#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CREB3L4	148327	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	153946097	153946099	+	Splice_Site	DEL	TTC	TTC	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:153946097_153946099delTTC	ENST00000368607.3	+	9	1165_1167	c.899_901delTTC	c.(898-903)attctt>att	p.L302del	CREB3L4_ENST00000368603.1_Splice_Site_p.L302del|JTB_ENST00000471173.1_5'Flank|CREB3L4_ENST00000468845.1_3'UTR|CREB3L4_ENST00000271889.4_Splice_Site_p.L302del|CREB3L4_ENST00000405694.3_Splice_Site_p.L155del|CREB3L4_ENST00000368600.3_Splice_Site_p.L282del	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	302					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCCTCCCAGATTCTTCTTTTTTC	0.557																																					p.300_300del		.											.	.	.	0			c.898_900del						.			0,4260		0,0,2130						4.9	1.0			30	12,8242		4,4,4119	no	coding-near-splice	CREB3L4	NM_130898.2		4,4,6249	A1A1,A1R,RR		0.1454,0.0,0.0959				12,12502				SO:0001630	splice_region_variant	148327	exon9			CCCAGATTCTTCT	AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.898-1TTC>-	1.37:g.153946100_153946102delTTC		Somatic	29	0		WXS	Illumina HiSeq	.	35	11	NM_001255979	D3DV62|Q5T4L0|Q86YW6	In_Frame_Del	DEL	ENST00000368607.3	37	CCDS1056.1																																																																																			.		0.557	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	In_Frame_Del
MAOB	4129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	43652720	43652720	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:43652720C>T	ENST00000378069.4	-	8	1021	c.874G>A	c.(874-876)Ggt>Agt	p.G292S	MAOB_ENST00000536181.1_Missense_Mutation_p.G276S|MAOB_ENST00000538942.1_Missense_Mutation_p.G276S	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	292					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	ATGACTGAACCCAAAGGCACA	0.398																																					p.G292S		.											.	.	.	0			c.G874A						.						98.0	83.0	88.0					X																	43652720		2203	4300	6503	SO:0001583	missense	4129	exon8			CTGAACCCAAAGG		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.874G>A	X.37:g.43652720C>T	ENSP00000367309:p.Gly292Ser	Somatic	90	0		WXS	Illumina HiSeq	.	56	13	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	34	5.385803	0.95967	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	T;T;T	0.55930	0.49;0.49;0.49	5.97	5.97	0.96955	Amine oxidase (1);	0.000000	0.85682	D	0.000000	T	0.78742	0.4331	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81897	-0.0722	10	0.66056	D	0.02	-14.7718	19.371	0.94484	0.0:1.0:0.0:0.0	.	276;292	B7Z5H3;P27338	.;AOFB_HUMAN	S	292;276;276	ENSP00000367309:G292S;ENSP00000441613:G276S;ENSP00000442240:G276S	ENSP00000367309:G292S	G	-	1	0	MAOB	43537664	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.326000	0.79133	2.527000	0.85204	0.600000	0.82982	GGT	.		0.398	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350734	50350734	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:50350734C>T	ENST00000289292.7	-	6	3691	c.3408G>A	c.(3406-3408)gaG>gaA	p.E1136E	SHROOM4_ENST00000376020.2_Silent_p.E1136E|SHROOM4_ENST00000460112.3_Silent_p.E1020E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1136	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cttcttcctcctcctcctcct	0.567																																					p.E1136E		.											.	.	.	0			c.G3408A						.						15.0	14.0	15.0					X																	50350734		2203	4298	6501	SO:0001819	synonymous_variant	57477	exon6			TTCCTCCTCCTCC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3408G>A	X.37:g.50350734C>T		Somatic	18	0		WXS	Illumina HiSeq	.	11	4	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.567	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
OTOP1	133060	hgsc.bcm.edu	37	4	4228425	4228425	+	Missense_Mutation	SNP	T	T	C	rs78657691		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:4228425T>C	ENST00000296358.4	-	1	191	c.167A>G	c.(166-168)aAa>aGa	p.K56R		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	56					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTCGGCCAGTTTCTGTGGGAC	0.741																																					p.K56R		.											OTOP1,caecum,carcinoma,0,1	OTOP1	0	0			c.A167G						.																																			SO:0001583	missense	133060	exon1			GCCAGTTTCTGTG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.167A>G	4.37:g.4228425T>C	ENSP00000296358:p.Lys56Arg	Somatic	7	2		WXS	Illumina HiSeq	.	8	2	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	T	15.92	2.976461	0.53720	.	.	ENSG00000163982	ENST00000296358	T	0.13420	2.59	4.08	2.78	0.32641	.	0.000000	0.85682	U	0.000000	T	0.24812	0.0602	L	0.39898	1.24	0.53005	D	0.99996	D	0.89917	1.0	D	0.80764	0.994	T	0.01561	-1.1324	10	0.87932	D	0	.	10.0264	0.42074	0.0:0.0:0.1696:0.8304	.	56	Q7RTM1	OTOP1_HUMAN	R	56	ENSP00000296358:K56R	ENSP00000296358:K56R	K	-	2	0	OTOP1	4279326	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	4.318000	0.59190	1.490000	0.48466	0.352000	0.21897	AAA	.		0.741	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
FNBP4	23360	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	47744682	47744682	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:47744682G>T	ENST00000263773.5	-	15	2663	c.2651C>A	c.(2650-2652)aCt>aAt	p.T884N		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	884						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						TGAGGGAGCAGTCACTCCAAT	0.542																																					p.T884N		.											.	.	.	0			c.C2651A						.						78.0	80.0	79.0					11																	47744682		2080	4202	6282	SO:0001583	missense	23360	exon15			GGAGCAGTCACTC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2651C>A	11.37:g.47744682G>T	ENSP00000263773:p.Thr884Asn	Somatic	42	0		WXS	Illumina HiSeq	.	33	4	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083652	0.76642	.	.	ENSG00000109920	ENST00000263773	T	0.35421	1.31	5.21	5.21	0.72293	.	0.291643	0.38778	N	0.001579	T	0.39462	0.1079	L	0.56769	1.78	0.34892	D	0.74564	P	0.48764	0.915	B	0.42062	0.374	T	0.58934	-0.7548	10	0.62326	D	0.03	-8.0015	16.927	0.86179	0.0:0.0:1.0:0.0	.	884	Q8N3X1	FNBP4_HUMAN	N	884	ENSP00000263773:T884N	ENSP00000263773:T884N	T	-	2	0	FNBP4	47701258	1.000000	0.71417	0.915000	0.36163	0.932000	0.56968	6.125000	0.71627	2.435000	0.82474	0.555000	0.69702	ACT	.		0.542	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
FAT3	120114	hgsc.bcm.edu	37	11	92087946	92087946	+	Missense_Mutation	SNP	G	G	T	rs374699170		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:92087946G>T	ENST00000298047.6	+	1	2685	c.2668G>T	c.(2668-2670)Gac>Tac	p.D890Y	FAT3_ENST00000541502.1_Missense_Mutation_p.D890Y|FAT3_ENST00000525166.1_Missense_Mutation_p.D740Y|FAT3_ENST00000409404.2_Missense_Mutation_p.D890Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	890	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTATGTAGCCGACCAGTTGGA	0.433										TCGA Ovarian(4;0.039)																											p.D890Y		.											FAT3_ENST00000409404,NS,carcinoma,0,2	FAT3_ENST00000409404	0	0			c.G2668T						.						103.0	98.0	100.0					11																	92087946		1911	4129	6040	SO:0001583	missense	120114	exon1			GTAGCCGACCAGT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2668G>T	11.37:g.92087946G>T	ENSP00000298047:p.Asp890Tyr	Somatic	39	0		WXS	Illumina HiSeq	.	26	2	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	16.68	3.190301	0.58017	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.52295	4.65;4.65;0.67;4.65	5.37	5.37	0.77165	.	.	.	.	.	T	0.63604	0.2525	L	0.49126	1.545	0.49299	D	0.999778	D	0.76494	0.999	D	0.67725	0.953	T	0.64542	-0.6383	9	0.59425	D	0.04	.	18.103	0.89512	0.0:0.0:1.0:0.0	.	890	Q8TDW7-3	.	Y	890;890;890;740	ENSP00000298047:D890Y;ENSP00000387040:D890Y;ENSP00000443786:D890Y;ENSP00000432586:D740Y	ENSP00000298047:D890Y	D	+	1	0	FAT3	91727594	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.954000	0.87848	2.526000	0.85167	0.467000	0.42956	GAC	.		0.433	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
DIAPH3	81624	hgsc.bcm.edu;bcgsc.ca	37	13	60498918	60498918	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr13:60498918G>T	ENST00000400324.4	-	18	2381	c.2161C>A	c.(2161-2163)Cag>Aag	p.Q721K	DIAPH3_ENST00000267215.4_Missense_Mutation_p.Q721K|DIAPH3_ENST00000400330.1_Missense_Mutation_p.Q721K|DIAPH3_ENST00000400319.1_Missense_Mutation_p.Q651K|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Missense_Mutation_p.Q675K|DIAPH3_ENST00000377908.2_Missense_Mutation_p.Q710K	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	721	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CAAAGGTTCTGGGCAATTTTA	0.279																																					p.Q721K		.											.	.	.	0			c.C2161A						.						46.0	47.0	47.0					13																	60498918		1781	4047	5828	SO:0001583	missense	81624	exon18			GGTTCTGGGCAAT	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2161C>A	13.37:g.60498918G>T	ENSP00000383178:p.Gln721Lys	Somatic	71	0		WXS	Illumina HiSeq	.	76	4	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703346	0.88924	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04	5.67	5.67	0.87782	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.55545	0.1927	M	0.88979	2.995	0.54753	D	0.999986	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.97110	0.987;1.0;0.994	T	0.62992	-0.6736	10	0.87932	D	0	.	18.3448	0.90318	0.0:0.0:1.0:0.0	.	458;458;721	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	K	721;721;710;675;651;710;651;675;721;458;721	ENSP00000383178:Q721K;ENSP00000383184:Q721K;ENSP00000367141:Q710K;ENSP00000383173:Q651K;ENSP00000383174:Q675K;ENSP00000267215:Q721K	ENSP00000267214:Q458K	Q	-	1	0	DIAPH3	59396919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.875000	0.75551	2.660000	0.90430	0.650000	0.86243	CAG	.		0.279	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
OR4C15	81309	hgsc.bcm.edu	37	11	55321858	55321858	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:55321858C>A	ENST00000314644.2	+	1	76	c.76C>A	c.(76-78)Caa>Aaa	p.Q26K		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TATGATACCACAAATTGATCT	0.343										HNSCC(20;0.049)																											p.Q26K		.											.	.	.	0			c.C76A						.						148.0	147.0	147.0					11																	55321858		2201	4296	6497	SO:0001583	missense	81309	exon1			ATACCACAAATTG	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.76C>A	11.37:g.55321858C>A	ENSP00000324958:p.Gln26Lys	Somatic	40	0		WXS	Illumina HiSeq	.	34	2	NM_001001920	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	C	7.210	0.595276	0.13875	.	.	ENSG00000181939	ENST00000314644	T	0.00000	9.93	4.85	-1.79	0.07932	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.01185	-1.1425	6	0.87932	D	0	.	5.1602	0.15056	0.0:0.3872:0.1656:0.4472	.	.	.	.	K	26	ENSP00000324958:Q26K	ENSP00000324958:Q26K	Q	+	1	0	OR4C15	55078434	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.315000	0.01124	-0.188000	0.10499	-0.532000	0.04303	CAA	.		0.343	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
RFX4	5992	hgsc.bcm.edu	37	12	107103190	107103190	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:107103190C>T	ENST00000392842.1	+	9	1330	c.916C>T	c.(916-918)Cga>Tga	p.R306*	RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Nonsense_Mutation_p.R315*|RFX4_ENST00000229387.5_Nonsense_Mutation_p.R212*	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	306					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R306*(1)|p.R315*(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						AGAAAACTTGCGAAACATCAA	0.398																																					p.R315X		.											RFX4_ENST00000357881,NS,carcinoma,0,5	RFX4_ENST00000357881	0	2	Substitution - Nonsense(2)	large_intestine(2)	c.C943T						.						86.0	75.0	79.0					12																	107103190		2203	4300	6503	SO:0001587	stop_gained	5992	exon9			AACTTGCGAAACA	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.916C>T	12.37:g.107103190C>T	ENSP00000376585:p.Arg306*	Somatic	53	0		WXS	Illumina HiSeq	.	46	2	NM_001206691	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Nonsense_Mutation	SNP	ENST00000392842.1	37	CCDS9106.1	.	.	.	.	.	.	.	.	.	.	C	39	7.428677	0.98279	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774;ENST00000551640;ENST00000229387	.	.	.	5.59	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-8.515	15.4125	0.74937	0.1443:0.8557:0.0:0.0	.	.	.	.	X	306;315;315;251;212	.	ENSP00000229387:R212X	R	+	1	2	RFX4	105627320	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	2.987000	0.49378	1.294000	0.44707	0.650000	0.86243	CGA	.		0.398	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491	
NOS1	4842	hgsc.bcm.edu	37	12	117660627	117660627	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:117660627G>A	ENST00000338101.4	-	26	3974	c.3970C>T	c.(3970-3972)Caa>Taa	p.Q1324*	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Nonsense_Mutation_p.Q1290*			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ATCTTGGATTGCCGGCACCCG	0.572																																					p.Q1324X	Esophageal Squamous(162;1748 2599 51982 52956)	.											NOS1,middle_lobe,carcinoma,0,1	NOS1	0	0			c.C3970T						.						101.0	102.0	102.0					12																	117660627		1946	4123	6069	SO:0001587	stop_gained	4842	exon27			TGGATTGCCGGCA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3970C>T	12.37:g.117660627G>A	ENSP00000337459:p.Gln1324*	Somatic	58	0		WXS	Illumina HiSeq	.	36	2	NM_001204218		Nonsense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	47	13.880061	0.99768	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	.	.	.	3.98	3.98	0.46160	.	0.059761	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-20.1743	12.5133	0.56017	0.0:0.1681:0.8319:0.0	.	.	.	.	X	1185;1290;1324	.	ENSP00000320758:Q1290X	Q	-	1	0	NOS1	116145010	1.000000	0.71417	0.979000	0.43373	0.993000	0.82548	6.284000	0.72652	2.209000	0.71365	0.655000	0.94253	CAA	.		0.572	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
HSF4	3299	hgsc.bcm.edu	37	16	67200473	67200473	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr16:67200473C>A	ENST00000521374.1	+	6	574	c.574C>A	c.(574-576)Ctc>Atc	p.L192I	HSF4_ENST00000421453.1_Missense_Mutation_p.L192I|HSF4_ENST00000517867.1_3'UTR|HSF4_ENST00000584272.1_Missense_Mutation_p.L192I|HSF4_ENST00000264009.8_Missense_Mutation_p.L192I			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	192	Hydrophobic repeat HR-A/B.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.L192F(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GATCCAGTGTCTCTTTGGGCC	0.562																																					p.L192I		.											HSF4,NS,carcinoma,0,1	HSF4	0	1	Substitution - Missense(1)	cervix(1)	c.C574A						.						56.0	63.0	61.0					16																	67200473		1909	4136	6045	SO:0001583	missense	3299	exon8			CAGTGTCTCTTTG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.574C>A	16.37:g.67200473C>A	ENSP00000430947:p.Leu192Ile	Somatic	47	0		WXS	Illumina HiSeq	.	39	2	NM_001538	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.88|16.88	3.244485|3.244485	0.59103|0.59103	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374;ENST00000517729|ENST00000517750	.|.	.|.	.|.	4.43|4.43	4.43|4.43	0.53597|0.53597	.|.	0.176099|.	0.42964|.	D|.	0.000630|.	T|T	0.58264|0.58264	0.2110|0.2110	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	P;D|.	0.56521|.	0.663;0.976|.	B;P|.	0.50049|.	0.403;0.629|.	T|T	0.55354|0.55354	-0.8154|-0.8154	9|5	0.46703|.	T|.	0.11|.	-14.9759|-14.9759	15.7826|15.7826	0.78272|0.78272	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	192;192|.	Q9ULV5-2;Q9ULV5|.	.;HSF4_HUMAN|.	I|Y	192;192;192;192;129|38	.|.	ENSP00000264009:L192I|.	L|S	+|+	1|2	0|0	HSF4|HSF4	65757974|65757974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.806000|5.806000	0.69150|0.69150	2.255000|2.255000	0.74692|0.74692	0.563000|0.563000	0.77884|0.77884	CTC|TCT	.		0.562	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538	
IARS2	55699	hgsc.bcm.edu	37	1	220269438	220269438	+	Intron	SNP	T	T	A	rs202120344|rs201594568	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:220269438T>A	ENST00000302637.5	+	2	371				IARS2_ENST00000366922.1_Intron	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial						gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTTTTTTTTTTAAAACAGAAA	0.313													t|||	2	0.000399361	0.0	0.0	5008	,	,		16437	0.0		0.0	False		,,,				2504	0.002				.		.											.	.	.	0			.						.						29.0	31.0	30.0					1																	220269438		2200	4299	6499	SO:0001627	intron_variant	26828	.			TTTTTTTAAAACA	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.268-8T>A	1.37:g.220269438T>A		Somatic	67	0		WXS	Illumina HiSeq	.	81	4	.	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	RNA	SNP	ENST00000302637.5	37	CCDS1523.1																																																																																			0.001		0.313	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
PIK3C2G	5288	hgsc.bcm.edu	37	12	18443878	18443878	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:18443878C>A	ENST00000266497.5	+	3	889	c.851C>A	c.(850-852)tCt>tAt	p.S284Y	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.S284Y|PIK3C2G_ENST00000535651.1_Missense_Mutation_p.S284Y|RERGL_ENST00000541632.1_Intron|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.S284Y|PIK3C2G_ENST00000536967.1_3'UTR			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	284					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CAGCTCTTTTCTAAGACCAAG	0.338																																					p.S284Y		.											PIK3C2G_ENST00000433979,NS,carcinoma,0,2	PIK3C2G_ENST00000433979	0	0			c.C851A						.						65.0	60.0	62.0					12																	18443878		1825	4078	5903	SO:0001583	missense	5288	exon4			TCTTTTCTAAGAC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.851C>A	12.37:g.18443878C>A	ENSP00000266497:p.Ser284Tyr	Somatic	51	0		WXS	Illumina HiSeq	.	39	2	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093956	0.36952	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.07	3.15	0.36227	Phosphoinositide 3-kinase, ras-binding (2);	1.907450	0.02223	N	0.064183	T	0.48714	0.1515	L	0.44542	1.39	0.09310	N	1	P;P;P	0.49253	0.921;0.904;0.921	P;P;P	0.49140	0.601;0.465;0.601	T	0.39563	-0.9608	10	0.66056	D	0.02	-0.5188	9.5906	0.39543	0.0:0.7126:0.2874:0.0	.	283;284;284	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	Y	284	ENSP00000443850:S284Y;ENSP00000404845:S284Y;ENSP00000266497:S284Y;ENSP00000445381:S284Y	ENSP00000266497:S284Y	S	+	2	0	PIK3C2G	18335145	0.021000	0.18746	0.023000	0.16930	0.037000	0.13140	0.304000	0.19228	1.217000	0.43442	0.644000	0.83932	TCT	.		0.338	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
OSBP	5007	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	59361134	59361134	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:59361134G>T	ENST00000263847.1	-	9	2100	c.1621C>A	c.(1621-1623)Cag>Aag	p.Q541K	MIR3162_ENST00000581818.1_RNA	NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	541					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TTGATTTCCTGACGCAATGTC	0.458																																					p.Q541K		.											.	.	.	0			c.C1621A						.						144.0	125.0	131.0					11																	59361134		2201	4295	6496	SO:0001583	missense	5007	exon9			TTTCCTGACGCAA	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1621C>A	11.37:g.59361134G>T	ENSP00000263847:p.Gln541Lys	Somatic	49	0		WXS	Illumina HiSeq	.	40	4	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	G	37	5.986175	0.97173	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.30448	1.53	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.65943	0.2740	M	0.92122	3.275	0.80722	D	1	D	0.69078	0.997	D	0.67103	0.949	T	0.71148	-0.4677	10	0.52906	T	0.07	-25.3475	19.3923	0.94587	0.0:0.0:1.0:0.0	.	541	P22059	OSBP1_HUMAN	K	541;141	ENSP00000263847:Q541K	ENSP00000263847:Q541K	Q	-	1	0	OSBP	59117710	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.674000	0.98633	2.882000	0.98803	0.655000	0.94253	CAG	.		0.458	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
AVEN	57099	hgsc.bcm.edu	37	15	34295319	34295319	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:34295319C>T	ENST00000306730.3	-	2	488	c.359G>A	c.(358-360)cGa>cAa	p.R120Q	CHRM5_ENST00000383263.5_Intron	NM_020371.2	NP_065104.1	Q9NQS1	AVEN_HUMAN	apoptosis, caspase activation inhibitor	120					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	intracellular (GO:0005622)|membrane (GO:0016020)		p.R120Q(1)		cervix(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|stomach(1)	7		all_lung(180;1.78e-08)		all cancers(64;1.66e-15)|GBM - Glioblastoma multiforme(113;1.42e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0359)		ATCTTGATATCGATCCCAGTT	0.403																																					p.R120Q		.											AVEN,rectum,carcinoma,0,1	AVEN	0	1	Substitution - Missense(1)	large_intestine(1)	c.G359A						.						152.0	131.0	138.0					15																	34295319		2201	4298	6499	SO:0001583	missense	57099	exon2			TGATATCGATCCC	AF283508	CCDS10030.1	15q13.1	2011-10-19		2008-07-07	ENSG00000169857	ENSG00000169857			13509	protein-coding gene	gene with protein product	"""cell death regulator aven"", ""programmed cell death 12"""	605265				10949025	Standard	XM_005254563		Approved	PDCD12	uc001zhj.3	Q9NQS1	OTTHUMG00000129371	ENST00000306730.3:c.359G>A	15.37:g.34295319C>T	ENSP00000306822:p.Arg120Gln	Somatic	44	0		WXS	Illumina HiSeq	.	47	2	NM_020371		Missense_Mutation	SNP	ENST00000306730.3	37	CCDS10030.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607775	0.87258	.	.	ENSG00000169857	ENST00000306730	T	0.59502	0.26	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.77197	-0.2676	10	0.72032	D	0.01	-7.548	17.1238	0.86709	0.0:1.0:0.0:0.0	.	120	Q9NQS1	AVEN_HUMAN	Q	120	ENSP00000306822:R120Q	ENSP00000306822:R120Q	R	-	2	0	AVEN	32082611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.373000	0.66162	2.357000	0.79964	0.591000	0.81541	CGA	.		0.403	AVEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251523.2	NM_020371	
TP53BP1	7158	hgsc.bcm.edu	37	15	43714161	43714161	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:43714161C>T	ENST00000263801.3	-	19	4229	c.3977G>A	c.(3976-3978)aGc>aAc	p.S1326N	TP53BP1_ENST00000382044.4_Missense_Mutation_p.S1331N|TP53BP1_ENST00000450115.2_Missense_Mutation_p.S1331N|TP53BP1_ENST00000382039.3_Missense_Mutation_p.S1331N	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1326					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GCTTCCACTGCTGTGCATAGC	0.592								Other conserved DNA damage response genes																													p.S1331N		.											TP53BP1,colon,carcinoma,0,1	TP53BP1	0	0			c.G3992A						.						102.0	95.0	97.0					15																	43714161		2201	4298	6499	SO:0001583	missense	7158	exon19			CCACTGCTGTGCA	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3977G>A	15.37:g.43714161C>T	ENSP00000263801:p.Ser1326Asn	Somatic	38	0		WXS	Illumina HiSeq	.	42	2	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657140	0.88154	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.05382	3.5;3.5;3.45;3.5	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	L	0.27053	0.805	0.58432	D	0.999993	D;D;D;D	0.89917	0.993;0.999;1.0;1.0	D;D;D;D	0.85130	0.968;0.994;0.997;0.997	T	0.03240	-1.1057	10	0.34782	T	0.22	-9.141	20.2216	0.98326	0.0:1.0:0.0:0.0	.	1331;1326;1331;1331	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	N	1326;1331;1331;1331	ENSP00000263801:S1326N;ENSP00000371475:S1331N;ENSP00000371470:S1331N;ENSP00000393497:S1331N	ENSP00000263801:S1326N	S	-	2	0	TP53BP1	41501453	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.212000	0.58514	2.860000	0.98153	0.655000	0.94253	AGC	.		0.592	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
ARFGAP2	84364	hgsc.bcm.edu	37	11	47196591	47196591	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:47196591G>T	ENST00000524782.1	-	5	683	c.455C>A	c.(454-456)tCt>tAt	p.S152Y	ARFGAP2_ENST00000395449.3_5'UTR|ARFGAP2_ENST00000426335.2_Intron|ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000419701.2_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	152	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.S152F(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GAAGAAATCAGAGTCCTTCTT	0.473																																					p.S152Y		.											ARFGAP2,scalp,carcinoma,0,1	ARFGAP2	0	1	Substitution - Missense(1)	skin(1)	c.C455A						.						327.0	338.0	335.0					11																	47196591		2201	4298	6499	SO:0001583	missense	84364	exon5			AAATCAGAGTCCT	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.455C>A	11.37:g.47196591G>T	ENSP00000434442:p.Ser152Tyr	Somatic	44	0		WXS	Illumina HiSeq	.	34	2	NM_032389	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	ENST00000524782.1	37	CCDS7926.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.802128	0.90538	.	.	ENSG00000149182	ENST00000524782;ENST00000525398;ENST00000525314;ENST00000528444;ENST00000530596	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.52	5.52	0.82312	.	0.246709	0.42172	D	0.000751	T	0.60715	0.2290	M	0.63428	1.95	0.80722	D	1	D;P	0.54397	0.966;0.621	P;B	0.52554	0.702;0.255	T	0.64428	-0.6410	10	0.87932	D	0	-12.5763	19.4741	0.94979	0.0:0.0:1.0:0.0	.	152;152	B7Z6H9;Q8N6H7	.;ARFG2_HUMAN	Y	152;152;152;152;145	ENSP00000434442:S152Y;ENSP00000431939:S152Y;ENSP00000434809:S152Y;ENSP00000431684:S152Y;ENSP00000435488:S145Y	ENSP00000434442:S152Y	S	-	2	0	ARFGAP2	47153167	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	6.034000	0.70933	2.595000	0.87683	0.655000	0.94253	TCT	.		0.473	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350731	50350731	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:50350731C>T	ENST00000289292.7	-	6	3694	c.3411G>A	c.(3409-3411)gaG>gaA	p.E1137E	SHROOM4_ENST00000376020.2_Silent_p.E1137E|SHROOM4_ENST00000460112.3_Silent_p.E1021E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1137	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cttcttcttcctcctcctcct	0.557																																					p.E1137E		.											.	.	.	0			c.G3411A						.						15.0	14.0	15.0					X																	50350731		2203	4298	6501	SO:0001819	synonymous_variant	57477	exon6			TTCTTCCTCCTCC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3411G>A	X.37:g.50350731C>T		Somatic	20	0		WXS	Illumina HiSeq	.	12	4	NM_020717	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.557	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
DPY19L2P2	349152	hgsc.bcm.edu	37	7	102918096	102918096	+	RNA	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:102918096G>A	ENST00000312132.4	-	0	680							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										CTGGAATAAAGAAAAAAAGGA	0.264																																					.		.											.	.	.	0			.						.																																					349152	.			AATAAAGAAAAAA	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102918096G>A		Somatic	76	0		WXS	Illumina HiSeq	.	66	5	.	Q8N9V4|Q8ND62	RNA	SNP	ENST00000312132.4	37																																																																																				.		0.264	DPY19L2P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347877.1	NM_182634	
NPY4R	5540	hgsc.bcm.edu	37	10	47087274	47087274	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr10:47087274G>T	ENST00000395716.1	+	2	576	c.491G>T	c.(490-492)tGg>tTg	p.W164L	NPY4R_ENST00000374312.1_Missense_Mutation_p.W164L			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	164					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)	p.W164*(1)									GTGCTCATCTGGGTCATTGCC	0.582																																					p.W164L		.											PPYR1,colon,carcinoma,0,2	PPYR1	0	1	Substitution - Nonsense(1)	ovary(1)	c.G491T						.						229.0	182.0	198.0					10																	47087274		2203	4300	6503	SO:0001583	missense	5540	exon3			TCATCTGGGTCAT		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.491G>T	10.37:g.47087274G>T	ENSP00000379066:p.Trp164Leu	Somatic	52	0		WXS	Illumina HiSeq	.	42	3	NM_005972	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	ENST00000395716.1	37	CCDS31193.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391274	0.83011	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	D;D	0.88741	-2.42;-2.42	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96420	0.8832	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97729	1.0201	10	0.87932	D	0	.	16.0236	0.80522	0.0:0.0:1.0:0.0	.	164	P50391	NPY4R_HUMAN	L	164	ENSP00000363431:W164L;ENSP00000379066:W164L	ENSP00000363431:W164L	W	+	2	0	PPYR1	46507280	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.445000	0.97587	2.464000	0.83262	0.609000	0.83330	TGG	.		0.582	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
PTPN3	5774	hgsc.bcm.edu;bcgsc.ca	37	9	112216792	112216792	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:112216792G>T	ENST00000374541.2	-	5	456	c.352C>A	c.(352-354)Cag>Aag	p.Q118K	PTPN3_ENST00000262539.3_Intron	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	118	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TGTTCTTGCTGCAGTGTGTTG	0.313																																					p.Q118K		.											.	.	.	0			c.C352A						.						151.0	157.0	155.0					9																	112216792		2203	4300	6503	SO:0001583	missense	5774	exon5			CTTGCTGCAGTGT		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.352C>A	9.37:g.112216792G>T	ENSP00000363667:p.Gln118Lys	Somatic	73	0		WXS	Illumina HiSeq	.	64	4	NM_001145368	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029708	0.75504	.	.	ENSG00000070159	ENST00000394831;ENST00000374541	T	0.77229	-1.08	5.67	5.67	0.87782	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.83741	0.5320	L	0.42008	1.315	0.80722	D	1	P;P	0.50443	0.759;0.935	P;P	0.61800	0.59;0.894	T	0.83162	-0.0098	10	0.49607	T	0.09	.	19.3642	0.94454	0.0:0.0:1.0:0.0	.	118;118	B7Z9V1;P26045	.;PTN3_HUMAN	K	118	ENSP00000363667:Q118K	ENSP00000363667:Q118K	Q	-	1	0	PTPN3	111256613	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.285000	0.78660	2.689000	0.91719	0.462000	0.41574	CAG	.		0.313	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
RGS7BP	401190	hgsc.bcm.edu;bcgsc.ca	37	5	63802565	63802565	+	Silent	SNP	C	C	T	rs555466122		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr5:63802565C>T	ENST00000334025.2	+	1	440	c.114C>T	c.(112-114)agC>agT	p.S38S	RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	38					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		GCAGGGGCAGCGGCTCCGAGA	0.592																																					p.S38S		.											RGS7BP,NS,adenoma,0,1	RGS7BP	0	0			c.C114T						.						34.0	47.0	43.0					5																	63802565		2203	4300	6503	SO:0001819	synonymous_variant	401190	exon1			GGGCAGCGGCTCC	BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.114C>T	5.37:g.63802565C>T		Somatic	152	0		WXS	Illumina HiSeq	.	121	6	NM_001029875	B7Z3X1	Silent	SNP	ENST00000334025.2	37	CCDS34170.1																																																																																			.		0.592	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368464.1	NM_001029875	
NCK2	8440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	106471558	106471558	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:106471558C>T	ENST00000233154.4	+	3	481	c.39C>T	c.(37-39)taC>taT	p.Y13Y	NCK2_ENST00000522586.1_Silent_p.Y13Y|AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000393349.2_Silent_p.Y13Y|AC009505.2_ENST00000427050.2_RNA|AC009505.2_ENST00000596418.1_RNA|NCK2_ENST00000451463.2_Silent_p.Y13Y	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	13	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						AGTGGGACTACACCGCCCAGC	0.537																																					p.Y13Y		.											.	.	.	0			c.C39T						.						92.0	90.0	90.0					2																	106471558		2203	4300	6503	SO:0001819	synonymous_variant	8440	exon2			GGACTACACCGCC	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.39C>T	2.37:g.106471558C>T		Somatic	41	0		WXS	Illumina HiSeq	.	23	5	NM_001004720	D3DVK1|Q9BWN9|Q9UIC3	Silent	SNP	ENST00000233154.4	37	CCDS33266.1																																																																																			.		0.537	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
EXOG	9941	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	38539183	38539183	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:38539183G>T	ENST00000287675.5	+	2	323	c.227G>T	c.(226-228)tGt>tTt	p.C76F	EXOG_ENST00000358249.2_5'UTR|EXOG_ENST00000422077.2_Intron	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	76					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						GAGGCAAGGTGTTACACTAAT	0.413																																					p.C76F		.											.	.	.	0			c.G227T						.						94.0	93.0	93.0					3																	38539183		2203	4300	6503	SO:0001583	missense	9941	exon2			CAAGGTGTTACAC	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.227G>T	3.37:g.38539183G>T	ENSP00000287675:p.Cys76Phe	Somatic	84	0		WXS	Illumina HiSeq	.	40	4	NM_005107	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Missense_Mutation	SNP	ENST00000287675.5	37	CCDS2680.1	.	.	.	.	.	.	.	.	.	.	G	3.850	-0.032082	0.07543	.	.	ENSG00000157036	ENST00000287675	T	0.26957	1.7	5.16	2.37	0.29283	DNA/RNA non-specific endonuclease (1);Extracellular Endonuclease, subunit A (1);	0.717335	0.14211	N	0.334076	T	0.17492	0.0420	L	0.33485	1.01	0.09310	N	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.22138	-1.0225	9	.	.	.	0.1139	8.6807	0.34207	0.3618:0.0:0.6382:0.0	.	76	Q9Y2C4	EXOG_HUMAN	F	76	ENSP00000287675:C76F	.	C	+	2	0	EXOG	38514187	0.101000	0.21875	0.068000	0.19968	0.996000	0.88848	0.350000	0.20079	0.769000	0.33313	0.563000	0.77884	TGT	.		0.413	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107	
MT-CYB	4519	hgsc.bcm.edu;broad.mit.edu	37	M	15154	15154	+	Silent	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrM:15154C>A	ENST00000361789.2	+	1	408	c.408C>A	c.(406-408)ggC>ggA	p.G136G	MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	136					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CTCCCGTGAGGCCAAATATCA	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G136G		.											.	.	.	0			c.C408A						.																																			SO:0001819	synonymous_variant	0	exon1			GTGAGGCCAAATA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.408C>A	M.37:g.15154C>A		Somatic	6	0	585	WXS	Illumina HiSeq	.	29	25	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	37																																																																																				.		0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
TRPS1	7227	hgsc.bcm.edu	37	8	116631413	116631413	+	Silent	SNP	C	C	T	rs372146914		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:116631413C>T	ENST00000220888.5	-	2	1032	c.873G>A	c.(871-873)ctG>ctA	p.L291L	TRPS1_ENST00000519674.1_Silent_p.L291L|TRPS1_ENST00000395715.3_Silent_p.L304L|TRPS1_ENST00000519076.1_Silent_p.L245L|TRPS1_ENST00000520276.1_Silent_p.L295L			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	291					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.L304L(2)|p.L291L(2)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGATGTCCTGCAGCACACCAG	0.418									Langer-Giedion syndrome																												p.L304L		.											TRPS1_ENST00000395715,NS,carcinoma,0,2	TRPS1_ENST00000395715	0	4	Substitution - coding silent(4)	lung(4)	c.G912A						.						90.0	83.0	85.0					8																	116631413		1911	4143	6054	SO:0001819	synonymous_variant	7227	exon3	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	GTCCTGCAGCACA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.873G>A	8.37:g.116631413C>T		Somatic	57	0		WXS	Illumina HiSeq	.	36	3	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37																																																																																				.		0.418	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
ZNF468	90333	hgsc.bcm.edu	37	19	53344781	53344781	+	Nonsense_Mutation	SNP	G	G	A	rs531943295	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr19:53344781G>A	ENST00000595646.1	-	4	886	c.766C>T	c.(766-768)Cga>Tga	p.R256*	ZNF468_ENST00000243639.4_3'UTR|ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000396409.4_Nonsense_Mutation_p.R203*|ZNF468_ENST00000390651.4_Nonsense_Mutation_p.R203*			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		GCAAGGTATCGCTTCTGATTA	0.383													-|||	2	0.000399361	0.0	0.0	5008	,	,		20990	0.0		0.0	False		,,,				2504	0.002				p.R256X		.											.	.	.	0			c.C766T						.						125.0	109.0	114.0					19																	53344781		2203	4300	6503	SO:0001587	stop_gained	90333	exon4			GGTATCGCTTCTG	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.766C>T	19.37:g.53344781G>A	ENSP00000470381:p.Arg256*	Somatic	76	0		WXS	Illumina HiSeq	.	52	4	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Nonsense_Mutation	SNP	ENST00000595646.1	37	CCDS33094.1	.	.	.	.	.	.	.	.	.	.	a	20.1	3.933102	0.73442	.	.	ENSG00000204604	ENST00000243639;ENST00000396409;ENST00000390651;ENST00000393865	.	.	.	1.94	-3.59	0.04583	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	0.3942	0.00415	0.4192:0.1632:0.1493:0.2683	.	.	.	.	X	256;203;203;6	.	ENSP00000243639:R256X	R	-	1	2	ZNF468	58036593	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.218000	0.09240	-0.450000	0.07107	0.174000	0.16983	CGA	.		0.383	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
SPG11	80208	hgsc.bcm.edu	37	15	44888451	44888451	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:44888451G>T	ENST00000261866.7	-	25	4280	c.4264C>A	c.(4264-4266)Caa>Aaa	p.Q1422K	SPG11_ENST00000427534.2_Missense_Mutation_p.Q1422K|SPG11_ENST00000558319.1_Missense_Mutation_p.Q1422K|SPG11_ENST00000535302.2_Missense_Mutation_p.Q1422K	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1422					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTGCAGACTTGATCGCTGTCC	0.478																																					p.Q1422K		.											SPG11,NS,lymphoid_neoplasm,0,1	SPG11	0	0			c.C4264A						.						120.0	121.0	120.0					15																	44888451		2198	4298	6496	SO:0001583	missense	80208	exon25			AGACTTGATCGCT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.4264C>A	15.37:g.44888451G>T	ENSP00000261866:p.Gln1422Lys	Somatic	46	0		WXS	Illumina HiSeq	.	35	2	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.591301	0.00864	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.77750	-1.12;-1.12;-1.12	4.93	4.0	0.46444	.	1.069680	0.07184	N	0.854537	T	0.71962	0.3402	L	0.51422	1.61	0.22961	N	0.998501	B;B;B	0.27068	0.082;0.053;0.167	B;B;B	0.28011	0.058;0.022;0.085	T	0.55055	-0.8200	10	0.09338	T	0.73	.	11.1983	0.48726	0.0:0.1849:0.8151:0.0	.	1422;1422;1422	C4B7M2;F5H3N6;Q96JI7	.;.;SPTCS_HUMAN	K	1422	ENSP00000261866:Q1422K;ENSP00000445278:Q1422K;ENSP00000396110:Q1422K	ENSP00000261866:Q1422K	Q	-	1	0	SPG11	42675743	0.636000	0.27207	0.015000	0.15790	0.074000	0.17049	3.420000	0.52735	1.276000	0.44395	0.655000	0.94253	CAA	.		0.478	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
EFCAB13	124989	hgsc.bcm.edu	37	17	45412686	45412686	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:45412686C>T	ENST00000331493.2	+	5	566	c.155C>T	c.(154-156)cCg>cTg	p.P52L	ITGB3_ENST00000560629.1_3'UTR|EFCAB13_ENST00000517484.1_Missense_Mutation_p.P52L|EFCAB13_ENST00000520802.1_Intron|ITGB3_ENST00000435993.2_3'UTR	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	52						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.P52L(1)									GAAATTTCACCGGAAATTAGG	0.303																																					p.P52L		.											C17orf57,colon,carcinoma,0,1	C17orf57	0	1	Substitution - Missense(1)	large_intestine(1)	c.C155T						.						55.0	57.0	56.0					17																	45412686		2202	4298	6500	SO:0001583	missense	124989	exon5			TTTCACCGGAAAT	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.155C>T	17.37:g.45412686C>T	ENSP00000332111:p.Pro52Leu	Somatic	82	0		WXS	Illumina HiSeq	.	57	3	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179026	0.38511	.	.	ENSG00000178852	ENST00000331493;ENST00000519772;ENST00000517484;ENST00000344176	T;T	0.75367	-0.26;-0.93	2.77	0.7	0.18099	.	1.160920	0.06802	N	0.788920	T	0.78181	0.4243	L	0.54323	1.7	0.09310	N	0.999998	D;D;D	0.76494	0.997;0.999;0.991	P;P;P	0.61477	0.623;0.889;0.485	T	0.61496	-0.7051	9	.	.	.	0.0609	3.4404	0.07461	0.2714:0.5877:0.0:0.1409	.	52;52;52	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	L	52	ENSP00000332111:P52L;ENSP00000430048:P52L	.	P	+	2	0	C17orf57	42767685	0.992000	0.36948	0.131000	0.22000	0.034000	0.12701	0.888000	0.28268	0.216000	0.20781	-0.127000	0.14921	CCG	.		0.303	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
KCNJ9	3765	hgsc.bcm.edu	37	1	160057420	160057420	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:160057420C>T	ENST00000368088.3	+	3	1237	c.995C>T	c.(994-996)tCg>tTg	p.S332L		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	332					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.S332*(1)		biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCCACACCTTCGTGCAGTGCT	0.617																																					p.S332L		.											KCNJ9,rectum,carcinoma,0,1	KCNJ9	0	1	Substitution - Nonsense(1)	large_intestine(1)	c.C995T						.						65.0	60.0	62.0					1																	160057420		2203	4300	6503	SO:0001583	missense	3765	exon3			CACCTTCGTGCAG	U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.995C>T	1.37:g.160057420C>T	ENSP00000357067:p.Ser332Leu	Somatic	21	0		WXS	Illumina HiSeq	.	37	2	NM_004983	Q5JW75	Missense_Mutation	SNP	ENST00000368088.3	37	CCDS1194.1	.	.	.	.	.	.	.	.	.	.	c	3.258	-0.151870	0.06585	.	.	ENSG00000162728	ENST00000368088	D	0.93763	-3.28	4.21	4.21	0.49690	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.076672	0.53938	D	0.000054	T	0.72534	0.3472	N	0.17723	0.515	0.09310	N	1	P	0.46064	0.872	B	0.35688	0.208	T	0.69709	-0.5072	10	0.09084	T	0.74	.	10.9489	0.47317	0.0:0.6688:0.3312:0.0	.	332	Q92806	IRK9_HUMAN	L	332	ENSP00000357067:S332L	ENSP00000357067:S332L	S	+	2	0	KCNJ9	158324044	0.000000	0.05858	0.871000	0.34182	0.907000	0.53573	0.407000	0.21049	1.909000	0.55274	0.550000	0.68814	TCG	.		0.617	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060628.1	NM_004983	
COL21A1	81578	hgsc.bcm.edu	37	6	56035527	56035527	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:56035527C>T	ENST00000244728.5	-	5	1343	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	COL21A1_ENST00000370819.1_Missense_Mutation_p.V316M|COL21A1_ENST00000535941.1_Missense_Mutation_p.V316M	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	316	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATTTTGTCCACACCATTTAAG	0.343																																					p.V316M		.											.	.	.	0			c.G946A						.						91.0	81.0	84.0					6																	56035527		1866	4101	5967	SO:0001583	missense	81578	exon5			TGTCCACACCATT	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.946G>A	6.37:g.56035527C>T	ENSP00000244728:p.Val316Met	Somatic	78	0		WXS	Illumina HiSeq	.	77	4	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758652	0.31137	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	T;T;T	0.13901	2.55;2.55;2.55	4.38	4.38	0.52667	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.268907	0.24109	N	0.041473	T	0.10078	0.0247	L	0.36672	1.1	0.80722	D	1	P;D	0.56521	0.911;0.976	P;P	0.47744	0.482;0.556	T	0.06588	-1.0818	10	0.48119	T	0.1	.	16.9495	0.86240	0.0:1.0:0.0:0.0	.	316;316	Q96P44-3;Q96P44	.;COLA1_HUMAN	M	316	ENSP00000244728:V316M;ENSP00000359855:V316M;ENSP00000444384:V316M	ENSP00000244728:V316M	V	-	1	0	COL21A1	56143486	0.531000	0.26338	1.000000	0.80357	0.918000	0.54935	1.044000	0.30329	1.982000	0.57802	0.591000	0.81541	GTG	.		0.343	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
UTRN	7402	hgsc.bcm.edu	37	6	145051568	145051568	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:145051568G>A	ENST00000367545.3	+	53	7885	c.7885G>A	c.(7885-7887)Gat>Aat	p.D2629N	UTRN_ENST00000367526.4_Missense_Mutation_p.D184N	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2629					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.D2629N(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTTCTTGGCTGATCAGCCAAT	0.448																																					p.D2629N		.											UTRN,bladder,carcinoma,0,2	UTRN	0	1	Substitution - Missense(1)	lung(1)	c.G7885A						.						84.0	90.0	88.0					6																	145051568		2203	4300	6503	SO:0001583	missense	7402	exon53			TTGGCTGATCAGC	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.7885G>A	6.37:g.145051568G>A	ENSP00000356515:p.Asp2629Asn	Somatic	40	0		WXS	Illumina HiSeq	.	41	2	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808882	0.50421	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.34472	1.36;1.36	5.41	5.41	0.78517	.	0.000000	0.50627	D	0.000114	T	0.13927	0.0337	L	0.32530	0.975	0.41217	D	0.986488	B	0.24426	0.103	B	0.27715	0.082	T	0.04128	-1.0975	10	0.09590	T	0.72	.	14.4163	0.67153	0.073:0.0:0.927:0.0	.	2629	P46939	UTRO_HUMAN	N	2629;184	ENSP00000356515:D2629N;ENSP00000356496:D184N	ENSP00000356496:D184N	D	+	1	0	UTRN	145093261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.869000	0.75521	2.559000	0.86315	0.650000	0.86243	GAT	.		0.448	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
MAP3K4	4216	hgsc.bcm.edu	37	6	161519381	161519381	+	Missense_Mutation	SNP	C	C	T	rs146403419	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:161519381C>T	ENST00000392142.4	+	17	3744	c.3596C>T	c.(3595-3597)gCt>gTt	p.A1199V	MAP3K4_ENST00000348824.7_Intron|MAP3K4_ENST00000366919.2_Intron|MAP3K4_ENST00000366920.2_Missense_Mutation_p.A1195V	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1199	Poly-Ala.			Missing (in Ref. 1; AAB68804). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		gctgctgctgctgttgctgcC	0.602													C|||	3	0.000599042	0.0023	0.0	5008	,	,		12144	0.0		0.0	False		,,,				2504	0.0				p.A1199V		.											MAP3K4_ENST00000392142,colon,carcinoma,0,12	MAP3K4_ENST00000392142	0	0			c.C3596T						.	-	VAL/ALA,	3,4403	4.2+/-10.8	0,3,2200	96.0	93.0	94.0		3596,	3.0	0.1	6	dbSNP_134	94	0,8600		0,0,4300	yes	missense,intron	MAP3K4	NM_005922.2,NM_006724.2	64,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,	1199/1609,	161519381	3,13003	2203	4300	6503	SO:0001583	missense	4216	exon17			CTGCTGCTGTTGC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3596C>T	6.37:g.161519381C>T	ENSP00000375986:p.Ala1199Val	Somatic	23	1		WXS	Illumina HiSeq	.	15	3	NM_005922	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	7.803	0.714124	0.15306	6.81E-4	0.0	ENSG00000085511	ENST00000392142;ENST00000366920	T;T	0.71341	-0.56;-0.56	3.04	3.04	0.35103	.	0.581661	0.14365	N	0.324150	T	0.32010	0.0815	N	0.14661	0.345	0.38002	D	0.934254	B;B	0.23249	0.082;0.015	B;B	0.21708	0.036;0.011	T	0.10543	-1.0625	10	0.13470	T	0.59	-3.3456	10.1934	0.43041	0.0:1.0:0.0:0.0	.	1195;1199	F5H538;Q9Y6R4	.;M3K4_HUMAN	V	1199;1195	ENSP00000375986:A1199V;ENSP00000355887:A1195V	ENSP00000355887:A1195V	A	+	2	0	MAP3K4	161439371	0.008000	0.16893	0.115000	0.21578	0.390000	0.30446	0.116000	0.15561	2.093000	0.63338	0.366000	0.22137	GCT	0.000		0.602	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
POLE	5426	hgsc.bcm.edu	37	12	133202250	133202250	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:133202250G>T	ENST00000320574.5	-	47	6681	c.6638C>A	c.(6637-6639)gCc>gAc	p.A2213D	POLE_ENST00000535270.1_Missense_Mutation_p.A2186D	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2213			A -> V (found in a colorectal sample; somatic mutation). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.A2213V(1)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CAGGGTGAAGGCCATCAGCTT	0.637								DNA polymerases (catalytic subunits)																													p.A2213D		.											POLE,colon,carcinoma,0,1	POLE	0	1	Substitution - Missense(1)	large_intestine(1)	c.C6638A						.						142.0	132.0	136.0					12																	133202250		2203	4300	6503	SO:0001583	missense	5426	exon47			GTGAAGGCCATCA		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6638C>A	12.37:g.133202250G>T	ENSP00000322570:p.Ala2213Asp	Somatic	27	0		WXS	Illumina HiSeq	.	25	2	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943953	0.73672	.	.	ENSG00000177084	ENST00000434528;ENST00000320574;ENST00000455752;ENST00000320557;ENST00000535270	T;T;T	0.22539	1.95;1.95;1.95	5.74	5.74	0.90152	.	0.102125	0.64402	D	0.000002	T	0.32675	0.0837	M	0.79926	2.475	0.54753	D	0.999983	P;P	0.43973	0.738;0.823	B;B	0.39027	0.288;0.254	T	0.26916	-1.0089	10	0.54805	T	0.06	.	19.919	0.97077	0.0:0.0:1.0:0.0	.	2213;423	Q07864;B3KS74	DPOE1_HUMAN;.	D	423;2213;2224;128;2186	ENSP00000322570:A2213D;ENSP00000406383:A2224D;ENSP00000445753:A2186D	ENSP00000322473:A128D	A	-	2	0	POLE	131712323	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.318000	0.79029	2.712000	0.92718	0.561000	0.74099	GCC	.		0.637	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
LASP1	3927	hgsc.bcm.edu;broad.mit.edu	37	17	37071356	37071356	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:37071356C>T	ENST00000318008.6	+	6	900	c.569C>T	c.(568-570)gCa>gTa	p.A190V	LASP1_ENST00000433206.2_Missense_Mutation_p.A134V|LASP1_ENST00000435347.3_Missense_Mutation_p.A190V	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	190					ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						AAGGAGCCTGCAGCCCCAGTC	0.657			T	MLL	AML																																p.A190V		.		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	.	.	0			c.C569T						.						54.0	59.0	57.0					17																	37071356		2203	4300	6503	SO:0001583	missense	3927	exon6			AGCCTGCAGCCCC		CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.569C>T	17.37:g.37071356C>T	ENSP00000325240:p.Ala190Val	Somatic	73	0		WXS	Illumina HiSeq	.	74	4	NM_006148	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	ENST00000318008.6	37	CCDS11331.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234110	0.58886	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347;ENST00000419929	T;T;T;T	0.28454	1.61;1.61;1.61;2.34	5.25	4.28	0.50868	Src homology-3 domain (1);	0.307474	0.34932	N	0.003569	T	0.21145	0.0509	L	0.29908	0.895	0.41681	D	0.989298	B;B	0.11235	0.004;0.001	B;B	0.12837	0.008;0.002	T	0.05115	-1.0905	10	0.13108	T	0.6	.	12.3807	0.55305	0.0:0.9176:0.0:0.0824	.	134;190	B4DGQ0;Q14847	.;LASP1_HUMAN	V	190;134;190;154	ENSP00000325240:A190V;ENSP00000401048:A134V;ENSP00000392853:A190V;ENSP00000391897:A154V	ENSP00000325240:A190V	A	+	2	0	LASP1	34324882	0.985000	0.35326	0.996000	0.52242	0.985000	0.73830	2.906000	0.48735	1.197000	0.43143	0.561000	0.74099	GCA	.		0.657	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	
C7	730	hgsc.bcm.edu	37	5	40945430	40945430	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr5:40945430G>T	ENST00000313164.9	+	7	1057	c.698G>T	c.(697-699)cGc>cTc	p.R233L		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	233	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TCTTCTTCACGCAGTTATACT	0.323																																					p.R233L		.											C7_ENST00000313164,NS,carcinoma,0,1	C7_ENST00000313164	0	0			c.G698T						.						129.0	122.0	124.0					5																	40945430		1858	4098	5956	SO:0001583	missense	730	exon7			CTTCACGCAGTTA	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.698G>T	5.37:g.40945430G>T	ENSP00000322061:p.Arg233Leu	Somatic	58	0		WXS	Illumina HiSeq	.	43	2	NM_000587	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733274	0.30684	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	D	0.83992	-1.79	5.15	-4.55	0.03441	Membrane attack complex component/perforin (MACPF) domain (2);	2.751520	0.01524	N	0.018474	T	0.61110	0.2321	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.17979	0.02	T	0.55315	-0.8160	10	0.10902	T	0.67	1.0461	2.8041	0.05422	0.2628:0.455:0.1592:0.1231	.	233	P10643	CO7_HUMAN	L	233	ENSP00000322061:R233L	ENSP00000322061:R233L	R	+	2	0	C7	40981187	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.503000	0.02277	-0.810000	0.04375	-0.324000	0.08512	CGC	.		0.323	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84608503	84608503	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:84608503A>G	ENST00000344803.2	+	4	3165	c.3118A>G	c.(3118-3120)Aca>Gca	p.T1040A		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1040					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATTAGATTCAACAAGCTCATT	0.438																																					p.T1040A		.											.	.	.	0			c.A3118G						.						155.0	160.0	159.0					9																	84608503		1867	4099	5966	SO:0001583	missense	389763	exon4			GATTCAACAAGCT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3118A>G	9.37:g.84608503A>G	ENSP00000341988:p.Thr1040Ala	Somatic	67	0		WXS	Illumina HiSeq	.	66	11	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	A	0.138	-1.105512	0.01828	.	.	ENSG00000214929	ENST00000344803	T	0.03635	3.86	1.36	-1.72	0.08107	.	.	.	.	.	T	0.01870	0.0059	N	0.12746	0.255	0.09310	N	1	B	0.19817	0.039	B	0.15870	0.014	T	0.46205	-0.9208	9	0.36615	T	0.2	1.134	1.4795	0.02433	0.4562:0.0:0.2308:0.3129	.	1040	Q6ZQQ2	F75D1_HUMAN	A	1040	ENSP00000341988:T1040A	ENSP00000341988:T1040A	T	+	1	0	FAM75D1	83798323	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-0.214000	0.09292	-0.446000	0.07149	0.477000	0.44152	ACA	.		0.438	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
IL24	11009	hgsc.bcm.edu	37	1	207076334	207076334	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:207076334C>T	ENST00000294984.2	+	7	825	c.551C>T	c.(550-552)gCa>gTa	p.A184V	IL24_ENST00000491169.1_3'UTR|IL24_ENST00000391929.3_Missense_Mutation_p.A185V|IL24_ENST00000367093.3_Missense_Mutation_p.A132V|FAIM3_ENST00000528654.1_5'Flank	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	184					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					GACGTAGAAGCAGCTCTGACC	0.488																																					p.A185V		.											.	.	.	0			c.C554T						.						229.0	226.0	227.0					1																	207076334		2203	4300	6503	SO:0001583	missense	11009	exon7			TAGAAGCAGCTCT	U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.551C>T	1.37:g.207076334C>T	ENSP00000294984:p.Ala184Val	Somatic	57	0		WXS	Illumina HiSeq	.	98	2	NM_001185156	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Missense_Mutation	SNP	ENST00000294984.2	37	CCDS1471.1	.	.	.	.	.	.	.	.	.	.	C	9.765	1.171183	0.21621	.	.	ENSG00000162892	ENST00000391929;ENST00000294984;ENST00000367093	T;T;T	0.18657	2.2;2.2;2.2	4.34	2.38	0.29361	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.607741	0.15719	N	0.248009	T	0.10680	0.0261	N	0.17723	0.515	0.26938	N	0.966314	B;B;B	0.31705	0.336;0.319;0.319	B;B;B	0.26416	0.048;0.069;0.069	T	0.19160	-1.0314	10	0.29301	T	0.29	.	6.2782	0.20993	0.0:0.7572:0.0:0.2428	.	132;185;184	Q2YHE5;Q53XZ7;Q13007	.;.;IL24_HUMAN	V	185;184;132	ENSP00000375795:A185V;ENSP00000294984:A184V;ENSP00000356060:A132V	ENSP00000294984:A184V	A	+	2	0	IL24	205142957	0.129000	0.22400	0.913000	0.36048	0.547000	0.35210	-0.002000	0.12924	1.017000	0.39495	0.563000	0.77884	GCA	.		0.488	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088680.2	NM_006850	
TRPV4	59341	hgsc.bcm.edu	37	12	110252313	110252313	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:110252313G>A	ENST00000418703.2	-	1	383	c.289C>T	c.(289-291)Cct>Tct	p.P97S	TRPV4_ENST00000536570.1_5'Flank|TRPV4_ENST00000541794.1_Missense_Mutation_p.P97S|TRPV4_ENST00000392719.2_Missense_Mutation_p.P97S|TRPV4_ENST00000261740.2_Missense_Mutation_p.P97S|TRPV4_ENST00000537083.1_Missense_Mutation_p.P97S|TRPV4_ENST00000536838.1_Missense_Mutation_p.P63S|TRPV4_ENST00000346520.2_Missense_Mutation_p.P97S|TRPV4_ENST00000544971.1_Missense_Mutation_p.P97S	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	97			P -> R (in DSMAC; loss of function mutation). {ECO:0000269|PubMed:22526352}.		actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TTGGGCCCAGGCACCACCGAG	0.567																																					p.P97S		.											TRPV4,NS,carcinoma,0,1	TRPV4	0	0			c.C289T						.						71.0	68.0	69.0					12																	110252313		2203	4300	6503	SO:0001583	missense	59341	exon1			GCCCAGGCACCAC	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.289C>T	12.37:g.110252313G>A	ENSP00000406191:p.Pro97Ser	Somatic	30	0		WXS	Illumina HiSeq	.	32	2	NM_001177433	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877283	0.51801	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.91351	-2.72;-2.72;-2.68;-2.83;-2.73;-2.83;-2.68;-2.71	3.68	3.68	0.42216	.	0.415319	0.26418	N	0.024484	D	0.83603	0.5290	L	0.27053	0.805	0.25104	N	0.990767	P;B;P;B;B	0.43578	0.811;0.016;0.48;0.013;0.027	B;B;B;B;B	0.40534	0.332;0.007;0.188;0.011;0.015	T	0.75736	-0.3213	10	0.32370	T	0.25	.	12.1598	0.54098	0.0:0.0:1.0:0.0	.	97;97;97;97;63	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	S	97;97;97;97;97;97;97;63	ENSP00000406191:P97S;ENSP00000261740:P97S;ENSP00000376480:P97S;ENSP00000319003:P97S;ENSP00000443611:P97S;ENSP00000442738:P97S;ENSP00000442167:P97S;ENSP00000444336:P63S	ENSP00000261740:P97S	P	-	1	0	TRPV4	108736696	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.125000	0.89590	1.615000	0.50252	0.465000	0.42564	CCT	.		0.567	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
SASS6	163786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100573425	100573425	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:100573425C>A	ENST00000287482.5	-	9	1137	c.997G>T	c.(997-999)Gat>Tat	p.D333Y	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.D166Y	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	333					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		TGGTCCTTATCCTTGATTTCC	0.343																																					p.D333Y		.											.	.	.	0			c.G997T						.						112.0	110.0	110.0					1																	100573425		2203	4300	6503	SO:0001583	missense	163786	exon9			CCTTATCCTTGAT	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.997G>T	1.37:g.100573425C>A	ENSP00000287482:p.Asp333Tyr	Somatic	39	0		WXS	Illumina HiSeq	.	30	8	NM_194292	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	37	CCDS764.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580140	0.86645	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.77877	2.26;-1.13	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.88171	0.6365	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88492	0.3076	10	0.87932	D	0	-24.4594	20.1813	0.98205	0.0:1.0:0.0:0.0	.	333	Q6UVJ0	SAS6_HUMAN	Y	333;306;166	ENSP00000287482:D333Y;ENSP00000440169:D166Y	ENSP00000287482:D333Y	D	-	1	0	SASS6	100346013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.291000	0.78721	2.763000	0.94921	0.585000	0.79938	GAT	.		0.343	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
NDUFAF6	137682	hgsc.bcm.edu	37	8	96047805	96047805	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:96047805G>T	ENST00000396124.4	+	3	443		c.e3+1		NDUFAF6_ENST00000396113.1_Splice_Site|NDUFAF6_ENST00000396111.2_Splice_Site|NDUFAF6_ENST00000542894.1_Splice_Site|NDUFAF6_ENST00000286687.4_Splice_Site	NM_152416.3	NP_689629.2	Q330K2	NDUF6_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 6						biosynthetic process (GO:0009058)|mitochondrial respiratory chain complex I assembly (GO:0032981)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	transferase activity (GO:0016740)										ACTATGGAAGGTAAAAAAAAA	0.328																																					.		.											.	.	.	0			c.420+1G>T						.						35.0	36.0	35.0					8																	96047805		1809	4064	5873	SO:0001630	splice_region_variant	137682	exon3			TGGAAGGTAAAAA	BC028166	CCDS6266.2	8q22.1	2013-10-21	2012-05-08	2012-05-08	ENSG00000156170	ENSG00000156170		"""Mitochondrial respiratory chain complex assembly factors"""	28625	protein-coding gene	gene with protein product		612392	"""chromosome 8 open reading frame 38"""	C8orf38		22019594, 23509070	Standard	NM_152416		Approved	MGC40214	uc003yhj.3	Q330K2	OTTHUMG00000150173	ENST00000396124.4:c.420+1G>T	8.37:g.96047805G>T		Somatic	132	4		WXS	Illumina HiSeq	.	155	9	NM_152416	A8MT28|A8MWF0|B4DQ45|Q8N6U6	Splice_Site	SNP	ENST00000396124.4	37	CCDS6266.2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.177662	0.78564	.	.	ENSG00000156170	ENST00000523378;ENST00000396113;ENST00000396111;ENST00000519136;ENST00000542894;ENST00000396124;ENST00000519804	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9411	0.89027	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8orf38	96116981	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.756000	0.91651	2.534000	0.85438	0.591000	0.81541	.	.		0.328	NDUFAF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316700.2	NM_152416	Intron
KRTAP13-2	337959	hgsc.bcm.edu	37	21	31744209	31744209	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr21:31744209C>T	ENST00000399889.2	-	1	348	c.323G>A	c.(322-324)cGc>cAc	p.R108H		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	108						intermediate filament (GO:0005882)		p.R108P(1)		endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						GCCCAGGGAGCGGCAGCTGCT	0.607																																					p.R108H		.											KRTAP13-2,rectum,carcinoma,0,2	KRTAP13-2	0	1	Substitution - Missense(1)	lung(1)	c.G323A						.						48.0	49.0	48.0					21																	31744209		2203	4300	6503	SO:0001583	missense	337959	exon1			AGGGAGCGGCAGC	AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.323G>A	21.37:g.31744209C>T	ENSP00000382777:p.Arg108His	Somatic	33	0		WXS	Illumina HiSeq	.	27	2	NM_181621		Missense_Mutation	SNP	ENST00000399889.2	37	CCDS13589.1	.	.	.	.	.	.	.	.	.	.	C	0.766	-0.767386	0.02974	.	.	ENSG00000182816	ENST00000399889	T	0.03358	3.96	4.48	1.15	0.20763	.	1.529090	0.04771	N	0.427941	T	0.03477	0.0100	L	0.37466	1.105	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.48293	-0.9048	10	0.13470	T	0.59	.	3.7238	0.08467	0.0:0.5126:0.1994:0.288	.	108	Q52LG2	KR132_HUMAN	H	108	ENSP00000382777:R108H	ENSP00000382777:R108H	R	-	2	0	KRTAP13-2	30666080	0.000000	0.05858	0.001000	0.08648	0.695000	0.40330	-1.349000	0.02627	0.068000	0.16574	-0.251000	0.11542	CGC	.		0.607	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128245.1		
LPP	4026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	188590442	188590442	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:188590442C>T	ENST00000312675.4	+	10	1847	c.1601C>T	c.(1600-1602)cCg>cTg	p.P534L	LPP_ENST00000543006.1_Missense_Mutation_p.P534L	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	534	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		AAATTTGCCCCGCGATGTTCT	0.522			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																p.P534L		.		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	LPP_ENST00000312675,colon,carcinoma,0,1	LPP_ENST00000312675	0	0			c.C1601T						.						130.0	122.0	125.0					3																	188590442		2203	4300	6503	SO:0001583	missense	4026	exon10			TTGCCCCGCGATG	AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1601C>T	3.37:g.188590442C>T	ENSP00000318089:p.Pro534Leu	Somatic	26	0		WXS	Illumina HiSeq	.	35	15	NM_005578	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	37	CCDS3291.1	.	.	.	.	.	.	.	.	.	.	C	34	5.293830	0.95546	.	.	ENSG00000145012	ENST00000312675;ENST00000543006	D;D	0.88509	-2.39;-2.39	5.51	5.51	0.81932	Zinc finger, LIM-type (2);	0.047447	0.85682	N	0.000000	D	0.96266	0.8782	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.97160	0.9837	10	0.87932	D	0	.	18.4152	0.90567	0.0:1.0:0.0:0.0	.	387;534	B7Z8W0;Q93052	.;LPP_HUMAN	L	534	ENSP00000318089:P534L;ENSP00000438891:P534L	ENSP00000318089:P534L	P	+	2	0	LPP	190073136	1.000000	0.71417	0.825000	0.32803	0.972000	0.66771	7.818000	0.86416	2.603000	0.88011	0.655000	0.94253	CCG	.		0.522	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578	
ALLC	55821	hgsc.bcm.edu	37	2	3744995	3744995	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:3744995G>T	ENST00000252505.3	+	10	961	c.799G>T	c.(799-801)Gca>Tca	p.A267S	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	286					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.A267T(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TTTCCGATTGGCACATCCTGG	0.373										HNSCC(21;0.051)																											p.A267S		.											ALLC,caecum,carcinoma,0,1	ALLC	0	1	Substitution - Missense(1)	large_intestine(1)	c.G799T						.						153.0	150.0	151.0					2																	3744995		1853	4098	5951	SO:0001583	missense	55821	exon10			CGATTGGCACATC	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.799G>T	2.37:g.3744995G>T	ENSP00000252505:p.Ala267Ser	Somatic	85	0		WXS	Illumina HiSeq	.	66	3	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634410	0.47049	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.6	4.71	0.59529	Allantoicase domain (1);Galactose-binding domain-like (1);	0.150433	0.64402	N	0.000020	T	0.62454	0.2429	M	0.81682	2.555	0.32579	N	0.528785	B	0.25048	0.117	B	0.31101	0.124	T	0.70532	-0.4846	9	0.51188	T	0.08	-8.6623	13.6058	0.62046	0.0:0.0:0.8435:0.1565	.	286	Q8N6M5	ALLC_HUMAN	S	267	.	ENSP00000252505:A267S	A	+	1	0	ALLC	3722870	1.000000	0.71417	0.736000	0.30914	0.640000	0.38277	5.530000	0.67141	1.328000	0.45358	0.655000	0.94253	GCA	.		0.373	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
POU1F1	5449	hgsc.bcm.edu	37	3	87311274	87311274	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:87311274C>A	ENST00000350375.2	-	4	675	c.551G>T	c.(550-552)tGc>tTc	p.C184F	POU1F1_ENST00000560656.1_Intron|POU1F1_ENST00000344265.3_Missense_Mutation_p.C210F	NM_000306.2	NP_000297.1	P28069	PIT1_HUMAN	POU class 1 homeobox 1	184	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				B cell differentiation (GO:0030183)|cell fate specification (GO:0001708)|determination of adult lifespan (GO:0008340)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear transport (GO:0051169)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|somatotropin secreting cell development (GO:0060133)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(2)	18	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		TTTCAGTTTGCATGCATTTTT	0.428																																					p.C210F		.											POU1F1_ENST00000344265,caecum,carcinoma,0,2	POU1F1_ENST00000344265	0	0			c.G629T						.						142.0	132.0	136.0					3																	87311274		2203	4300	6503	SO:0001583	missense	5449	exon4			AGTTTGCATGCAT	D10216	CCDS2919.1, CCDS46873.1	3p11.2	2011-06-20	2007-07-13		ENSG00000064835	ENSG00000064835		"""Homeoboxes / POU class"""	9210	protein-coding gene	gene with protein product	"""growth hormone factor 1"""	173110	"""POU domain class 1, transcription factor 1"""	PIT1		1956794	Standard	NM_001122757		Approved	GHF-1, POU1F1a	uc010hoj.1	P28069	OTTHUMG00000158992	ENST00000350375.2:c.551G>T	3.37:g.87311274C>A	ENSP00000263781:p.Cys184Phe	Somatic	34	0		WXS	Illumina HiSeq	.	27	2	NM_001122757	O75757|Q15132|Q15133|Q9UD34|Q9UEL3	Missense_Mutation	SNP	ENST00000350375.2	37	CCDS2919.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393568	0.62066	.	.	ENSG00000064835	ENST00000350375;ENST00000344265	D;D	0.84370	-1.84;-1.84	6.02	6.02	0.97574	POU-specific (3);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.93446	0.7909	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93317	0.6689	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	210;184	P28069-2;P28069	.;PIT1_HUMAN	F	184;210	ENSP00000263781:C184F;ENSP00000342931:C210F	ENSP00000342931:C210F	C	-	2	0	POU1F1	87393964	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	TGC	.		0.428	POU1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352827.1	NM_000306	
BCL6B	255877	hgsc.bcm.edu	37	17	6928019	6928019	+	Missense_Mutation	SNP	C	C	G	rs146207245|rs55799550	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:6928019C>G	ENST00000293805.5	+	4	793	c.701C>G	c.(700-702)tCc>tGc	p.S234C		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	234	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						GACGAGGCCTCcagcagcagc	0.592																																					p.S234C		.											.,22	.	85	0			c.C701G						.						17.0	22.0	20.0					17																	6928019		2097	4186	6283	SO:0001583	missense	255877	exon4			AGGCCTCCAGCAG	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.701C>G	17.37:g.6928019C>G	ENSP00000293805:p.Ser234Cys	Somatic	34	0		WXS	Illumina HiSeq	.	23	0	NM_181844	Q6PCB4	Missense_Mutation	SNP	ENST00000293805.5	37	CCDS42248.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854566	0.32791	.	.	ENSG00000161940	ENST00000293805	T	0.08807	3.05	5.18	4.19	0.49359	.	0.565883	0.16303	N	0.220362	T	0.06872	0.0175	N	0.22421	0.69	0.23735	N	0.996983	B	0.02656	0.0	B	0.01281	0.0	T	0.26326	-1.0106	10	0.49607	T	0.09	.	11.2513	0.49028	0.0:0.8073:0.1927:0.0	.	234	Q8N143	BCL6B_HUMAN	C	234	ENSP00000293805:S234C	ENSP00000293805:S234C	S	+	2	0	BCL6B	6868743	0.071000	0.21146	0.857000	0.33713	0.641000	0.38312	1.290000	0.33319	1.368000	0.46115	0.655000	0.94253	TCC	.		0.592	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
KIAA0825	285600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	93732013	93732013	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr5:93732013T>C	ENST00000513200.3	-	16	3161	c.3089A>G	c.(3088-3090)aAc>aGc	p.N1030S	KIAA0825_ENST00000427991.2_Missense_Mutation_p.N1030S	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	1030										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TTCCACAGTGTTTCCGTCCTC	0.368																																					p.N1030S		.											.	.	.	0			c.A3089G						.						80.0	67.0	71.0					5																	93732013		692	1591	2283	SO:0001583	missense	285600	exon17			ACAGTGTTTCCGT	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.3089A>G	5.37:g.93732013T>C	ENSP00000424618:p.Asn1030Ser	Somatic	42	0		WXS	Illumina HiSeq	.	38	8	NM_001145678	O94914|Q6ZNN2	Missense_Mutation	SNP	ENST00000513200.3	37		.	.	.	.	.	.	.	.	.	.	T	17.37	3.371573	0.61624	.	.	ENSG00000185261	ENST00000513200;ENST00000427991	T;T	0.49139	0.79;0.79	5.47	5.47	0.80525	.	.	.	.	.	T	0.65863	0.2732	M	0.66939	2.045	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66084	0.941;0.941	T	0.69548	-0.5116	9	0.72032	D	0.01	.	15.5428	0.76070	0.0:0.0:0.0:1.0	.	1030;1030	Q8IV33;C9J0Q2	K0825_HUMAN;.	S	1030	ENSP00000424618:N1030S;ENSP00000400288:N1030S	ENSP00000400288:N1030S	N	-	2	0	KIAA0825	93757769	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.866000	0.75506	2.091000	0.63221	0.533000	0.62120	AAC	.		0.368	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000254102.5	NM_173665	
ATF6	22926	hgsc.bcm.edu;bcgsc.ca	37	1	161816251	161816251	+	Silent	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:161816251G>A	ENST00000367942.3	+	10	1267	c.1200G>A	c.(1198-1200)caG>caA	p.Q400Q	ATF6_ENST00000476437.1_3'UTR	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	400					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	TGTTGGAACAGGATTCCAGGA	0.398																																					p.Q400Q		.											.	.	.	0			c.G1200A						.						89.0	88.0	88.0					1																	161816251		2203	4300	6503	SO:0001819	synonymous_variant	22926	exon10			GGAACAGGATTCC	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1200G>A	1.37:g.161816251G>A		Somatic	40	0		WXS	Illumina HiSeq	.	61	4	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Silent	SNP	ENST00000367942.3	37	CCDS1235.1																																																																																			.		0.398	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
EML6	400954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55074664	55074664	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:55074664A>T	ENST00000356458.6	+	8	1611	c.1091A>T	c.(1090-1092)aAc>aTc	p.N364I	RNU7-81P_ENST00000516698.1_RNA	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	364						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GCCCGCTGTAACATGGAAGAG	0.552																																					p.N364I		.											.	.	.	0			c.A1091T						.						68.0	55.0	59.0					2																	55074664		692	1591	2283	SO:0001583	missense	400954	exon8			GCTGTAACATGGA		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1091A>T	2.37:g.55074664A>T	ENSP00000348842:p.Asn364Ile	Somatic	44	0		WXS	Illumina HiSeq	.	38	7	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	A	19.27	3.796133	0.70567	.	.	ENSG00000214595	ENST00000356458	T	0.04809	3.55	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.27759	U	0.017961	T	0.07999	0.0200	L	0.56280	1.765	0.58432	D	0.999994	B	0.33135	0.399	B	0.35607	0.206	T	0.36138	-0.9760	10	0.21014	T	0.42	.	16.1564	0.81670	1.0:0.0:0.0:0.0	.	364	Q6ZMW3	EMAL6_HUMAN	I	364	ENSP00000348842:N364I	ENSP00000348842:N364I	N	+	2	0	EML6	54928168	1.000000	0.71417	0.999000	0.59377	0.141000	0.21300	8.962000	0.93254	2.228000	0.72767	0.477000	0.44152	AAC	.		0.552	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
ATG4D	84971	hgsc.bcm.edu	37	19	10657598	10657598	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr19:10657598C>A	ENST00000309469.4	+	4	750	c.577C>A	c.(577-579)Cgc>Agc	p.R193S	ATG4D_ENST00000540862.1_Intron	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	193					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)	p.R193C(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TGGGCCTGCCCGCTGGATGCC	0.716																																					p.R193S		.											ATG4D,caecum,carcinoma,0,2	ATG4D	0	1	Substitution - Missense(1)	lung(1)	c.C577A						.						17.0	18.0	18.0					19																	10657598		2193	4286	6479	SO:0001583	missense	84971	exon4			CCTGCCCGCTGGA	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.577C>A	19.37:g.10657598C>A	ENSP00000311318:p.Arg193Ser	Somatic	41	0		WXS	Illumina HiSeq	.	42	2	NM_032885	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	37	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.248174	0.39697	.	.	ENSG00000130734	ENST00000309469	.	.	.	5.12	1.76	0.24704	.	0.736852	0.13331	N	0.395954	T	0.18045	0.0433	N	0.15975	0.35	0.09310	N	0.999999	B;B;B	0.15719	0.001;0.014;0.0	B;B;B	0.20184	0.007;0.028;0.004	T	0.29366	-1.0014	9	0.15066	T	0.55	-11.4652	5.8508	0.18691	0.0:0.6214:0.1374:0.2411	.	130;216;193	B4DGM8;B7ZAY9;Q86TL0	.;.;ATG4D_HUMAN	S	193	.	ENSP00000311318:R193S	R	+	1	0	ATG4D	10518598	0.000000	0.05858	0.326000	0.25389	0.947000	0.59692	-0.007000	0.12810	0.554000	0.29061	0.561000	0.74099	CGC	.		0.716	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
TEX15	56154	hgsc.bcm.edu	37	8	30701108	30701108	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:30701108G>T	ENST00000256246.2	-	1	5500	c.5426C>A	c.(5425-5427)tCt>tAt	p.S1809Y		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1809					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AAATGGAACAGAAAGAGAAAA	0.338																																					p.S1809Y		.											.	.	.	0			c.C5426A						.						79.0	77.0	78.0					8																	30701108		2203	4300	6503	SO:0001583	missense	56154	exon1			GGAACAGAAAGAG	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.5426C>A	8.37:g.30701108G>T	ENSP00000256246:p.Ser1809Tyr	Somatic	54	0		WXS	Illumina HiSeq	.	43	3	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560917	0.65538	.	.	ENSG00000133863	ENST00000256246	T	0.24538	1.85	5.54	5.54	0.83059	.	0.000000	0.50627	D	0.000119	T	0.49881	0.1583	L	0.59436	1.845	0.51012	D	0.999903	D	0.89917	1.0	D	0.91635	0.999	T	0.48246	-0.9052	10	0.87932	D	0	.	18.2504	0.90000	0.0:0.0:1.0:0.0	.	1809	Q9BXT5	TEX15_HUMAN	Y	1809	ENSP00000256246:S1809Y	ENSP00000256246:S1809Y	S	-	2	0	TEX15	30820650	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.623000	0.74238	2.598000	0.87819	0.650000	0.86243	TCT	.		0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
EVI5	7813	hgsc.bcm.edu	37	1	93089878	93089878	+	Missense_Mutation	SNP	C	C	T	rs201423013		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:93089878C>T	ENST00000370331.1	-	14	1643	c.1634G>A	c.(1633-1635)cGt>cAt	p.R545H	EVI5_ENST00000540033.1_Missense_Mutation_p.R545H|EVI5_ENST00000543509.1_Missense_Mutation_p.R556H|EVI5_ENST00000491940.1_5'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	545	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.R545H(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CCCAGTAGTACGAGCTAAGTG	0.383																																					p.R545H		.											EVI5,NS,carcinoma,0,1	EVI5	0	1	Substitution - Missense(1)	endometrium(1)	c.G1634A						.						103.0	88.0	93.0					1																	93089878		2203	4300	6503	SO:0001583	missense	7813	exon14			GTAGTACGAGCTA	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1634G>A	1.37:g.93089878C>T	ENSP00000359356:p.Arg545His	Somatic	49	1		WXS	Illumina HiSeq	.	30	2	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.938011	0.92526	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.40476	1.03;1.03;1.03	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	L	0.55213	1.73	0.80722	D	1	D;P	0.53619	0.961;0.884	P;P	0.58077	0.832;0.684	T	0.44375	-0.9332	10	0.51188	T	0.08	-2.2735	19.6894	0.95993	0.0:1.0:0.0:0.0	.	556;545	F5H4R0;O60447	.;EVI5_HUMAN	H	545;545;556;244	ENSP00000359356:R545H;ENSP00000440826:R545H;ENSP00000445019:R556H	ENSP00000345500:R244H	R	-	2	0	EVI5	92862466	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.197000	0.77814	2.651000	0.90000	0.655000	0.94253	CGT	.		0.383	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
DOCK4	9732	hgsc.bcm.edu	37	7	111381218	111381218	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:111381218G>T	ENST00000437633.1	-	46	5201	c.4945C>A	c.(4945-4947)Caa>Aaa	p.Q1649K	DOCK4_ENST00000494651.2_Missense_Mutation_p.Q532K|DOCK4_ENST00000428084.1_Missense_Mutation_p.Q1658K	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1649	Ser-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCAGAAGCTTGTGAGGACAGT	0.408																																					p.Q1649K		.											.	.	.	0			c.C4945A						.						208.0	207.0	207.0					7																	111381218		1865	4102	5967	SO:0001583	missense	9732	exon46			AAGCTTGTGAGGA		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4945C>A	7.37:g.111381218G>T	ENSP00000404179:p.Gln1649Lys	Somatic	103	0		WXS	Illumina HiSeq	.	98	4	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768566|4.768566	0.90020|0.90020	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.|T;T;T	.|0.05580	.|4.15;3.42;4.15	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.11452|0.11452	0.0279|0.0279	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|P;P;P;P;P	.|0.50943	.|0.801;0.898;0.92;0.9;0.94	.|B;P;B;B;P	.|0.49922	.|0.275;0.626;0.445;0.366;0.57	T|T	0.07578|0.07578	-1.0765|-1.0765	5|10	.|0.05721	.|T	.|0.95	.|.	19.3209|19.3209	0.94237|0.94237	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|556;532;1694;1649;1658	.|B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2	.|.;.;.;DOCK4_HUMAN;.	Q|K	1109;1681|1637;1658;532;1649;1646	.|ENSP00000410746:Q1658K;ENSP00000440944:Q532K;ENSP00000404179:Q1649K	.|ENSP00000345432:Q1646K	H|Q	-|-	3|1	2|0	DOCK4|DOCK4	111168454|111168454	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.999000|0.999000	0.98932|0.98932	9.411000|9.411000	0.97342|0.97342	2.800000|2.800000	0.96347|0.96347	0.655000|0.655000	0.94253|0.94253	CAC|CAA	.		0.408	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
IAPP	3375	hgsc.bcm.edu	37	12	21526361	21526361	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr12:21526361G>T	ENST00000240652.3	+	2	212	c.76G>T	c.(76-78)Gaa>Taa	p.E26*	IAPP_ENST00000542023.1_Nonsense_Mutation_p.E26*|SLCO1A2_ENST00000537524.1_Intron|SLCO1A2_ENST00000473830.1_Intron|SLCO1A2_ENST00000307378.6_Intron|IAPP_ENST00000539393.1_Nonsense_Mutation_p.E26*	NM_000415.2	NP_000406.1	P10997	IAPP_HUMAN	islet amyloid polypeptide	26					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|endocrine pancreas development (GO:0031018)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell differentiation (GO:0045596)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)			lung(3)	3						TACACCCATTGAAAGGTTGGT	0.348																																					p.E26X		.											.	.	.	0			c.G76T						.						131.0	125.0	127.0					12																	21526361		2203	4300	6503	SO:0001587	stop_gained	3375	exon2			CCCATTGAAAGGT		CCDS8688.1	12p12.1	2013-02-25			ENSG00000121351	ENSG00000121351		"""Endogenous ligands"""	5329	protein-coding gene	gene with protein product	"""amylin"""	147940					Standard	NM_000415		Approved	AMYLIN, DAP, IAP	uc001rev.3	P10997	OTTHUMG00000169128	ENST00000240652.3:c.76G>T	12.37:g.21526361G>T	ENSP00000240652:p.Glu26*	Somatic	90	0		WXS	Illumina HiSeq	.	65	4	NM_000415	Q0ZD87|Q14598	Nonsense_Mutation	SNP	ENST00000240652.3	37	CCDS8688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.43|16.43	3.122192|3.122192	0.56613|0.56613	.|.	.|.	ENSG00000121351|ENSG00000121351	ENST00000539393;ENST00000240652;ENST00000542023;ENST00000537593|ENST00000535428	.|.	.|.	.|.	5.77|5.77	1.91|1.91	0.25777|0.25777	.|.	0.738768|.	0.12878|.	N|.	0.431678|.	.|T	.|0.49932	.|0.1586	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.56032	.|-0.8046	.|3	0.38643|.	T|.	0.18|.	-0.1072|-0.1072	9.3961|9.3961	0.38404|0.38404	0.2804:0.0:0.7196:0.0|0.2804:0.0:0.7196:0.0	.|.	.|.	.|.	.|.	X|F	26|7	.|.	ENSP00000240652:E26X|.	E|L	+|+	1|3	0|2	IAPP|IAPP	21417628|21417628	0.556000|0.556000	0.26538|0.26538	0.007000|0.007000	0.13788|0.13788	0.014000|0.014000	0.08584|0.08584	0.862000|0.862000	0.27899|0.27899	0.080000|0.080000	0.16959|0.16959	-0.136000|-0.136000	0.14681|0.14681	GAA|TTG	.		0.348	IAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402356.1	NM_000415	
C14orf37	145407	hgsc.bcm.edu	37	14	58604812	58604812	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr14:58604812G>A	ENST00000267485.7	-	2	1459	c.1265C>T	c.(1264-1266)aCg>aTg	p.T422M	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	422						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GGTGGATTCCGTGAAGTCTCC	0.438																																					p.T422M		.											C14orf37,NS,adenoma,0,1	C14orf37	0	0			c.C1265T						.						88.0	86.0	87.0					14																	58604812		2203	4300	6503	SO:0001583	missense	145407	exon2			GATTCCGTGAAGT		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1265C>T	14.37:g.58604812G>A	ENSP00000267485:p.Thr422Met	Somatic	49	0		WXS	Illumina HiSeq	.	36	3	NM_001001872	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	ENST00000267485.7	37	CCDS32089.1	.	.	.	.	.	.	.	.	.	.	G	9.618	1.133105	0.21041	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.19806	2.12	5.86	-4.7	0.03288	.	1.059670	0.07288	N	0.871966	T	0.06508	0.0167	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.29253	0.239;0.117;0.239;0.239	B;B;B;B	0.18263	0.021;0.021;0.021;0.021	T	0.29243	-1.0018	10	0.36615	T	0.2	1.84	3.8087	0.08788	0.5168:0.1039:0.2754:0.1038	.	460;422;422;422	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	M	422;460	ENSP00000267485:T422M	ENSP00000267485:T422M	T	-	2	0	C14orf37	57674565	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.066000	0.14489	-0.787000	0.04510	-0.136000	0.14681	ACG	.		0.438	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872	
HTR2B	3357	hgsc.bcm.edu	37	2	231973540	231973540	+	Silent	SNP	G	G	T	rs539709485		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:231973540G>T	ENST00000258400.3	-	4	1649	c.1137C>A	c.(1135-1137)gtC>gtA	p.V379V	PSMD1_ENST00000488354.1_3'UTR|PSMD1_ENST00000373635.4_Intron|PSMD1_ENST00000308696.6_Intron|PSMD1_ENST00000409643.1_Intron	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	379					activation of phospholipase C activity (GO:0007202)|behavior (GO:0007610)|calcium-mediated signaling (GO:0019722)|cardiac muscle hypertrophy (GO:0003300)|cellular calcium ion homeostasis (GO:0006874)|cellular response to temperature stimulus (GO:0071502)|cGMP biosynthetic process (GO:0006182)|embryonic morphogenesis (GO:0048598)|ERK1 and ERK2 cascade (GO:0070371)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|heart morphogenesis (GO:0003007)|intestine smooth muscle contraction (GO:0014827)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell death (GO:0060548)|neural crest cell differentiation (GO:0014033)|neural crest cell migration (GO:0001755)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphorylation (GO:0016310)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	drug binding (GO:0008144)|G-protein alpha-subunit binding (GO:0001965)|Ras GTPase activator activity (GO:0005099)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Amoxapine(DB00543)|Apomorphine(DB00714)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Dihydroergotamine(DB00320)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Lisuride(DB00589)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Ropinirole(DB00268)|Triflupromazine(DB00508)|Yohimbine(DB01392)	AGAGGGTGTAGACCAAAGGAT	0.423																																					p.V379V	Ovarian(155;1331 1891 12853 14038 34991)	.											HTR2B,NS,carcinoma,0,1	HTR2B	0	0			c.C1137A						.						105.0	107.0	107.0					2																	231973540		2203	4300	6503	SO:0001819	synonymous_variant	3357	exon4			GGTGTAGACCAAA		CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""			8143856	Standard	NM_000867		Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.1137C>A	2.37:g.231973540G>T		Somatic	33	0		WXS	Illumina HiSeq	.	31	2	NM_000867	B2R9D5|Q53TI1|Q62221|Q6P523	Silent	SNP	ENST00000258400.3	37	CCDS2483.1																																																																																			.		0.423	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256957.2	NM_000867	
TRIB1	10221	hgsc.bcm.edu	37	8	126445609	126445609	+	Silent	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:126445609G>T	ENST00000311922.3	+	2	993	c.411G>T	c.(409-411)ctG>ctT	p.L137L	TRIB1_ENST00000520847.1_5'UTR|TRIB1_ENST00000519576.1_5'Flank|TRIB1_ENST00000521778.1_3'UTR	NM_001282985.1|NM_025195.2	NP_001269914.1|NP_079471.1			tribbles pseudokinase 1											NS(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			ACATCCAGCTGCCATCGCACA	0.502																																					p.L137L		.											TRIB1_ENST00000311922,NS,carcinoma,0,1	TRIB1_ENST00000311922	0	0			c.G411T						.						194.0	196.0	195.0					8																	126445609		2203	4300	6503	SO:0001819	synonymous_variant	10221	exon2			CCAGCTGCCATCG	AF205437	CCDS6357.1, CCDS64971.1	8q24.13	2013-10-03	2013-10-03			ENSG00000173334			16891	protein-coding gene	gene with protein product		609461	"""tribbles homolog 1 (Drosophila)"""			9342215, 16715410	Standard	NM_001282985		Approved	C8FW, GIG2, TRB1	uc003yrx.3	Q96RU8		ENST00000311922.3:c.411G>T	8.37:g.126445609G>T		Somatic	31	0		WXS	Illumina HiSeq	.	34	3	NM_025195		Silent	SNP	ENST00000311922.3	37	CCDS6357.1																																																																																			.		0.502	TRIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381430.1	NM_025195	
HLA-A	3105	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	29910349	29910349	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:29910349C>G	ENST00000396634.1	+	3	360	c.19C>G	c.(19-21)Cga>Gga	p.R7G	HLA-A_ENST00000376806.5_Missense_Mutation_p.R7G|HLA-A_ENST00000376802.2_Missense_Mutation_p.R7G|HLA-A_ENST00000376809.5_Missense_Mutation_p.R7G			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	7					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CATGGCGCCCCGAACCCTCCT	0.677									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.R7G		.											.	.	.	0			c.C19G						.						35.0	37.0	37.0					6																	29910349		2201	4296	6497	SO:0001583	missense	3105	exon1	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GCGCCCCGAACCC	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.19C>G	6.37:g.29910349C>G	ENSP00000379873:p.Arg7Gly	Somatic	90	0		WXS	Illumina HiSeq	.	56	15	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	11.86	1.765959	0.31228	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00672	5.89;5.89;5.89;5.91	3.72	-6.36	0.01969	.	6.449800	0.01184	N	0.007157	T	0.00815	0.0027	L	0.46614	1.455	0.09310	N	1	D;D;D;D	0.69078	0.997;0.996;0.994;0.996	D;D;D;D	0.83275	0.985;0.996;0.988;0.996	T	0.39820	-0.9595	10	0.87932	D	0	.	4.6254	0.12476	0.2481:0.1715:0.4911:0.0893	.	7;7;7;7	Q5SRN7;P16188;Q5SRN5;P04439	.;1A30_HUMAN;.;1A03_HUMAN	G	7	ENSP00000379873:R7G;ENSP00000366002:R7G;ENSP00000366005:R7G;ENSP00000365998:R7G	ENSP00000348012:R7G	R	+	1	2	HLA-A	30018328	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-2.254000	0.01183	-1.159000	0.02807	-0.531000	0.04308	CGA	.		0.677	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
ZFHX4	79776	hgsc.bcm.edu	37	8	77775451	77775451	+	Silent	SNP	T	T	A	rs199874527		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:77775451T>A	ENST00000521891.2	+	11	9949	c.9501T>A	c.(9499-9501)ccT>ccA	p.P3167P	ZFHX4_ENST00000518282.1_Silent_p.P3141P|ZFHX4_ENST00000455469.2_Silent_p.P3122P|ZFHX4_ENST00000050961.6_Silent_p.P3118P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctccaccacctcctcctcctc	0.522										HNSCC(33;0.089)																											p.P3167P		.											ZFHX4,colon,carcinoma,0,2	ZFHX4	0	0			c.T9501A						.						52.0	53.0	53.0					8																	77775451		2064	4225	6289	SO:0001819	synonymous_variant	79776	exon11			ACCACCTCCTCCT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9501T>A	8.37:g.77775451T>A		Somatic	33	1		WXS	Illumina HiSeq	.	31	2	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																			.		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ARSD	414	hgsc.bcm.edu	37	X	2825480	2825480	+	Silent	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:2825480G>A	ENST00000381154.1	-	10	1689	c.1614C>T	c.(1612-1614)caC>caT	p.H538H	ARSD-AS1_ENST00000414053.1_RNA	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	538					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTATCACGGCGTGGTACAGGG	0.647																																					p.H538H		.											.	.	.	0			c.C1614T						.						25.0	23.0	24.0					X																	2825480		2203	4300	6503	SO:0001819	synonymous_variant	414	exon10			CACGGCGTGGTAC	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1614C>T	X.37:g.2825480G>A		Somatic	87	0		WXS	Illumina HiSeq	.	88	4	NM_001669	Q9UHJ8	Silent	SNP	ENST00000381154.1	37	CCDS35196.1																																																																																			.		0.647	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		
GPLD1	2822	hgsc.bcm.edu	37	6	24448365	24448365	+	Silent	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:24448365G>A	ENST00000230036.1	-	16	1628	c.1518C>T	c.(1516-1518)tgC>tgT	p.C506C		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	506					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						AACATACCTGGCAAGAAATGG	0.453																																					p.C506C		.											GPLD1,colon,carcinoma,0,1	GPLD1	0	0			c.C1518T						.						136.0	130.0	132.0					6																	24448365		2203	4300	6503	SO:0001819	synonymous_variant	2822	exon16			TACCTGGCAAGAA	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1518C>T	6.37:g.24448365G>A		Somatic	57	0		WXS	Illumina HiSeq	.	43	2	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Silent	SNP	ENST00000230036.1	37	CCDS4553.1																																																																																			.		0.453	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
SEPT11	55752	hgsc.bcm.edu	37	4	77949912	77949912	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:77949912G>T	ENST00000264893.6	+	8	1285	c.1084G>T	c.(1084-1086)Gag>Tag	p.E362*	SEPT11_ENST00000502584.1_Nonsense_Mutation_p.E362*|SEPT11_ENST00000541121.1_Nonsense_Mutation_p.E372*|SEPT11_ENST00000512575.1_3'UTR|SEPT11_ENST00000510515.1_Nonsense_Mutation_p.E372*|SEPT11_ENST00000505788.1_Nonsense_Mutation_p.E362*	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	362					cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						GGCAGAGAAAGAGGTAAGCCA	0.398																																					p.E362X		.											.	.	.	0			c.G1084T						.						95.0	91.0	92.0					4																	77949912		2203	4300	6503	SO:0001587	stop_gained	55752	exon8			GAGAAAGAGGTAA	AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.1084G>T	4.37:g.77949912G>T	ENSP00000264893:p.Glu362*	Somatic	48	0		WXS	Illumina HiSeq	.	70	4	NM_018243	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Nonsense_Mutation	SNP	ENST00000264893.6	37	CCDS34018.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.070450|8.070450	0.98638|0.98638	.|.	.|.	ENSG00000138758|ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000541121;ENST00000502401|ENST00000506731	.|D	.|0.83673	.|-1.75	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.285862|.	0.34484|.	N|.	0.003932|.	.|D	.|0.91703	.|0.7377	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.91561	.|0.5264	.|5	0.87932|0.72032	D|D	0|0.01	.|.	20.5596|20.5596	0.99324|0.99324	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|N	362;362;354;362;372;372;15|90	.|ENSP00000423103:K90N	ENSP00000264893:E362X|ENSP00000423103:K90N	E|K	+|+	1|3	0|2	SEPT11|SEPT11	78168936|78168936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.873000|0.873000	0.50193|0.50193	9.338000|9.338000	0.96553|0.96553	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	GAG|AAG	.		0.398	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362676.1	NM_018243	
SLC6A5	9152	hgsc.bcm.edu	37	11	20660044	20660044	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:20660044G>A	ENST00000525748.1	+	13	2182	c.1909G>A	c.(1909-1911)Gcc>Acc	p.A637T	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	637					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	CACCTATGCTGCCTCCTATGC	0.463																																					p.A637T		.											SLC6A5,NS,meningioma,0,1	SLC6A5	0	0			c.G1909A						.						398.0	315.0	343.0					11																	20660044		2203	4300	6503	SO:0001583	missense	9152	exon13			TATGCTGCCTCCT	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1909G>A	11.37:g.20660044G>A	ENSP00000434364:p.Ala637Thr	Somatic	35	0		WXS	Illumina HiSeq	.	31	2	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	G	37	5.989018	0.97179	.	.	ENSG00000165970	ENST00000525748	T	0.77877	-1.13	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.87006	0.6070	L	0.60012	1.86	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.87153	0.2210	10	0.87932	D	0	.	20.1	0.97870	0.0:0.0:1.0:0.0	.	637	Q9Y345	SC6A5_HUMAN	T	637	ENSP00000434364:A637T	ENSP00000434364:A637T	A	+	1	0	SLC6A5	20616620	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.754000	0.98908	2.829000	0.97493	0.655000	0.94253	GCC	.		0.463	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
RABL6	55684	hgsc.bcm.edu	37	9	139734309	139734309	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:139734309G>T	ENST00000311502.7	+	13	2158	c.1922G>T	c.(1921-1923)aGt>aTt	p.S641I	RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000371675.3_Missense_Mutation_p.S526I|RABL6_ENST00000371663.4_Missense_Mutation_p.S642I|RABL6_ENST00000357466.2_Intron			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	641					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										AAGGAGAGCAGTGAGGAAGGT	0.682																																					p.S642I		.											.	.	.	0			c.G1925T						.						18.0	23.0	22.0					9																	139734309		1961	4127	6088	SO:0001583	missense	55684	exon13			AGAGCAGTGAGGA	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1922G>T	9.37:g.139734309G>T	ENSP00000311134:p.Ser641Ile	Somatic	82	0		WXS	Illumina HiSeq	.	79	4	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	37	CCDS48058.1	.	.	.	.	.	.	.	.	.	.	.	12.03	1.815209	0.32053	.	.	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000371675;ENST00000435930	T;T;T;T	0.73681	-0.67;-0.68;-0.67;-0.77	4.72	4.72	0.59763	.	0.338891	0.33127	N	0.005251	D	0.82346	0.5017	M	0.71581	2.175	0.50813	D	0.999891	D;D;D	0.76494	0.999;0.997;0.994	D;D;P	0.72075	0.976;0.931;0.855	T	0.81636	-0.0843	10	0.40728	T	0.16	-14.0842	8.9208	0.35610	0.1028:0.0:0.8972:0.0	.	435;642;641	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	I	642;641;526;435	ENSP00000360727:S642I;ENSP00000311134:S641I;ENSP00000360740:S526I;ENSP00000408442:S435I	ENSP00000311134:S641I	S	+	2	0	C9orf86	138854130	1.000000	0.71417	0.169000	0.22859	0.034000	0.12701	6.146000	0.71777	2.162000	0.67917	0.561000	0.74099	AGT	.		0.682	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
SLIT2	9353	hgsc.bcm.edu	37	4	20530586	20530586	+	Silent	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:20530586C>A	ENST00000504154.1	+	16	1729	c.1477C>A	c.(1477-1479)Cga>Aga	p.R493R	MIR218-1_ENST00000384999.1_RNA|SLIT2_ENST00000273739.5_Silent_p.R497R|SLIT2_ENST00000503823.1_Silent_p.R485R|SLIT2_ENST00000503837.1_Silent_p.R489R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	493					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.R493*(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AGAAGATTATCGATCAAAATT	0.353																																					p.R493R		.											SLIT2,NS,carcinoma,0,1	SLIT2	0	1	Substitution - Nonsense(1)	endometrium(1)	c.C1477A						.						95.0	99.0	98.0					4																	20530586		2203	4300	6503	SO:0001819	synonymous_variant	9353	exon16			GATTATCGATCAA	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1477C>A	4.37:g.20530586C>A		Somatic	40	0		WXS	Illumina HiSeq	.	39	2	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1																																																																																			.		0.353	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
UBR1	197131	hgsc.bcm.edu	37	15	43322177	43322177	+	Missense_Mutation	SNP	G	G	A	rs375913511		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:43322177G>A	ENST00000290650.4	-	21	2422	c.2344C>T	c.(2344-2346)Cca>Tca	p.P782S	UBR1_ENST00000382177.2_Missense_Mutation_p.P782S	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	782					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P782S(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GCACTGTGTGGCATGGGTTCA	0.388																																					p.P782S		.											UBR1,NS,carcinoma,0,1	UBR1	0	1	Substitution - Missense(1)	kidney(1)	c.C2344T						.	G	SER/PRO	0,4406		0,0,2203	217.0	194.0	202.0		2344	4.9	1.0	15		202	1,8597	1.2+/-3.3	0,1,4298	no	missense	UBR1	NM_174916.2	74	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	782/1750	43322177	1,13003	2203	4299	6502	SO:0001583	missense	197131	exon21			TGTGTGGCATGGG		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.2344C>T	15.37:g.43322177G>A	ENSP00000290650:p.Pro782Ser	Somatic	47	0		WXS	Illumina HiSeq	.	29	3	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897516	0.33535	0.0	1.16E-4	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.38560	1.13;1.13	4.95	4.95	0.65309	.	0.053880	0.64402	D	0.000001	T	0.19565	0.0470	N	0.11064	0.09	0.44447	D	0.997371	B;B	0.30406	0.021;0.278	B;B	0.24974	0.008;0.057	T	0.11203	-1.0597	10	0.02654	T	1	-16.8028	12.6609	0.56813	0.0:0.304:0.696:0.0	.	782;782	B4DYL2;Q8IWV7	.;UBR1_HUMAN	S	782	ENSP00000290650:P782S;ENSP00000371612:P782S	ENSP00000290650:P782S	P	-	1	0	UBR1	41109469	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.370000	0.73114	2.580000	0.87095	0.561000	0.74099	CCA	.		0.388	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
OR5D14	219436	hgsc.bcm.edu	37	11	55563503	55563503	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:55563503C>T	ENST00000335605.1	+	1	472	c.472C>T	c.(472-474)Ccc>Tcc	p.P158S		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CATGTTTGGCCCCTTGGTACT	0.493																																					p.P158S		.											OR5D14,right_upper_lobe,carcinoma,0,1	OR5D14	0	0			c.C472T						.						158.0	153.0	154.0					11																	55563503		2200	4296	6496	SO:0001583	missense	219436	exon1			TTTGGCCCCTTGG	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.472C>T	11.37:g.55563503C>T	ENSP00000334456:p.Pro158Ser	Somatic	61	0		WXS	Illumina HiSeq	.	49	2	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	CCDS31508.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-2.915497	0.00055	.	.	ENSG00000186113	ENST00000335605	T	0.29142	1.58	4.94	0.825	0.18824	GPCR, rhodopsin-like superfamily (1);	0.155476	0.30383	N	0.009754	T	0.03520	0.0101	N	0.00037	-2.525	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41875	-0.9484	10	0.02654	T	1	-8.1045	5.2517	0.15524	0.1329:0.5573:0.0:0.3097	.	158	Q8NGL3	OR5DE_HUMAN	S	158	ENSP00000334456:P158S	ENSP00000334456:P158S	P	+	1	0	OR5D14	55320079	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-1.227000	0.02950	-0.107000	0.12088	-0.275000	0.10095	CCC	.		0.493	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
KIAA1324L	222223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	86521048	86521048	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:86521048C>G	ENST00000450689.2	-	21	3207	c.3022G>C	c.(3022-3024)Gca>Cca	p.A1008P	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.A937P|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.A841P|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.A768P	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	1008						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ACCTTGGTTGCCAAAGATTTG	0.383																																					p.A1008P		.											.,2	.	225	0			c.G3022C						.						143.0	139.0	140.0					7																	86521048		2203	4300	6503	SO:0001583	missense	222223	exon21			TGGTTGCCAAAGA	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.3022G>C	7.37:g.86521048C>G	ENSP00000413445:p.Ala1008Pro	Somatic	76	0		WXS	Illumina HiSeq	.	61	6	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.560280|4.560280	0.86335|0.86335	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314|ENST00000423294	T;T;T;T|.	0.20598|.	2.33;2.09;2.06;2.09|.	5.77|5.77	4.86|4.86	0.63082|0.63082	.|.	0.050258|.	0.85682|.	D|.	0.000000|.	T|T	0.61274|0.61274	0.2334|0.2334	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.991;0.999;0.999|.	T|T	0.59107|0.59107	-0.7516|-0.7516	10|5	0.56958|.	D|.	0.05|.	.|.	12.8102|12.8102	0.57635|0.57635	0.0:0.9171:0.0:0.0829|0.0:0.9171:0.0:0.0829	.|.	1008;768;841|.	A8MWY0;A8MWY0-2;B4DJV3|.	K132L_HUMAN;.;.|.	P|A	1008;768;937;841|968	ENSP00000413445:A1008P;ENSP00000297222:A768P;ENSP00000397377:A937P;ENSP00000402390:A841P|.	ENSP00000297222:A768P|.	A|G	-|-	1|2	0|0	KIAA1324L|KIAA1324L	86358984|86358984	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	5.700000|5.700000	0.68318|0.68318	1.495000|1.495000	0.48549|0.48549	0.655000|0.655000	0.94253|0.94253	GCA|GGC	.		0.383	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
DNAJC2	27000	hgsc.bcm.edu	37	7	102967063	102967063	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:102967063A>G	ENST00000379263.3	-	5	749	c.499T>C	c.(499-501)Tca>Cca	p.S167P	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Missense_Mutation_p.S167P	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	167	ZRF1-UBD.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)	p.S167P(2)		endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						GAAGGAACTGAGTTATCAAAA	0.353																																					p.S167P		.											Q99543-2,NS,carcinoma,0,2	Q99543-2	0	2	Substitution - Missense(2)	ovary(2)	c.T499C						.						94.0	88.0	90.0					7																	102967063		1844	4092	5936	SO:0001583	missense	27000	exon5			GAACTGAGTTATC	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.499T>C	7.37:g.102967063A>G	ENSP00000368565:p.Ser167Pro	Somatic	49	0		WXS	Illumina HiSeq	.	46	2	NM_001129887	A4VCI0|Q9BVX1	Missense_Mutation	SNP	ENST00000379263.3	37	CCDS43628.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836203	0.71373	.	.	ENSG00000105821	ENST00000249270;ENST00000379263;ENST00000537811;ENST00000454277	.	.	.	5.55	5.55	0.83447	.	0.237467	0.43579	D	0.000542	T	0.60521	0.2275	M	0.68317	2.08	0.80722	D	1	P;P	0.43750	0.816;0.534	P;B	0.45343	0.477;0.328	T	0.64141	-0.6477	9	0.52906	T	0.07	-17.6215	11.6085	0.51045	0.8669:0.0:0.0:0.1331	.	167;167	Q99543-2;Q99543	.;DNJC2_HUMAN	P	167;167;167;93	.	ENSP00000249270:S167P	S	-	1	0	DNAJC2	102754299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.151000	0.50670	2.333000	0.79357	0.482000	0.46254	TCA	.		0.353	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
BMP2K	55589	hgsc.bcm.edu	37	4	79792166	79792166	+	Missense_Mutation	SNP	C	C	G	rs202184856|rs200441916	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:79792166C>G	ENST00000335016.5	+	11	1627	c.1461C>G	c.(1459-1461)caC>caG	p.H487Q	BMP2K_ENST00000502871.1_Missense_Mutation_p.H487Q	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	487	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						agcagcagcaccaccaccacc	0.502													c|||	68	0.0135783	0.0416	0.0043	5008	,	,		11259	0.001		0.007	False		,,,				2504	0.002				p.H487Q		.											BMP2K_ENST00000502871,caecum,carcinoma,0,4	BMP2K_ENST00000502871	0	0			c.C1461G						.	-	GLN/HIS,GLN/HIS	12,4302		0,12,2145	20.0	24.0	23.0		1461,1461		0.1	4		23	2,8424		0,2,4211	no	missense,missense	BMP2K	NM_017593.3,NM_198892.1	24,24	0,14,6356	GG,GC,CC		0.0237,0.2782,0.1099	possibly-damaging,possibly-damaging	487/663,487/1162	79792166	14,12726	2157	4213	6370	SO:0001583	missense	55589	exon11			GCAGCACCACCAC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1461C>G	4.37:g.79792166C>G	ENSP00000334836:p.His487Gln	Somatic	24	0		WXS	Illumina HiSeq	.	30	3	NM_017593	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.755|0.755	-0.771272|-0.771272	0.02951|0.02951	0.002782|0.002782	2.37E-4|2.37E-4	ENSG00000138756|ENSG00000138756	ENST00000502871;ENST00000335016;ENST00000264889|ENST00000502613	T;T|.	0.71341|.	1.16;-0.56|.	.|.	.|.	.|.	.|.	3.253760|.	0.01410|.	N|.	0.013962|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.39094|.	0.659;0.404|.	B;B|.	0.18263|.	0.021;0.021|.	T|T	0.24119|0.24119	-1.0169|-1.0169	9|4	0.10902|.	T|.	0.67|.	.|.	3.2348|3.2348	0.06761|0.06761	0.4658:0.5342:0.0:0.0|0.4658:0.5342:0.0:0.0	.|.	487;487|.	Q9NSY1;Q4W5H2|.	BMP2K_HUMAN;.|.	Q|A	487;487;501|180	ENSP00000421768:H487Q;ENSP00000334836:H487Q|.	ENSP00000264889:H501Q|.	H|P	+|+	3|1	2|0	BMP2K|BMP2K	80011190|80011190	0.000000|0.000000	0.05858|0.05858	0.126000|0.126000	0.21872|0.21872	0.030000|0.030000	0.12068|0.12068	-1.617000|-1.617000	0.02051|0.02051	0.372000|0.372000	0.24591|0.24591	0.377000|0.377000	0.23210|0.23210	CAC|CCA	.		0.502	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
AHNAK2	113146	hgsc.bcm.edu	37	14	105412163	105412163	+	Missense_Mutation	SNP	C	C	G	rs201181175		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr14:105412163C>G	ENST00000333244.5	-	7	9744	c.9625G>C	c.(9625-9627)Gtg>Ctg	p.V3209L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3209						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGCTTCACGTCCACCTGG	0.607																																					p.V3209L		.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2_ENST00000333244	0	0			c.G9625C						.						108.0	70.0	83.0					14																	105412163		1920	3847	5767	SO:0001583	missense	113146	exon7			GCTTCACGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9625G>C	14.37:g.105412163C>G	ENSP00000353114:p.Val3209Leu	Somatic	32	1		WXS	Illumina HiSeq	.	36	3	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990179	0.18966	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	2.98	-2.26	0.06867	.	.	.	.	.	T	0.00906	0.0030	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48875	-0.8996	9	0.22109	T	0.4	.	0.8864	0.01245	0.2903:0.3589:0.1435:0.2074	.	3209	Q8IVF2	AHNK2_HUMAN	L	3209	ENSP00000353114:V3209L	ENSP00000353114:V3209L	V	-	1	0	AHNAK2	104483208	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.193000	0.00564	-0.054000	0.13266	0.313000	0.20887	GTG	.		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
DNAH12	201625	hgsc.bcm.edu	37	3	57394104	57394104	+	Missense_Mutation	SNP	C	C	T	rs377699028		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:57394104C>T	ENST00000351747.2	-	40	6302	c.6122G>A	c.(6121-6123)cGa>cAa	p.R2041Q		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2041	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TGAGAAGATTCGGACCATAGT	0.413																																					p.R2041Q		.											DNAH12,caecum,carcinoma,0,1	DNAH12	0	0			c.G6122A						.	C	GLN/ARG	0,1384		0,0,692	123.0	109.0	113.0		6122	5.2	1.0	3		113	1,3181		0,1,1590	no	missense	DNAH12	NM_178504.4	43	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	probably-damaging	2041/3093	57394104	1,4565	692	1591	2283	SO:0001583	missense	201625	exon40			AAGATTCGGACCA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6122G>A	3.37:g.57394104C>T	ENSP00000295937:p.Arg2041Gln	Somatic	70	0		WXS	Illumina HiSeq	.	32	2	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	37		.	.	.	.	.	.	.	.	.	.	C	14.41	2.526206	0.44969	0.0	3.14E-4	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.39056	1.1;1.1	5.21	5.21	0.72293	ATPase, AAA+ type, core (1);	.	.	.	.	T	0.62282	0.2415	M	0.67397	2.05	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.63005	-0.6733	9	0.48119	T	0.1	.	18.76	0.91847	0.0:1.0:0.0:0.0	.	2041	Q6ZR08	DYH12_HUMAN	Q	2041;2060	ENSP00000295937:R2041Q;ENSP00000418137:R2060Q	ENSP00000295937:R2041Q	R	-	2	0	DNAH12	57369144	0.998000	0.40836	0.998000	0.56505	0.984000	0.73092	3.872000	0.56085	2.421000	0.82119	0.557000	0.71058	CGA	.		0.413	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
NUP210L	91181	hgsc.bcm.edu	37	1	153994676	153994676	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:153994676G>A	ENST00000368559.3	-	32	4513	c.4442C>T	c.(4441-4443)gCc>gTc	p.A1481V	NUP210L_ENST00000271854.3_Missense_Mutation_p.A1481V|NUP210L_ENST00000368553.1_Missense_Mutation_p.A414V	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1481					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGGCTCAATGGCATGCTCTAC	0.493																																					p.A1481V		.											NUP210L,NS,carcinoma,0,1	NUP210L	0	0			c.C4442T						.						137.0	136.0	136.0					1																	153994676		2038	4193	6231	SO:0001583	missense	91181	exon32			TCAATGGCATGCT	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.4442C>T	1.37:g.153994676G>A	ENSP00000357547:p.Ala1481Val	Somatic	51	0		WXS	Illumina HiSeq	.	59	3	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972242	0.92919	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.23147	3.49;1.92;3.22	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000003	T	0.31606	0.0802	L	0.34521	1.04	0.51233	D	0.999913	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	T	0.00885	-1.1527	10	0.27785	T	0.31	-13.1298	18.4451	0.90681	0.0:0.0:1.0:0.0	.	1481;1481	E7EP56;Q5VU65	.;P210L_HUMAN	V	1481;414;1481	ENSP00000357547:A1481V;ENSP00000357541:A414V;ENSP00000271854:A1481V	ENSP00000271854:A1481V	A	-	2	0	NUP210L	152261300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.622000	0.61240	2.894000	0.99253	0.591000	0.81541	GCC	.		0.493	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36094620	36094620	+	Silent	SNP	C	C	T	rs200815371		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr14:36094620C>T	ENST00000389698.3	-	34	5748	c.5358G>A	c.(5356-5358)ctG>ctA	p.L1786L	RALGAPA1_ENST00000307138.6_Silent_p.L1786L|RALGAPA1_ENST00000382366.3_Silent_p.L1799L|RALGAPA1_ENST00000258840.6_Silent_p.L1833L	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1786	Minimal domain that binds to TCF3/E12. {ECO:0000250}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CATTTTTCTTCAGGAGATGAA	0.373																																					p.L1786L		.											RALGAPA1_ENST00000307138,NS,carcinoma,0,2	RALGAPA1_ENST00000307138	0	0			c.G5358A						.						103.0	110.0	107.0					14																	36094620		2203	4298	6501	SO:0001819	synonymous_variant	253959	exon34			TTTCTTCAGGAGA	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5358G>A	14.37:g.36094620C>T		Somatic	52	0		WXS	Illumina HiSeq	.	34	2	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	ENST00000389698.3	37	CCDS32065.1																																																																																			0.001		0.373	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
GALNT14	79623	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	31178586	31178586	+	Silent	SNP	A	A	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:31178586A>T	ENST00000349752.5	-	6	1191	c.552T>A	c.(550-552)atT>atA	p.I184I	GALNT14_ENST00000420311.2_Silent_p.I149I|GALNT14_ENST00000406653.1_Silent_p.I164I|GALNT14_ENST00000486564.1_5'Flank|GALNT14_ENST00000324589.5_Silent_p.I189I|GALNT14_ENST00000356174.3_Silent_p.I151I	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	184	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CAGCGCCCCGAATCCGGGACC	0.597																																					p.I189I		.											.	.	.	0			c.T567A						.						57.0	57.0	57.0					2																	31178586		2203	4300	6503	SO:0001819	synonymous_variant	79623	exon7			GCCCCGAATCCGG	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.552T>A	2.37:g.31178586A>T		Somatic	22	0		WXS	Illumina HiSeq	.	24	5	NM_001253826	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	ENST00000349752.5	37	CCDS1773.2																																																																																			.		0.597	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
MMEL1	79258	hgsc.bcm.edu	37	1	2540788	2540788	+	Silent	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:2540788G>A	ENST00000378412.3	-	6	686	c.525C>T	c.(523-525)tgC>tgT	p.C175C	MMEL1_ENST00000288709.6_Silent_p.C166C|MMEL1_ENST00000502556.1_Intron			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	175						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		TCTGGTTCATGCAGGAGCGGT	0.692																																					p.C175C		.											MMEL1,colon,carcinoma,0,1	MMEL1	0	0			c.C525T						.						31.0	24.0	26.0					1																	2540788		2202	4299	6501	SO:0001819	synonymous_variant	79258	exon6			GTTCATGCAGGAG	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.525C>T	1.37:g.2540788G>A		Somatic	45	0		WXS	Illumina HiSeq	.	27	2	NM_033467	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Silent	SNP	ENST00000378412.3	37	CCDS30569.2																																																																																			.		0.692	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	
RAD51AP2	729475	hgsc.bcm.edu	37	2	17698681	17698681	+	Silent	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:17698681G>T	ENST00000399080.2	-	1	1025	c.1002C>A	c.(1000-1002)ctC>ctA	p.L334L		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	334								p.L334L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTTGGCTACTGAGTGATGGGT	0.333																																					p.L334L		.											RAD51AP2,NS,lymphoid_neoplasm,0,1	RAD51AP2	0	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1002A						.						75.0	69.0	71.0					2																	17698681		1816	4079	5895	SO:0001819	synonymous_variant	729475	exon1			GCTACTGAGTGAT	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.1002C>A	2.37:g.17698681G>T		Somatic	39	0		WXS	Illumina HiSeq	.	32	2	NM_001099218		Silent	SNP	ENST00000399080.2	37	CCDS42656.1																																																																																			.		0.333	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
TMIGD1	388364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28643709	28643709	+	Splice_Site	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:28643709C>A	ENST00000328886.4	-	7	858		c.e7-1		TMIGD1_ENST00000538566.2_Splice_Site	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1							integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						GCTTTCTCATCTGAAATGAAT	0.318																																					.		.											.	.	.	0			c.786-1G>T						.						79.0	78.0	79.0					17																	28643709		2203	4300	6503	SO:0001630	splice_region_variant	388364	exon8			TCTCATCTGAAAT	AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.786-1G>T	17.37:g.28643709C>A		Somatic	55	0		WXS	Illumina HiSeq	.	39	11	NM_206832	A8K2K1|Q6ZMC6	Splice_Site	SNP	ENST00000328886.4	37	CCDS32605.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511798	0.64522	.	.	ENSG00000182271	ENST00000328886	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8494	0.70284	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMIGD1	25667835	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.434000	0.52841	2.785000	0.95823	0.655000	0.94253	.	.		0.318	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447955.1	NM_206832	Intron
CA10	56934	hgsc.bcm.edu	37	17	49825140	49825140	+	Silent	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:49825140G>T	ENST00000285273.4	-	5	1429	c.318C>A	c.(316-318)tcC>tcA	p.S106S	CA10_ENST00000340813.6_Silent_p.S112S|CA10_ENST00000451037.2_Silent_p.S106S|CA10_ENST00000570565.1_Silent_p.S31S|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000442502.2_Silent_p.S106S	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	106					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CCAGGCGAAGGGATACGTGTC	0.542																																					p.S106S		.											CA10,NS,malignant_melanoma,0,2	CA10	0	0			c.C318A						.						144.0	129.0	134.0					17																	49825140		2203	4300	6503	SO:0001819	synonymous_variant	56934	exon5			GCGAAGGGATACG	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.318C>A	17.37:g.49825140G>T		Somatic	48	0		WXS	Illumina HiSeq	.	38	2	NM_001082534	B2R7J0|B4DGL6	Silent	SNP	ENST00000285273.4	37	CCDS32684.1																																																																																			.		0.542	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
MAP2K1	5604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	66729174	66729174	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:66729174G>C	ENST00000307102.5	+	3	913	c.382G>C	c.(382-384)Ggc>Cgc	p.G128R		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		G -> V (in CFC3). {ECO:0000269|PubMed:18042262}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GTACATCGTGGGCTTCTATGG	0.512																																					p.G128R		.											.	.	.	0			c.G382C						.						178.0	135.0	150.0					15																	66729174		2201	4299	6500	SO:0001583	missense	5604	exon3			ATCGTGGGCTTCT	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.382G>C	15.37:g.66729174G>C	ENSP00000302486:p.Gly128Arg	Somatic	45	0		WXS	Illumina HiSeq	.	34	9	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.192125|5.192125	0.94923|0.94923	.|.	.|.	ENSG00000169032|ENSG00000169032	ENST00000425818|ENST00000307102	.|D	.|0.92545	.|-3.06	5.15|5.15	5.15|5.15	0.70609|0.70609	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.89942|0.89942	0.6861|0.6861	N|N	0.02275|0.02275	-0.615|-0.615	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.998;0.999	.|D;D	.|0.78314	.|0.979;0.991	D|D	0.92511|0.92511	0.6016|0.6016	6|10	.|0.41790	.|T	.|0.15	-19.2098|-19.2098	18.6564|18.6564	0.91455|0.91455	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|106;128	.|B4DFY5;Q02750	.|.;MP2K1_HUMAN	A|R	67|128	.|ENSP00000302486:G128R	.|ENSP00000302486:G128R	G|G	+|+	2|1	0|0	MAP2K1|MAP2K1	64516228|64516228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	9.723000|9.723000	0.98772|0.98772	2.385000|2.385000	0.81259|0.81259	0.655000|0.655000	0.94253|0.94253	GGG|GGC	.		0.512	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
PPP6C	5537	hgsc.bcm.edu	37	9	127933372	127933372	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:127933372G>A	ENST00000373547.4	-	2	262	c.163C>T	c.(163-165)Cat>Tat	p.H55Y	PPP6C_ENST00000451402.1_Missense_Mutation_p.H92Y|PPP6C_ENST00000373546.3_5'UTR|PPP6C_ENST00000415905.1_Missense_Mutation_p.H55Y	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit	55					G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						ACCTGTCCATGGATATCTCCA	0.378																																					p.H92Y		.											PPP6C_ENST00000451402,NS,malignant_melanoma,0,4	PPP6C_ENST00000451402	0	0			c.C274T						.						189.0	180.0	183.0					9																	127933372		2203	4300	6503	SO:0001583	missense	5537	exon3			GTCCATGGATATC	AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.163C>T	9.37:g.127933372G>A	ENSP00000362648:p.His55Tyr	Somatic	38	0		WXS	Illumina HiSeq	.	36	2	NM_001123355	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Missense_Mutation	SNP	ENST00000373547.4	37	CCDS6861.1	.	.	.	.	.	.	.	.	.	.	G	31	5.062242	0.93846	.	.	ENSG00000119414	ENST00000373547;ENST00000451402;ENST00000415905;ENST00000456642	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	6.02	6.02	0.97574	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.84211	0.5422	H	0.99689	4.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.90797	0.4691	10	0.87932	D	0	-21.5472	19.1045	0.93287	0.0:0.0:1.0:0.0	.	55;92;55	O00743-2;O00743-3;O00743	.;.;PPP6_HUMAN	Y	55;92;55;43	ENSP00000362648:H55Y;ENSP00000392147:H92Y;ENSP00000411744:H55Y;ENSP00000416287:H43Y	ENSP00000362648:H55Y	H	-	1	0	PPP6C	126973193	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.672000	0.91181	2.865000	0.98341	0.655000	0.94253	CAT	.		0.378	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	
ADAM5	255926	hgsc.bcm.edu	37	8	39182774	39182774	+	RNA	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:39182774C>T	ENST00000505455.1	+	0	565							Q6NVV9	ADAM5_HUMAN	ADAM metallopeptidase domain 5, pseudogene								metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)										TATTGAAATGCATATTGTTGT	0.279																																					.		.											.	.	.	0			.						.																																					255926	.			GAAATGCATATTG	BC047448		8p11.23	2012-08-22	2010-03-12	2012-08-22	ENSG00000196115	ENSG00000196115		"""ADAM metallopeptidase domain containing"""	212	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 5"""	ADAM5P		8786143, 10417343	Standard	NR_001448		Approved	tMDCII	uc003xnb.3	Q6NVV9	OTTHUMG00000154982		8.37:g.39182774C>T		Somatic	68	0		WXS	Illumina HiSeq	.	58	3	.	A8MW71|Q4G196	RNA	SNP	ENST00000505455.1	37																																																																																				.		0.279	ADAM5-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000337882.1	NR_001448	
XPO5	57510	hgsc.bcm.edu	37	6	43519110	43519110	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:43519110G>T	ENST00000265351.7	-	15	1863	c.1653C>A	c.(1651-1653)tgC>tgA	p.C551*	XPO5_ENST00000424378.2_5'UTR	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	551	Necessary for interaction with ILF3.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TAGTAAGGACGCAGGACAGGA	0.428																																					p.C551X		.											XPO5,NS,carcinoma,0,1	XPO5	0	0			c.C1653A						.						130.0	130.0	130.0					6																	43519110		1915	4132	6047	SO:0001587	stop_gained	57510	exon15			AAGGACGCAGGAC	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.1653C>A	6.37:g.43519110G>T	ENSP00000265351:p.Cys551*	Somatic	83	0		WXS	Illumina HiSeq	.	80	4	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Nonsense_Mutation	SNP	ENST00000265351.7	37	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	G	36	5.930372	0.97116	.	.	ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000372252;ENST00000372258;ENST00000439465	.	.	.	5.55	0.0137	0.14097	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-12.6268	9.8634	0.41129	0.7424:0.0:0.2576:0.0	.	.	.	.	X	551;256;91;91;179	.	ENSP00000265351:C551X	C	-	3	2	XPO5	43627088	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	2.090000	0.41682	-0.096000	0.12329	-0.300000	0.09419	TGC	.		0.428	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
LIAS	11019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39472905	39472905	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:39472905G>C	ENST00000513731.1	+	5	595	c.543G>C	c.(541-543)caG>caC	p.Q181H	LIAS_ENST00000261434.3_Missense_Mutation_p.Q311H|LIAS_ENST00000340169.2_Missense_Mutation_p.Q311H|LIAS_ENST00000381846.1_Missense_Mutation_p.Q268H					lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						AATATATGCAGCCAACAAGGC	0.363																																					p.Q311H		.											.	.	.	0			c.G933C						.						152.0	135.0	140.0					4																	39472905		2203	4300	6503	SO:0001583	missense	11019	exon9			TATGCAGCCAACA	AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369	ENST00000513731.1:c.543G>C	4.37:g.39472905G>C	ENSP00000425580:p.Gln181His	Somatic	53	0		WXS	Illumina HiSeq	.	35	7	NM_194451		Missense_Mutation	SNP	ENST00000513731.1	37		.	.	.	.	.	.	.	.	.	.	G	18.50	3.636717	0.67130	.	.	ENSG00000121897	ENST00000340169;ENST00000261434;ENST00000513731;ENST00000381846	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.72	1.49	0.22878	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.91109	0.7201	H	0.98901	4.365	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.80764	0.978;0.994;0.977	D	0.89281	0.3612	10	0.87932	D	0	-12.0035	7.834	0.29360	0.4625:0.0:0.5375:0.0	.	268;181;311	C9JCF6;D6RCP8;O43766	.;.;LIAS_HUMAN	H	311;311;181;268	ENSP00000340676:Q311H;ENSP00000261434:Q311H;ENSP00000425580:Q181H;ENSP00000371270:Q268H	ENSP00000261434:Q311H	Q	+	3	2	LIAS	39149300	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.662000	0.37418	0.345000	0.23873	0.563000	0.77884	CAG	.		0.363	LIAS-006	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000361037.1	NM_194451	
TRIM69	140691	hgsc.bcm.edu;bcgsc.ca	37	15	45059569	45059569	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr15:45059569C>T	ENST00000559390.1	+	8	2030	c.1102C>T	c.(1102-1104)Ctg>Ttg	p.L368L	TRIM69_ENST00000338264.4_Silent_p.L209L|TRIM69_ENST00000558173.1_Silent_p.L164L|TRIM69_ENST00000329464.4_Silent_p.L368L|TRIM69_ENST00000561043.1_Silent_p.L131L|TRIM69_ENST00000560442.1_Silent_p.L164L|TRIM69_ENST00000558329.1_Silent_p.L147L			Q86WT6	TRI69_HUMAN	tripartite motif containing 69	368	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		TGTGGCTGTACTGGGCTCAAG	0.463																																					p.L368L	Pancreas(84;519 1450 1802 20427 34706)	.											.	.	.	0			c.C1102T						.						136.0	138.0	138.0					15																	45059569		2198	4298	6496	SO:0001819	synonymous_variant	140691	exon7			GCTGTACTGGGCT	AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.1102C>T	15.37:g.45059569C>T		Somatic	71	0		WXS	Illumina HiSeq	.	61	4	NM_182985	A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Silent	SNP	ENST00000559390.1	37	CCDS32220.1																																																																																			.		0.463	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416171.1		
ZNF569	148266	hgsc.bcm.edu;bcgsc.ca	37	19	37904891	37904891	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr19:37904891G>T	ENST00000316950.6	-	6	1226	c.669C>A	c.(667-669)ttC>ttA	p.F223L	ZNF569_ENST00000392150.2_Missense_Mutation_p.F64L|ZNF569_ENST00000392149.2_Missense_Mutation_p.F223L	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTTGTGACTGAAGGCTTTTC	0.348																																					p.F223L		.											.	.	.	0			c.C669A						.						62.0	66.0	65.0					19																	37904891		2202	4300	6502	SO:0001583	missense	148266	exon6			GTGACTGAAGGCT	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.669C>A	19.37:g.37904891G>T	ENSP00000325018:p.Phe223Leu	Somatic	68	0		WXS	Illumina HiSeq	.	49	4	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631547	0.46944	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.41065	1.01;1.01	3.73	-0.339	0.12647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38897	N	0.001521	T	0.59878	0.2226	M	0.84156	2.68	0.33027	D	0.529674	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.65631	-0.6121	10	0.62326	D	0.03	.	7.5415	0.27742	0.5074:0.0:0.4926:0.0	.	64;223	Q17RR6;Q5MCW4	.;ZN569_HUMAN	L	223;64	ENSP00000325018:F223L;ENSP00000375993:F64L	ENSP00000325018:F223L	F	-	3	2	ZNF569	42596731	0.004000	0.15560	0.089000	0.20774	0.991000	0.79684	-0.003000	0.12901	-0.082000	0.12640	0.591000	0.81541	TTC	.		0.348	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
TRIM36	55521	hgsc.bcm.edu	37	5	114483090	114483090	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr5:114483090G>T	ENST00000282369.3	-	3	421	c.300C>A	c.(298-300)ggC>ggA	p.G100G	TRIM36_ENST00000515104.1_5'UTR|TRIM36_ENST00000514154.1_De_novo_Start_OutOfFrame|TRIM36_ENST00000513154.1_Splice_Site_p.G88G|TRIM36-IT1_ENST00000503723.1_RNA	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	100					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TGCGCTTCCAGCCTGTGTAAT	0.408																																					p.G100G		.											.	.	.	0			c.C300A						.						108.0	93.0	98.0					5																	114483090		2202	4300	6502	SO:0001630	splice_region_variant	55521	exon3			CTTCCAGCCTGTG	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.299-1C>A	5.37:g.114483090G>T		Somatic	44	0		WXS	Illumina HiSeq	.	38	4	NM_018700	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Silent	SNP	ENST00000282369.3	37	CCDS4115.1																																																																																			.		0.408	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	Silent
OR4C13	283092	hgsc.bcm.edu	37	11	49974531	49974531	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:49974531C>A	ENST00000555099.1	+	1	589	c.557C>A	c.(556-558)gCc>gAc	p.A186D		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						ATCAATCTTGCCTGCACTAAT	0.438																																					p.A186D		.											OR4C13,NS,carcinoma,0,1	OR4C13	0	0			c.C557A						.						232.0	205.0	214.0					11																	49974531		2201	4296	6497	SO:0001583	missense	283092	exon1			ATCTTGCCTGCAC	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.557C>A	11.37:g.49974531C>A	ENSP00000452277:p.Ala186Asp	Somatic	51	0		WXS	Illumina HiSeq	.	60	3	NM_001001955	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	ENST00000555099.1	37	CCDS31495.1	.	.	.	.	.	.	.	.	.	.	.	9.416	1.081806	0.20309	.	.	ENSG00000258817	ENST00000555099	T	0.00231	8.49	2.7	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.145928	0.31636	N	0.007304	T	0.00695	0.0023	H	0.97023	3.925	0.21386	N	0.999703	D	0.56521	0.976	D	0.65010	0.931	T	0.30208	-0.9986	9	.	.	.	.	7.2981	0.26405	0.0:0.8576:0.0:0.1424	.	186	Q8NGP0	OR4CD_HUMAN	D	186	ENSP00000452277:A186D	.	A	+	2	0	OR4C13	49931107	0.000000	0.05858	0.976000	0.42696	0.088000	0.18126	0.162000	0.16501	0.474000	0.27392	0.186000	0.17326	GCC	.		0.438	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
TIGD2	166815	hgsc.bcm.edu	37	4	90035034	90035034	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:90035034G>T	ENST00000317005.2	+	1	1067	c.909G>T	c.(907-909)ttG>ttT	p.L303F	RP11-84C13.1_ENST00000603357.1_lincRNA|FAM13A_ENST00000502459.1_5'Flank	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	303	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L303F(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		AAGAAATGTTGAGTTCAGATG	0.408																																					p.L303F		.											TIGD2,colon,carcinoma,0,2	TIGD2	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G909T						.						64.0	64.0	64.0					4																	90035034		2203	4300	6503	SO:0001583	missense	166815	exon1			AATGTTGAGTTCA	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.909G>T	4.37:g.90035034G>T	ENSP00000317170:p.Leu303Phe	Somatic	59	0		WXS	Illumina HiSeq	.	42	2	NM_145715		Missense_Mutation	SNP	ENST00000317005.2	37	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822257	0.32237	.	.	ENSG00000180346	ENST00000317005	T	0.44482	0.92	4.49	0.482	0.16815	.	0.000000	0.34046	N	0.004301	T	0.57286	0.2043	M	0.84156	2.68	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.45086	-0.9285	10	0.48119	T	0.1	-1.2923	3.2349	0.06761	0.2778:0.0:0.4075:0.3147	.	303	Q4W5G0	TIGD2_HUMAN	F	303	ENSP00000317170:L303F	ENSP00000317170:L303F	L	+	3	2	TIGD2	90254057	0.998000	0.40836	0.230000	0.23976	0.902000	0.53008	0.656000	0.24948	0.128000	0.18479	0.557000	0.71058	TTG	.		0.408	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715	
C17orf53	78995	hgsc.bcm.edu;broad.mit.edu	37	17	42232260	42232260	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:42232260C>T	ENST00000319977.4	+	7	1838	c.1601C>T	c.(1600-1602)aCg>aTg	p.T534M	C17orf53_ENST00000245382.6_Missense_Mutation_p.T458M|C17orf53_ENST00000585683.1_Missense_Mutation_p.T533M	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	534										NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTGCTGGAGACGTGCCAGAAT	0.607																																					p.T534M		.											C17orf53,colon,carcinoma,0,1	C17orf53	0	0			c.C1601T						.						80.0	67.0	72.0					17																	42232260		2203	4300	6503	SO:0001583	missense	78995	exon7			TGGAGACGTGCCA	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.1601C>T	17.37:g.42232260C>T	ENSP00000313500:p.Thr534Met	Somatic	7	0		WXS	Illumina HiSeq	.	7	3	NM_024032	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	CCDS11477.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332117	0.60853	.	.	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.48836	0.8;0.87	5.69	3.59	0.41128	.	0.318221	0.32372	N	0.006196	T	0.59662	0.2210	M	0.66939	2.045	0.27671	N	0.946779	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.67103	0.949;0.931;0.949	T	0.53049	-0.8493	10	0.72032	D	0.01	-3.4396	6.4023	0.21646	0.3376:0.5688:0.0:0.0936	.	533;458;534	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	M	534;458	ENSP00000313500:T534M;ENSP00000245382:T458M	ENSP00000245382:T458M	T	+	2	0	C17orf53	39587786	0.985000	0.35326	0.629000	0.29254	0.807000	0.45602	2.743000	0.47442	1.417000	0.47077	0.455000	0.32223	ACG	.		0.607	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032	
NDST3	9348	hgsc.bcm.edu	37	4	119154220	119154220	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:119154220T>C	ENST00000296499.5	+	9	2276	c.1873T>C	c.(1873-1875)Tcc>Ccc	p.S625P	NDST3_ENST00000433996.2_Missense_Mutation_p.S544P	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	625	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CCTTAGTAACTCCCCCAGCCC	0.358																																					p.S625P		.											.	.	.	0			c.T1873C						.						163.0	162.0	162.0					4																	119154220		2203	4300	6503	SO:0001583	missense	9348	exon9			AGTAACTCCCCCA	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1873T>C	4.37:g.119154220T>C	ENSP00000296499:p.Ser625Pro	Somatic	111	0		WXS	Illumina HiSeq	.	80	4	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.196383	0.58126	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.53640	0.61;0.61	5.64	5.64	0.86602	Sulfotransferase domain (1);	0.057217	0.64402	D	0.000001	T	0.41766	0.1173	N	0.17474	0.49	0.37744	D	0.925735	D;P	0.64830	0.994;0.848	P;P	0.49477	0.592;0.612	T	0.45673	-0.9245	10	0.37606	T	0.19	.	15.8571	0.78987	0.0:0.0:0.0:1.0	.	544;625	B4DI67;O95803	.;NDST3_HUMAN	P	625;544	ENSP00000296499:S625P;ENSP00000396625:S544P	ENSP00000296499:S625P	S	+	1	0	NDST3	119373668	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.181000	0.71988	2.136000	0.66102	0.519000	0.50382	TCC	.		0.358	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
USP20	10868	hgsc.bcm.edu	37	9	132642541	132642541	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:132642541C>T	ENST00000315480.4	+	25	2892	c.2734C>T	c.(2734-2736)Cgg>Tgg	p.R912W	USP20_ENST00000372429.3_Missense_Mutation_p.R912W|USP20_ENST00000472108.1_3'UTR|USP20_ENST00000358355.1_Missense_Mutation_p.R912W			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	912					endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R912W(2)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				AGCCGAGACGCGGGCCGTGTG	0.647																																					p.R912W		.											USP20_ENST00000372429,NS,carcinoma,0,2	USP20_ENST00000372429	0	2	Substitution - Missense(2)	endometrium(2)	c.C2734T						.						20.0	26.0	24.0					9																	132642541		2079	4207	6286	SO:0001583	missense	10868	exon25			GAGACGCGGGCCG	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2734C>T	9.37:g.132642541C>T	ENSP00000313811:p.Arg912Trp	Somatic	60	0		WXS	Illumina HiSeq	.	40	2	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.188203	0.38609	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.21191	2.02;2.02;2.02	5.14	5.14	0.70334	.	0.338156	0.31648	N	0.007292	T	0.28764	0.0713	M	0.72894	2.215	0.80722	D	1	B	0.17268	0.021	B	0.06405	0.002	T	0.08229	-1.0732	10	0.66056	D	0.02	.	17.5953	0.88010	0.0:1.0:0.0:0.0	.	912	Q9Y2K6	UBP20_HUMAN	W	912	ENSP00000361506:R912W;ENSP00000313811:R912W;ENSP00000351122:R912W	ENSP00000313811:R912W	R	+	1	2	USP20	131682362	0.990000	0.36364	0.990000	0.47175	0.011000	0.07611	2.946000	0.49050	2.382000	0.81193	0.655000	0.94253	CGG	.		0.647	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
DTNB	1838	hgsc.bcm.edu;bcgsc.ca	37	2	25611194	25611194	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:25611194G>T	ENST00000406818.3	-	17	1861	c.1612C>A	c.(1612-1614)Cat>Aat	p.H538N	DTNB_ENST00000404103.3_Missense_Mutation_p.H538N|DTNB_ENST00000545439.1_Missense_Mutation_p.H327N|DTNB_ENST00000405222.1_Missense_Mutation_p.H501N|DTNB_ENST00000407661.3_Missense_Mutation_p.H538N|DTNB_ENST00000407038.3_Missense_Mutation_p.H508N|DTNB_ENST00000407186.1_Missense_Mutation_p.H501N|DTNB_ENST00000496972.2_Missense_Mutation_p.H474N|DTNB_ENST00000288642.8_Missense_Mutation_p.H538N	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	538						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGCCTCCATGGGTGGGCGAT	0.597																																					p.H538N		.											.	.	.	0			c.C1612A						.						31.0	38.0	36.0					2																	25611194		2054	4177	6231	SO:0001583	missense	1838	exon17			CTCCATGGGTGGG	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1612C>A	2.37:g.25611194G>T	ENSP00000384084:p.His538Asn	Somatic	71	0		WXS	Illumina HiSeq	.	72	4	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037338	0.54896	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439	T;T;T;T;T;T;T;T;T	0.46063	2.21;2.21;2.22;2.21;2.22;2.21;2.21;2.22;0.88	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.53498	0.1800	L	0.58669	1.825	0.58432	D	0.999996	P;P;P;P;P;B;P;P;P;P;B;B	0.50528	0.895;0.758;0.791;0.749;0.895;0.305;0.895;0.936;0.936;0.534;0.399;0.399	P;P;P;B;B;B;B;P;P;B;B;B	0.54544	0.573;0.457;0.468;0.359;0.434;0.148;0.392;0.755;0.755;0.185;0.229;0.09	T	0.43360	-0.9396	10	0.25106	T	0.35	-19.8388	16.7312	0.85435	0.0:0.0:1.0:0.0	.	327;474;531;531;474;501;501;508;538;538;538;538	B7Z202;F5GZG4;B7Z6A9;Q1I0L3;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941;Q86VR4	.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN;.	N	474;538;538;538;508;501;501;538;327	ENSP00000444463:H474N;ENSP00000384084:H538N;ENSP00000385482:H538N;ENSP00000385193:H538N;ENSP00000384767:H508N;ENSP00000384787:H501N;ENSP00000385784:H501N;ENSP00000288642:H538N;ENSP00000444961:H327N	ENSP00000288642:H538N	H	-	1	0	DTNB	25464698	1.000000	0.71417	0.956000	0.39512	0.167000	0.22549	9.618000	0.98365	2.551000	0.86045	0.561000	0.74099	CAT	.		0.597	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
F13A1	2162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	6175067	6175067	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:6175067G>A	ENST00000264870.3	-	12	1758	c.1493C>T	c.(1492-1494)gCc>gTc	p.A498V		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	498					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTACATCAGGGCAGTTTCTAG	0.458																																					p.A498V		.											.	.	.	0			c.C1493T						.						95.0	88.0	90.0					6																	6175067		2203	4300	6503	SO:0001583	missense	2162	exon12			ATCAGGGCAGTTT	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1493C>T	6.37:g.6175067G>A	ENSP00000264870:p.Ala498Val	Somatic	66	0		WXS	Illumina HiSeq	.	59	13	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957330	0.92726	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	D	0.96168	-3.93	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97839	1.0267	10	0.87932	D	0	.	19.0512	0.93046	0.0:0.0:1.0:0.0	.	435;498	F5H080;P00488	.;F13A_HUMAN	V	498;435	ENSP00000264870:A498V	ENSP00000264870:A498V	A	-	2	0	F13A1	6120066	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	6.928000	0.75846	2.735000	0.93741	0.655000	0.94253	GCC	.		0.458	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
BRWD1	54014	hgsc.bcm.edu	37	21	40668258	40668258	+	Silent	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr21:40668258G>T	ENST00000333229.2	-	6	708	c.381C>A	c.(379-381)gcC>gcA	p.A127A	BRWD1_ENST00000380800.3_Silent_p.A127A|BRWD1_ENST00000470108.1_5'Flank|BRWD1_ENST00000342449.3_Silent_p.A127A	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	127					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A127>?(2)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GAGCAGCAAAGGCAGAGCCCT	0.393																																					p.A127A	Melanoma(170;988 1986 4794 16843 39731)	.											.,2	.	325	2	Complex(2)	skin(2)	c.C381A						.						115.0	116.0	116.0					21																	40668258		2203	4300	6503	SO:0001819	synonymous_variant	54014	exon6			AGCAAAGGCAGAG	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.381C>A	21.37:g.40668258G>T		Somatic	97	0		WXS	Illumina HiSeq	.	85	4	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	37	CCDS13662.1																																																																																			.		0.393	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
OLFM3	118427	broad.mit.edu	37	1	102269800	102269800	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:102269800G>T	ENST00000338858.5	-	6	1430	c.1431C>A	c.(1429-1431)gaC>gaA	p.D477E	OLFM3_ENST00000370103.4_Missense_Mutation_p.D457E|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	477					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TTGCCTATGTGTCATCCTCTG	0.383																																					p.D457E													.	OLFM3	178	0			c.C1371A						.						95.0	90.0	92.0					1																	102269800		2203	4300	6503	SO:0001583	missense	118427	exon6			CTATGTGTCATCC	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1431C>A	1.37:g.102269800G>T	ENSP00000345192:p.Asp477Glu	Somatic	48	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	G	9.567	1.119915	0.20877	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.89415	-2.45;-2.51	5.47	4.55	0.56014	.	0.045537	0.85682	D	0.000000	T	0.62097	0.2400	N	0.04043	-0.29	0.80722	D	1	B;B	0.15719	0.014;0.002	B;B	0.12156	0.007;0.003	T	0.62685	-0.6802	10	0.40728	T	0.16	.	8.8722	0.35323	0.2249:0.0:0.7751:0.0	.	457;477	Q5T3V6;Q96PB7	.;NOE3_HUMAN	E	457;477	ENSP00000359121:D457E;ENSP00000345192:D477E	ENSP00000345192:D477E	D	-	3	2	OLFM3	102042388	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.917000	0.28665	1.437000	0.47472	0.650000	0.86243	GAC	.		0.383	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
DRAM2	128338	broad.mit.edu;ucsc.edu	37	1	111663216	111663216	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:111663216G>A	ENST00000286692.4	-	6	1056	c.439C>T	c.(439-441)Cag>Tag	p.Q147*	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Nonsense_Mutation_p.Q147*			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	147					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						ATTTTGGGCTGCATTTGGTAG	0.428																																					p.Q147X													.	DRAM2	19	0			c.C439T						.						126.0	109.0	115.0					1																	111663216		2203	4299	6502	SO:0001587	stop_gained	128338	exon6			TGGGCTGCATTTG	AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.439C>T	1.37:g.111663216G>A	ENSP00000286692:p.Gln147*	Somatic	54	0		WXS	Illumina GAIIx	Phase_I	32	4	NM_178454	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Nonsense_Mutation	SNP	ENST00000286692.4	37	CCDS30801.1	.	.	.	.	.	.	.	.	.	.	G	39	7.329627	0.98214	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-3.5612	15.7886	0.78332	0.0:0.0:1.0:0.0	.	.	.	.	X	147	.	ENSP00000286692:Q147X	Q	-	1	0	DRAM2	111464739	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.352000	0.79404	2.873000	0.98535	0.563000	0.77884	CAG	.		0.428	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	
VWA5B1	127731	broad.mit.edu	37	1	20669758	20669758	+	Frame_Shift_Del	DEL	C	C	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:20669758delC	ENST00000375079.2	+	16	2694	c.2498delC	c.(2497-2499)accfs	p.T833fs	VWA5B1_ENST00000375083.4_Frame_Shift_Del_p.T833fs|VWA5B1_ENST00000289815.8_Frame_Shift_Del_p.T833fs|VWA5B1_ENST00000525343.1_3'UTR	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	833						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						GAGCTGGGGACCCCTGGACCG	0.716																																					p.T833fs													.	VWA5B1	44	0			c.2498delC						.						13.0	23.0	20.0					1																	20669758		689	1589	2278	SO:0001589	frameshift_variant	127731	exon16			TGGGGACCCCTGG	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2498delC	1.37:g.20669758delC	ENSP00000364220:p.Thr833fs	Somatic	14	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Frame_Shift_Del	DEL	ENST00000375079.2	37																																																																																				.		0.716	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
PSEN2	5664	broad.mit.edu	37	1	227076607	227076607	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:227076607G>A	ENST00000366783.3	+	8	1080	c.644G>A	c.(643-645)gGc>gAc	p.G215D	PSEN2_ENST00000391872.2_Missense_Mutation_p.G248D|PSEN2_ENST00000340188.4_Missense_Mutation_p.G215D|PSEN2_ENST00000366782.1_Missense_Mutation_p.G248D|PSEN2_ENST00000422240.2_Missense_Mutation_p.G215D|PSEN2_ENST00000472139.2_Missense_Mutation_p.G71D	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	215					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GGGGCAGTGGGCATGGTGTGC	0.582																																					p.G215D													.	PSEN2	55	0			c.G644A						.						141.0	122.0	129.0					1																	227076607		2203	4300	6503	SO:0001583	missense	5664	exon8			CAGTGGGCATGGT	BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.644G>A	1.37:g.227076607G>A	ENSP00000355747:p.Gly215Asp	Somatic	30	0		WXS	Illumina GAIIx	Phase_I	39	4	NM_012486	A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	ENST00000366783.3	37	CCDS1556.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020071	0.93462	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D;D	0.99904	-7.69;-7.69;-7.69;-7.69;-7.69;-7.69;-7.69	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.99921	0.9963	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96041	0.9024	10	0.87932	D	0	.	18.7799	0.91928	0.0:0.0:1.0:0.0	.	215;215	A8K8D4;P49810	.;PSN2_HUMAN	D	215;215;215;42;248;248;71	ENSP00000355747:G215D;ENSP00000339860:G215D;ENSP00000403737:G215D;ENSP00000427912:G42D;ENSP00000355746:G248D;ENSP00000375745:G248D;ENSP00000427806:G71D	ENSP00000339860:G215D	G	+	2	0	PSEN2	225143230	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.790000	0.99075	2.426000	0.82243	0.561000	0.74099	GGC	.		0.582	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1	NM_000447	
BMS1	9790	broad.mit.edu	37	10	43318571	43318571	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr10:43318571G>A	ENST00000374518.5	+	20	3201	c.3138G>A	c.(3136-3138)atG>atA	p.M1046I		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1046					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.M1046I(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGTAGGGAATGTTTAATTCTG	0.393																																					p.M1046I													BMS1,NS,carcinoma,0,2	BMS1	132	1	Substitution - Missense(1)	endometrium(1)	c.G3138A						.						74.0	83.0	80.0					10																	43318571		2202	4297	6499	SO:0001583	missense	9790	exon20			GGGAATGTTTAAT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3138G>A	10.37:g.43318571G>A	ENSP00000363642:p.Met1046Ile	Somatic	291	2		WXS	Illumina GAIIx	Phase_I	206	6	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485181	0.63962	.	.	ENSG00000165733	ENST00000374518	T	0.26957	1.7	4.54	4.54	0.55810	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39600	0.1084	M	0.86953	2.85	0.80722	D	1	B	0.14438	0.01	B	0.17433	0.018	T	0.48636	-0.9018	10	0.72032	D	0.01	.	17.7203	0.88349	0.0:0.0:1.0:0.0	.	1046	Q14692	BMS1_HUMAN	I	1046	ENSP00000363642:M1046I	ENSP00000363642:M1046I	M	+	3	0	BMS1	42638577	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.443000	0.97568	2.250000	0.74265	0.454000	0.30748	ATG	.		0.393	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
VPS51	738	broad.mit.edu	37	11	64875830	64875830	+	Missense_Mutation	SNP	C	C	T	rs544293367		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:64875830C>T	ENST00000279281.3	+	5	979	c.887C>T	c.(886-888)cCg>cTg	p.P296L	VPS51_ENST00000527646.1_3'UTR|AP003068.9_ENST00000528887.1_RNA	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	296					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CCCTCACCTCCGGCTCCCGAC	0.697													C|||	1	0.000199681	0.0	0.0014	5008	,	,		12911	0.0		0.0	False		,,,				2504	0.0				p.P296L													.	.	.	0			c.C887T						.						17.0	20.0	19.0					11																	64875830		2197	4295	6492	SO:0001583	missense	738	exon5			CACCTCCGGCTCC	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.887C>T	11.37:g.64875830C>T	ENSP00000279281:p.Pro296Leu	Somatic	9	0		WXS	Illumina GAIIx	Phase_I	3	2	NM_013265	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	ENST00000279281.3	37	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	C	7.651	0.683011	0.14907	.	.	ENSG00000149823	ENST00000279281;ENST00000529180;ENST00000534557	T;T;T	0.78481	-1.18;-1.18;-1.18	5.11	4.13	0.48395	Cullin repeat-like-containing domain (1);	0.188625	0.46442	D	0.000299	T	0.62319	0.2418	L	0.27053	0.805	0.23271	N	0.998008	B	0.16396	0.017	B	0.08055	0.003	T	0.45160	-0.9280	9	.	.	.	-17.9623	10.0566	0.42248	0.2005:0.7995:0.0:0.0	.	296	Q9UID3	FFR_HUMAN	L	296;321;210	ENSP00000279281:P296L;ENSP00000435245:P321L;ENSP00000435691:P210L	.	P	+	2	0	C11orf2	64632406	0.557000	0.26546	0.653000	0.29593	0.536000	0.34869	4.157000	0.58144	2.386000	0.81285	0.549000	0.68633	CCG	.		0.697	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	
PRSS33	260429	broad.mit.edu	37	16	2835911	2835911	+	Missense_Mutation	SNP	C	C	A	rs373423015		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr16:2835911C>A	ENST00000293851.5	-	3	290	c.131G>T	c.(130-132)cGg>cTg	p.R44L	PRSS33_ENST00000576886.1_Missense_Mutation_p.R44L|PRSS33_ENST00000570702.1_Missense_Mutation_p.R44L	NM_152891.2	NP_690851.2	Q8NF86	PRS33_HUMAN	protease, serine, 33	44	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			prostate(1)	1						CTCTCCGTCCCGGCCATCCCG	0.711																																					p.R44L	NSCLC(194;489 2153 16702 19171 27758)												.	PRSS33	7	0			c.G131T						.						10.0	14.0	13.0					16																	2835911		2001	4132	6133	SO:0001583	missense	260429	exon3			CCGTCCCGGCCAT	AF536382	CCDS42110.1	16p13.3	2014-09-04			ENSG00000103355	ENSG00000103355		"""Serine peptidases / Serine peptidases"""	30405	protein-coding gene	gene with protein product		613797				12795636	Standard	NM_152891		Approved	EOS	uc002cro.1	Q8NF86	OTTHUMG00000177360	ENST00000293851.5:c.131G>T	16.37:g.2835911C>A	ENSP00000293851:p.Arg44Leu	Somatic	46	0		WXS	Illumina GAIIx	Phase_I	38	3	NM_152891	A6NNQ3|Q8N171	Missense_Mutation	SNP	ENST00000293851.5	37	CCDS42110.1	.	.	.	.	.	.	.	.	.	.	C	4.216	0.038885	0.08148	.	.	ENSG00000103355	ENST00000293851	D	0.88975	-2.45	4.39	-3.84	0.04256	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.826457	0.10433	N	0.675317	T	0.73179	0.3554	N	0.05487	-0.04	0.09310	N	1	B	0.13145	0.007	B	0.20577	0.03	T	0.58312	-0.7658	10	0.27785	T	0.31	.	7.536	0.27710	0.0:0.233:0.1351:0.6319	.	44	Q8NF86	PRS33_HUMAN	L	44	ENSP00000293851:R44L	ENSP00000293851:R44L	R	-	2	0	PRSS33	2775912	0.000000	0.05858	0.002000	0.10522	0.103000	0.19146	-1.169000	0.03120	-0.917000	0.03813	-0.675000	0.03792	CGG	.		0.711	PRSS33-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436446.1	NM_152891	
RABEP2	79874	broad.mit.edu	37	16	28936433	28936435	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr16:28936433_28936435delGCC	ENST00000358201.4	-	1	638_640	c.50_52delGGC	c.(49-54)cggccg>ccg	p.R17del	RABEP2_ENST00000357573.6_In_Frame_Del_p.R17del|RABEP2_ENST00000561803.1_5'UTR|RABEP2_ENST00000544477.1_In_Frame_Del_p.R17del	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	17					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CCAGCCCCCGgccgccgccgccg	0.744																																					p.17_18del	Pancreas(66;639 1284 10093 31061 49099)												.	RABEP2	48	0			c.50_52del						.			6,1818		2,2,908						-0.3	0.0			3	18,4526		5,8,2259	no	coding	RABEP2	NM_024816.2		7,10,3167	A1A1,A1R,RR		0.3961,0.3289,0.3769				24,6344				SO:0001651	inframe_deletion	79874	exon1			CCCCCGGCCGCCG	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.50_52delGGC	16.37:g.28936442_28936444delGCC	ENSP00000350934:p.Arg17del	Somatic	13	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_024816		In_Frame_Del	DEL	ENST00000358201.4	37	CCDS42140.1																																																																																			.		0.744	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816	
TGIF1	7050	broad.mit.edu	37	18	3447749	3447749	+	Silent	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr18:3447749G>A	ENST00000548489.2	+	1	143	c.12G>A	c.(10-12)tcG>tcA	p.S4S	TGIF1_ENST00000577543.1_5'Flank|TGIF1_ENST00000405385.3_5'Flank|TGIF1_ENST00000551402.1_5'Flank|TGIF1_ENST00000407501.2_5'Flank|TGIF1_ENST00000343820.5_5'Flank|TGIF1_ENST00000401449.1_Intron	NM_173207.1	NP_775299.1	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	0					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TGACTTGCTCGGGCAAAAGTT	0.483																																					p.S4S													.	TGIF1	41	0			c.G12A						.						128.0	119.0	122.0					18																	3447749		2203	4300	6503	SO:0001819	synonymous_variant	7050	exon1			TTGCTCGGGCAAA	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000548489.2:c.12G>A	18.37:g.3447749G>A		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	35	4	NM_173207	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Silent	SNP	ENST00000548489.2	37	CCDS11832.1																																																																																			.		0.483	TGIF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254366.4	NM_170695	
ABHD1	84696	broad.mit.edu	37	2	27353427	27353427	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:27353427T>C	ENST00000316470.4	+	9	1147	c.1033T>C	c.(1033-1035)Tcc>Ccc	p.S345P	PREB_ENST00000416802.1_5'Flank	NM_032604.3	NP_115993	Q96SE0	ABHD1_HUMAN	abhydrolase domain containing 1	345						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|lung(3)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCCCAACACTCCCCCTACGT	0.632																																					p.S345P													.	ABHD1	18	0			c.T1033C						.						86.0	90.0	89.0					2																	27353427		2203	4300	6503	SO:0001583	missense	84696	exon9			CAACACTCCCCCT	AK093447	CCDS1736.1	2p23.3	2011-01-21			ENSG00000143994	ENSG00000143994		"""Abhydrolase domain containing"""	17553	protein-coding gene	gene with protein product		612195				11922611	Standard	NM_032604		Approved	LABH1, FLJ36128	uc002rit.3	Q96SE0	OTTHUMG00000097072	ENST00000316470.4:c.1033T>C	2.37:g.27353427T>C	ENSP00000326491:p.Ser345Pro	Somatic	42	0		WXS	Illumina GAIIx	Phase_I	40	3	NM_032604	B3KSF6|E9PDR9|Q05BY3|Q53SZ1|Q8IXQ7	Missense_Mutation	SNP	ENST00000316470.4	37	CCDS1736.1	.	.	.	.	.	.	.	.	.	.	T	9.758	1.169276	0.21621	.	.	ENSG00000143994	ENST00000316470	T	0.71103	-0.54	5.42	4.28	0.50868	.	0.097401	0.44097	D	0.000490	T	0.73544	0.3600	L	0.61218	1.895	0.09310	N	1	D	0.58970	0.984	P	0.59643	0.861	T	0.63963	-0.6518	10	0.30854	T	0.27	-2.7562	4.294	0.10892	0.1764:0.0916:0.0:0.7319	.	345	Q96SE0	ABHD1_HUMAN	P	345	ENSP00000326491:S345P	ENSP00000326491:S345P	S	+	1	0	ABHD1	27206931	0.000000	0.05858	0.050000	0.19076	0.028000	0.11728	0.028000	0.13644	2.055000	0.61198	0.418000	0.28097	TCC	.		0.632	ABHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214188.1	NM_032604	
ANKRD20A8P	729171	broad.mit.edu	37	2	95519360	95519360	+	RNA	SNP	G	G	T	rs77762483		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:95519360G>T	ENST00000432432.2	-	0	353					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene									p.Q82K(2)									GTGACCACTTGCACATGGCCA	0.393																																					.													AC097374_3,NS,carcinoma,0,2	.	.	2	Substitution - Missense(2)	endometrium(1)|central_nervous_system(1)	.						.																																					0	.			CCACTTGCACATG			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95519360G>T		Somatic	204	1		WXS	Illumina GAIIx	Phase_I	154	8	.	A6NC18	RNA	SNP	ENST00000432432.2	37																																																																																				.		0.393	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene	OTTHUMT00000451404.1		
ANKRD36	375248	broad.mit.edu	37	2	97877449	97877449	+	Frame_Shift_Del	DEL	A	A	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:97877449delA	ENST00000461153.2	+	58	3684	c.3440delA	c.(3439-3441)gaafs	p.E1147fs	ANKRD36_ENST00000420699.2_Frame_Shift_Del_p.E1147fs			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1147										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ATGGCCACGGAAAAAAAGGAT	0.333																																					p.E1147fs													.	ANKRD36	170	0			c.3440delA						.						144.0	136.0	139.0					2																	97877449		692	1591	2283	SO:0001589	frameshift_variant	375248	exon58			CCACGGAAAAAAA	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3440delA	2.37:g.97877449delA	ENSP00000419530:p.Glu1147fs	Somatic	168	0		WXS	Illumina GAIIx	Phase_I	123	5	NM_001164315	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Frame_Shift_Del	DEL	ENST00000461153.2	37	CCDS54379.1																																																																																			.		0.333	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5		
RGPD8	727851	broad.mit.edu;bcgsc.ca	37	2	113147025	113147025	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:113147025C>T	ENST00000302558.3	-	20	3688	c.3497G>A	c.(3496-3498)tGc>tAc	p.C1166Y	RGPD8_ENST00000409750.1_Missense_Mutation_p.C1026Y	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1166	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						AAGCCGCTGGCATTCCTCAAA	0.438																																					p.C1166Y													.	RGPD8	81	0			c.G3497A						.						1.0	1.0	1.0					2																	113147025		5	27	32	SO:0001583	missense	727851	exon20			CGCTGGCATTCCT	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.3497G>A	2.37:g.113147025C>T	ENSP00000306637:p.Cys1166Tyr	Somatic	224	0		WXS	Illumina GAIIx	Phase_I	162	17	NM_001164463	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	-	9.621	1.133937	0.21123	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.48201	0.82;0.82	2.3	2.3	0.28687	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.59918	0.2229	L	0.56280	1.765	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62590	-0.6822	9	0.87932	D	0	-3.2478	10.3508	0.43934	0.0:1.0:0.0:0.0	.	1166	O14715	RGPD8_HUMAN	Y	1166;1026	ENSP00000306637:C1166Y;ENSP00000386511:C1026Y	ENSP00000306637:C1166Y	C	-	2	0	RGPD8	112863496	1.000000	0.71417	0.996000	0.52242	0.666000	0.39218	5.837000	0.69381	1.299000	0.44798	0.152000	0.16155	TGC	.		0.438	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
AP000282.2	0	broad.mit.edu	37	21	34369061	34369061	+	RNA	DEL	T	T	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr21:34369061delT	ENST00000420356.1	-	0	201				AP000282.2_ENST00000454622.1_RNA																							ggaaggcctcttgcagttgag	0.507																																					.													.	.	.	0			.						.																																					0	.			GGCCTCTTGCAGT																													21.37:g.34369061delT		Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	1	.		RNA	DEL	ENST00000420356.1	37																																																																																				.		0.507	AP000282.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000315806.1		
MORC3	23515	broad.mit.edu	37	21	37747505	37747505	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr21:37747505G>T	ENST00000400485.1	+	17	2807	c.2731G>T	c.(2731-2733)Gat>Tat	p.D911Y	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	911					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						GCCTGATCTTGATCTTCAGCA	0.358																																					p.D911Y													.	MORC3	78	0			c.G2731T						.						168.0	156.0	160.0					21																	37747505		1934	4142	6076	SO:0001583	missense	23515	exon17			GATCTTGATCTTC	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2731G>T	21.37:g.37747505G>T	ENSP00000383333:p.Asp911Tyr	Somatic	64	0		WXS	Illumina GAIIx	Phase_I	65	3	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864516	0.51482	.	.	ENSG00000159256	ENST00000400485	T	0.20463	2.07	5.77	3.96	0.45880	.	0.165136	0.51477	D	0.000085	T	0.33411	0.0862	M	0.61703	1.905	0.48135	D	0.99959	D	0.55385	0.971	P	0.57502	0.822	T	0.05835	-1.0861	10	0.87932	D	0	-21.3004	6.5877	0.22630	0.0685:0.13:0.6664:0.1351	.	911	Q14149	MORC3_HUMAN	Y	911	ENSP00000383333:D911Y	ENSP00000383333:D911Y	D	+	1	0	MORC3	36669375	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	4.145000	0.58065	0.788000	0.33755	0.585000	0.79938	GAT	.		0.358	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
DSCAM	1826	broad.mit.edu	37	21	41452122	41452122	+	Silent	SNP	T	T	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr21:41452122T>C	ENST00000400454.1	-	25	4854	c.4377A>G	c.(4375-4377)ccA>ccG	p.P1459P		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1459	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTATGCGCCCTGGGCCCACTC	0.463																																					p.P1459P	Melanoma(134;970 1778 1785 21664 32388)												.	DSCAM	347	0			c.A4377G						.						154.0	145.0	148.0					21																	41452122		1874	4120	5994	SO:0001819	synonymous_variant	1826	exon25			GCGCCCTGGGCCC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4377A>G	21.37:g.41452122T>C		Somatic	29	0		WXS	Illumina GAIIx	Phase_I	36	3	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.463	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
CPNE4	131034	broad.mit.edu;ucsc.edu	37	3	131756416	131756416	+	5'UTR	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:131756416C>T	ENST00000512055.1	-	0	1234				CPNE4_ENST00000512332.1_Missense_Mutation_p.R13K|CPNE4_ENST00000502818.1_Missense_Mutation_p.R13K|CPNE4_ENST00000511604.1_5'UTR|CPNE4_ENST00000429747.1_5'Flank			Q96A23	CPNE4_HUMAN	copine IV							extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CCCAGCTCTCCTTTTAATGGA	0.498																																					.													.	.	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	131034	.			GCTCTCCTTTTAA	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.-893G>A	3.37:g.131756416C>T		Somatic	43	1		WXS	Illumina GAIIx	Phase_I	20	5	.	D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	C	9.048	0.991355	0.18966	.	.	ENSG00000196353	ENST00000512332;ENST00000502818	T;T	0.53640	0.61;0.61	5.77	1.56	0.23342	.	.	.	.	.	T	0.31040	0.0784	.	.	.	0.21627	N	0.999617	B	0.02656	0.0	B	0.01281	0.0	T	0.22277	-1.0221	8	0.48119	T	0.1	.	3.7029	0.08389	0.2085:0.5106:0.0:0.2809	.	13	Q96A23-2	.	K	13	ENSP00000424853:R13K;ENSP00000421646:R13K	ENSP00000421646:R13K	R	-	2	0	CPNE4	133239106	0.767000	0.28508	0.906000	0.35671	0.946000	0.59487	0.294000	0.19047	0.359000	0.24239	0.643000	0.83706	AGG	.		0.498	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	
HTT	3064	broad.mit.edu	37	4	3076651	3076652	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:3076651_3076652delGC	ENST00000355072.5	+	1	244_245	c.99_100delGC	c.(97-102)cagcagfs	p.QQ33fs	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	33	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		agcagcagcagcagcagcagca	0.698																																					p.33_34del													.	HTT	221	0			c.99_100del						.																																			SO:0001589	frameshift_variant	3064	exon1			GCAGCAGCAGCAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.99_100delGC	4.37:g.3076651_3076652delGC	ENSP00000347184:p.Gln33fs	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	7	2	NM_002111	Q9UQB7	Frame_Shift_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.698	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HTT	3064	broad.mit.edu	37	4	3076654	3076657	+	Frame_Shift_Del	DEL	GCAG	GCAG	-	rs587777899|rs9993357		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr4:3076654_3076657delGCAG	ENST00000355072.5	+	1	247_250	c.102_105delGCAG	c.(100-105)cagcagfs	p.QQ36fs	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	36	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		agcagcagcagcagcagcaacagc	0.706																																					p.34_35del													.	HTT	221	0			c.102_105del						.																																			SO:0001589	frameshift_variant	3064	exon1			GCAGCAGCAGCAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.102_105delGCAG	4.37:g.3076654_3076657delGCAG	ENSP00000347184:p.Gln36fs	Somatic	11	0		WXS	Illumina GAIIx	Phase_I	7	2	NM_002111	Q9UQB7	Frame_Shift_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.706	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
KDELR2	11014	broad.mit.edu	37	7	6523689	6523691	+	5'UTR	DEL	GGC	GGC	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:6523689_6523691delGGC	ENST00000258739.4	-	0	182_184				KDELR2_ENST00000490996.1_5'Flank|FLJ20306_ENST00000601673.1_In_Frame_Del_p.A22del|KDELR2_ENST00000463747.1_5'UTR|DAGLB_ENST00000436575.1_5'UTR	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2						intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		AAATGTTCATggcggcggcggcg	0.724																																					.													.	KDELR2	31	0			.						.																																			SO:0001623	5_prime_UTR_variant	0	.			GTTCATGGCGGCG	X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.-3GCC>-	7.37:g.6523698_6523700delGGC		Somatic	11	0		WXS	Illumina GAIIx	Phase_I	6	2	.	A4D2P4|Q6IPC5|Q96E30	In_Frame_Del	DEL	ENST00000258739.4	37	CCDS5351.1																																																																																			.		0.724	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059424.2		
RAMP3	10268	broad.mit.edu	37	7	45197468	45197470	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:45197468_45197470delTGC	ENST00000242249.4	+	1	79_81	c.41_43delTGC	c.(40-45)ttgctg>ttg	p.14_15LL>L	RAMP3_ENST00000496212.1_In_Frame_Del_p.14_15LL>L|RAMP3_ENST00000481345.1_In_Frame_Del_p.14_15LL>L	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	14					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CTTCTCCCGTTGCTGCTGCTGCT	0.768																																					p.14_15del													.	RAMP3	32	0			c.41_43del						.			4,3496		0,4,1746						0.1	0.1			4	12,7034		1,10,3512	no	coding	RAMP3	NM_005856.2		1,14,5258	A1A1,A1R,RR		0.1703,0.1143,0.1517				16,10530				SO:0001651	inframe_deletion	10268	exon1			TCCCGTTGCTGCT	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.41_43delTGC	7.37:g.45197477_45197479delTGC	ENSP00000242249:p.Leu18del	Somatic	7	0		WXS	Illumina GAIIx	Phase_I	6	2	NM_005856	Q7Z2Y1	In_Frame_Del	DEL	ENST00000242249.4	37	CCDS5503.1																																																																																			.		0.768	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
ACTR3C	653857	broad.mit.edu	37	7	149981851	149981851	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:149981851C>T	ENST00000539352.1	-	6	806	c.555G>A	c.(553-555)ccG>ccA	p.P185P	ACTR3C_ENST00000252071.4_Silent_p.P185P	NM_001164458.1	NP_001157930.1	Q9C0K3	ARP3C_HUMAN	ARP3 actin-related protein 3 homolog C (yeast)	185						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)										CCTTATACAGCGGACGCCGCA	0.408																																					p.P185P													.	.	.	0			c.G555A						.						76.0	66.0	69.0					7																	149981851		692	1591	2283	SO:0001819	synonymous_variant	653857	exon6			ATACAGCGGACGC		CCDS47744.1	7q36.1	2009-09-23			ENSG00000106526	ENSG00000106526			37282	protein-coding gene	gene with protein product						11162478, 14651955	Standard	NM_001164458		Approved	ARP11	uc022aps.1	Q9C0K3	OTTHUMG00000158323	ENST00000539352.1:c.555G>A	7.37:g.149981851C>T		Somatic	58	0		WXS	Illumina GAIIx	Phase_I	31	3	NM_001164459	Q5CZI4	Silent	SNP	ENST00000539352.1	37	CCDS47744.1																																																																																			.		0.408	ACTR3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350676.2		
HTRA4	203100	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	38840515	38840515	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:38840515G>T	ENST00000302495.4	+	8	1316	c.1216G>T	c.(1216-1218)Gtg>Ttg	p.V406L		NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	406	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TTTCCCTGATGTGAGTTCTGG	0.388																																					p.V406L													.	HTRA4	25	0			c.G1216T						.						122.0	115.0	117.0					8																	38840515		2203	4300	6503	SO:0001583	missense	203100	exon8			CCTGATGTGAGTT	AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.1216G>T	8.37:g.38840515G>T	ENSP00000305919:p.Val406Leu	Somatic	44	1		WXS	Illumina GAIIx	Phase_I	46	15	NM_153692	Q542Z4|Q6PF13	Missense_Mutation	SNP	ENST00000302495.4	37	CCDS6110.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550847	0.45383	.	.	ENSG00000169495	ENST00000302495	T	0.20200	2.09	5.5	4.61	0.57282	PDZ/DHR/GLGF (2);	0.083185	0.46758	N	0.000269	T	0.28400	0.0702	L	0.61036	1.89	0.44562	D	0.997528	P	0.43701	0.815	P	0.50109	0.631	T	0.05886	-1.0858	10	0.52906	T	0.07	-8.4248	4.6047	0.12371	0.0814:0.1544:0.6042:0.1601	.	406	P83105	HTRA4_HUMAN	L	406	ENSP00000305919:V406L	ENSP00000305919:V406L	V	+	1	0	HTRA4	38959672	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	2.492000	0.45311	1.289000	0.44618	0.655000	0.94253	GTG	.		0.388	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377077.1	NM_153692	
RP11-401H2.1	0	broad.mit.edu	37	8	52209691	52209691	+	RNA	DEL	T	T	-			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr8:52209691delT	ENST00000521294.1	+	0	120																											aacccggggatttttgtggtc	0.483																																					.													.	.	.	0			.						.																																					0	.			CGGGGATTTTTGT																													8.37:g.52209691delT		Somatic	6	0		WXS	Illumina GAIIx	Phase_I	6	1	.		RNA	DEL	ENST00000521294.1	37																																																																																				.		0.483	RP11-401H2.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000377902.1		
CNTNAP3	79937	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	39176053	39176053	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:39176053G>A	ENST00000297668.6	-	7	1037	c.964C>T	c.(964-966)Cgg>Tgg	p.R322W	CNTNAP3_ENST00000377656.2_Missense_Mutation_p.R322W|CNTNAP3_ENST00000377653.2_5'UTR|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.R234W|CNTNAP3_ENST00000323947.7_Missense_Mutation_p.R322W|CNTNAP3_ENST00000377659.1_Missense_Mutation_p.R322W	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	322	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGAATGCCCGCGATCTTCCG	0.383																																					p.R322W													CNTNAP3,NS,carcinoma,+1,1	CNTNAP3	82	0			c.C964T						.						59.0	66.0	64.0					9																	39176053		2200	4297	6497	SO:0001583	missense	79937	exon7			ATGCCCGCGATCT	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.964C>T	9.37:g.39176053G>A	ENSP00000297668:p.Arg322Trp	Somatic	180	0		WXS	Illumina GAIIx	Phase_I	125	22	NM_033655	B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	37	CCDS6616.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380800	0.24944	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000323947;ENST00000377659;ENST00000377653	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	3.09	0.788	0.18601	Concanavalin A-like lectin/glucanase (2);Concanavalin A-like lectin/glucanase, subgroup (2);Laminin G domain (4);Laminin G, subdomain 2 (2);	.	.	.	.	T	0.75759	0.3893	N	0.12182	0.205	0.09310	N	1	D;B;B;D;D	0.63880	0.993;0.007;0.011;0.992;0.979	D;B;B;P;B	0.68621	0.959;0.013;0.001;0.792;0.401	T	0.68413	-0.5415	9	0.59425	D	0.04	.	12.2121	0.54386	0.0:0.7022:0.2978:0.0	.	322;322;322;322;322	E2QRH2;Q96NU0;Q9BZ76-2;A6NC89;Q9BZ76	.;CNT3B_HUMAN;.;.;CNTP3_HUMAN	W	322;322;234;322;322;234	ENSP00000297668:R322W;ENSP00000366884:R322W;ENSP00000350863:R234W;ENSP00000320728:R322W;ENSP00000366887:R322W	ENSP00000297668:R322W	R	-	1	2	CNTNAP3	39166053	0.284000	0.24287	0.000000	0.03702	0.043000	0.13939	0.653000	0.24902	0.152000	0.19188	0.460000	0.39030	CGG	.		0.383	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
LINC01410	103352539	broad.mit.edu	37	9	66457322	66457322	+	lincRNA	SNP	G	G	C	rs11262292	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr9:66457322G>C	ENST00000424345.1	+	0	34				RNA5SP283_ENST00000365604.1_RNA																							tggagcgacagcgacagagcc	0.632																																					.													.	.	.	0			.						.																																					0	.			GCGACAGCGACAG																													9.37:g.66457322G>C		Somatic	62	0		WXS	Illumina GAIIx	Phase_I	32	4	.		RNA	SNP	ENST00000424345.1	37																																																																																				.		0.632	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000128851.1		
MT-ND2	4536	broad.mit.edu	37	M	2646	2646	+	5'Flank	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrM:2646G>A	ENST00000361453.3	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						tggctccacgagggttcagct	0.488																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CACGAGGGTTCAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2646G>A	Exception_encountered	Somatic	680	0		WXS	Illumina GAIIx	Phase_I	1695	20	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.488	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
AGTR2	186	broad.mit.edu;bcgsc.ca	37	X	115303767	115303767	+	Silent	SNP	T	T	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:115303767T>C	ENST00000371906.4	+	3	424	c.234T>C	c.(232-234)gtT>gtC	p.V78V		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	78					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	CTAAAAAGGTTTCTAGCATAT	0.363																																					p.V78V													.	AGTR2	62	0			c.T234C						.						209.0	199.0	202.0					X																	115303767		2203	4300	6503	SO:0001819	synonymous_variant	186	exon3			AAAGGTTTCTAGC	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.234T>C	X.37:g.115303767T>C		Somatic	41	0		WXS	Illumina GAIIx	Phase_I	22	3	NM_000686	B2R9V1|Q13016|Q6FGY7	Silent	SNP	ENST00000371906.4	37	CCDS14569.1																																																																																			.		0.363	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
WNT9A	7483	ucsc.edu	37	1	228109277	228109277	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:228109277C>T	ENST00000272164.5	-	4	1050	c.1040G>A	c.(1039-1041)tGc>tAc	p.C347Y		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	347					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				CTCCACATAGCAGCACCAACG	0.637																																					p.C347Y													.	WNT9A	39	0			c.G1040A						.						69.0	58.0	62.0					1																	228109277		2203	4300	6503	SO:0001583	missense	7483	exon4			ACATAGCAGCACC	AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.1040G>A	1.37:g.228109277C>T	ENSP00000272164:p.Cys347Tyr	Somatic	24	0		WXS	Illumina HiSeq		38	4	NM_003395	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	ENST00000272164.5	37	CCDS31045.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.853144	0.71719	.	.	ENSG00000143816	ENST00000272164	D	0.82984	-1.67	4.64	3.73	0.42828	.	0.000000	0.85682	D	0.000000	D	0.93897	0.8047	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94885	0.8042	10	0.87932	D	0	.	11.8878	0.52613	0.0:0.9152:0.0:0.0848	.	347	O14904	WNT9A_HUMAN	Y	347	ENSP00000272164:C347Y	ENSP00000272164:C347Y	C	-	2	0	WNT9A	226175900	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.564000	0.82326	1.184000	0.42957	0.484000	0.47621	TGC	.		0.637	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091646.1	NM_003395	
HSPD1	3329	ucsc.edu	37	2	198363501	198363501	+	Silent	SNP	C	C	T	rs201599915	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:198363501C>T	ENST00000388968.3	-	2	339	c.72G>A	c.(70-72)cgG>cgA	p.R24R	HSPE1_ENST00000233893.5_5'Flank|HSPE1_ENST00000409468.1_5'Flank|HSPD1_ENST00000544407.1_Silent_p.R24R|HSPD1_ENST00000345042.2_Silent_p.R24R|HSPE1-MOB4_ENST00000604458.1_5'Flank|HSPE1_ENST00000409729.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	24					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)	p.R24R(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			TGGCATAAGCCCGAGTGAGAT	0.502																																					p.R24R													HSPD1_ENST00000426480,caecum,carcinoma,0,7	HSPD1	68	1	Substitution - coding silent(1)	breast(1)	c.G72A						.						59.0	60.0	59.0					2																	198363501		2203	4300	6503	SO:0001819	synonymous_variant	3329	exon2			ATAAGCCCGAGTG	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.72G>A	2.37:g.198363501C>T		Somatic	96	12		WXS	Illumina HiSeq		53	16	NM_002156	B2R5M6|B7Z712|Q38L19|Q9UCR6	Silent	SNP	ENST00000388968.3	37	CCDS33357.1																																																																																			.		0.502	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335324.2	NM_002156	
SEC14L5	9717	ucsc.edu	37	16	5046986	5046986	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr16:5046986G>T	ENST00000251170.7	+	8	1091	c.911G>T	c.(910-912)tGg>tTg	p.W304L		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	304						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						CTTCAGACCTGGCAACCCCCT	0.602																																					p.W304L													.	SEC14L5	79	0			c.G911T						.						33.0	33.0	33.0					16																	5046986		1936	4105	6041	SO:0001583	missense	9717	exon8			AGACCTGGCAACC	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.911G>T	16.37:g.5046986G>T	ENSP00000251170:p.Trp304Leu	Somatic	16	0		WXS	Illumina HiSeq		27	4	NM_014692		Missense_Mutation	SNP	ENST00000251170.7	37	CCDS45403.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719207	0.89205	.	.	ENSG00000103184	ENST00000251170	T	0.60171	0.21	4.66	4.66	0.58398	Cellular retinaldehyde-binding/triple function, C-terminal (1);Phosphatidylinositol transfer protein-like, N-terminal (1);	0.198882	0.36409	N	0.002608	T	0.62109	0.2401	L	0.58101	1.795	0.80722	D	1	P	0.47484	0.896	P	0.46362	0.514	T	0.68957	-0.5272	10	0.87932	D	0	-7.9771	18.0897	0.89471	0.0:0.0:1.0:0.0	.	304	O43304	S14L5_HUMAN	L	304	ENSP00000251170:W304L	ENSP00000251170:W304L	W	+	2	0	SEC14L5	4986987	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.099000	0.94207	2.573000	0.86826	0.491000	0.48974	TGG	.		0.602	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434379.1		
DNAH2	146754	ucsc.edu;bcgsc.ca	37	17	7661812	7661812	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr17:7661812G>T	ENST00000572933.1	+	14	3511		c.e14-1		DNAH2_ENST00000389173.2_Splice_Site			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTTATGCACAGGATTATTGCC	0.498																																					.													.	DNAH2	498	0			c.2052-1G>T						.						150.0	150.0	150.0					17																	7661812		2203	4300	6503	SO:0001630	splice_region_variant	146754	exon13			TGCACAGGATTAT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2052-1G>T	17.37:g.7661812G>T		Somatic	22	0		WXS	Illumina HiSeq		19	4	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Splice_Site	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056946	0.76074	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0726	0.93145	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH2	7602537	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	8.559000	0.90708	2.809000	0.96659	0.555000	0.69702	.	.		0.498	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	Intron
LEPROT	54741	bcgsc.ca	37	1	65895660	65895660	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:65895660G>A	ENST00000371065.4	+	3	346	c.208G>A	c.(208-210)Gca>Aca	p.A70T	LEPR_ENST00000371059.3_Intron|LEPROT_ENST00000484243.1_3'UTR|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000349533.6_Intron|LEPR_ENST00000344610.8_Intron|LEPR_ENST00000371060.3_Intron	NM_001198681.1|NM_017526.4	NP_001185610.1|NP_059996.1	O15243	OBRG_HUMAN	leptin receptor overlapping transcript	70					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			kidney(1)|large_intestine(1)|lung(5)	7				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TCGGGAACTGGCATATTTCTT	0.443																																					p.A79T													.	LEPROT	16	0			c.G235A						.						362.0	343.0	349.0					1																	65895660		2203	4300	6503	SO:0001583	missense	54741	exon4			GAACTGGCATATT	Y12670	CCDS630.1, CCDS72801.1	1p31.2	2008-02-05			ENSG00000213625	ENSG00000213625			29477	protein-coding gene	gene with protein product	"""leptin receptor gene related protein"""	613461				9207021	Standard	NM_001198681		Approved	OBRGRP, OB-RGRP, VPS55, FLJ90360	uc001dcf.3	O15243	OTTHUMG00000009065	ENST00000371065.4:c.208G>A	1.37:g.65895660G>A	ENSP00000360104:p.Ala70Thr	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	84	4	NM_001198681	Q6FHL5	Missense_Mutation	SNP	ENST00000371065.4	37	CCDS630.1	.	.	.	.	.	.	.	.	.	.	G	33	5.230795	0.95207	.	.	ENSG00000213625	ENST00000371065	.	.	.	5.75	4.83	0.62350	.	0.000000	0.85682	U	0.000000	T	0.58793	0.2147	M	0.75264	2.295	0.80722	D	1	P	0.38300	0.626	B	0.42625	0.393	T	0.67515	-0.5651	9	0.87932	D	0	-1.0354	16.2919	0.82756	0.0:0.0:0.8667:0.1333	.	70	O15243	OBRG_HUMAN	T	70	.	ENSP00000360104:A70T	A	+	1	0	LEPROT	65668248	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	7.639000	0.83342	1.412000	0.46977	0.557000	0.71058	GCA	.		0.443	LEPROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025132.4	NM_017526	
SPTBN1	6711	bcgsc.ca	37	2	54858076	54858076	+	Silent	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:54858076C>T	ENST00000356805.4	+	16	3173	c.2892C>T	c.(2890-2892)tgC>tgT	p.C964C	SPTBN1_ENST00000333896.5_Silent_p.C951C	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	964					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ACCTCGAGTGCAATGAAACCA	0.577																																					p.C964C													.	SPTBN1	378	0			c.C2892T						.						58.0	52.0	54.0					2																	54858076		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon16			CGAGTGCAATGAA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2892C>T	2.37:g.54858076C>T		Somatic	18	0		WXS	Illumina HiSeq	Phase_1	10	3	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1																																																																																			.		0.577	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
Unknown	0	bcgsc.ca	37	2	65432383	65432383	+	IGR	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:65432383C>T								SNORA74 (46389 upstream) : ACTR2 (22503 downstream)																							CAAAGTCTTGCAGTGGCGTGG	0.438																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GTCTTGCAGTGGC																													2.37:g.65432383C>T		Somatic	100	0		WXS	Illumina HiSeq	Phase_1	93	5	.		RNA	SNP		37																																																																																				.	0	0.438								
ENPP7P2	100421813	bcgsc.ca	37	3	75496343	75496343	+	lincRNA	SNP	A	A	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr3:75496343A>T	ENST00000608169.1	+	0	205																											GTCCCACGTTATCTGGCTCTC	0.493																																					.													.	.	.	0			.						.																																					0	.			CACGTTATCTGGC																													3.37:g.75496343A>T		Somatic	34	0		WXS	Illumina HiSeq	Phase_1	36	5	.		RNA	SNP	ENST00000608169.1	37																																																																																				.		0.493	RP11-803B1.8-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000471513.1		
REEP2	51308	bcgsc.ca	37	5	137776731	137776731	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr5:137776731C>T	ENST00000254901.5	+	2	181	c.59C>T	c.(58-60)gCc>gTc	p.A20V	REEP2_ENST00000506158.1_5'UTR|REEP2_ENST00000378339.2_Missense_Mutation_p.A20V|REEP2_ENST00000464751.2_3'UTR	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	20					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CTGTACCCAGCCTATTCTTCC	0.577																																					p.A20V													REEP2,NS,carcinoma,-1,1	REEP2	21	0			c.C59T						.						101.0	87.0	91.0					5																	137776731		2203	4300	6503	SO:0001583	missense	51308	exon2			ACCCAGCCTATTC	AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.59C>T	5.37:g.137776731C>T	ENSP00000254901:p.Ala20Val	Somatic	17	0		WXS	Illumina HiSeq	Phase_1	10	3	NM_016606	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	37	CCDS4205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.855461|5.855461	0.97030|0.97030	.|.	.|.	ENSG00000132563|ENSG00000132563	ENST00000378339;ENST00000254901|ENST00000512126	D;D|.	0.93488|.	-3.23;-3.23|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77164|0.77164	0.4090|0.4090	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.77557|.	0.986;0.99|.	T|T	0.76777|0.76777	-0.2834|-0.2834	10|5	0.62326|.	D|.	0.03|.	-8.1994|-8.1994	19.0909|19.0909	0.93227|0.93227	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	20;20|.	A8K3D2;Q9BRK0|.	.;REEP2_HUMAN|.	V|S	20|58	ENSP00000367590:A20V;ENSP00000254901:A20V|.	ENSP00000254901:A20V|.	A|P	+|+	2|1	0|0	REEP2|REEP2	137804630|137804630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.258000|7.258000	0.78371|0.78371	2.601000|2.601000	0.87937|0.87937	0.561000|0.561000	0.74099|0.74099	GCC|CCT	.		0.577	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606	
YAP1P1	442266	bcgsc.ca	37	6	147729123	147729123	+	IGR	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr6:147729123C>T								RP11-361F15.2 (17522 upstream) : SAMD5 (100939 downstream)																							TTTCCTTAACCGTGGCACCTA	0.512																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	442266	.			CTTAACCGTGGCA																													6.37:g.147729123C>T		Somatic	18	0		WXS	Illumina HiSeq	Phase_1	13	4	.		RNA	SNP		37																																																																																				.	0	0.512								
FEZF1	389549	bcgsc.ca	37	7	121943286	121943286	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr7:121943286C>T	ENST00000442488.2	-	2	948	c.881G>A	c.(880-882)gGa>gAa	p.G294E	FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000427185.2_Missense_Mutation_p.G244E|FEZF1-AS1_ENST00000437317.1_RNA|FEZF1_ENST00000331178.4_Missense_Mutation_p.G290E	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	294					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						GAAACCTTTTCCGCACACTTT	0.468																																					p.G294E													.	FEZF1	60	0			c.G881A						.						143.0	135.0	138.0					7																	121943286		2203	4300	6503	SO:0001583	missense	389549	exon2			CCTTTTCCGCACA	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.881G>A	7.37:g.121943286C>T	ENSP00000411145:p.Gly294Glu	Somatic	73	0		WXS	Illumina HiSeq	Phase_1	62	4	NM_001024613	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	ENST00000442488.2	37	CCDS34741.2	.	.	.	.	.	.	.	.	.	.	C	32	5.139798	0.94560	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	T;T;T	0.20463	3.22;2.07;3.22	5.23	5.23	0.72850	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.47129	-0.9141	10	0.87932	D	0	-7.8378	19.2154	0.93776	0.0:1.0:0.0:0.0	.	294;244	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	E	294;290;244	ENSP00000411145:G294E;ENSP00000332777:G290E;ENSP00000392727:G244E	ENSP00000332777:G290E	G	-	2	0	FEZF1	121730522	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.009000	0.70745	2.602000	0.87976	0.650000	0.86243	GGA	.		0.468	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613	
MUC5AC	4586	bcgsc.ca	37	11	1212966	1212966	+	3'UTR	SNP	C	C	A	rs76103892		TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:1212966C>A	ENST00000358378.6	+	0	207							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		caacctctgcctctacagcca	0.572																																					.													.	.	.	0			.						.						57.0	52.0	53.0					11																	1212966		872	1988	2860	SO:0001624	3_prime_UTR_variant	4586	.			CTCTGCCTCTACA	AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*204C>A	11.37:g.1212966C>A		Somatic	118	1		WXS	Illumina HiSeq	Phase_1	80	9	.	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	SNP	ENST00000358378.6	37																																																																																				C|0.500;T|0.500		0.572	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	protein_coding	OTTHUMT00000396096.2	XM_001130382	
ANKK1	255239	bcgsc.ca	37	11	113270029	113270029	+	Silent	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr11:113270029G>T	ENST00000303941.3	+	8	1432	c.1338G>T	c.(1336-1338)ctG>ctT	p.L446L		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	446							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CTGCGCGCCTGCTCCTGGACC	0.602																																					p.L446L													.	ANKK1	83	0			c.G1338T						.						20.0	24.0	22.0					11																	113270029		2125	4239	6364	SO:0001819	synonymous_variant	255239	exon8			GCGCCTGCTCCTG	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1338G>T	11.37:g.113270029G>T		Somatic	18	0		WXS	Illumina HiSeq	Phase_1	13	3	NM_178510		Silent	SNP	ENST00000303941.3	37	CCDS44734.1																																																																																			.		0.602	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510	
PIEZO1	9780	bcgsc.ca	37	16	88793124	88793124	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr16:88793124G>A	ENST00000301015.9	-	25	3944	c.3698C>T	c.(3697-3699)tCg>tTg	p.S1233L		NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1233					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GAGGCTCACCGACAGCATGTT	0.692																																					p.S1233L													.	PIEZO1	79	0			c.C3698T						.						29.0	27.0	28.0					16																	88793124		692	1590	2282	SO:0001630	splice_region_variant	9780	exon25			CTCACCGACAGCA	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.3699+1C>T	16.37:g.88793124G>A		Somatic	22	0		WXS	Illumina HiSeq	Phase_1	12	3	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632942	0.87660	.	.	ENSG00000103335	ENST00000301015	T	0.17370	2.28	4.51	3.55	0.40652	.	0.214085	0.41097	D	0.000951	T	0.35970	0.0950	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	P	0.60949	0.881	T	0.19192	-1.0313	10	0.62326	D	0.03	-14.4251	11.6582	0.51330	0.0892:0.0:0.9108:0.0	.	1233	Q92508	PIEZ1_HUMAN	L	1233	ENSP00000301015:S1233L	ENSP00000301015:S1233L	S	-	2	0	FAM38A	87320625	1.000000	0.71417	0.999000	0.59377	0.821000	0.46438	8.783000	0.91813	1.128000	0.42052	0.491000	0.48974	TCG	.		0.692	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	Missense_Mutation
BCAM	4059	bcgsc.ca	37	19	45315768	45315768	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr19:45315768A>C	ENST00000270233.6	+	4	489	c.467A>C	c.(466-468)aAa>aCa	p.K156T	BCAM_ENST00000589651.1_Missense_Mutation_p.K156T	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	156	Ig-like V-type 2.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TCCCCCAACAAAGGGACACTG	0.652																																					p.K156T													.	BCAM	53	0			c.A467C						.						69.0	57.0	61.0					19																	45315768		2203	4300	6503	SO:0001583	missense	4059	exon4			CCAACAAAGGGAC	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.467A>C	19.37:g.45315768A>C	ENSP00000270233:p.Lys156Thr	Somatic	50	0		WXS	Illumina HiSeq	Phase_1	18	3	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	1.841	-0.467318	0.04476	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.76316	-1.01;-1.01	3.79	-4.71	0.03279	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60766	0.2294	L	0.38175	1.15	0.22933	N	0.998542	B	0.10296	0.003	B	0.11329	0.006	T	0.42749	-0.9433	9	0.17369	T	0.5	-1.2077	6.6015	0.22703	0.372:0.1515:0.4765:0.0	.	156	P50895	BCAM_HUMAN	T	156	ENSP00000270233:K156T;ENSP00000375817:K156T	ENSP00000270233:K156T	K	+	2	0	BCAM	50007608	0.000000	0.05858	0.532000	0.27989	0.449000	0.32228	-1.386000	0.02537	-1.444000	0.01950	-0.736000	0.03550	AAA	.		0.652	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
SRRM1P3	100130190	bcgsc.ca	37	X	136067097	136067097	+	RNA	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chrX:136067097G>T	ENST00000424306.1	+	0	2052																											TTCCGGAGAAGGTTCTTTAGG	0.438																																					.													.	.	.	0			.						.																																					100130190	.			GGAGAAGGTTCTT																													X.37:g.136067097G>T		Somatic	52	0		WXS	Illumina HiSeq	Phase_1	44	11	.		RNA	SNP	ENST00000424306.1	37																																																																																				.		0.438	RP11-308D16.4-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000058514.2		
AQP10	89872	hgsc.bcm.edu	37	1	154296076	154296076	+	Silent	SNP	T	T	G	rs1194610	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:154296076T>G	ENST00000324978.3	+	5	541	c.501T>G	c.(499-501)acT>acG	p.T167T	AQP10_ENST00000484864.1_Silent_p.T167T|ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000355197.4_3'UTR	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	167					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.T167T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTCTGGGCACTGGGATGCTGA	0.592																																					p.T167T		.											AQP10,NS,carcinoma,0,1	AQP10	0	1	Substitution - coding silent(1)	stomach(1)	c.T501G						.						126.0	135.0	132.0					1																	154296076		2203	4300	6503	SO:0001819	synonymous_variant	89872	exon5			GGGCACTGGGATG	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.501T>G	1.37:g.154296076T>G		Somatic	51	0		WXS	Illumina HiSeq	.	49	2	NM_080429	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	ENST00000324978.3	37	CCDS1065.1																																																																																			.		0.592	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
LCE4A	199834	hgsc.bcm.edu	37	1	152681679	152681680	+	Missense_Mutation	DNP	CC	CC	GT	rs6143428|rs11269814|rs200890315	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:152681679_152681680CC>GT	ENST00000368777.1	+	2	384_385	c.128_129CC>GT	c.(127-129)tCC>tGT	p.S43C	LCE4A_ENST00000335535.3_Missense_Mutation_p.S43C			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	43	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			TGCTGTGGCTCCAGCTCTGGGG	0.599																																					p.S43C		.											LCE4A,rectum,carcinoma,+1,15	LCE4A	1	0			c.C129T						.																																			SO:0001583	missense	199834	exon1			TGGCTCCAGCTCT	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	Exception_encountered	1.37:g.152681679_152681680delinsGT	ENSP00000357766:p.Ser43Cys	Somatic	32	2		WXS	Illumina HiSeq	.	36	0	NM_178356	Q14D97	Missense_Mutation	DNP	ENST00000368777.1	37	CCDS1022.1																																																																																			.		0.599	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040048.1	NM_178356	
OR6F1	343169	hgsc.bcm.edu	37	1	247875415	247875415	+	Missense_Mutation	SNP	A	A	C	rs2282316	byFrequency	TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr1:247875415A>C	ENST00000302084.2	-	1	690	c.643T>G	c.(643-645)Ttt>Gtt	p.F215V	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	215			F -> L (in dbSNP:rs2282316).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F215L(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TAGGAGACAAAGGTGATGAGG	0.552																																					p.F215V		.											OR6F1,NS,carcinoma,0,1	OR6F1	0	1	Substitution - Missense(1)	stomach(1)	c.T643G						.						132.0	116.0	122.0					1																	247875415		2203	4300	6503	SO:0001583	missense	343169	exon1			AGACAAAGGTGAT	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.643T>G	1.37:g.247875415A>C	ENSP00000305640:p.Phe215Val	Somatic	29	0		WXS	Illumina HiSeq	.	45	2	NM_001005286	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.781750	0.00079	.	.	ENSG00000169214	ENST00000302084	T	0.00015	9.15	3.72	-1.83	0.07833	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34268	N	0.004102	T	0.00039	0.0001	N	0.01505	-0.83	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.12218	-1.0556	9	0.18276	T	0.48	-10.0518	2.2613	0.04068	0.3244:0.121:0.4315:0.1232	.	215	Q8NGZ6	OR6F1_HUMAN	V	215	ENSP00000305640:F215V	ENSP00000305640:F215V	F	-	1	0	OR6F1	245942038	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.023000	0.03607	-0.547000	0.06207	-1.054000	0.02325	TTT	.		0.552	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
METTL8	79828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	172188372	172188372	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2R-01A-11D-A417-09	TCGA-W5-AA2R-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	800521c7-a4a8-4184-aed7-573d0b99c23a	0562fd1a-2435-4350-8e46-6d7036ae748c	g.chr2:172188372G>T	ENST00000375258.4	-	6	877	c.662C>A	c.(661-663)tCt>tAt	p.S221Y		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	221						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						GGACTCCGGAGAGTTCCTATG	0.438																																					.		.											.	.	.	0			.						.						43.0	42.0	42.0					2																	172188372		2202	4299	6501	SO:0001583	missense	79828	p.S221Y			TCCGGAGAGTTCC	AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.662C>A	2.37:g.172188372G>T	ENSP00000364407:p.Ser221Tyr	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	27	10	.	Q53TM9|Q53TQ0	Missense_Mutation	SNP	ENST00000375258.4	37		.	.	.	.	.	.	.	.	.	.	G	14.86	2.661588	0.47572	.	.	ENSG00000123600	ENST00000375258	T	0.04156	3.69	5.71	-4.22	0.03800	Methyltransferase type 11 (1);	1.272120	0.04928	N	0.456171	T	0.03564	0.0102	N	0.12422	0.21	0.09310	N	1	P;P;P	0.48764	0.915;0.501;0.641	P;B;P	0.48227	0.571;0.26;0.447	T	0.32877	-0.9890	10	0.02654	T	1	-0.0064	9.8108	0.40822	0.6366:0.0:0.2606:0.1028	.	176;221;221	B4DLT0;B3KW44;Q9H825	.;.;METL8_HUMAN	Y	221	ENSP00000364407:S221Y	ENSP00000364407:S221Y	S	-	2	0	METTL8	171896618	0.000000	0.05858	0.001000	0.08648	0.778000	0.44026	-0.293000	0.08320	-1.388000	0.02092	-0.471000	0.05019	TCT	.		0.438	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255345.3	NM_024770	
