797	0.31;1.5	5.3	2.59	0.31030	.	0.714379	0.12604	N	0.454498	T	0.23532	0.0569	N	0.00841	-1.15	0.29086	N	0.882363	B	0.02656	0.0	B	0.06405	0.002	T	0.15065	-1.0450	10	0.39692	T	0.17	.	5.3548	0.16055	0.636:0.1616:0.2024:0.0	.	1982	Q9UPN3	MACF1_HUMAN	S	1982;417	ENSP00000362006:N1982S;ENSP00000289893:N417S	ENSP00000289893:N417S	N	+	2	0	MACF1	39570777	0.663000	0.27448	0.705000	0.30386	0.251000	0.25915	2.027000	0.41078	0.845000	0.35118	0.454000	0.30748	AAT	.		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
GBP1	2633	broad.mit.edu	37	1	89528730	89528730	+	Missense_Mutation	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:89528730T>C	ENST00000370473.4	-	2	407	c.188A>G	c.(187-189)aAg>aGg	p.K63R		NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	63	GB1/RHD3-type G.|GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		CCACTCACCCTTTTTCTTTCC	0.493																																					p.K63R													GBP1,middle_lobe,carcinoma,0,1	GBP1	68	0			c.A188G						.						111.0	101.0	105.0					1																	89528730		2203	4300	6503	SO:0001583	missense	2633	exon2			TCACCCTTTTTCT	BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.188A>G	1.37:g.89528730T>C	ENSP00000359504:p.Lys63Arg	Somatic	94	1		WXS	Illumina GAIIx	Phase_I	92	3	NM_002053	D3DT26|Q5T8M1	Missense_Mutation	SNP	ENST00000370473.4	37	CCDS718.1	.	.	.	.	.	.	.	.	.	.	T	5.523	0.281439	0.10458	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.74947	-0.89	4.76	-1.55	0.08558	Guanylate-binding protein, N-terminal (1);	0.763001	0.12196	N	0.490681	T	0.47210	0.1433	L	0.58510	1.815	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.49133	-0.8971	10	0.40728	T	0.16	.	7.8153	0.29256	0.0:0.0895:0.4196:0.4909	.	63	P32455	GBP1_HUMAN	R	63;26	ENSP00000359504:K63R	ENSP00000359504:K63R	K	-	2	0	GBP1	89301318	0.000000	0.05858	0.474000	0.27266	0.035000	0.12851	-0.894000	0.04123	-0.104000	0.12154	0.260000	0.18958	AAG	.		0.493	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3	NM_002053	
DENND4B	9909	broad.mit.edu	37	1	153907303	153907303	+	Silent	SNP	C	C	T	rs557071025	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:153907303C>T	ENST00000361217.4	-	18	3124	c.2706G>A	c.(2704-2706)caG>caA	p.Q902Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	902	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgctgttgctgct	0.642																																					p.Q902Q													DENND4B_ENST00000361217,bladder,carcinoma,0,2	DENND4B	210	0			c.G2706A						.						30.0	39.0	36.0					1																	153907303		2184	4281	6465	SO:0001819	synonymous_variant	9909	exon18			CTGCTGCTGTTGC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2706G>A	1.37:g.153907303C>T		Somatic	26	0		WXS	Illumina GAIIx	Phase_I	26	3	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
RFWD2	64326	hgsc.bcm.edu	37	1	175956191	175956191	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:175956191G>T	ENST00000367669.3	-	18	2535	c.2021C>A	c.(2020-2022)aCt>aAt	p.T674N	RFWD2_ENST00000308769.8_Missense_Mutation_p.T650N	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	674					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AGTTAGCAAAGTCTTAGAAAG	0.323																																					p.T674N	Ovarian(134;1413 1765 5706 35534 51541)	.											.	.	.	0			c.C2021A						.						73.0	71.0	72.0					1																	175956191		2203	4300	6503	SO:0001583	missense	64326	exon18			AGCAAAGTCTTAG	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.2021C>A	1.37:g.175956191G>T	ENSP00000356641:p.Thr674Asn	Somatic	48	0		WXS	Illumina HiSeq	.	44	4	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	37	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719707	0.68844	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.70282	-0.47;-0.47;-0.47	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047887	0.85682	D	0.000000	T	0.79155	0.4398	L	0.36672	1.1	0.80722	D	1	P;P;P;D;P	0.57899	0.591;0.851;0.874;0.981;0.851	B;P;B;D;P	0.69824	0.352;0.775;0.262;0.966;0.775	T	0.79899	-0.1608	10	0.62326	D	0.03	-12.7845	19.3277	0.94268	0.0:0.0:1.0:0.0	.	449;434;650;674;674	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	N	449;674;509;650	ENSP00000356641:T674N;ENSP00000356638:T509N;ENSP00000310943:T650N	ENSP00000310943:T650N	T	-	2	0	RFWD2	174222814	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.931000	0.92884	2.723000	0.93209	0.655000	0.94253	ACT	.		0.323	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
RD3	343035	broad.mit.edu;bcgsc.ca	37	1	211652604	211652604	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:211652604A>G	ENST00000367002.4	-	3	1525	c.362T>C	c.(361-363)gTg>gCg	p.V121A	RD3_ENST00000484910.1_5'UTR	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	121					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)					central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		CTCCTGCAGCACCGAGCGGAA	0.697																																					p.V121A													.	RD3	26	0			c.T362C						.						17.0	17.0	17.0					1																	211652604		2200	4299	6499	SO:0001583	missense	343035	exon3			TGCAGCACCGAGC	AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.362T>C	1.37:g.211652604A>G	ENSP00000355969:p.Val121Ala	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	20	4	NM_183059	A8K595	Missense_Mutation	SNP	ENST00000367002.4	37	CCDS1498.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154217	0.57259	.	.	ENSG00000198570	ENST00000367002	T	0.18810	2.19	4.09	4.09	0.47781	.	0.136386	0.47852	D	0.000220	T	0.28699	0.0711	M	0.79475	2.455	0.44531	D	0.997487	B	0.19583	0.037	B	0.22386	0.039	T	0.18272	-1.0342	10	0.72032	D	0.01	-33.8818	13.4154	0.60966	1.0:0.0:0.0:0.0	.	121	Q7Z3Z2	RD3_HUMAN	A	121	ENSP00000355969:V121A	ENSP00000355969:V121A	V	-	2	0	RD3	209719227	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.334000	0.59291	1.637000	0.50538	0.454000	0.30748	GTG	.		0.697	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089837.1	NM_183059	
FAM21A	387680	broad.mit.edu	37	10	51826259	51826259	+	5'Flank	DEL	A	A	-	rs368712005		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr10:51826259delA	ENST00000282633.5	+	0	0				FAM21A_ENST00000314664.7_5'Flank|FAM21A_ENST00000351071.6_5'Flank|RP11-324H6.5_ENST00000456967.1_RNA	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A						retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						TAACAAAAGCAAAAAAAAAAA	0.333																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			AAAAGCAAAAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225		10.37:g.51826259delA	Exception_encountered	Somatic	8	0		WXS	Illumina GAIIx	Phase_I	12	5	.	A2A3S2|A2A3U6|Q6DHY0	RNA	DEL	ENST00000282633.5	37	CCDS41527.1																																																																																			.		0.333	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276917.2	NM_001005751	
OR51A4	401666	broad.mit.edu	37	11	4967989	4967989	+	Silent	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:4967989G>T	ENST00000380373.2	-	1	367	c.342C>A	c.(340-342)tcC>tcA	p.S114S	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAGGACTGAGGACTCCAGTA	0.453																																					p.S114S													.	OR51A4	73	0			c.C342A						.						177.0	178.0	177.0					11																	4967989		2191	4286	6477	SO:0001819	synonymous_variant	401666	exon1			GACTGAGGACTCC	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.342C>A	11.37:g.4967989G>T		Somatic	58	0		WXS	Illumina GAIIx	Phase_I	42	3	NM_001005329		Silent	SNP	ENST00000380373.2	37	CCDS31367.1																																																																																			.		0.453	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OR5D16	390144	broad.mit.edu;bcgsc.ca	37	11	55606662	55606662	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:55606662G>A	ENST00000378396.1	+	1	435	c.435G>A	c.(433-435)atG>atA	p.M145I		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TCTGTGCCATGCTGGTGGTTG	0.448																																					p.M145I													OR5D16,NS,carcinoma,+2,1	OR5D16	94	0			c.G435A						.						126.0	114.0	118.0					11																	55606662		2201	4296	6497	SO:0001583	missense	390144	exon1			TGCCATGCTGGTG	AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.435G>A	11.37:g.55606662G>A	ENSP00000367649:p.Met145Ile	Somatic	38	0		WXS	Illumina GAIIx	Phase_I	60	5	NM_001005496	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	.	.	.	.	.	.	.	.	.	.	.	13.33	2.204083	0.38905	.	.	ENSG00000205029	ENST00000378396	T	0.00063	8.78	4.31	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.04063	-0.285	0.09310	N	1	B	0.12630	0.006	B	0.21151	0.033	T	0.00501	-1.1702	9	0.22109	T	0.4	-2.3044	7.178	0.25755	0.0844:0.0:0.6187:0.297	.	145	Q8NGK9	OR5DG_HUMAN	I	145	ENSP00000367649:M145I	ENSP00000367649:M145I	M	+	3	0	OR5D16	55363238	0.000000	0.05858	0.001000	0.08648	0.631000	0.37964	-2.580000	0.00907	0.427000	0.26145	-0.273000	0.10243	ATG	.		0.448	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496	
POC1B	282809	broad.mit.edu	37	12	89891025	89891025	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr12:89891025G>T	ENST00000313546.3	-	3	323	c.195C>A	c.(193-195)agC>agA	p.S65R	POC1B_ENST00000541909.1_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000549035.1_Missense_Mutation_p.S23R|POC1B_ENST00000378528.2_5'UTR|POC1B_ENST00000393179.4_Intron	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	65					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						AAAACTGCACGCTGGTTACAA	0.438																																					p.S65R													.	POC1B	41	0			c.C195A						.						155.0	140.0	145.0					12																	89891025		2203	4300	6503	SO:0001583	missense	282809	exon3			CTGCACGCTGGTT	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.195C>A	12.37:g.89891025G>T	ENSP00000323302:p.Ser65Arg	Somatic	40	0		WXS	Illumina GAIIx	Phase_I	53	3	NM_172240	G3V1X0	Missense_Mutation	SNP	ENST00000313546.3	37	CCDS31869.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217266	0.39201	.	.	ENSG00000139323	ENST00000313546;ENST00000549035	T;T	0.65732	-0.17;-0.17	5.65	2.78	0.32641	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.127039	0.64402	D	0.000001	T	0.74313	0.3700	M	0.72624	2.21	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.74788	-0.3546	10	0.66056	D	0.02	.	10.0726	0.42341	0.3166:0.0:0.6834:0.0	.	65	Q8TC44	POC1B_HUMAN	R	65;23	ENSP00000323302:S65R;ENSP00000447916:S23R	ENSP00000323302:S65R	S	-	3	2	POC1B	88415156	0.011000	0.17503	1.000000	0.80357	0.998000	0.95712	-0.660000	0.05317	0.725000	0.32318	0.591000	0.81541	AGC	.		0.438	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406637.1	NM_172240	
RPL21P7	145370	broad.mit.edu	37	14	65733835	65733838	+	lincRNA	DEL	CTTT	CTTT	-	rs370367895		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr14:65733835_65733838delCTTT	ENST00000553754.1	-	0	368																											ttctttcctgctttctttctttct	0.299																																					.													.	.	.	0			.						.																																					0	.			TTCCTGCTTTCTT																													14.37:g.65733843_65733846delCTTT		Somatic	5	0		WXS	Illumina GAIIx	Phase_I	7	2	.		RNA	DEL	ENST00000553754.1	37																																																																																				.		0.299	CTD-2509G16.5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000412041.1		
DNM1P47	100216544	broad.mit.edu	37	15	102297875	102297875	+	RNA	SNP	A	A	G	rs139575469	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:102297875A>G	ENST00000561463.1	+	0	5921									DNM1 pseudogene 47																		CGAGACTCGCATGGGAAGAAG	0.582													.|||	1557	0.310903	0.4682	0.2695	5008	,	,		30893	0.1508		0.4036	False		,,,				2504	0.1973				.													.	.	.	0			.						.																																					0	.			ACTCGCATGGGAA	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102297875A>G		Somatic	27	0		WXS	Illumina GAIIx	Phase_I	38	4	.		RNA	SNP	ENST00000561463.1	37																																																																																				G|1.000;|0.000		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1	NG_009149	
OR10H1	26539	broad.mit.edu	37	19	15918259	15918259	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:15918259C>T	ENST00000334920.2	-	1	677	c.589G>A	c.(589-591)Gcc>Acc	p.A197T		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ACGCCTTTGGCCACCACCAGC	0.562																																					p.A197T													.	OR10H1	59	0			c.G589A						.						190.0	146.0	161.0					19																	15918259		2203	4300	6503	SO:0001583	missense	26539	exon1			CTTTGGCCACCAC	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.589G>A	19.37:g.15918259C>T	ENSP00000335596:p.Ala197Thr	Somatic	80	0		WXS	Illumina GAIIx	Phase_I	71	3	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	.	3.797	-0.042567	0.07452	.	.	ENSG00000186723	ENST00000334920	T	0.00123	8.7	4.09	1.94	0.25998	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000141	T	0.00073	0.0002	N	0.04018	-0.295	0.31270	N	0.691817	B	0.10296	0.003	B	0.17722	0.019	T	0.00171	-1.1960	10	0.11485	T	0.65	.	4.8697	0.13625	0.2098:0.6785:0.0:0.1116	.	197	Q9Y4A9	O10H1_HUMAN	T	197	ENSP00000335596:A197T	ENSP00000335596:A197T	A	-	1	0	OR10H1	15779259	0.056000	0.20664	0.811000	0.32455	0.012000	0.07955	0.389000	0.20751	0.385000	0.24970	-0.165000	0.13383	GCC	.		0.562	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
SCN2A	6326	broad.mit.edu	37	2	166231253	166231253	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:166231253G>T	ENST00000375437.2	+	22	4321	c.4031G>T	c.(4030-4032)tGt>tTt	p.C1344F	SCN2A_ENST00000357398.3_Missense_Mutation_p.C1344F|SCN2A_ENST00000283256.6_Missense_Mutation_p.C1344F|SCN2A_ENST00000375427.2_Missense_Mutation_p.C1344F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1344					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTCTGGTTTGTCTGATCTTT	0.373																																					p.C1344F													.	SCN2A	589	0			c.G4031T						.						164.0	155.0	158.0					2																	166231253		2203	4300	6503	SO:0001583	missense	6326	exon21			TGGTTTGTCTGAT	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4031G>T	2.37:g.166231253G>T	ENSP00000364586:p.Cys1344Phe	Somatic	56	1		WXS	Illumina GAIIx	Phase_I	54	4	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200051	0.79015	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89	4.48	4.48	0.54585	Ion transport (1);	0.000000	0.64402	D	0.000003	D	0.99184	0.9717	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.99204	1.0874	10	0.87932	D	0	.	17.5276	0.87805	0.0:0.0:1.0:0.0	.	1344;1344	Q99250-2;Q99250	.;SCN2A_HUMAN	F	1344	ENSP00000364586:C1344F;ENSP00000349973:C1344F;ENSP00000283256:C1344F;ENSP00000364576:C1344F	ENSP00000283256:C1344F	C	+	2	0	SCN2A	165939499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.192000	0.70111	0.467000	0.42956	TGT	.		0.373	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
RBBP8NL	140893	broad.mit.edu	37	20	60991830	60991830	+	Missense_Mutation	SNP	C	C	T	rs371268446		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr20:60991830C>T	ENST00000252998.1	-	5	455	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	100						extracellular space (GO:0005615)											GATGAAGATGCGCTGCAGGTT	0.682																																					p.R100H													C20orf151,colon,carcinoma,-1,1	.	.	0			c.G299A						.	C	HIS/ARG	1,4393		0,1,2196	61.0	54.0	56.0		299	-1.7	0.0	20		56	0,8584		0,0,4292	no	missense	C20orf151	NM_080833.2	29	0,1,6488	TT,TC,CC		0.0,0.0228,0.0077	benign	100/665	60991830	1,12977	2197	4292	6489	SO:0001583	missense	140893	exon5			AAGATGCGCTGCA	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.299G>A	20.37:g.60991830C>T	ENSP00000252998:p.Arg100His	Somatic	47	0		WXS	Illumina GAIIx	Phase_I	41	3	NM_080833	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	37	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.001645	0.00431	2.28E-4	0.0	ENSG00000130701	ENST00000252998	T	0.14144	2.53	4.46	-1.69	0.08186	Tumour-suppressor protein CtIP N-terminal (1);	0.242516	0.41097	N	0.000951	T	0.03053	0.0090	N	0.00563	-1.375	0.23628	N	0.997256	B	0.02656	0.0	B	0.01281	0.0	T	0.41431	-0.9509	10	0.26408	T	0.33	-7.6853	9.7795	0.40640	0.0:0.3615:0.0:0.6385	.	100	Q8NC74	CT151_HUMAN	H	100	ENSP00000252998:R100H	ENSP00000252998:R100H	R	-	2	0	C20orf151	60425225	1.000000	0.71417	0.018000	0.16275	0.004000	0.04260	2.367000	0.44213	-0.841000	0.04200	-2.069000	0.00389	CGC	.		0.682	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080029.1	NM_080833	
TPTEP1	387590	broad.mit.edu	37	22	17128576	17128576	+	lincRNA	SNP	A	A	C	rs2381064		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr22:17128576A>C	ENST00000426585.1	+	0	442									transmembrane phosphatase with tensin homology pseudogene 1																		AGTCGCCCGTAGTTTTGTTTC	0.478																																					.													.	.	.	0			.						.																																					0	.			GCCCGTAGTTTTG			22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17128576A>C		Somatic	46	1		WXS	Illumina GAIIx	Phase_I	45	4	.		RNA	SNP	ENST00000426585.1	37																																																																																				.		0.478	TPTEP1-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000280575.1	NR_001591	
BAP1	8314	broad.mit.edu	37	3	52436651	52436667	+	Frame_Shift_Del	DEL	TGAACTCATCGTAGTTG	TGAACTCATCGTAGTTG	-	rs200194082|rs144881611		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:52436651_52436667delTGAACTCATCGTAGTTG	ENST00000460680.1	-	16	2478_2494	c.2007_2023delCAACTACGATGAGTTCA	c.(2005-2025)cacaactacgatgagttcatcfs	p.NYDEFI670fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.NYDEFI652fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D672G(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AAGGTGCAGATGAACTCATCGTAGTTGTGGGTCCTTC	0.562			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.669_675del	GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	1	Substitution - Missense(1)	eye(1)	c.2007_2023del						.																																			SO:0001589	frameshift_variant	8314	exon16			TGCAGATGAACTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.2007_2023delCAACTACGATGAGTTCA	3.37:g.52436651_52436667delTGAACTCATCGTAGTTG	ENSP00000417132:p.Asn670fs	Somatic	12	0		WXS	Illumina GAIIx	Phase_I	9	4	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.562	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
HMGB1P5	10354	broad.mit.edu	37	3	22424366	22424366	+	RNA	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:22424366G>T	ENST00000451497.1	+	0	931									high mobility group box 1 pseudogene 5																		CTGTTTTGTTGACATTCTGAA	0.333																																					.													.	.	.	0			.						.																																					0	.			TTTGTTGACATTC	AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424366G>T		Somatic	39	0		WXS	Illumina GAIIx	Phase_I	38	5	.		RNA	SNP	ENST00000451497.1	37																																																																																				.		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000340803.1	NG_000897	
KBTBD8	84541	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	67054577	67054577	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:67054577G>A	ENST00000417314.2	+	3	1235	c.1186G>A	c.(1186-1188)Gga>Aga	p.G396R	KBTBD8_ENST00000295568.4_Missense_Mutation_p.G370R|KBTBD8_ENST00000460576.1_Intron			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	396						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GTATGCAATCGGAGGTCGTGT	0.443																																					p.G396R													.	KBTBD8	101	0			c.G1186A						.						179.0	171.0	173.0					3																	67054577		2203	4300	6503	SO:0001583	missense	84541	exon3			GCAATCGGAGGTC	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.1186G>A	3.37:g.67054577G>A	ENSP00000401878:p.Gly396Arg	Somatic	72	1		WXS	Illumina GAIIx	Phase_I	38	13	NM_032505	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	37	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525168	0.85600	.	.	ENSG00000163376	ENST00000295568;ENST00000417314	D;D	0.98777	-5.13;-5.13	5.36	5.36	0.76844	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.96333	3.805	0.80722	D	1	D	0.69078	0.997	D	0.63793	0.918	D	0.98567	1.0644	9	.	.	.	.	19.4459	0.94847	0.0:0.0:1.0:0.0	.	396	Q8NFY9	KBTB8_HUMAN	R	370;396	ENSP00000295568:G370R;ENSP00000401878:G396R	.	G	+	1	0	KBTBD8	67137267	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	9.813000	0.99286	2.676000	0.91093	0.557000	0.71058	GGA	.		0.443	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505	
SLC9C1	285335	broad.mit.edu	37	3	111985124	111985124	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr3:111985124G>T	ENST00000305815.5	-	8	1091	c.839C>A	c.(838-840)aCa>aAa	p.T280K	SLC9C1_ENST00000487372.1_Missense_Mutation_p.T280K	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	280					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TTTAAAACTTGTAGAATTTAA	0.274																																					p.T280K													.	.	.	0			c.C839A						.						65.0	73.0	70.0					3																	111985124		2202	4295	6497	SO:0001583	missense	285335	exon8			AAACTTGTAGAAT	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.839C>A	3.37:g.111985124G>T	ENSP00000306627:p.Thr280Lys	Somatic	370	2		WXS	Illumina GAIIx	Phase_I	304	5	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929495	0.52759	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.12984	2.63;2.63	5.04	5.04	0.67666	Cation/H+ exchanger (1);	0.105838	0.42294	D	0.000740	T	0.29458	0.0734	L	0.55481	1.735	0.35360	D	0.78812	P;D	0.71674	0.935;0.998	P;D	0.66979	0.704;0.948	T	0.15983	-1.0418	10	0.29301	T	0.29	-15.4206	14.2567	0.66058	0.0:0.0:1.0:0.0	.	280;280	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	K	280	ENSP00000306627:T280K;ENSP00000420688:T280K	ENSP00000306627:T280K	T	-	2	0	SLC9A10	113467814	1.000000	0.71417	0.998000	0.56505	0.261000	0.26267	2.322000	0.43814	2.497000	0.84241	0.603000	0.83216	ACA	.		0.274	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
DPY19L2P2	349152	broad.mit.edu	37	7	102898150	102898150	+	RNA	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:102898150G>A	ENST00000312132.4	-	0	2422							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ATGAATGTGCGATACCAGGAG	0.308																																					.													.	.	.	0			.						.																																					0	.			ATGTGCGATACCA	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102898150G>A		Somatic	154	1		WXS	Illumina GAIIx	Phase_I	165	4	.	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																				.		0.308	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347877.1	NM_182634	
ACTR3C	653857	broad.mit.edu	37	7	149990455	149990455	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:149990455T>C	ENST00000539352.1	-	3	350	c.99A>G	c.(97-99)acA>acG	p.T33T	ACTR3C_ENST00000252071.4_Silent_p.T33T	NM_001164458.1	NP_001157930.1	Q9C0K3	ARP3C_HUMAN	ARP3 actin-related protein 3 homolog C (yeast)	33						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.T33T(1)									TCCCCGTTAATGTACGTTCAC	0.468																																					p.T33T													Q9C0K3_HUMAN,NS,carcinoma,0,1	.	.	1	Substitution - coding silent(1)	kidney(1)	c.A99G						.						165.0	135.0	144.0					7																	149990455		692	1591	2283	SO:0001819	synonymous_variant	653857	exon3			CGTTAATGTACGT		CCDS47744.1	7q36.1	2009-09-23			ENSG00000106526	ENSG00000106526			37282	protein-coding gene	gene with protein product						11162478, 14651955	Standard	NM_001164458		Approved	ARP11	uc022aps.1	Q9C0K3	OTTHUMG00000158323	ENST00000539352.1:c.99A>G	7.37:g.149990455T>C		Somatic	86	0		WXS	Illumina GAIIx	Phase_I	81	5	NM_001164459	Q5CZI4	Silent	SNP	ENST00000539352.1	37	CCDS47744.1																																																																																			.		0.468	ACTR3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350676.2		
NOS3	4846	broad.mit.edu	37	7	150704218	150704218	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr7:150704218G>A	ENST00000297494.3	+	17	2323	c.1966G>A	c.(1966-1968)Gca>Aca	p.A656T	NOS3_ENST00000461406.1_Missense_Mutation_p.A450T	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGGCTCCCGGGCATACCCCCA	0.682																																					p.A656T													NOS3,NS,carcinoma,-2,1	NOS3	131	0			c.G1966A						.						101.0	102.0	102.0					7																	150704218		2203	4300	6503	SO:0001583	missense	4846	exon17			TCCCGGGCATACC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.1966G>A	7.37:g.150704218G>A	ENSP00000297494:p.Ala656Thr	Somatic	50	0		WXS	Illumina GAIIx	Phase_I	43	3	NM_000603	Q495E5	Missense_Mutation	SNP	ENST00000297494.3	37	CCDS5912.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391992	0.83011	.	.	ENSG00000164867	ENST00000297494;ENST00000461406	T;T	0.74002	-0.8;-0.8	4.92	4.92	0.64577	Flavodoxin/nitric oxide synthase (2);	0.000000	0.64402	D	0.000010	T	0.71230	0.3315	L	0.33189	0.99	0.80722	D	1	B;B	0.33739	0.032;0.422	B;B	0.42653	0.056;0.394	T	0.70749	-0.4787	10	0.39692	T	0.17	-22.7549	16.0526	0.80774	0.0:0.0:1.0:0.0	.	450;656	E7ESA7;P29474	.;NOS3_HUMAN	T	656;450	ENSP00000297494:A656T;ENSP00000417143:A450T	ENSP00000297494:A656T	A	+	1	0	NOS3	150335151	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.913000	0.87471	2.457000	0.83068	0.499000	0.49734	GCA	.		0.682	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	
BTN2A2	10385	ucsc.edu	37	6	26393052	26393052	+	Missense_Mutation	SNP	A	A	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:26393052A>T	ENST00000356709.4	+	8	1540	c.1429A>T	c.(1429-1431)Act>Tct	p.T477S	BTN2A2_ENST00000432533.2_3'UTR|BTN2A2_ENST00000352867.2_Missense_Mutation_p.T361S|BTN2A2_ENST00000416795.2_Missense_Mutation_p.T477S|BTN2A2_ENST00000482536.1_Missense_Mutation_p.T267S|BTN2A2_ENST00000469230.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	477	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TTCAGCCTTTACTGTGCCTGT	0.552																																					p.T477S													.	BTN2A2	87	0			c.A1429T						.						132.0	114.0	120.0					6																	26393052		2203	4300	6503	SO:0001583	missense	10385	exon8			GCCTTTACTGTGC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.1429A>T	6.37:g.26393052A>T	ENSP00000349143:p.Thr477Ser	Somatic	26	2		WXS	Illumina HiSeq		41	8	NM_006995	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	37	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	.	0.009	-1.845525	0.00568	.	.	ENSG00000124508	ENST00000356709;ENST00000352867;ENST00000482536;ENST00000416795	T;T;T;T	0.60548	0.18;0.18;0.18;0.18	3.63	-7.27	0.01461	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.471490	0.04092	N	0.311434	T	0.07324	0.0185	N	0.04148	-0.265	0.21652	N	0.999607	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.03463	-1.1034	10	0.02654	T	1	.	5.6901	0.17825	0.5157:0.0:0.2603:0.224	.	267;361;477	E9PH07;A6NM84;Q8WVV5	.;.;BT2A2_HUMAN	S	477;361;267;477	ENSP00000349143:T477S;ENSP00000337117:T361S;ENSP00000419451:T267S;ENSP00000399308:T477S	ENSP00000337117:T361S	T	+	1	0	BTN2A2	26501031	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.420000	0.07062	-1.474000	0.01879	-0.589000	0.04120	ACT	.		0.552	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
BTN2A2	10385	ucsc.edu	37	6	26393054	26393054	+	Silent	SNP	T	T	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:26393054T>C	ENST00000356709.4	+	8	1542	c.1431T>C	c.(1429-1431)acT>acC	p.T477T	BTN2A2_ENST00000432533.2_3'UTR|BTN2A2_ENST00000352867.2_Silent_p.T361T|BTN2A2_ENST00000416795.2_Silent_p.T477T|BTN2A2_ENST00000482536.1_Silent_p.T267T|BTN2A2_ENST00000469230.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	477	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						CAGCCTTTACTGTGCCTGTGA	0.562																																					p.T477T													.	BTN2A2	87	0			c.T1431C						.						132.0	114.0	120.0					6																	26393054		2203	4300	6503	SO:0001819	synonymous_variant	10385	exon8			CTTTACTGTGCCT	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.1431T>C	6.37:g.26393054T>C		Somatic	26	2		WXS	Illumina HiSeq		40	8	NM_006995	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Silent	SNP	ENST00000356709.4	37	CCDS4606.1																																																																																			.		0.562	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
EPN2	22905	ucsc.edu;bcgsc.ca	37	17	19186722	19186722	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr17:19186722G>T	ENST00000314728.5	+	3	774	c.290G>T	c.(289-291)cGg>cTg	p.R97L	EPN2_ENST00000571254.1_Missense_Mutation_p.R97L|EPN2_ENST00000395620.2_Missense_Mutation_p.R97L|EPN2_ENST00000347697.2_Missense_Mutation_p.R97L|EPN2_ENST00000395618.3_Intron|EPN2_ENST00000575595.1_Intron|EPN2_ENST00000395626.1_Missense_Mutation_p.R97L	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	97	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CAGCAGTGCCGGGAGAACATC	0.557																																					p.R97L													.	EPN2	52	0			c.G290T						.						91.0	73.0	79.0					17																	19186722		2203	4300	6503	SO:0001583	missense	22905	exon3			AGTGCCGGGAGAA	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.290G>T	17.37:g.19186722G>T	ENSP00000320543:p.Arg97Leu	Somatic	39	0		WXS	Illumina HiSeq		32	4	NM_148921	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311071	0.81358	.	.	ENSG00000072134	ENST00000347697;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.34	4.14	0.48551	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.099558	0.64402	D	0.000003	T	0.57770	0.2076	M	0.85197	2.74	0.40232	D	0.977858	D;D;P;P;D;P	0.58970	0.967;0.984;0.537;0.94;0.967;0.531	B;P;B;B;B;B	0.53549	0.324;0.729;0.287;0.324;0.324;0.212	T	0.65269	-0.6209	10	0.87932	D	0	-13.3618	3.9264	0.09265	0.3356:0.0:0.6644:0.0	.	97;97;97;97;97;97	Q52LD0;B7ZKM5;E9PBC1;E7EMC3;E9PBC2;O95208	.;.;.;.;.;EPN2_HUMAN	L	97	ENSP00000261495:R97L;ENSP00000320543:R97L;ENSP00000378990:R97L;ENSP00000378982:R97L;ENSP00000378988:R97L	ENSP00000320543:R97L	R	+	2	0	EPN2	19127315	1.000000	0.71417	0.919000	0.36401	0.772000	0.43724	6.298000	0.72763	2.663000	0.90544	0.561000	0.74099	CGG	.		0.557	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964	
GRIN2D	2906	ucsc.edu;bcgsc.ca	37	19	48925062	48925062	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:48925062G>T	ENST00000263269.3	+	10	2200	c.2112G>T	c.(2110-2112)caG>caT	p.Q704H		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	704					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCCAGGAGCAGTACCCGCCCC	0.587																																					p.Q704H													.	GRIN2D	76	0			c.G2112T						.						65.0	61.0	62.0					19																	48925062		2203	4300	6503	SO:0001583	missense	2906	exon10			GGAGCAGTACCCG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2112G>T	19.37:g.48925062G>T	ENSP00000263269:p.Gln704His	Somatic	36	0		WXS	Illumina HiSeq		32	4	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777782	0.31502	.	.	ENSG00000105464	ENST00000263269	T	0.12984	2.63	4.57	0.714	0.18180	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.05456	0.0144	N	0.12182	0.205	0.40737	D	0.982792	B	0.18610	0.029	B	0.12156	0.007	T	0.37267	-0.9713	10	0.15952	T	0.53	.	4.9931	0.14224	0.3449:0.1555:0.4996:0.0	.	704	O15399	NMDE4_HUMAN	H	704	ENSP00000263269:Q704H	ENSP00000263269:Q704H	Q	+	3	2	GRIN2D	53616874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.714000	0.25808	0.411000	0.25702	0.655000	0.94253	CAG	.		0.587	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
RBMX	27316	ucsc.edu	37	X	135958704	135958704	+	Missense_Mutation	SNP	G	G	C	rs112089728		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chrX:135958704G>C	ENST00000320676.7	-	5	653	c.499C>G	c.(499-501)Cct>Gct	p.P167A	RBMX_ENST00000431446.3_Intron|RBMX_ENST00000496459.2_5'Flank|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000565438.1_Missense_Mutation_p.P39A|RBMX_ENST00000570135.1_Missense_Mutation_p.P32A|RBMX_ENST00000562646.1_Missense_Mutation_p.P167A	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	167					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P167A(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GGTCCTGAAGGTGCAGATCTC	0.453																																					p.P167A													.	RBMX	149	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C499G						.						122.0	109.0	113.0					X																	135958704		2203	4300	6503	SO:0001583	missense	27316	exon5			CTGAAGGTGCAGA		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.499C>G	X.37:g.135958704G>C	ENSP00000359645:p.Pro167Ala	Somatic	34	4		WXS	Illumina HiSeq		52	14	NM_002139	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	19.40	3.820034	0.71028	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.79247	-1.25	5.52	5.52	0.82312	.	0.000000	0.85682	U	0.000000	T	0.74306	0.3699	L	0.53561	1.675	0.09310	P	0.999999244383	P;B	0.38335	0.627;0.162	B;B	0.32980	0.156;0.037	T	0.80574	-0.1322	9	0.62326	D	0.03	.	18.5809	0.91171	0.0:0.0:1.0:0.0	.	167;154	P38159;Q8N8Y7	HNRPG_HUMAN;.	A	167;154	ENSP00000359645:P167A	ENSP00000359645:P167A	P	-	1	0	RBMX	135786370	1.000000	0.71417	0.984000	0.44739	0.984000	0.73092	8.740000	0.91579	2.331000	0.79229	0.592000	0.82586	CCT	.		0.453	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
CEP104	9731	bcgsc.ca	37	1	3750520	3750520	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:3750520G>A	ENST00000378230.3	-	12	1889	c.1565C>T	c.(1564-1566)aCa>aTa	p.T522I	CEP104_ENST00000460038.1_5'UTR	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa	522						centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						ACAGTGAGCTGTTTCAAGTTT	0.403																																					p.T522I													.	CEP104	79	0			c.C1565T						.						130.0	122.0	124.0					1																	3750520		2203	4300	6503	SO:0001583	missense	9731	exon12			TGAGCTGTTTCAA	AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.1565C>T	1.37:g.3750520G>A	ENSP00000367476:p.Thr522Ile	Somatic	77	0		WXS	Illumina HiSeq	Phase_1	54	4	NM_014704	Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Missense_Mutation	SNP	ENST00000378230.3	37	CCDS30571.1	.	.	.	.	.	.	.	.	.	.	G	3.015	-0.203004	0.06219	.	.	ENSG00000116198	ENST00000378230	T	0.27402	1.67	5.03	5.03	0.67393	Armadillo-like helical (1);Armadillo-type fold (1);	0.182863	0.47852	D	0.000204	T	0.50820	0.1638	L	0.58302	1.8	0.80722	D	1	P;D	0.89917	0.774;1.0	B;D	0.87578	0.211;0.998	T	0.37619	-0.9698	10	0.20046	T	0.44	.	17.3632	0.87357	0.0:0.0:1.0:0.0	.	522;522	O60308-3;O60308	.;CE104_HUMAN	I	522	ENSP00000367476:T522I	ENSP00000367476:T522I	T	-	2	0	CEP104	3740380	0.997000	0.39634	0.018000	0.16275	0.069000	0.16628	5.021000	0.64072	2.329000	0.79093	0.467000	0.42956	ACA	.		0.403	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009747.3	NM_014704	
LOC100129138	100129138	bcgsc.ca	37	1	104615792	104615792	+	lincRNA	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:104615792C>T	ENST00000418362.1	+	0	148					NR_033990.1																						AGGCGGGGGCCGGAGAGGACA	0.577																																					.													.	.	.	0			.						.																																					0	.			GGGGGCCGGAGAG																													1.37:g.104615792C>T		Somatic	22	0		WXS	Illumina HiSeq	Phase_1	27	8	.		RNA	SNP	ENST00000418362.1	37																																																																																				.		0.577	RP11-364B6.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000030377.1		
OR2AJ1	127608	bcgsc.ca	37	1	248098009	248098009	+	Silent	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr1:248098009A>G	ENST00000318244.3	+	1	939	c.939A>G	c.(937-939)aaA>aaG	p.K313K	OR2L13_ENST00000366478.2_5'Flank			Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						TGCACAAAAAAATGAATAGGA	0.363																																					.													.	.	.	0			.						.																																			SO:0001819	synonymous_variant	127608	.			CAAAAAAATGAAT			1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.939A>G	1.37:g.248098009A>G		Somatic	46	0		WXS	Illumina HiSeq	Phase_1	38	10	.		Silent	SNP	ENST00000318244.3	37																																																																																				.		0.363	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000096863.1	NG_004652	
LMAN2L	81562	bcgsc.ca	37	2	97373516	97373516	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr2:97373516G>T	ENST00000264963.4	-	7	861	c.839C>A	c.(838-840)cCa>cAa	p.P280Q	LMAN2L_ENST00000426463.2_Missense_Mutation_p.P146Q|LMAN2L_ENST00000377079.4_Missense_Mutation_p.P291Q|LMAN2L_ENST00000534882.1_Missense_Mutation_p.P135Q|FER1L5_ENST00000457909.1_RNA|LMAN2L_ENST00000537039.1_Missense_Mutation_p.P142Q	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	280					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						TTCCTCTTCTGGGGTTCTCTC	0.468																																					p.P291Q													.	LMAN2L	27	0			c.C872A						.						109.0	109.0	109.0					2																	97373516		2203	4300	6503	SO:0001583	missense	81562	exon8			TCTTCTGGGGTTC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.839C>A	2.37:g.97373516G>T	ENSP00000264963:p.Pro280Gln	Somatic	64	0		WXS	Illumina HiSeq	Phase_1	48	4	NM_001142292	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	37	CCDS2023.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212604	0.39102	.	.	ENSG00000114988	ENST00000264963;ENST00000377079;ENST00000426463;ENST00000537039;ENST00000534882	T;T;T;T;T	0.77620	0.88;0.87;-1.11;-1.06;-1.1	5.62	4.68	0.58851	Concanavalin A-like lectin/glucanase, subgroup (1);	0.268725	0.35615	N	0.003093	T	0.70640	0.3247	L	0.57536	1.79	0.45097	D	0.998115	B;B;B;B;B	0.27823	0.19;0.175;0.19;0.015;0.167	B;B;B;B;B	0.24006	0.038;0.035;0.038;0.005;0.05	T	0.68526	-0.5385	10	0.40728	T	0.16	.	9.0612	0.36436	0.0806:0.1512:0.7682:0.0	.	135;153;146;291;280	B4DVH1;B4DI83;B4DSH3;Q9H0V9-2;Q9H0V9	.;.;.;.;LMA2L_HUMAN	Q	280;291;146;142;135	ENSP00000264963:P280Q;ENSP00000366280:P291Q;ENSP00000396391:P146Q;ENSP00000441701:P142Q;ENSP00000438501:P135Q	ENSP00000264963:P280Q	P	-	2	0	LMAN2L	96737243	0.995000	0.38212	1.000000	0.80357	0.985000	0.73830	2.247000	0.43151	2.633000	0.89246	0.655000	0.94253	CCA	.		0.468	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
TMEM184C	55751	bcgsc.ca	37	4	148539206	148539206	+	Silent	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr4:148539206C>T	ENST00000296582.3	+	1	673	c.99C>T	c.(97-99)tgC>tgT	p.C33C	TMEM184C_ENST00000508208.1_Silent_p.C33C|RP11-425A23.1_ENST00000508072.1_RNA	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	33						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						TTCCCCTATGCGTGTGGGAAT	0.502											OREG0016353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C33C													.	TMEM184C	25	0			c.C99T						.						257.0	226.0	237.0					4																	148539206		2203	4300	6503	SO:0001819	synonymous_variant	55751	exon1			CCTATGCGTGTGG	AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.99C>T	4.37:g.148539206C>T		Somatic	94	0	1718	WXS	Illumina HiSeq	Phase_1	67	4	NM_018241	D3DP04|Q86X84|Q969I7|Q9NXM2	Silent	SNP	ENST00000296582.3	37	CCDS3770.1																																																																																			.		0.502	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1	NM_018241	
Unknown	0	bcgsc.ca	37	5	2787892	2787892	+	IGR	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:2787892G>T								C5orf38 (32384 upstream) : RP11-468D11.1 (43242 downstream)																							TTGTCCCACAGTATTGGCTGA	0.343																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CCCACAGTATTGG																													5.37:g.2787892G>T		Somatic	37	0		WXS	Illumina HiSeq	Phase_1	52	7	.		RNA	SNP		37																																																																																				.	0	0.343								
DNAH5	1767	bcgsc.ca	37	5	13830277	13830277	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:13830277C>T	ENST00000265104.4	-	37	6211	c.6107G>A	c.(6106-6108)cGt>cAt	p.R2036H		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2036	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TAGATCAATACGGTTAAATTC	0.353									Kartagener syndrome																												p.R2036H													DNAH5,colon,carcinoma,-1,1	DNAH5	868	0			c.G6107A						.						81.0	80.0	80.0					5																	13830277		2203	4300	6503	SO:0001583	missense	1767	exon37	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TCAATACGGTTAA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6107G>A	5.37:g.13830277C>T	ENSP00000265104:p.Arg2036His	Somatic	39	0		WXS	Illumina HiSeq	Phase_1	64	4	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	34	5.301820	0.95601	.	.	ENSG00000039139	ENST00000265104	T	0.15017	2.46	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.62816	0.2459	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75852	-0.3171	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2036	Q8TE73	DYH5_HUMAN	H	2036	ENSP00000265104:R2036H	ENSP00000265104:R2036H	R	-	2	0	DNAH5	13883277	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGT	.		0.353	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
SLC36A1	206358	bcgsc.ca	37	5	150853233	150853233	+	Splice_Site	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:150853233G>T	ENST00000243389.3	+	8	946		c.e8-1		SLC36A1_ENST00000520701.1_Splice_Site|SLC36A1_ENST00000521925.1_Splice_Site	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1						amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CTGTCTTTCAGAGGATCCCAG	0.443																																					.	Melanoma(151;1534 1860 12947 32979 37872)												.	SLC36A1	50	0			c.724-1G>T						.						166.0	182.0	177.0					5																	150853233		2203	4300	6503	SO:0001630	splice_region_variant	206358	exon8			CTTTCAGAGGATC	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.724-1G>T	5.37:g.150853233G>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_1	49	4	NM_078483	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Splice_Site	SNP	ENST00000243389.3	37	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.588113	0.66105	.	.	ENSG00000123643	ENST00000520701;ENST00000243389;ENST00000456739;ENST00000521925	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6685	0.91501	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC36A1	150833426	1.000000	0.71417	0.931000	0.37212	0.906000	0.53458	9.091000	0.94151	2.488000	0.83962	0.655000	0.94253	.	.		0.443	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1	NM_078483	Intron
PNLDC1	154197	bcgsc.ca	37	6	160225658	160225658	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr6:160225658G>T	ENST00000610273.1	+	6	588	c.417G>T	c.(415-417)tgG>tgT	p.W139C	PNLDC1_ENST00000392167.3_Missense_Mutation_p.W150C|PNLDC1_ENST00000609334.1_3'UTR	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	139						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTGGGAACTGGAGAGTTCGCA	0.463																																					p.W139C													.	PNLDC1	66	0			c.G417T						.						101.0	97.0	98.0					6																	160225658		2203	4300	6503	SO:0001583	missense	154197	exon6			GAACTGGAGAGTT	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.417G>T	6.37:g.160225658G>T	ENSP00000476448:p.Trp139Cys	Somatic	76	0		WXS	Illumina HiSeq	Phase_1	70	5	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344866	0.41498	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.28	5.28	0.74379	Ribonuclease H-like (1);	0.000000	0.56097	D	0.000030	T	0.54919	0.1888	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.56111	-0.8033	9	0.35671	T	0.21	.	16.0736	0.80951	0.0:0.0:1.0:0.0	.	150;139	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	C	139;150	.	ENSP00000275275:W139C	W	+	3	0	PNLDC1	160145648	1.000000	0.71417	0.853000	0.33588	0.235000	0.25334	5.988000	0.70579	2.457000	0.83068	0.655000	0.94253	TGG	.		0.463	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
Unknown	0	bcgsc.ca	37	9	45376206	45376206	+	IGR	SNP	A	A	C	rs372171742		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr9:45376206A>C								RP11-449H15.2 (163705 upstream) : RP11-187C18.5 (17638 downstream)																							TCGCGGACCAAACCAACGATG	0.527																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	441420	.			GGACCAAACCAAC																													9.37:g.45376206A>C		Somatic	51	2		WXS	Illumina HiSeq	Phase_1	41	7	.		RNA	SNP		37																																																																																				.	0	0.527								
SNX15	29907	bcgsc.ca	37	11	64799964	64799964	+	Missense_Mutation	SNP	A	A	G			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr11:64799964A>G	ENST00000377244.3	+	3	327	c.197A>G	c.(196-198)cAc>cGc	p.H66R	SNX15_ENST00000352068.5_Missense_Mutation_p.H66R|RP11-399J13.3_ENST00000301886.3_3'UTR	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	66	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						GCCTACACCCACCGCAACCTC	0.597																																					p.H66R	Esophageal Squamous(56;269 1304 3324 8253)												.	SNX15	35	0			c.A197G						.						80.0	69.0	72.0					11																	64799964		2201	4297	6498	SO:0001583	missense	29907	exon3			ACACCCACCGCAA	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.197A>G	11.37:g.64799964A>G	ENSP00000366452:p.His66Arg	Somatic	63	0		WXS	Illumina HiSeq	Phase_1	46	5	NM_147777	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.8|20.8	4.051886|4.051886	0.75960|0.75960	.|.	.|.	ENSG00000110025|ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068|ENST00000525648	T;T;T;T|.	0.39997|.	1.05;1.05;1.05;1.05|.	5.48|5.48	5.48|5.48	0.80851|0.80851	Phox homologous domain (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71719|0.71719	0.3373|0.3373	M|M	0.62266|0.62266	1.93|1.93	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.993;0.999|.	D;D;D|.	0.69824|.	0.966;0.937;0.966|.	T|T	0.75036|0.75036	-0.3459|-0.3459	10|6	0.72032|0.87932	D|D	0.01|0	-16.9879|-16.9879	13.5299|13.5299	0.61615|0.61615	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	66;66;66|.	E5KQS5;E5KQS6;Q9NRS6|.	.;.;SNX15_HUMAN|.	R|A	66;62;54;66|25	ENSP00000366452:H66R;ENSP00000437277:H62R;ENSP00000431690:H54R;ENSP00000316410:H66R|.	ENSP00000316410:H66R|ENSP00000436023:T25A	H|T	+|+	2|1	0|0	SNX15|SNX15	64556540|64556540	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	8.223000|8.223000	0.89779|0.89779	2.073000|2.073000	0.62155|0.62155	0.533000|0.533000	0.62120|0.62120	CAC|ACC	.		0.597	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
POLE	5426	bcgsc.ca	37	12	133253969	133253969	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr12:133253969C>T	ENST00000320574.5	-	8	824	c.781G>A	c.(781-783)Gat>Aat	p.D261N	POLE_ENST00000535270.1_Missense_Mutation_p.D234N	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	261					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	ACAAGGTCATCTCGGCGGGTG	0.428								DNA polymerases (catalytic subunits)																													p.D261N													.	POLE	416	0			c.G781A						.						123.0	115.0	118.0					12																	133253969		2203	4300	6503	SO:0001583	missense	5426	exon8			GGTCATCTCGGCG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.781G>A	12.37:g.133253969C>T	ENSP00000322570:p.Asp261Asn	Somatic	56	0		WXS	Illumina HiSeq	Phase_1	55	4	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625413	0.87560	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.09445	2.98;2.98;2.98;2.98	5.64	5.64	0.86602	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.20618	0.0496	L	0.50333	1.59	0.80722	D	1	P;P	0.49961	0.93;0.629	P;B	0.50825	0.651;0.229	T	0.00322	-1.1818	10	0.30078	T	0.28	.	19.7069	0.96076	0.0:1.0:0.0:0.0	.	234;261	F5H1D6;Q07864	.;DPOE1_HUMAN	N	261;272;234;41;196	ENSP00000322570:D261N;ENSP00000406383:D272N;ENSP00000445753:D234N;ENSP00000442519:D41N	ENSP00000322570:D261N	D	-	1	0	POLE	131764042	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.736000	0.84948	2.654000	0.90174	0.563000	0.77884	GAT	.		0.428	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
IPMKP1	401730	bcgsc.ca	37	13	23411988	23411988	+	IGR	SNP	A	A	C			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr13:23411988A>C								SNORD36 (34625 upstream) : RP11-363G2.4 (13923 downstream)																							GGGCTTATTAAATTTATGTGT	0.368																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	401730	.			TTATTAAATTTAT																													13.37:g.23411988A>C		Somatic	54	0		WXS	Illumina HiSeq	Phase_1	33	5	.		RNA	SNP		37																																																																																				.	0	0.368								
Unknown	0	bcgsc.ca	37	15	20450232	20450232	+	IGR	SNP	G	G	A	rs375441502		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:20450232G>A								RP11-173D3.1 (97026 upstream) : CHEK2P2 (37764 downstream)																							AGCCGGGAGCGTTCCTGTGCG	0.597																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GGGAGCGTTCCTG																													15.37:g.20450232G>A		Somatic	124	0		WXS	Illumina HiSeq	Phase_1	114	10	.		RNA	SNP		37																																																																																				.	0	0.597								
UBE2Q2	92912	bcgsc.ca	37	15	76183298	76183298	+	Missense_Mutation	SNP	G	G	A			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr15:76183298G>A	ENST00000267938.4	+	11	1354	c.972G>A	c.(970-972)atG>atA	p.M324I	UBE2Q2_ENST00000561851.1_Missense_Mutation_p.M308I|UBE2Q2_ENST00000569423.1_Missense_Mutation_p.M289I|UBE2Q2_ENST00000338677.4_Intron	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	324					protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						CGGTCATCATGCAAATAAATG	0.388																																					p.M324I													.	UBE2Q2	26	0			c.G972A						.						114.0	118.0	117.0					15																	76183298		2197	4294	6491	SO:0001583	missense	92912	exon11			CATCATGCAAATA	BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.972G>A	15.37:g.76183298G>A	ENSP00000267938:p.Met324Ile	Somatic	66	0		WXS	Illumina HiSeq	Phase_1	52	4	NM_173469	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Missense_Mutation	SNP	ENST00000267938.4	37	CCDS10286.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186081	0.57909	.	.	ENSG00000140367	ENST00000267938;ENST00000426727	T	0.35973	1.28	5.2	4.26	0.50523	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.28067	0.0692	L	0.28054	0.825	0.80722	D	1	B;B;B	0.18610	0.029;0.007;0.007	B;B;B	0.21151	0.033;0.014;0.014	T	0.04650	-1.0936	10	0.48119	T	0.1	.	13.962	0.64185	0.0:0.0:0.8471:0.1529	.	308;308;324	E9PHD0;B7Z3Q2;Q8WVN8	.;.;UB2Q2_HUMAN	I	324;308	ENSP00000267938:M324I	ENSP00000267938:M324I	M	+	3	0	UBE2Q2	73970353	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.530000	0.98051	1.141000	0.42275	0.460000	0.39030	ATG	.		0.388	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	
PIEZO2	63895	bcgsc.ca	37	18	10718203	10718203	+	Missense_Mutation	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr18:10718203C>T	ENST00000503781.3	-	34	4909	c.4910G>A	c.(4909-4911)gGa>gAa	p.G1637E	PIEZO2_ENST00000580640.1_Missense_Mutation_p.G1662E|PIEZO2_ENST00000302079.6_Missense_Mutation_p.G1637E	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	1637					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										GTTACCTGGTCCATCGGATTT	0.403																																					p.G1637E													.	.	.	0			c.G4910A						.						443.0	333.0	367.0					18																	10718203		692	1591	2283	SO:0001583	missense	63895	exon34			CCTGGTCCATCGG	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.4910G>A	18.37:g.10718203C>T	ENSP00000421377:p.Gly1637Glu	Somatic	35	0		WXS	Illumina HiSeq	Phase_1	35	4	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37		.	.	.	.	.	.	.	.	.	.	C	14.83	2.653258	0.47362	.	.	ENSG00000154864	ENST00000302079	T	0.71934	-0.61	5.38	5.38	0.77491	.	.	.	.	.	T	0.75459	0.3852	L	0.43923	1.385	0.80722	D	1	.	.	.	.	.	.	T	0.71424	-0.4597	7	0.32370	T	0.25	.	19.5036	0.95105	0.0:1.0:0.0:0.0	.	.	.	.	E	1637	ENSP00000303316:G1637E	ENSP00000303316:G1637E	G	-	2	0	FAM38B	10708203	0.998000	0.40836	0.999000	0.59377	0.996000	0.88848	4.910000	0.63321	2.672000	0.90937	0.650000	0.86243	GGA	.		0.403	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
ZNF534	147658	bcgsc.ca	37	19	52941105	52941105	+	Missense_Mutation	SNP	G	G	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr19:52941105G>T	ENST00000332323.6	+	4	492	c.431G>T	c.(430-432)gGa>gTa	p.G144V	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.G131V	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						AATATTTATGGATGTAAGCAT	0.338																																					p.G144V													.	ZNF534	105	0			c.G431T						.						84.0	75.0	78.0					19																	52941105		1568	3581	5149	SO:0001583	missense	147658	exon4			TTTATGGATGTAA	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.431G>T	19.37:g.52941105G>T	ENSP00000327538:p.Gly144Val	Somatic	45	0		WXS	Illumina HiSeq	Phase_1	47	4	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	G	8.787	0.929624	0.18131	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.06849	3.25;3.31	1.62	-1.88	0.07713	.	.	.	.	.	T	0.11324	0.0276	L	0.27053	0.805	0.09310	N	1	B;D	0.89917	0.045;1.0	B;D	0.91635	0.015;0.999	T	0.27971	-1.0058	9	0.30854	T	0.27	.	2.993	0.05989	0.5526:0.2477:0.1996:0.0	.	131;144	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	V	144;131;143	ENSP00000327538:G144V;ENSP00000391358:G131V	ENSP00000327538:G144V	G	+	2	0	ZNF534	57632917	0.000000	0.05858	0.022000	0.16811	0.291000	0.27294	0.126000	0.15769	-0.100000	0.12241	0.205000	0.17691	GGA	.		0.338	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
TMEM257	9142	bcgsc.ca	37	X	144909307	144909307	+	Silent	SNP	C	C	T			TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chrX:144909307C>T	ENST00000408967.2	+	1	380	c.112C>T	c.(112-114)Ctg>Ttg	p.L38L		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	38						integral component of membrane (GO:0016021)											AGCATCCCCACTGACTATATT	0.274																																					p.L38L													.	.	.	0			c.C112T						.						80.0	77.0	78.0					X																	144909307		2203	4300	6503	SO:0001819	synonymous_variant	9142	exon1			TCCCCACTGACTA	Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.112C>T	X.37:g.144909307C>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_1	79	4	NM_004709	Q14CW0	Silent	SNP	ENST00000408967.2	37	CCDS14681.1																																																																																			.		0.274	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
KCNMB1	3779	hgsc.bcm.edu	37	5	169805956	169805956	+	Missense_Mutation	SNP	C	C	T	rs2301149	byFrequency	TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr5:169805956C>T	ENST00000274629.4	-	4	770	c.328G>A	c.(328-330)Gtg>Atg	p.V110M	KCNIP1_ENST00000518527.1_Intron|KCNIP1_ENST00000377360.4_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	110			V -> L (in dbSNP:rs2301149).		blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	TAATTGTCCACGCTGCCTGGG	0.547																																					p.E110K		.											KCNMB1,NS,carcinoma,0,1	KCNMB1	0	0			c.G328A						.						62.0	64.0	63.0					5																	169805956		2203	4300	6503	SO:0001583	missense	3779	exon4			TGTCCACGCTGCC	AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.328G>A	5.37:g.169805956C>T	ENSP00000274629:p.Val110Met	Somatic	53	0		WXS	Illumina HiSeq	.	59	3	NM_004137	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Missense_Mutation	SNP	ENST00000274629.4	37	CCDS4373.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201474	0.58234	.	.	ENSG00000145936	ENST00000274629	T	0.09445	2.98	5.17	3.03	0.35002	.	0.407302	0.25175	N	0.032575	T	0.04452	0.0122	N	0.08118	0	0.09310	P	0.99999999356255	B	0.18610	0.029	B	0.09377	0.004	T	0.30650	-0.9971	8	.	.	.	.	6.0615	0.19841	0.184:0.2949:0.5211:0.0	.	110	Q16558	KCMB1_HUMAN	M	110	ENSP00000274629:V110M	.	V	-	1	0	KCNMB1	169738534	1.000000	0.71417	0.996000	0.52242	0.461000	0.32589	1.632000	0.37102	0.580000	0.29522	-0.335000	0.08231	GTG	.		0.547	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3		
PCDH15	65217	hgsc.bcm.edu	37	10	55566583	55566583	+	Missense_Mutation	SNP	G	G	T	rs570460962		TCGA-3X-AAVE-01A-11D-A417-09	TCGA-3X-AAVE-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	57584133-036a-4eab-9c63-c0fdd134ae42	36d5f070-dd59-4be0-85b4-ce3e1cb99d06	g.chr10:55566583G>T	ENST00000373965.2	-	36	5205	c.4811C>A	c.(4810-4812)tCt>tAt	p.S1604Y	PCDH15_ENST00000414778.1_Missense_Mutation_p.S1601Y	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTTTTCAGTAGAAAATGGCCC	0.473										HNSCC(58;0.16)																											.		.											PCDH15_ENST00000414778,NS,carcinoma,0,1	PCDH15_ENST00000414778	0	0			.						.						279.0	256.0	263.0					10																	55566583		1568	3582	5150	SO:0001583	missense	65217	p.S1604Y			TCAGTAGAAAATG	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4811C>A	10.37:g.55566583G>T	ENSP00000363076:p.Ser1604Tyr	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	38	2	.	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000373965.2	37		.	.	.	.	.	.	.	.	.	.	G	14.52	2.559630	0.45590	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746	T;T	0.60040	0.22;0.26	5.71	5.71	0.89125	.	.	.	.	.	T	0.55721	0.1938	L	0.60455	1.87	0.80722	D	1	P;P	0.37955	0.612;0.612	B;B	0.33890	0.172;0.172	T	0.62025	-0.6941	9	0.87932	D	0	.	17.6362	0.88123	0.0:0.0:1.0:0.0	.	1595;1601	C6ZEF7;C9J4F3	.;.	Y	1604;1601;1597	ENSP00000363076:S1604Y;ENSP00000410304:S1601Y	ENSP00000363076:S1604Y	S	-	2	0	PCDH15	55236589	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.031000	0.76491	2.699000	0.92147	0.655000	0.94253	TCT	.		0.473	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	NM_033056	
